siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 382   383   385   460   480   550   570   580   616   768   879   1263   1265   1279   1304   1315   1550   1678   2371   2372  
2382   2386   2485   2902   2911   3110   3144   3861   4140   4141   4143   4152   4160   4212   4228   4235   4236   4527   4537   4543  
4611   4613   4740   4804   4946   4952   4969   4991   4996   4997   5057   5178   5190   5199   5222   5225   5233   5236   5368   5373  
5428   5486   5502   5557   5567   5578   5582   5657   5694   5702   5708   5737   6103   6116   6120   6124   6149   6275   6287   6291  
6307   6315   6342  
Biltr, Rnaxs 170   196   204   325   326   327   329   330   452   478   522   524   555   559   581   595   596   609   610   622  
624   655   656   657   658   659   660   812   878   880   1010   1042   1048   1049   1050   1051   1052   1199   1201   1228  
1257   1258   1259   1278   1318   1333   1432   1433   1434   1508   1511   1512   1517   1553   1572   1573   1574   1575   1578   1582  
1612   1613   1619   1620   1626   1629   1636   1638   1639   1663   1665   1666   1675   1712   1720   1887   1892   1893   1921   2116  
2117   2210   2212   2377   2380   2381   2422   2453   2454   2455   2456   2457   2458   2459   2460   2479   2480   2481   2492   2513  
2514   2534   2536   2593   2665   2666   2716   2719   2721   2799   2800   2801   2804   2839   2840   2841   2843   2844   2845   2899  
2900   2901   2906   2963   2969   2997   3005   3052   3053   3054   3055   3056   3057   3058   3061   3063   3066   3067   3118   3149  
3150   3181   3182   3183   3204   3205   3206   3231   3255   3256   3399   3496   3514   3515   3516   3517   3518   3519   3520   3572  
3575   3611   3612   3613   3663   3664   3732   3733   3734   3758   3827   3828   3829   3833   3862   3863   3897   3898   3899   3910  
3911   3912   3955   3959   3979   3988   4007   4013   4045   4046   4068   4071   4072   4104   4161   4170   4184   4191   4383   4384  
4392   4393   4395   4466   4499   4532   4535   4539   4540   4596   4621   4625   4629   4630   4631   4640   4694   4695   4696   4697  
4698   4699   4703   4709   4720   4747   4774   4776   4809   4874   4875   4880   4899   4900   4901   4902   4906   4924   4925   4926  
4927   4932   4933   4934   4935   4964   4975   4984   4985   4986   5036   5037   5038   5039   5043   5045   5046   5051   5147   5166  
5167   5169   5175   5177   5188   5194   5195   5196   5197   5215   5259   5260   5286   5311   5312   5313   5314   5316   5317   5355  
5362   5363   5366   5405   5406   5408   5430   5436   5441   5452   5453   5455   5466   5467   5470   5471   5473   5476   5480   5491  
5494   5526   5538   5541   5542   5545   5546   5597   5598   5603   5604   5605   5606   5608   5615   5654   5655   5659   5660   5664  
5668   5683   5690   5696   5697   5709   5717   5718   5721   5722   5730   5732   5740   5744   5745   5746   5766   5945   5946   5947  
5972   6029   6031   6095   6096   6097   6100   6101   6105   6106   6140   6142   6147   6148   6166   6167   6168   6169   6170   6171  
6172   6173   6202   6203   6279   6280   6281   6282   6284   6292   6293   6314   6317   6320   6321   6343   6349   6350   6351  
Biltr, Rnaxs, Sidirect 444   445   446   582   583   590   625   1306   1307   1314   1319   1440   1513   1640   1711   1713   2378   3834   4133   4162  
4163   4171   4185   4528   4533   4536   4626   4775   4876   4936   4937   4976   4977   4983   5170   5171   5369   5427   5431   5495  
5496   5547   5548   5552   5607   5656   5661   5665   5669   5691   5698   5731   5733   6030   6062   6139   6141   6143   6283   6285  
6294   6295   6318   6322   6344   6345  
Biltr, Ernai 877   1133   3860   4817   5342  
Biltr, Ernai, Rnaxs, Sidirect 4541   5168  
Biltr, Ernai, Rnaxs 1664   5472  
Biltr, Ernai, Sidirect 5482  


Target Position: 5717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5717GCAAAGGAAAUGGACUCAU76.75871804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5825735GCAAAGGAAATGGACTCATATGAGTCCATTTCCTTTGC0.171900.098600.698301.000001.000001.00000


Target Position: 6116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6116CUAAGAAUCUGAGAUUUUA95.170997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6114-6136TTCTAAGAATCTGAGATTTTATAUAAAAUCUCAGAUUCUUAGAACUAAGAAUCUGAGAUUUUAUAU5.36.9


Target Position: 3520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3520CAGUGCCUGAAUACAUAAA90.7713253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6483538CAGTGCCTGAATACATAAATTTATGTATTCAGGCACTG0.444500.048900.784500.750001.000001.00000


Target Position: 5178, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5178GGUAGUAAAUAUGAAACUA100.87612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5176-5198CAGGTAGTAAATATGAAACTAGGUAGUUUCAUAUUUACUACCUGGGUAGUAAAUAUGAAACUAGGU19.214.303


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665UGCUAUGCAAAUACAAUAA83.6372900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391683TGCTATGCAAATACAATAATTATTGTATTTGCATAGCA0.230300.036700.819000.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CAAUAAACUGGAAAAAACU85.674672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1676-1698TACAATAAACTGGAAAAAACTGTAGUUUUUUCCAGUUUAUUGUACAAUAAACUGGAAAAAACUGUU-1.8-0.321


Target Position: 4162, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4162GGUAUAUUUGAAAAAAAAA96.097868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3594180GGTATATTTGAAAAAAAAATTTTTTTTTCAAATATACC0.827300.063400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4160-4182GAGGTATATTTGAAAAAAAAAAAUUUUUUUUUCAAAUAUACCUCGGUAUAUUUGAAAAAAAAAAAU-11.31.111


Target Position: 3860, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860GCCACAAAGCAGUGAAUUU85.4809694

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2386019GCCACAAAGCAGTGAATTT1/1/0/097.75EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANA3:102264623..102264641(+)|7:55273280..55273298(+)|8:116729129,116729327..116729137,116729336(+)00EGFR(0.002)


Target Position: 3833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3833UGAAAAUGCAGAAUACCUA86.5932595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953851TGAAAATGCAGAATACCTATAGGTATTCTGCATTTTCA0.362700.093800.551700.750001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640GAUAAUUUCAGGAAACAAA95.63478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731658GATAATTTCAGGAAACAAATTTGTTTCCTGAAATTATC0.477200.084700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1638-1660GTGATAATTTCAGGAAACAAAAAUUUGUUUCCUGAAAUUAUCACGAUAAUUUCAGGAAACAAAAAU14.9-10.322


Target Position: 4395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4395CUGCAAAACACUAAAGAUC69.38693037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9834413CTGCAAAACACTAAAGATCGATCTTTAGTGTTTTGCAG0.485100.367600.603400.500001.000001.00000


Target Position: 3067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3067CCAUAUGUACCAUCGAUGU80.34321318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8613085CCATATGTACCATCGATGTACATCGATGGTACATATGG0.097900.041200.637900.750001.000001.00000


Target Position: 6031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6031ACAAGUUCCCUAAAAGUUG65.35993751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9206049ACAAGTTCCCTAAAAGTTGCAACTTTTAGGGAACTTGT0.293600.010800.560300.500001.000001.00000


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149GAUCAUCGAAUUCUCCAAA91.9317209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883167GATCATCGAATTCTCCAAATTTGGAGAATTCGATGATC0.117300.007600.681000.750001.000001.00000


Target Position: 6287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6287CAUUGUAGCAUUAAAUUCU85.6323677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6285-6307CACATTGTAGCATTAAATTCTAGAGAAUUUAAUGCUACAAUGUGCAUUGUAGCAUUAAAUUCUAGU2.111.6


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GCCAAGGGAGUUUGUGGAG63.49734048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051910GCCAAGGGAGTTTGTGGAGCTCCACAAACTCCCTTGGC0.223300.055200.689700.750001.000001.00000


Target Position: 2380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380AGGAAACUGAAUUCAAAAA85.3375708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362398AGGAAACTGAATTCAAAAATTTTTGAATTCAGTTTCCT0.154700.054400.844800.750001.000001.00000


Target Position: 4985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4985UCACUUCAAAAGCUUUUUA75.87661952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8615003TCACTTCAAAAGCTTTTTATAAAAAGCTTTTGAAGTGA0.100400.011200.689700.750001.000001.00000


Target Position: 1629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629GAUGGAGAUGUGAUAAUUU94.7072113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9581647GATGGAGATGTGATAATTTAAATTATCACATCTCCATC0.079600.013100.681000.750001.000001.00000


Target Position: 6321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6321UGAAACAGUAACUUAAUAA87.6073483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4156339TGAAACAGTAACTTAATAATTATTAAGTTACTGTTTCA0.251800.138800.689700.750001.000001.00000


Target Position: 4991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4991CAAAAGCUUUUUACUCAAA91.1882235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4989-5011TTCAAAAGCTTTTTACTCAAAGAUUUGAGUAAAAAGCUUUUGAACAAAAGCUUUUUACUCAAAGAU20.317.022


Target Position: 5732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5732UCAUAGAUGCUAACCUUAA85.6065680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7335750TCATAGATGCTAACCTTAATTAAGGTTAGCATCTATGA0.255200.098500.689700.750001.000001.00000


Target Position: 5547, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5547GCAUUGUUAAGAAAGUAUU83.4125932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6965565GCATTGTTAAGAAAGTATTAATACTTTCTTAACAATGC0.144600.063600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5545-5567CAGCATTGTTAAGAAAGTATTTGAAUACUUUCUUAACAAUGCUGGCAUUGUUAAGAAAGUAUUUGU4.612.102


Target Position: 2386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2386CUGAAUUCAAAAAGAUCAA83.9643857

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2384-2406AACTGAATTCAAAAAGATCAAAGUUGAUCUUUUUGAAUUCAGUUCUGAAUUCAAAAAGAUCAAAGU20.416.322


Target Position: 5408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5408ACCCCAUCCAAUUUAUCAA82.44281023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2955426ACCCCATCCAATTTATCAATTGATAAATTGGATGGGGT0.584200.102300.706900.750001.000001.00000


Target Position: 2839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2839UGCUGGGUGCGGAAGAGAA81.56591155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952857TGCTGGGTGCGGAAGAGAATTCTCTTCCGCACCCAGCA0.650200.010300.681000.750000.962000.75000


Target Position: 6169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6169CUCAGGACAUGCAGAAAUA93.7369142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7266187CTCAGGACATGCAGAAATATATTTCTGCATGTCCTGAG0.154600.041600.767200.750001.000001.00000


Target Position: 4952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4952GUUACUUAUGGAAGAUAGU78.35481586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4950-4972GTGTTACTTATGGAAGATAGTTTACUAUCUUCCAUAAGUAACACGUUACUUAUGGAAGAUAGUUUU11.66.622


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UCGAUGAAGCCUACGUGAU69.56913010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472554TCGATGAAGCCTACGTGATATCACGTAGGCTTCATCGA0.400600.035200.612100.750001.000001.00000


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664CCGAGUAUCUCAACACUGU83.0225968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6823682CCGAGTATCTCAACACTGTACAGTGTTGAGATACTCGG0.147600.031700.706900.750000.923900.62500


Target Position: 5656, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5656GGUAUGAAAGAUACAAAGA92.0448202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7025674GGTATGAAAGATACAAAGATCTTTGTATCTTTCATACC0.278700.107800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5654-5676TGGGTATGAAAGATACAAAGATAUCUUUGUAUCUUUCAUACCCAGGUAUGAAAGAUACAAAGAUAU11.816.1


Target Position: 1513, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CCUUUGAGAACCUAGAAAU84.6684784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031531CCTTTGAGAACCTAGAAATATTTCTAGGTTCTCAAAGG0.246500.104100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1511-1533TGCCTTTGAGAACCTAGAAATCAAUUUCUAGGUUCUCAAAGGCACCUUUGAGAACCUAGAAAUCAU11.716.623


Target Position: 5659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5659AUGAAAGAUACAAAGAUAA85.2778711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8035677ATGAAAGATACAAAGATAATTATCTTTGTATCTTTCAT0.636900.246500.620700.500001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052CCCACUCAUGCUCUACAAC69.01013103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011070CCCACTCATGCTCTACAACGTTGTAGAGCATGAGTGGG0.698400.464100.844800.750000.962000.62500


Target Position: 6351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6351CUAAAAAAAAAAAAAAAAA83.9124865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4426369CTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAG0.994300.986400.672400.750001.000001.00000


Target Position: 5236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5236GUUUUAGAAGGAAAAAAGU76.18531902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5234-5256ATGTTTTAGAAGGAAAAAAGTTCACUUUUUUCCUUCUAAAACAUGUUUUAGAAGGAAAAAAGUUCU-5.97.102


Target Position: 4984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4984UUCACUUCAAAAGCUUUUU54.80565256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9855002TTCACTTCAAAAGCTTTTTAAAAAGCTTTTGAAGTGAA0.121700.016300.672400.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GUGUAACGGAAUAGGUAUU80.25641325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1263-1285GTGTGTAACGGAATAGGTATTGGAAUACCUAUUCCGUUACACACGUGUAACGGAAUAGGUAUUGGU19.821.032


Target Position: 5606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5606ACUCUAUUAUGCUCUCAAA95.382589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7545624ACTCTATTATGCTCTCAAATTTGAGAGCATAATAGAGT0.210800.201400.706900.750001.000001.00000


Target Position: 6295, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6295CAUUAAAUUCUAGUAUUUU87.7502474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5796313CATTAAATTCTAGTATTTTAAAATACTAGAATTTAATG0.172500.094100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6293-6315AGCATTAAATTCTAGTATTTTTGAAAAUACUAGAAUUUAAUGCUCAUUAAAUUCUAGUAUUUUUGU4.6-10.3


Target Position: 5225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5225CAUUUGCAGAUGUUUUAGA86.0137646

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5223-5245AACATTTGCAGATGTTTTAGAAGUCUAAAACAUCUGCAAAUGUUCAUUUGCAGAUGUUUUAGAAGU4.920.012


Target Position: 4621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4621GACUUGUUUGUCUUCCAUU85.94652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3394639GACTTGTTTGTCTTCCATTAATGGAAGACAAACAAGTC0.293300.154200.810300.750000.951100.62500


Target Position: 3055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055UCCCUCAGCCACCCAUAUG54.0055339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673073TCCCTCAGCCACCCATATGCATATGGGTGGCTGAGGGA0.250700.133500.715500.500001.000001.00000


Target Position: 4141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141CAGAAAUUUAUCUUUCAAA94.5593119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161AGCAGAAATTTATCTTTCAAAGAUUUGAAAGAUAAAUUUCUGCUCAGAAAUUUAUCUUUCAAAGAU12.25.322


Target Position: 3206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3206GGAUGAAAGAAUGCAUUUG76.32881880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603224GGATGAAAGAATGCATTTGCAAATGCATTCTTTCATCC0.125400.075000.724100.750001.000001.00000


Target Position: 3110, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110GAUGAUAGACGCAGAUAGU89.4371336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3108-3130TGGATGATAGACGCAGATAGTCGACUAUCUGCGUCUAUCAUCCAGAUGAUAGACGCAGAUAGUCGU17.813.333


Target Position: 4983, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4983CUUCACUUCAAAAGCUUUU68.66513166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6125001CTTCACTTCAAAAGCTTTTAAAAGCTTTTGAAGTGAAG0.207400.054700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4981-5003TACTTCACTTCAAAAGCTTTTTAAAAAGCUUUUGAAGUGAAGUACUUCACUUCAAAAGCUUUUUAU17.019.231


Target Position: 445, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445GGAAUUUGGAAAUUACCUA92.6135181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885463GGAATTTGGAAATTACCTATAGGTAATTTCCAAATTCC0.092700.021500.698301.000000.945700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
443-465TGGGAATTTGGAAATTACCTATGUAGGUAAUUUCCAAAUUCCCAGGAAUUUGGAAAUUACCUAUGU18.57.422


Target Position: 5147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5147GACAGUAGCAUUAUGAGUA97.556440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9955165GACAGTAGCATTATGAGTATACTCATAATGCTACTGTC0.074300.012500.637900.750001.000001.00000


Target Position: 5312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5312GCCCACCUUUUUUCCUAAU73.13152375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7495330GCCCACCTTTTTTCCTAATATTAGGAAAAAAGGTGGGC0.285300.017200.991401.000001.000001.00000


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005CGGAAUCCCUGCCAGCGAG68.61983172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033023CGGAATCCCTGCCAGCGAGCTCGCTGGCAGGGATTCCG0.100200.010000.603400.750000.940200.75000


Target Position: 4007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4007GGUUUUGCAACGUUUACAC72.92142408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9134025GGTTTTGCAACGTTTACACGTGTAAACGTTGCAAAACC0.391400.028400.560300.750000.951100.62500


Target Position: 6030, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6030CACAAGUUCCCUAAAAGUU80.75471265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8366048CACAAGTTCCCTAAAAGTTAACTTTTAGGGAACTTGTG0.205900.012400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6028-6050CCCACAAGTTCCCTAAAAGTTGCAACUUUUAGGGAACUUGUGGGCACAAGUUCCCUAAAAGUUGCU4.917.8


Target Position: 1664, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664GUGCUAUGCAAAUACAAUA94.1446130

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1166419GTGCTATGCAAATACAATA1/1/0/097.75EGFRNM_201284.1+NM_005228.3+NM_201282.1+NM_201283.11+1+1+0NANANA2:7483633..7483651(+)|7:55227940..55227958(+)00EGFR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681682GTGCTATGCAAATACAATATATTGTATTTGCATAGCAC0.175200.031000.750000.750000.983700.62500


Target Position: 6172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6172AGGACAUGCAGAAAUAUUU82.531014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7676190AGGACATGCAGAAATATTTAAATATTTCTGCATGTCCT0.124000.032800.844800.750001.000001.00000


Target Position: 5557, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5557GAAAGUAUUUGAUUUUUGU86.7835574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5555-5577AAGAAAGTATTTGATTTTTGTCTACAAAAAUCAAAUACUUUCUUGAAAGUAUUUGAUUUUUGUCUU-3.34.602


Target Position: 3611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3611GCCCAGCAGAGACCCACAC61.76834307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6593629GCCCAGCAGAGACCCACACGTGTGGGTCTCTGCTGGGC0.692700.023700.706900.750000.923900.75000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720CCAAAAUUAUAAGCAACAG72.38132513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441738CCAAAATTATAAGCAACAGCTGTTGCTTATAATTTTGG0.318100.276600.560300.750001.000001.00000


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658AGCUGCCCAUGAGAAAUUU72.20342549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715676AGCTGCCCATGAGAAATTTAAATTTCTCATGGGCAGCT0.786800.019200.853400.750001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711GUCAGAAAACCAAAAUUAU86.6471590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7031729GTCAGAAAACCAAAATTATATAATTTTGGTTTTCTGAC0.673000.269700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1709-1731CGGTCAGAAAACCAAAATTATAAAUAAUUUUGGUUUUCUGACCGGUCAGAAAACCAAAAUUAUAAU-9.720.422


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511UGCCUUUGAGAACCUAGAA78.74251525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211529TGCCTTTGAGAACCTAGAATTCTAGGTTCTCAAAGGCA0.803800.026500.681000.750001.000001.00000


Target Position: 1333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1333UCAAAAACUGCACCUCCAU69.54463014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121351TCAAAAACTGCACCTCCATATGGAGGTGCAGTTTTTGA0.214600.135400.569000.750001.000001.00000


Target Position: 5552, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5552GUUAAGAAAGUAUUUGAUU81.28291192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8705570GTTAAGAAAGTATTTGATTAATCAAATACTTTCTTAAC0.095000.042500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5550-5572TTGTTAAGAAAGTATTTGATTTTAAUCAAAUACUUUCUUAACAAGUUAAGAAAGUAUUUGAUUUUU7.27.101


Target Position: 4466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4466GGCAGGUACAGUAGGAUAA93.0487170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8284484GGCAGGTACAGTAGGATAATTATCCTACTGTACCTGCC0.108400.063400.965501.000001.000001.00000


Target Position: 4626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4626GUUUGUCUUCCAUUCCAUU83.349939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6174644GTTTGTCTTCCATTCCATTAATGGAATGGAAGACAAAC0.370500.123600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4624-4646TTGTTTGTCTTCCATTCCATTGTAAUGGAAUGGAAGACAAACAAGUUUGUCUUCCAUUCCAUUGUU20.119.232


Target Position: 6293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6293AGCAUUAAAUUCUAGUAUU84.8101770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5376311AGCATTAAATTCTAGTATTAATACTAGAATTTAATGCT0.185300.127800.844800.750001.000001.00000


Target Position: 5708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5708CACAAUUUAGCAAAGGAAA86.1961635

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5706-5728TTCACAATTTAGCAAAGGAAATGUUUCCUUUGCUAAAUUGUGAACACAAUUUAGCAAAGGAAAUGU18.75.3


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210GGGGGCCCUCCUCUUGCUG56.76875047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522228GGGGGCCCTCCTCTTGCTGCAGCAAGAGGAGGGCCCCC0.128300.011600.706900.750000.978300.75000


Target Position: 3861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861CCACAAAGCAGUGAAUUUA89.2237354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3859-3881CGCCACAAAGCAGTGAATTTATTUAAAUUCACUGCUUUGUGGCGCCACAAAGCAGUGAAUUUAUUU7.416.732


Target Position: 3256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256CCCUGAUGGAUGAAGAAGA85.3401707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783274CCCTGATGGATGAAGAAGATCTTCTTCATCCATCAGGG0.171100.015300.767200.750000.962000.75000


Target Position: 2911, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2911CAAUUUUACACAGAAUCUA89.8686306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2909-2931ATCAATTTTACACAGAATCTATAUAGAUUCUGUGUAAAAUUGAUCAAUUUUACACAGAAUCUAUAU19.1-9.732


Target Position: 5473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5473UCACACACACAUACAAAAU75.4192030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7205491TCACACACACATACAAAATATTTTGTATGTGTGTGTGA0.189400.101800.715500.750001.000001.00000


Target Position: 6320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6320UUGAAACAGUAACUUAAUA81.11421218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9686338TTGAAACAGTAACTTAATATATTAAGTTACTGTTTCAA0.343800.135500.603400.500001.000001.00000


Target Position: 4925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4925CACCCCAACCCCCCAAAAU69.08143088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5024943CACCCCAACCCCCCAAAATATTTTGGGGGGTTGGGGTG0.654400.546200.784500.750001.000001.00000


Target Position: 5177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5177AGGUAGUAAAUAUGAAACU78.02941638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9415195AGGTAGTAAATATGAAACTAGTTTCATATTTACTACCT0.115200.068800.637900.500001.000001.00000


Target Position: 5427, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5427GGAAGAAAUGGUUCAGAAA99.286521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9655445GGAAGAAATGGTTCAGAAATTTCTGAACCATTTCTTCC0.161100.008100.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5425-5447AAGGAAGAAATGGTTCAGAAAATUUUCUGAACCAUUUCUUCCUUGGAAGAAAUGGUUCAGAAAAUU20.414.801


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460GGUGAGAAAGUUAAAAUUC76.05021926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722478GGTGAGAAAGTTAAAATTCGAATTTTAACTTTCTCACC0.163500.022300.681000.750000.989100.62500


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480CGUCGCUAUCAAGGAAUUA86.2427631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8492498CGTCGCTATCAAGGAATTATAATTCCTTGATAGCGACG0.258600.011700.741401.000001.000001.00000


Target Position: 5428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5428GAAGAAAUGGUUCAGAAAA94.018132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5426-5448AGGAAGAAATGGTTCAGAAAATAUUUUCUGAACCAUUUCUUCCUGAAGAAAUGGUUCAGAAAAUAU20.45.301


Target Position: 4383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383UCAAGGCUUCCACUGCAAA76.65961825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274401TCAAGGCTTCCACTGCAAATTTGCAGTGGAAGCCTTGA0.187500.009400.724100.750000.989100.62500


Target Position: 5698, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5698CUAAGAAAUUCACAAUUUA95.993672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6355716CTAAGAAATTCACAATTTATAAATTGTGAATTTCTTAG0.161100.120800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5696-5718TTCTAAGAAATTCACAATTTAGCUAAAUUGUGAAUUUCUUAGAACUAAGAAAUUCACAAUUUAGCU5.37.1


Target Position: 5466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5466UGUUCAGUCACACACACAU80.75231266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9895484TGTTCAGTCACACACACATATGTGTGTGTGACTGAACA0.225700.150000.551700.750000.994600.62500


Target Position: 3205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3205GGGAUGAAAGAAUGCAUUU83.9601859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7433223GGGATGAAAGAATGCATTTAAATGCATTCTTTCATCCC0.129700.077700.991401.000001.000001.00000


Target Position: 5480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5480CACAUACAAAAUGUUCCUU76.43391856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5295498CACATACAAAATGTTCCTTAAGGAACATTTTGTATGTG0.350600.147000.655200.750000.934800.62500


Target Position: 2117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2117CCAUCCAAACUGCACCUAC71.19312721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062135CCATCCAAACTGCACCTACGTAGGTGCAGTTTGGATGG0.604000.019700.663800.750001.000001.00000


Target Position: 5608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5608UCUAUUAUGCUCUCAAAUA85.1189732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4775626TCTATTATGCTCTCAAATATATTTGAGAGCATAATAGA0.783700.164400.681000.750001.000001.00000


Target Position: 5694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5694GAUUCUAAGAAAUUCACAA98.928527

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5692-5714CTGATTCTAAGAAATTCACAATTUUGUGAAUUUCUUAGAAUCAGGAUUCUAAGAAAUUCACAAUUU20.56.9


Target Position: 5038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5038CCCCAAACCCCCUCCUUAC62.55084181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4055056CCCCAAACCCCCTCCTTACGTAAGGAGGGGGTTTGGGG0.299500.266600.810300.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CCCCCACUCAUGCUCUACA82.60661003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211068CCCCCACTCATGCTCTACATGTAGAGCATGAGTGGGGG0.608400.467700.784500.750001.000001.00000


Target Position: 3144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GAGUUGAUCAUCGAAUUCU82.08081076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164GTGAGTTGATCATCGAATTCTCCAGAAUUCGAUGAUCAACUCACGAGUUGAUCAUCGAAUUCUCCU16.719.233


Target Position: 2422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2422CGUUCGGCACGGUGUAUAA94.9382106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852440CGTTCGGCACGGTGTATAATTATACACCGTGCCGAACG0.330900.010400.741401.000000.962000.62500


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841CUGGGUGCGGAAGAGAAAG59.93494583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182859CTGGGTGCGGAAGAGAAAGCTTTCTCTTCCGCACCCAG0.752900.034500.646600.500001.000001.00000


Target Position: 4774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4774UGAGAAUGUGGAAUACCUA90.4105278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854792TGAGAATGTGGAATACCTATAGGTATTCCACATTCTCA0.331200.019400.551700.750000.956500.75000


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330CUGGAGGAAAAGAAAGUUU75.56462007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
686348CTGGAGGAAAAGAAAGTTTAAACTTTCTTTTCCTCCAG0.180300.021500.784500.750001.000001.00000


Target Position: 5317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5317CCUUUUUUCCUAAUCUGUG69.89142952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9745335CCTTTTTTCCTAATCTGTGCACAGATTAGGAAAAAAGG0.089000.042400.551700.750001.000001.00000


Target Position: 4880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4880AGAAGACUACAAAAAUGAA96.760554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674898AGAAGACTACAAAAATGAATTCATTTTTGTAGTCTTCT0.166700.043400.551700.750001.000001.00000


Target Position: 5604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5604CCACUCUAUUAUGCUCUCA84.2609826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7305622CCACTCTATTATGCTCTCATGAGAGCATAATAGAGTGG0.297300.275300.620700.750001.000001.00000


Target Position: 6029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6029CCACAAGUUCCCUAAAAGU80.21671332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7286047CCACAAGTTCCCTAAAAGTACTTTTAGGGAACTTGTGG0.227600.018300.637900.750001.000001.00000


Target Position: 2799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799CCGCAGCAUGUCAAGAUCA86.5356602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642817CCGCAGCATGTCAAGATCATGATCTTGACATGCTGCGG0.079300.029400.689700.750001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458AAGGUGAGAAAGUUAAAAU82.35851034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092476AAGGTGAGAAAGTTAAAATATTTTAACTTTCTCACCTT0.291900.111900.629300.500001.000001.00000


Target Position: 6106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6106CACAACAUUUCUAAGAAUC71.312702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9276124CACAACATTTCTAAGAATCGATTCTTAGAAATGTTGTG0.273700.048800.612100.500001.000001.00000


Target Position: 5045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5045CCCCCUCCUUACGCUUUGU64.42843897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9245063CCCCCTCCTTACGCTTTGTACAAAGCGTAAGGAGGGGG0.086200.086600.784500.750001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840GCUGGGUGCGGAAGAGAAA87.0141544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762858GCTGGGTGCGGAAGAGAAATTTCTCTTCCGCACCCAGC0.878300.022000.853401.000001.000001.00000


Target Position: 5233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5233GAUGUUUUAGAAGGAAAAA87.3215514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5231-5253CAGATGTTTTAGAAGGAAAAAAGUUUUUCCUUCUAAAACAUCUGGAUGUUUUAGAAGGAAAAAAGU18.75.301


Target Position: 2665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665GGGAACACAAAGACAAUAU85.5508687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582683GGGAACACAAAGACAATATATATTGTCTTTGTGTTCCC0.204600.016400.948301.000001.000001.00000


Target Position: 5430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5430AGAAAUGGUUCAGAAAAUA87.9895452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9205448AGAAATGGTTCAGAAAATATATTTTCTGAACCATTTCT0.131800.009600.681000.750001.000001.00000


Target Position: 4932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4932ACCCCCCAAAAUUAGUUUG51.69265600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9084950ACCCCCCAAAATTAGTTTGCAAACTAATTTTGGGGGGT0.112200.112400.706900.500001.000001.00000


Target Position: 4170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4170UGAAAAAAAAAAAAAGUAU74.60062143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3954188TGAAAAAAAAAAAAAGTATATACTTTTTTTTTTTTTCA0.358500.156000.681000.750001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478AUGAUCUUUCCUUCUUAAA76.96741775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854496ATGATCTTTCCTTCTTAAATTTAAGAAGGAAAGATCAT0.155000.048800.655200.500001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524CCUCAUUGCCCUCAACACA85.0817735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934542CCTCATTGCCCTCAACACATGTGTTGAGGGCAATGAGG0.251500.009200.637900.750000.978300.87500


Target Position: 4975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4975UCCUUUUACUUCACUUCAA80.92171246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5294993TCCTTTTACTTCACTTCAATTGAAGTGAAGTAAAAGGA0.412600.317200.724100.750001.000001.00000


Target Position: 4703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4703GACACAUCAAAUAAUAACU85.5642685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8474721GACACATCAAATAATAACTAGTTATTATTTGATGTGTC0.759400.359300.612100.500001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455CAGAAGGUGAGAAAGUUAA90.2891284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892473CAGAAGGTGAGAAAGTTAATTAACTTTCTCACCTTCTG0.402700.034900.750000.750001.000001.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659GCUGCCCAUGAGAAAUUUA88.5486419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738677GCTGCCCATGAGAAATTTATAAATTTCTCATGGGCAGC0.787700.017800.819001.000001.000001.00000


Target Position: 5548, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5548CAUUGUUAAGAAAGUAUUU86.6621588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7065566CATTGTTAAGAAAGTATTTAAATACTTTCTTAACAATG0.141200.058100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5546-5568AGCATTGTTAAGAAAGTATTTGAAAAUACUUUCUUAACAAUGCUCAUUGUUAAGAAAGUAUUUGAU4.66.902


Target Position: 4926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4926ACCCCAACCCCCCAAAAUU65.75493685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6734944ACCCCAACCCCCCAAAATTAATTTTGGGGGGTTGGGGT0.651000.542400.844800.750001.000001.00000


Target Position: 3911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3911CCUAAAAAUCCAGACUCUU79.09241485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4073929CCTAAAAATCCAGACTCTTAAGAGTCTGGATTTTTAGG0.243200.107200.706901.000001.000001.00000


Target Position: 385, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CUUUUGAAGAUCAUUUUCU75.74451979

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
383-405CACTTTTGAAGATCATTTTCTCAAGAAAAUGAUCUUCAAAAGUGCUUUUGAAGAUCAUUUUCUCAU7.47.712


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997CCAUAUGACGGAAUCCCUG71.16812722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9313015CCATATGACGGAATCCCTGCAGGGATTCCGTCATATGG0.155600.017600.560300.750000.967400.75000


Target Position: 4533, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4533CUUCCUUAGACUUACUUUU77.93271653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7384551CTTCCTTAGACTTACTTTTAAAAGTAAGTCTAAGGAAG0.131000.029200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4531-4553TTCTTCCTTAGACTTACTTTTGTAAAAGUAAGUCUAAGGAAGAACUUCCUUAGACUUACUUUUGUU4.919.932


Target Position: 4640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4640CCAUUGUUUUGAAACUCAG76.18481903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9544658CCATTGTTTTGAAACTCAGCTGAGTTTCAAAACAATGG0.124600.062400.560300.750001.000001.00000


Target Position: 3959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3959CCUCCAUCCCAACAGCCAU78.59511551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3903977CCTCCATCCCAACAGCCATATGGCTGTTGGGATGGAGG0.254800.181000.689701.000001.000001.00000


Target Position: 5476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476CACACACAUACAAAAUGUU85.5567686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6675494CACACACATACAAAATGTTAACATTTTGTATGTGTGTG0.325000.110400.646600.750000.934800.62500


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655AGGAGCUGCCCAUGAGAAA81.88641098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629673AGGAGCTGCCCATGAGAAATTTCTCATGGGCAGCTCCT0.175200.025700.844800.750000.967400.75000


Target Position: 5744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5744ACCUUAAAACAACGUGACA78.9531505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7985762ACCTTAAAACAACGTGACATGTCACGTTGTTTTAAGGT0.523600.354200.646600.500001.000001.00000


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181CCCAGCGCUACCUUGUCAU71.492664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6093199CCCAGCGCTACCTTGTCATATGACAAGGTAGCGCTGGG0.165000.130100.836201.000001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048GCCCCCCACUCAUGCUCUA81.49341168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1251066GCCCCCCACTCATGCTCTATAGAGCATGAGTGGGGGGC0.601700.424500.827601.000001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199CAGCUAUGAGAUGGAGGAA90.0326296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521217CAGCTATGAGATGGAGGAATTCCTCCATCTCATAGCTG0.146100.046200.612100.750001.000001.00000


Target Position: 6141, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6141CAGUUAACCACUUUCAUUA95.295495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5916159CAGTTAACCACTTTCATTATAATGAAAGTGGTTAACTG0.642200.437300.750000.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6139-6161GTCAGTTAACCACTTTCATTATTUAAUGAAAGUGGUUAACUGACCAGUUAACCACUUUCAUUAUUU7.412.9


Target Position: 3834, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3834GAAAAUGCAGAAUACCUAA97.347245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6223852GAAAATGCAGAATACCTAATTAGGTATTCTGCATTTTC0.372200.105200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3832-3854CTGAAAATGCAGAATACCTAAGGUUAGGUAUUCUGCAUUUUCAGGAAAAUGCAGAAUACCUAAGGU19.814.023


Target Position: 4936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4936CCCAAAAUUAGUUUGUGUU77.031765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394954CCCAAAATTAGTTTGTGTTAACACAAACTAATTTTGGG0.082700.078800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4934-4956CCCCCAAAATTAGTTTGTGTTACAACACAAACUAAUUUUGGGGGCCCAAAAUUAGUUUGUGUUACU19.311.322


Target Position: 3183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183CAGCGCUACCUUGUCAUUC64.45443893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843201CAGCGCTACCTTGTCATTCGAATGACAAGGTAGCGCTG0.183700.131700.612100.500001.000001.00000


Target Position: 5660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5660UGAAAGAUACAAAGAUAAA89.0839368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3045678TGAAAGATACAAAGATAAATTTATCTTTGTATCTTTCA0.625000.247200.724100.750001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278GGUAUUGGUGAAUUUAAAG78.41621575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831296GGTATTGGTGAATTTAAAGCTTTAAATTCACCAATACC0.506800.010500.715500.750001.000001.00000


Target Position: 4072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4072GCAUUCCUUUGUCUUCAAA89.5592326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5554090GCATTCCTTTGTCTTCAAATTTGAAGACAAAGGAATGC0.179400.038700.853401.000001.000001.00000


Target Position: 2456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456AGAAGGUGAGAAAGUUAAA90.0969290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432474AGAAGGTGAGAAAGTTAAATTTAACTTTCTCACCTTCT0.338700.075000.724100.750001.000001.00000


Target Position: 4927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4927CCCCAACCCCCCAAAAUUA80.13791341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1104945CCCCAACCCCCCAAAATTATAATTTTGGGGGGTTGGGG0.633900.524000.956901.000001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CAAAGUGUGUAACGGAAUA92.2885192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721277CAAAGTGTGTAACGGAATATATTCCGTTACACACTTTG0.252100.082100.603400.750001.000001.00000


Target Position: 4540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4540AGACUUACUUUUGUAAAAA88.6498411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9024558AGACTTACTTTTGTAAAAATTTTTACAAAAGTAAGTCT0.089200.029200.724100.750000.945700.62500


Target Position: 5190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5190GAAACUAGGGUUUGAAAUU84.1984832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5188-5210ATGAAACTAGGGTTTGAAATTGAAAUUUCAAACCCUAGUUUCAUGAAACUAGGGUUUGAAAUUGAU7.49.802


Target Position: 3514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3514UCCUCCCAGUGCCUGAAUA74.11882223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6833532TCCTCCCAGTGCCTGAATATATTCAGGCACTGGGAGGA0.188700.050400.827600.750000.956500.87500


Target Position: 6166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6166CACCUCAGGACAUGCAGAA86.0887642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7756184CACCTCAGGACATGCAGAATTCTGCATGTCCTGAGGTG0.120800.031400.620700.750001.000001.00000


Target Position: 2378, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378GAAGGAAACUGAAUUCAAA104.6062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922396GAAGGAAACTGAATTCAAATTTGAATTCAGTTTCCTTC0.168700.058000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2376-2398TTGAAGGAAACTGAATTCAAAAAUUUGAAUUCAGUUUCCUUCAAGAAGGAAACUGAAUUCAAAAAU7.418.722


Target Position: 4212, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4212GGAUCUUGGAGUUUUUCAU88.6611409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4210-4232GGGGATCTTGGAGTTTTTCATTGAUGAAAAACUCCAAGAUCCCCGGAUCUUGGAGUUUUUCAUUGU7.720.422


Target Position: 4528, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4528GAAUUCUUCCUUAGACUUA92.7907172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154546GAATTCTTCCTTAGACTTATAAGTCTAAGGAAGAATTC0.086900.059400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4526-4548TGGAATTCTTCCTTAGACTTACTUAAGUCUAAGGAAGAAUUCCAGAAUUCUUCCUUAGACUUACUU18.95.322


Target Position: 4698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4698AGGAUGACACAUCAAAUAA92.3956190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4104716AGGATGACACATCAAATAATTATTTGATGTGTCATCCT0.518800.354400.810300.750000.945700.75000


Target Position: 4185, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4185GUAUAUGUGAGGAUUUUUA94.1966128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7574203GTATATGTGAGGATTTTTATAAAAATCCTCACATATAC0.169300.025400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4183-4205AAGTATATGTGAGGATTTTTATTUAAAAAUCCUCACAUAUACUUGUAUAUGUGAGGAUUUUUAUUU0.48.223


Target Position: 6143, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6143GUUAACCACUUUCAUUAUU76.15551909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6366161GTTAACCACTTTCATTATTAATAATGAAAGTGGTTAAC0.665000.551700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6141-6163CAGTTAACCACTTTCATTATTCAAAUAAUGAAAGUGGUUAACUGGUUAACCACUUUCAUUAUUCAU8.720.0


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231CCUACAGACUCCAACUUCU86.0901641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833249CCTACAGACTCCAACTTCTAGAAGTTGGAGTCTGTAGG0.092200.007700.620700.750001.000001.00000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327GCUCUGGAGGAAAAGAAAG70.43472851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518345GCTCTGGAGGAAAAGAAAGCTTTCTTTTCCTCCAGAGC0.622900.035300.715500.750001.000001.00000


Target Position: 3399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3399GCUUGCAUUGAUAGAAAUG73.33172335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973417GCTTGCATTGATAGAAATGCATTTCTATCAATGCAAGC0.234800.007400.698300.750001.000001.00000


Target Position: 5691, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5691CCUGAUUCUAAGAAAUUCA88.4609423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7395709CCTGATTCTAAGAAATTCATGAATTTCTTAGAATCAGG0.547100.160800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5689-5711TCCCTGATTCTAAGAAATTCACAUGAAUUUCUUAGAAUCAGGGACCUGAUUCUAAGAAAUUCACAU10.420.4


Target Position: 3053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3053CCUCCCUCAGCCACCCAUA79.02391497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2363071CCTCCCTCAGCCACCCATATATGGGTGGCTGAGGGAGG0.396900.109900.801701.000001.000001.00000


Target Position: 6307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6307GUAUUUUUGUAGUUUGAAA95.478485

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6305-6327TAGTATTTTTGTAGTTTGAAACAUUUCAAACUACAAAAAUACUAGUAUUUUUGUAGUUUGAAACAU14.9-9.7


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613CCUCAAGGAGAUAAGUGAU87.0114545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231631CCTCAAGGAGATAAGTGATATCACTTATCTCCTTGAGG0.222100.013100.663801.000000.902200.62500


Target Position: 4996, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4996GCUUUUUACUCAAAGAGUA94.7157112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4994-5016AAGCTTTTTACTCAAAGAGTATAUACUCUUUGAGUAAAAAGCUUGCUUUUUACUCAAAGAGUAUAU17.7-3.822


Target Position: 2716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2716AGAUCGCAAAGGGCAUGAA82.52461015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922734AGATCGCAAAGGGCATGAATTCATGCCCTTTGCGATCT0.087700.018900.551700.750001.000001.00000


Target Position: 383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CACUUUUGAAGAUCAUUUU82.23541053

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
381-403GGCACTTTTGAAGATCATTTTCTAAAAUGAUCUUCAAAAGUGCCCACUUUUGAAGAUCAUUUUCUU7.210.322


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660CUGCCCAUGAGAAAUUUAC63.88133981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995678CTGCCCATGAGAAATTTACGTAAATTTCTCATGGGCAG0.118300.014500.603400.500001.000001.00000


Target Position: 4709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4709UCAAAUAAUAACUCGGAUU70.67862809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6504727TCAAATAATAACTCGGATTAATCCGAGTTATTATTTGA0.155800.149600.715500.750000.918500.62500


Target Position: 3899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3899GAUAGUAUGAGCCCUAAAA95.833475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5173917GATAGTATGAGCCCTAAAATTTTAGGGCTCATACTATC0.646300.068100.681000.750000.962000.62500


Target Position: 6281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6281GAGUCACAUUGUAGCAUUA103.9085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4356299GAGTCACATTGTAGCATTATAATGCTACAATGTGACTC0.230200.052600.775900.750001.000001.00000


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182CCAGCGCUACCUUGUCAUU79.20811462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5703200CCAGCGCTACCTTGTCATTAATGACAAGGTAGCGCTGG0.174500.130800.836201.000001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CAGUCGUCAGCCUGAACAU87.6908475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461591CAGTCGTCAGCCTGAACATATGTTCAGGCTGACGACTG0.129500.037400.629300.750000.929300.62500


Target Position: 5431, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5431GAAAUGGUUCAGAAAAUAU92.0449201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8905449GAAATGGTTCAGAAAATATATATTTTCTGAACCATTTC0.123200.010300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5429-5451AAGAAATGGTTCAGAAAATATTTAUAUUUUCUGAACCAUUUCUUGAAAUGGUUCAGAAAAUAUUUU2.118.802


Target Position: 6120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6120GAAUCUGAGAUUUUAUAUU90.6322264

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6118-6140AAGAATCTGAGATTTTATATTGTAAUAUAAAAUCUCAGAUUCUUGAAUCUGAGAUUUUAUAUUGUU-8.020.4


Target Position: 3057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057CCUCAGCCACCCAUAUGUA90.9438248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123075CCTCAGCCACCCATATGTATACATATGGGTGGCTGAGG0.204300.112800.663801.000000.994600.75000


Target Position: 2899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899UGGCAUUGGAAUCAAUUUU68.45573201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562917TGGCATTGGAATCAATTTTAAAATTGATTCCAATGCCA0.170600.056400.844800.750000.967400.87500


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675AUACAAUAAACUGGAAAAA77.80141664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961693ATACAATAAACTGGAAAAATTTTTCCAGTTTATTGTAT0.270900.192000.543100.500001.000001.00000


Target Position: 6314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6314UGUAGUUUGAAACAGUAAC62.13274249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9196332TGTAGTTTGAAACAGTAACGTTACTGTTTCAAACTACA0.311000.028900.560300.500001.000001.00000


Target Position: 5168, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5168GUGGAAUUCAGGUAGUAAA93.3842159

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4516819GTGGAATTCAGGTAGTAAA1/1/0/097.75EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANA5:51787968..51787986(+)|7:55274588..55274606(+)00EGFR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7535186GTGGAATTCAGGTAGTAAATTTACTACCTGAATTCCAC0.296200.017000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5166-5188GTGTGGAATTCAGGTAGTAAATAUUUACUACCUGAAUUCCACACGUGGAAUUCAGGUAGUAAAUAU14.320.102


Target Position: 4720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4720CUCGGAUUCCAGCCCACAU76.78591798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8824738CTCGGATTCCAGCCCACATATGTGGGCTGGAATCCGAG0.282600.010500.655200.750000.934800.62500


Target Position: 4532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4532UCUUCCUUAGACUUACUUU73.88982252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8434550TCTTCCTTAGACTTACTTTAAAGTAAGTCTAAGGAAGA0.104100.034800.724100.750001.000001.00000


Target Position: 4184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4184AGUAUAUGUGAGGAUUUUU81.13041217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5094202AGTATATGTGAGGATTTTTAAAAATCCTCACATATACT0.199400.045500.706900.750001.000001.00000


Target Position: 4541, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4541GACUUACUUUUGUAAAAAU93.9896135

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9454119GACTTACTTTTGTAAAAAT1/1/0/096.22EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANA7:55273961..55273979(+)00EGFR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924559GACTTACTTTTGTAAAAATATTTTTACAAAAGTAAGTC0.091600.053400.810300.750000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4539-4561TAGACTTACTTTTGTAAAAATGTAUUUUUACAAAAGUAAGUCUAGACUUACUUUUGUAAAAAUGUU0.017.622


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GCAAGUGUAAGAAGUGCGA82.07091077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901246GCAAGTGTAAGAAGTGCGATCGCACTTCTTACACTTGC0.075200.032500.560300.750001.000001.00000


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170CCGCCAACGCCACAACCAC65.60543708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754188CCGCCAACGCCACAACCACGTGGTTGTGGCGTTGGCGG0.685400.016900.620700.750000.902200.75000


Target Position: 5545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5545CAGCAUUGUUAAGAAAGUA94.2797125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7715563CAGCATTGTTAAGAAAGTATACTTTCTTAACAATGCTG0.149900.060000.603400.750001.000001.00000


Target Position: 6294, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6294GCAUUAAAUUCUAGUAUUU91.7094219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5196312GCATTAAATTCTAGTATTTAAATACTAGAATTTAATGC0.196200.113200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6292-6314TAGCATTAAATTCTAGTATTTTTAAAUACUAGAAUUUAAUGCUAGCAUUAAAUUCUAGUAUUUUUU6.3-1.4


Target Position: 5494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5494UCCUUUUGCUUUUAAAGUA79.15721471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9365512TCCTTTTGCTTTTAAAGTATACTTTAAAAGCAAAAGGA0.083700.020200.689700.750001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434GAUAUUCUGAAAACCGUAA89.3737341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931452GATATTCTGAAAACCGTAATTACGGTTTTCAGAATATC0.326400.037800.646600.750001.000001.00000


Target Position: 3516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3516CUCCCAGUGCCUGAAUACA80.03481356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8593534CTCCCAGTGCCTGAATACATGTATTCAGGCACTGGGAG0.178600.044100.603400.500000.956500.87500


Target Position: 1713, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713CAGAAAACCAAAAUUAUAA94.3166124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521731CAGAAAACCAAAATTATAATTATAATTTTGGTTTTCTG0.838200.323800.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1711-1733GTCAGAAAACCAAAATTATAAGCUUAUAAUUUUGGUUUUCUGACCAGAAAACCAAAAUUAUAAGCU-8.013.322


Target Position: 6315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6315GUAGUUUGAAACAGUAACU79.41831432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6313-6335TTGTAGTTTGAAACAGTAACTTAAGUUACUGUUUCAAACUACAAGUAGUUUGAAACAGUAACUUAU19.011.8


Target Position: 4611, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4611GCGUUAGACUGACUUGUUU86.7673577

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4609-4631GAGCGTTAGACTGACTTGTTTGTAAACAAGUCAGUCUAACGCUCGCGUUAGACUGACUUGUUUGUU17.820.933


Target Position: 1304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304CUCCAUAAAUGCUACGAAU86.1375638

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1302-1324CTCTCCATAAATGCTACGAATATAUUCGUAGCAUUUAUGGAGAGCUCCAUAAAUGCUACGAAUAUU20.921.223


Target Position: 4997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4997CUUUUUACUCAAAGAGUAU83.6209902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4995-5017AGCTTTTTACTCAAAGAGTATATAUACUCUUUGAGUAAAAAGCUCUUUUUACUCAAAGAGUAUAUU18.90.012


Target Position: 3828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828ACAGCUGAAAAUGCAGAAU70.68362808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7123846ACAGCTGAAAATGCAGAATATTCTGCATTTTCAGCTGT0.156900.019400.698300.750000.994600.87500


Target Position: 5215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5215GCUUUCACAACAUUUGCAG67.75853332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8675233GCTTTCACAACATTTGCAGCTGCAAATGTTGTGAAAGC0.153400.042500.569000.750001.000001.00000


Target Position: 4901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4901UGCUCUGAAAUCUCCUUUA81.98961089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124919TGCTCTGAAATCTCCTTTATAAAGGAGATTTCAGAGCA0.290400.013800.819000.750001.000001.00000


Target Position: 5467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5467GUUCAGUCACACACACAUA97.215350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7875485GTTCAGTCACACACACATATATGTGTGTGTGACTGAAC0.209500.124300.603400.750001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921GCAUACAGUGCCACCCAGA85.4554697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631939GCATACAGTGCCACCCAGATCTGGGTGGCACTGTATGC0.081700.008200.629300.750001.000001.00000


Target Position: 6285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6285CACAUUGUAGCAUUAAAUU83.1563957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5946303CACATTGTAGCATTAAATTAATTTAATGCTACAATGTG0.442200.114600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6283-6305GTCACATTGTAGCATTAAATTCTAAUUUAAUGCUACAAUGUGACCACAUUGUAGCAUUAAAUUCUU-10.319.3


Target Position: 3897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897AGGAUAGUAUGAGCCCUAA88.7673398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6703915AGGATAGTATGAGCCCTAATTAGGGCTCATACTATCCT0.380100.022400.810300.750000.962000.62500


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800CGCAGCAUGUCAAGAUCAC73.31862339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062818CGCAGCATGTCAAGATCACGTGATCTTGACATGCTGCG0.088500.027400.629300.750001.000001.00000


Target Position: 5199, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5199GUUUGAAAUUGAUAAUGCU86.2892626

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5197-5219GGGTTTGAAATTGATAATGCTTTAGCAUUAUCAAUUUCAAACCCGUUUGAAAUUGAUAAUGCUUUU15.27.703


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581AGGAAAUAUGUACUACGAA91.299229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456599AGGAAATATGTACTACGAATTCGTAGTACATATTTCCT0.501900.042000.672400.750001.000001.00000


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457GAAGGUGAGAAAGUUAAAA90.4547276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202475GAAGGTGAGAAAGTTAAAATTTTAACTTTCTCACCTTC0.543100.064400.672400.750001.000001.00000


Target Position: 5482, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5482CAUACAAAAUGUUCCUUUU88.8273391

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10548219CATACAAAATGTTCCTTTT1/1/0/096.22EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANA7:55274902..55274920(+)00EGFR(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5480-5502CACATACAAAATGTTCCTTTTGCAAAAGGAACAUUUUGUAUGUGCAUACAAAAUGUUCCUUUUGCU18.76.922


Target Position: 6282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6282AGUCACAUUGUAGCAUUAA83.5731908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5116300AGTCACATTGTAGCATTAATTAATGCTACAATGTGACT0.231300.064800.672400.750001.000001.00000


Target Position: 5316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5316ACCUUUUUUCCUAAUCUGU68.01133277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9805334ACCTTTTTTCCTAATCTGTACAGATTAGGAAAAAAGGT0.129300.071800.646600.500001.000001.00000


Target Position: 5166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5166GUGUGGAAUUCAGGUAGUA91.392225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9555184GTGTGGAATTCAGGTAGTATACTACCTGAATTCCACAC0.197100.008400.612100.750001.000001.00000


Target Position: 5195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5195UAGGGUUUGAAAUUGAUAA81.54851156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9025213TAGGGTTTGAAATTGATAATTATCAATTTCAAACCCTA0.239300.028000.637900.500001.000001.00000


Target Position: 5470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5470CAGUCACACACACAUACAA98.837330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6455488CAGTCACACACACATACAATTGTATGTGTGTGTGACTG0.169000.088600.637900.750001.000001.00000


Target Position: 4140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4140GCAGAAAUUUAUCUUUCAA97.609139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4138-4160GAGCAGAAATTTATCTTTCAAAGUUGAAAGAUAAAUUUCUGCUCGCAGAAAUUUAUCUUUCAAAGU20.412.021


Target Position: 4071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4071UGCAUUCCUUUGUCUUCAA81.51291166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6304089TGCATTCCTTTGTCTTCAATTGAAGACAAAGGAATGCA0.160900.034700.706900.750001.000001.00000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712UCAGAAAACCAAAAUUAUA85.8717656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971730TCAGAAAACCAAAATTATATATAATTTTGGTTTTCTGA0.814800.273100.681000.750001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657GAGCUGCCCAUGAGAAAUU80.21334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691675GAGCTGCCCATGAGAAATTAATTTCTCATGGGCAGCTC0.183100.021300.801700.750001.000001.00000


Target Position: 5946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5946CACUGCUAAAGUCCACAUA88.0259451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5175964CACTGCTAAAGTCCACATATATGTGGACTTTAGCAGTG0.202400.035300.750000.750000.983700.62500


Target Position: 4171, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4171GAAAAAAAAAAAAAGUAUA92.6973175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6804189GAAAAAAAAAAAAAGTATATATACTTTTTTTTTTTTTC0.348000.179600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4169-4191TTGAAAAAAAAAAAAAGTATATGUAUACUUUUUUUUUUUUUCAAGAAAAAAAAAAAAAGUAUAUGU4.6-11.310


Target Position: 4804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804GCUUUUGUUCUCGCAAAAA84.2737824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4802-4824CCGCTTTTGTTCTCGCAAAAACGUUUUUGCGAGAACAAAAGCGGGCUUUUGUUCUCGCAAAAACGU20.610.322


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663UGUGCUAUGCAAAUACAAU82.53311012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611681TGTGCTATGCAAATACAATATTGTATTTGCATAGCACA0.153600.027900.698300.750000.983700.75000


Target Position: 6283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6283GUCACAUUGUAGCAUUAAA96.126767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4406301GTCACATTGTAGCATTAAATTTAATGCTACAATGTGAC0.229000.070200.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6281-6303GAGTCACATTGTAGCATTAAATTUUUAAUGCUACAAUGUGACUCGUCACAUUGUAGCAUUAAAUUU15.320.5


Target Position: 5037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5037CCCCCAAACCCCCUCCUUA78.65181537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2175055CCCCCAAACCCCCTCCTTATAAGGAGGGGGTTTGGGGG0.405400.355100.956901.000001.000001.00000


Target Position: 2372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372GAUCUUGAAGGAAACUGAA95.445786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2370-2392AGGATCTTGAAGGAAACTGAATTUUCAGUUUCCUUCAAGAUCCUGAUCUUGAAGGAAACUGAAUUU19.220.423


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257CGCAAAGUGUGUAACGGAA92.627180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911275CGCAAAGTGTGTAACGGAATTCCGTTACACACTTTGCG0.206800.063100.750001.000001.000001.00000


Target Position: 6124, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6124CUGAGAUUUUAUAUUGUCA92.9518171

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6122-6144ATCTGAGATTTTATATTGTCAGTUGACAAUAUAAAAUCUCAGAUCUGAGAUUUUAUAUUGUCAGUU16.120.4


Target Position: 6350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6350GCUAAAAAAAAAAAAAAAA86.9032559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426368GCTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTAGC0.991400.978100.853401.000001.000001.00000


Target Position: 6202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6202GGGAAACAGAAGGACCUAC70.82182776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4256220GGGAAACAGAAGGACCTACGTAGGTCCTTCTGTTTCCC0.241700.064800.810300.750000.994600.62500


Target Position: 5495, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5495CCUUUUGCUUUUAAAGUAA88.7743396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9125513CCTTTTGCTTTTAAAGTAATTACTTTAAAAGCAAAAGG0.087500.019500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5493-5515TTCCTTTTGCTTTTAAAGTAATTUUACUUUAAAAGCAAAAGGAACCUUUUGCUUUUAAAGUAAUUU6.618.602


Target Position: 4902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4902GCUCUGAAAUCUCCUUUAG75.86041957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7924920GCTCTGAAATCTCCTTTAGCTAAAGGAGATTTCAGAGC0.334200.014900.681000.750001.000001.00000


Target Position: 5567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5567GAUUUUUGUCUCAAUGAAA97.849536

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5565-5587TTGATTTTTGTCTCAATGAAAATUUUCAUUGAGACAAAAAUCAAGAUUUUUGUCUCAAUGAAAAUU13.8-3.302


Target Position: 5526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5526AGAUCAGUCAGAGCCCCUA84.6025792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9615544AGATCAGTCAGAGCCCCTATAGGGGCTCTGACTGATCT0.134300.017700.551700.750001.000001.00000


Target Position: 5369, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5369CUUUGUAAACAGUGUUUUA93.6454145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9805387CTTTGTAAACAGTGTTTTATAAAACACTGTTTACAAAG0.076600.031000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5367-5389TCCTTTGTAAACAGTGTTTTAAAUAAAACACUGUUUACAAAGGACUUUGUAAACAGUGUUUUAAAU13.37.202


Target Position: 4543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4543CUUACUUUUGUAAAAAUGU72.81782422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4541-4563GACTTACTTTTGTAAAAATGTCCACAUUUUUACAAAAGUAAGUCCUUACUUUUGUAAAAAUGUCCU-3.34.922


Target Position: 2212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212GGGCCCUCCUCUUGCUGCU70.72552798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682230GGGCCCTCCTCTTGCTGCTAGCAGCAAGAGGAGGGCCC0.191500.011000.637900.750001.000001.00000


Target Position: 6168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6168CCUCAGGACAUGCAGAAAU79.49891415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7306186CCTCAGGACATGCAGAAATATTTCTGCATGTCCTGAGG0.133300.035800.836201.000001.000001.00000


Target Position: 5453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5453CAGCCUACAGUUAUGUUCA91.0773241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9225471CAGCCTACAGTTATGTTCATGAACATAACTGTAGGCTG0.161200.033500.560300.500001.000001.00000


Target Position: 4696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4696AGAGGAUGACACAUCAAAU93.4638151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8184714AGAGGATGACACATCAAATATTTGATGTGTCATCCTCT0.506500.013500.715500.750000.945701.00000


Target Position: 6147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6147ACCACUUUCAUUAUUCAUU72.24792540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7376165ACCACTTTCATTATTCATTAATGAATAATGAAAGTGGT0.689300.547000.844800.750001.000001.00000


Target Position: 2801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801GCAGCAUGUCAAGAUCACA94.1235131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312819GCAGCATGTCAAGATCACATGTGATCTTGACATGCTGC0.085300.023600.646600.750001.000001.00000


Target Position: 6344, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6344GCAAAAGCUAAAAAAAAAA87.4342504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1426362GCAAAAGCTAAAAAAAAAATTTTTTTTTTAGCTTTTGC0.987000.165900.853401.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6342-6364GAGCAAAAGCTAAAAAAAAAAAAUUUUUUUUUUAGCUUUUGCUCGCAAAAGCUAAAAAAAAAAAAU-11.318.6


Target Position: 5314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5314CCACCUUUUUUCCUAAUCU79.84991372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7255332CCACCTTTTTTCCTAATCTAGATTAGGAAAAAAGGTGG0.271000.032900.620700.750001.000001.00000


Target Position: 6170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6170UCAGGACAUGCAGAAAUAU75.51992015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7946188TCAGGACATGCAGAAATATATATTTCTGCATGTCCTGA0.116300.029200.681000.750001.000001.00000


Target Position: 622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622UAUCUAACUAUGAUGCAAA88.7683397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997640TATCTAACTATGATGCAAATTTGCATCATAGTTAGATA0.150700.068100.543100.500001.000001.00000


Target Position: 4906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4906UGAAAUCUCCUUUAGCCAU74.33082187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8784924TGAAATCTCCTTTAGCCATATGGCTAAAGGAGATTTCA0.569300.242600.569000.750001.000001.00000


Target Position: 3955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3955AGGUCCUCCAUCCCAACAG59.97664575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233973AGGTCCTCCATCCCAACAGCTGTTGGGATGGAGGACCT0.255000.017300.560300.500000.962000.62500


Target Position: 5945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5945CCACUGCUAAAGUCCACAU82.33131041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6275963CCACTGCTAAAGTCCACATATGTGGACTTTAGCAGTGG0.185000.025900.689701.000000.983700.62500


Target Position: 582, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582GGAAAUAUGUACUACGAAA104.4463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176600GGAAATATGTACTACGAAATTTCGTAGTACATATTTCC0.488900.143000.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
580-602GAGGAAATATGTACTACGAAAATUUUCGUAGUACAUAUUUCCUCGGAAAUAUGUACUACGAAAAUU20.91.822


Target Position: 3496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496ACAGCAUAGACGACACCUU78.92211509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903514ACAGCATAGACGACACCTTAAGGTGTCGTCTATGCTGT0.160800.058300.569000.750001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559UGGAAAACCUGCAGAUCAU80.74171270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368577TGGAAAACCTGCAGATCATATGATCTGCAGGTTTTCCA0.449500.243200.689700.750000.956500.75000


Target Position: 5740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5740GCUAACCUUAAAACAACGU67.18863434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8625758GCTAACCTTAAAACAACGTACGTTGTTTTAAGGTTAGC0.550100.131200.577600.750001.000001.00000


Target Position: 3829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3829CAGCUGAAAAUGCAGAAUA90.525272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443847CAGCTGAAAATGCAGAATATATTCTGCATTTTCAGCTG0.155900.017500.741400.750000.994600.75000


Target Position: 4924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4924UCACCCCAACCCCCCAAAA64.0573958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4364942TCACCCCAACCCCCCAAAATTTTGGGGGGTTGGGGTGA0.657000.528800.724100.750001.000001.00000


Target Position: 5043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5043AACCCCCUCCUUACGCUUU61.84154293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8005061AACCCCCTCCTTACGCTTTAAAGCGTAAGGAGGGGGTT0.114800.107800.646600.500001.000001.00000


Target Position: 6342, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6342GAGCAAAAGCUAAAAAAAA95.353991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6340-6362AAGAGCAAAAGCTAAAAAAAAAAUUUUUUUUAGCUUUUGCUCUUGAGCAAAAGCUAAAAAAAAAAU-11.318.6


Target Position: 2485, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2485CUAUCAAGGAAUUAAGAGA90.0913291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2483-2505CGCTATCAAGGAATTAAGAGAAGUCUCUUAAUUCCUUGAUAGCGCUAUCAAGGAAUUAAGAGAAGU11.713.432


Target Position: 4935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4935CCCCAAAAUUAGUUUGUGU79.27761453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8804953CCCCAAAATTAGTTTGTGTACACAAACTAATTTTGGGG0.093900.082900.784500.750001.000001.00000


Target Position: 5455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5455GCCUACAGUUAUGUUCAGU76.70621818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6455473GCCTACAGTTATGTTCAGTACTGAACATAACTGTAGGC0.156800.098900.793100.750001.000001.00000


Target Position: 5702, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5702GAAAUUCACAAUUUAGCAA91.9326207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5700-5722AAGAAATTCACAATTTAGCAAAGUUGCUAAAUUGUGAAUUUCUUGAAAUUCACAAUUUAGCAAAGU19.77.4


Target Position: 5405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5405UCCACCCCAUCCAAUUUAU66.30683575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6665423TCCACCCCATCCAATTTATATAAATTGGATGGGGTGGA0.358800.307000.827600.750001.000001.00000


Target Position: 2666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2666GGAACACAAAGACAAUAUU88.9799379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122684GGAACACAAAGACAATATTAATATTGTCTTTGTGTTCC0.164300.166300.862101.000001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010CCGCAAAUUCCGAGACGAA89.5683323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791028CCGCAAATTCCGAGACGAATTCGTCTCGGAATTTGCGG0.076600.037500.741401.000000.978300.62500


Target Position: 4625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4625UGUUUGUCUUCCAUUCCAU79.33961445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9714643TGTTTGTCTTCCATTCCATATGGAATGGAAGACAAACA0.354300.125800.551700.750001.000001.00000


Target Position: 5668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5668ACAAAGAUAAAUAAAACAU79.10361481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9845686ACAAAGATAAATAAAACATATGTTTTATTTATCTTTGT0.799900.496800.551700.750001.000001.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481GUCGCUAUCAAGGAAUUAA87.6479482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152499GTCGCTATCAAGGAATTAATTAATTCCTTGATAGCGAC0.246800.013700.784500.750001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612CCCUCAAGGAGAUAAGUGA87.3085516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561630CCCTCAAGGAGATAAGTGATCACTTATCTCCTTGAGGG0.237400.008400.767200.750000.902200.62500


Target Position: 4535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4535UCCUUAGACUUACUUUUGU67.67463347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574553TCCTTAGACTTACTTTTGTACAAAAGTAAGTCTAAGGA0.079900.026000.663800.500001.000001.00000


Target Position: 5170, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5170GGAAUUCAGGUAGUAAAUA91.3333228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4035188GGAATTCAGGTAGTAAATATATTTACTACCTGAATTCC0.351000.050300.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5168-5190GTGGAATTCAGGTAGTAAATATGUAUUUACUACCUGAAUUCCACGGAAUUCAGGUAGUAAAUAUGU4.616.302


Target Position: 4629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4629UGUCUUCCAUUCCAUUGUU74.28592194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9344647TGTCTTCCATTCCATTGTTAACAATGGAATGGAAGACA0.293900.149300.560300.750001.000001.00000


Target Position: 4809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4809UGUUCUCGCAAAAACGUAU74.45662164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874827TGTTCTCGCAAAAACGTATATACGTTTTTGCGAGAACA0.101400.010400.663800.750000.929300.87500


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636AUGUGAUAAUUUCAGGAAA86.9296557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931654ATGTGATAATTTCAGGAAATTTCCTGAAATTATCACAT0.091200.013800.655200.500001.000001.00000


Target Position: 6140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6140UCAGUUAACCACUUUCAUU77.54211694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5926158TCAGTTAACCACTTTCATTAATGAAAGTGGTTAACTGA0.638400.172800.715500.750000.962000.75000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CAGCUGCCAAAAGUGUGAU75.60371998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970830CAGCTGCCAAAAGTGTGATATCACACTTTTGGCAGCTG0.216600.008000.603400.750001.000001.00000


Target Position: 5366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5366GUCCUUUGUAAACAGUGUU75.40952032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9965384GTCCTTTGTAAACAGTGTTAACACTGTTTACAAAGGAC0.074300.041000.672400.750001.000001.00000


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453CCCAGAAGGUGAGAAAGUU81.09831222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222471CCCAGAAGGTGAGAAAGTTAACTTTCTCACCTTCTGGG0.247800.035000.844801.000000.923900.75000


Target Position: 1133, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133GAAGAAGUGUCCCCGUAAU87.2433523

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8113319GAAGAAGTGTCCCCGTAAT1/1/0/097.21EGFRNM_201283.1+NM_201284.1+NM_005228.3+NM_201282.11+1+1+1NANANANA00EGFR(0.002)


Target Position: 4384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4384CAAGGCUUCCACUGCAAAA89.288349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9214402CAAGGCTTCCACTGCAAAATTTTGCAGTGGAAGCCTTG0.204300.009500.646600.750001.000001.00000


Target Position: 5615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5615UGCUCUCAAAUACCCCUAA77.82241660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6645633TGCTCTCAAATACCCCTAATTAGGGGTATTTGAGAGCA0.178900.153000.819000.750001.000001.00000


Target Position: 6284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6284UCACAUUGUAGCAUUAAAU77.64771685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4466302TCACATTGTAGCATTAAATATTTAATGCTACAATGTGA0.228500.075600.715500.750001.000001.00000


Target Position: 3518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3518CCCAGUGCCUGAAUACAUA93.1648166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393536CCCAGTGCCTGAATACATATATGTATTCAGGCACTGGG0.492300.043700.948301.000000.956500.62500


Target Position: 5222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5222CAACAUUUGCAGAUGUUUU85.9736650

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5220-5242CACAACATTTGCAGATGTTTTAGAAAACAUCUGCAAAUGUUGUGCAACAUUUGCAGAUGUUUUAGU14.85.312


Target Position: 1314, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GCUACGAAUAUUAAACACU81.83891104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801332GCTACGAATATTAAACACTAGTGTTTAATATTCGTAGC0.879800.796000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1312-1334ATGCTACGAATATTAAACACTTCAGUGUUUAAUAUUCGUAGCAUGCUACGAAUAUUAAACACUUCU14.720.932


Target Position: 3052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3052GCCUCCCUCAGCCACCCAU69.61933000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2103070GCCTCCCTCAGCCACCCATATGGGTGGCTGAGGGAGGC0.418200.119300.844801.000000.945700.62500


Target Position: 5441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5441AGAAAAUAUUUUCAGCCUA88.6994402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9795459AGAAAATATTTTCAGCCTATAGGCTGAAAATATTTTCT0.101500.033500.551700.750000.983700.62500


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CCCCCCACUCAUGCUCUAC59.00024728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191067CCCCCCACTCATGCTCTACGTAGAGCATGAGTGGGGGG0.605000.463500.810300.750001.000001.00000


Target Position: 5057, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5057GCUUUGUCACACAAAAAGU81.02091234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5055-5077ACGCTTTGTCACACAAAAAGTGTACUUUUUGUGUGACAAAGCGUGCUUUGUCACACAAAAAGUGUU2.119.232


Target Position: 3204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3204GGGGAUGAAAGAAUGCAUU81.70841119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263222GGGGATGAAAGAATGCATTAATGCATTCTTTCATCCCC0.148600.009400.982801.000001.000001.00000


Target Position: 5542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5542CUACAGCAUUGUUAAGAAA94.6764114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7295560CTACAGCATTGTTAAGAAATTTCTTAACAATGCTGTAG0.133400.074700.672400.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051CCCCACUCAUGCUCUACAA88.3308430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961069CCCCACTCATGCTCTACAATTGTAGAGCATGAGTGGGG0.647300.471400.844801.000001.000001.00000


Target Position: 5546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5546AGCAUUGUUAAGAAAGUAU79.91581362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5625564AGCATTGTTAAGAAAGTATATACTTTCTTAACAATGCT0.177900.067900.810300.750001.000001.00000


Target Position: 4876, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4876GAUCAGAAGACUACAAAAA96.256463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6244894GATCAGAAGACTACAAAAATTTTTGTAGTCTTCTGATC0.233600.026100.681000.750000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4874-4896TAGATCAGAAGACTACAAAAATGUUUUUGUAGUCUUCUGAUCUAGAUCAGAAGACUACAAAAAUGU7.220.421


Target Position: 4536, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4536CCUUAGACUUACUUUUGUA99.160225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9884554CCTTAGACTTACTTTTGTATACAAAAGTAAGTCTAAGG0.075700.022400.663801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4534-4556TTCCTTAGACTTACTTTTGTAAAUACAAAAGUAAGUCUAAGGAACCUUAGACUUACUUUUGUAAAU10.318.932


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GCCUUAGCAGUCUUAUCUA95.58780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888627GCCTTAGCAGTCTTATCTATAGATAAGACTGCTAAGGC0.198000.010400.827601.000001.000001.00000


Target Position: 4775, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4775GAGAAUGUGGAAUACCUAA97.344546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7564793GAGAATGTGGAATACCTAATTAGGTATTCCACATTCTC0.166700.016900.775900.750000.956500.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4773-4795CTGAGAATGTGGAATACCTAAGGUUAGGUAUUCCACAUUCUCAGGAGAAUGUGGAAUACCUAAGGU19.819.222


Target Position: 5746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5746CUUAAAACAACGUGACAAA88.4647422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6535764CTTAAAACAACGTGACAAATTTGTCACGTTGTTTTAAG0.522300.451600.637900.750001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555CCUUUGGAAAACCUGCAGA76.59961840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879573CCTTTGGAAAACCTGCAGATCTGCAGGTTTTCCAAAGG0.526500.010600.620700.750000.956501.00000


Target Position: 5260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5260CCUAAAAUAAUUUCUCUAC72.97612396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7245278CCTAAAATAATTTCTCTACGTAGAGAAATTATTTTAGG0.135500.043200.663800.750001.000001.00000


Target Position: 4747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4747UCAGCAUUUGGACCAAUAG64.19923931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9584765TCAGCATTTGGACCAATAGCTATTGGTCCAAATGCTGA0.468100.012400.551700.500001.000001.00000


Target Position: 4900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4900CUGCUCUGAAAUCUCCUUU71.3742687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7314918CTGCTCTGAAATCTCCTTTAAAGGAGATTTCAGAGCAG0.293000.018200.784500.750001.000001.00000


Target Position: 382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382GCACUUUUGAAGAUCAUUU83.2629950

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
380-402GGGCACTTTTGAAGATCATTTTCAAAUGAUCUUCAAAAGUGCCCGCACUUUUGAAGAUCAUUUUCU16.210.322


Target Position: 4740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4740GGAUUCAUCAGCAUUUGGA87.8071469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4738-4760TTGGATTCATCAGCATTTGGACCUCCAAAUGCUGAUGAAUCCAAGGAUUCAUCAGCAUUUGGACCU17.716.231


Target Position: 5690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5690CCCUGAUUCUAAGAAAUUC72.98392394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5705708CCCTGATTCTAAGAAATTCGAATTTCTTAGAATCAGGG0.450000.146200.819000.750001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572GCAGUCGUCAGCCUGAACA81.7821112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761590GCAGTCGTCAGCCTGAACATGTTCAGGCTGACGACTGC0.120500.031300.646600.750000.907600.62500


Target Position: 4613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4613GUUAGACUGACUUGUUUGU74.89742101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4611-4633GCGTTAGACTGACTTGTTTGTCTACAAACAAGUCAGUCUAACGCGUUAGACUGACUUGUUUGUCUU12.218.933


Target Position: 3118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3118ACGCAGAUAGUCGCCCAAA77.29071731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483136ACGCAGATAGTCGCCCAAATTTGGGCGACTATCTGCGT0.081900.018900.775900.750000.918500.75000


Target Position: 3061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3061AGCCACCCAUAUGUACCAU72.86092415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453079AGCCACCCATATGTACCATATGGTACATATGGGTGGCT0.130200.135700.698300.750000.902200.62500


Target Position: 5362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5362AGCAGUCCUUUGUAAACAG74.33922185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9615380AGCAGTCCTTTGTAAACAGCTGTTTACAAAGGACTGCT0.079400.016000.569000.500001.000001.00000


Target Position: 4631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4631UCUUCCAUUCCAUUGUUUU68.25773239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3594649TCTTCCATTCCATTGTTTTAAAACAATGGAATGGAAGA0.278200.182300.724100.750001.000001.00000


Target Position: 6318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6318GUUUGAAACAGUAACUUAA96.059470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7576336GTTTGAAACAGTAACTTAATTAAGTTACTGTTTCAAAC0.354900.027700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6316-6338TAGTTTGAAACAGTAACTTAATAUUAAGUUACUGUUUCAAACUAGUUUGAAACAGUAACUUAAUAU6.67.7


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827CACAGCUGAAAAUGCAGAA86.8147568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193845CACAGCTGAAAATGCAGAATTCTGCATTTTCAGCTGTG0.143900.018900.620700.750000.994601.00000


Target Position: 5486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5486CAAAAUGUUCCUUUUGCUU78.4591564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5484-5506TACAAAATGTTCCTTTTGCTTTTAAGCAAAAGGAACAUUUUGUACAAAAUGUUCCUUUUGCUUUUU18.65.322


Target Position: 3255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255GCCCUGAUGGAUGAAGAAG66.44893545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223273GCCCTGATGGATGAAGAAGCTTCTTCATCCATCAGGGC0.159000.009500.862100.750000.956500.62500


Target Position: 1306, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306CCAUAAAUGCUACGAAUAU87.4872496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1411324CCATAAATGCTACGAATATATATTCGTAGCATTTATGG0.838500.245400.801701.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1304-1326CTCCATAAATGCTACGAATATTAAUAUUCGUAGCAUUUAUGGAGCCAUAAAUGCUACGAAUAUUAU16.5-1.833


Target Position: 6275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6275GUAAGUGAGUCACAUUGUA95.379790

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6273-6295TTGTAAGTGAGTCACATTGTAGCUACAAUGUGACUCACUUACAAGUAAGUGAGUCACAUUGUAGCU19.320.3


Target Position: 3612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3612CCCAGCAGAGACCCACACU72.26962537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063630CCCAGCAGAGACCCACACTAGTGTGGGTCTCTGCTGGG0.498100.014100.784500.750000.923900.87500


Target Position: 6279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6279GUGAGUCACAUUGUAGCAU78.23531603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6686297GTGAGTCACATTGTAGCATATGCTACAATGTGACTCAC0.151800.041700.637900.750001.000001.00000


Target Position: 4969, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4969GUUUUCUCCUUUUACUUCA82.7356991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4967-4989TAGTTTTCTCCTTTTACTTCACTUGAAGUAAAAGGAGAAAACUAGUUUUCUCCUUUUACUUCACUU14.614.822


Target Position: 4013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013GCAACGUUUACACCGACUA84.4642805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7624031GCAACGTTTACACCGACTATAGTCGGTGTAAACGTTGC0.125400.105700.681001.000001.000001.00000


Target Position: 5669, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5669CAAAGAUAAAUAAAACAUA97.432843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7835687CAAAGATAAATAAAACATATATGTTTTATTTATCTTTG0.773000.470700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5667-5689TACAAAGATAAATAAAACATAGTUAUGUUUUAUUUAUCUUUGUACAAAGAUAAAUAAAACAUAGUU5.36.9


Target Position: 5697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5697UCUAAGAAAUUCACAAUUU75.86661956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5955715TCTAAGAAATTCACAATTTAAATTGTGAATTTCTTAGA0.167900.135300.724100.750001.000001.00000


Target Position: 4152, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4152CUUUCAAAGAGGUAUAUUU86.4793608

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4150-4172ATCTTTCAAAGAGGTATATTTGAAAAUAUACCUCUUUGAAAGAUCUUUCAAAGAGGUAUAUUUGAU1.17.722


Target Position: 5373, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5373GUAAACAGUGUUUUAAACU76.52961848

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5371-5393TTGTAAACAGTGTTTTAAACTCTAGUUUAAAACACUGUUUACAAGUAAACAGUGUUUUAAACUCUU0.011.802


Target Position: 3734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3734GAAAGGCAGCCACCAAAUU78.92441508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963752GAAAGGCAGCCACCAAATTAATTTGGTGGCTGCCTTTC0.656000.014400.663800.750000.907601.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326GGCUCUGGAGGAAAAGAAA93.5737149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562344GGCTCTGGAGGAAAAGAAATTTCTTTTCCTCCAGAGCC0.399400.031001.000001.000001.000001.00000


Target Position: 4697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4697GAGGAUGACACAUCAAAUA96.144866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7674715GAGGATGACACATCAAATATATTTGATGTGTCATCCTC0.514900.066200.767200.750000.945700.87500


Target Position: 2844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844GGUGCGGAAGAGAAAGAAU87.8247466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1522862GGTGCGGAAGAGAAAGAATATTCTTTCTCTTCCGCACC0.527400.194300.844801.000001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GUACUACGAAAAUUCCUAU87.5428488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772608GTACTACGAAAATTCCTATATAGGAATTTTCGTAGTAC0.226800.160300.637900.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
588-610ATGTACTACGAAAATTCCTATGCAUAGGAAUUUUCGUAGUACAUGUACUACGAAAAUUCCUAUGCU19.920.833


Target Position: 3519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519CCAGUGCCUGAAUACAUAA93.2625161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4483537CCAGTGCCTGAATACATAATTATGTATTCAGGCACTGG0.457900.043000.810301.000000.983700.62500


Target Position: 5196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5196AGGGUUUGAAAUUGAUAAU77.32451727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6835214AGGGTTTGAAATTGATAATATTATCAATTTCAAACCCT0.240900.021600.836200.750001.000001.00000


Target Position: 4392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4392CCACUGCAAAACACUAAAG71.75542632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6624410CCACTGCAAAACACTAAAGCTTTAGTGTTTTGCAGTGG0.568300.127100.706900.750000.951100.62500


Target Position: 5603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5603UCCACUCUAUUAUGCUCUC60.97314431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9155621TCCACTCTATTATGCTCTCGAGAGCATAATAGAGTGGA0.304000.284900.560300.500001.000001.00000


Target Position: 5169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5169UGGAAUUCAGGUAGUAAAU73.98722239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6905187TGGAATTCAGGTAGTAAATATTTACTACCTGAATTCCA0.294000.021400.836200.750001.000001.00000


Target Position: 3910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3910CCCUAAAAAUCCAGACUCU83.8449872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263928CCCTAAAAATCCAGACTCTAGAGTCTGGATTTTTAGGG0.192400.101300.767200.750000.983700.62500


Target Position: 6291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6291GUAGCAUUAAAUUCUAGUA94.8133109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6289-6311TTGTAGCATTAAATTCTAGTATTUACUAGAAUUUAAUGCUACAAGUAGCAUUAAAUUCUAGUAUUU18.919.7


Target Position: 446, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446GAAUUUGGAAAUUACCUAU89.0882367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847464GAATTTGGAAATTACCTATATAGGTAATTTCCAAATTC0.102200.024900.629300.750000.945700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
444-466GGGAATTTGGAAATTACCTATGTAUAGGUAAUUUCCAAAUUCCCGAAUUUGGAAAUUACCUAUGUU19.811.322


Target Position: 6203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6203GGAAACAGAAGGACCUACA88.7384401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4946221GGAAACAGAAGGACCTACATGTAGGTCCTTCTGTTTCC0.239200.076000.663800.750000.994600.75000


Target Position: 5721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5721AGGAAAUGGACUCAUAGAU80.4821300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4765739AGGAAATGGACTCATAGATATCTATGAGTCCATTTCCT0.254800.056900.663800.750001.000001.00000


Target Position: 1279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GUAUUGGUGAAUUUAAAGA84.1502837

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1277-1299AGGTATTGGTGAATTTAAAGACTUCUUUAAAUUCACCAAUACCUGUAUUGGUGAAUUUAAAGACUU-3.820.022


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GGAAAUUACCUAUGUGCAG76.80881796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969470GGAAATTACCTATGTGCAGCTGCACATAGGTAATTTCC0.083300.008000.586200.750001.000001.00000


Target Position: 4976, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4976CCUUUUACUUCACUUCAAA92.4141187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2084994CCTTTTACTTCACTTCAAATTTGAAGTGAAGTAAAAGG0.421400.324600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4974-4996CTCCTTTTACTTCACTTCAAAAGUUUGAAGUGAAGUAAAAGGAGCCUUUUACUUCACUUCAAAAGU19.24.922


Target Position: 5194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5194CUAGGGUUUGAAAUUGAUA88.9114382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6835212CTAGGGTTTGAAATTGATATATCAATTTCAAACCCTAG0.197300.027300.629300.750001.000001.00000


Target Position: 550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550GAAUUCCUUUGGAAAACCU77.76351666

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
548-570GCGAATTCCTTTGGAAAACCTGCAGGUUUUCCAAAGGAAUUCGCGAAUUCCUUUGGAAAACCUGCU21.218.722


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058CUCAGCCACCCAUAUGUAC65.36663749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353076CTCAGCCACCCATATGTACGTACATATGGGTGGCTGAG0.184400.188600.629300.500000.994600.87500


Target Position: 5472, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5472GUCACACACACAUACAAAA93.5761148

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6547219GTCACACACACATACAAAA1/1/0/097.75EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANANA00EGFR(0.002)&RUNX1(0.029)&ZNF250(0.029)&TOP1MT(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5145490GTCACACACACATACAAAATTTTGTATGTGTGTGTGAC0.197400.099000.819000.750001.000001.00000


Target Position: 6280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6280UGAGUCACAUUGUAGCAUU79.44171427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5816298TGAGTCACATTGTAGCATTAATGCTACAATGTGACTCA0.171900.046200.715500.750001.000001.00000


Target Position: 5286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5286AGAUUGGAAGAUUCAGCUA88.83390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9635304AGATTGGAAGATTCAGCTATAGCTGAATCTTCCAATCT0.218000.009700.551700.750001.000001.00000


Target Position: 5578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5578CAAUGAAAAUAAAACUAUA105.9951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5576-5598CTCAATGAAAATAAAACTATATTUAUAGUUUUAUUUUCAUUGAGCAAUGAAAAUAAAACUAUAUUU4.67.401


Target Position: 3733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3733AGAAAGGCAGCCACCAAAU74.7612119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003751AGAAAGGCAGCCACCAAATATTTGGTGGCTGCCTTTCT0.670200.014300.715500.750000.907601.00000


Target Position: 580, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580GAGGAAAUAUGUACUACGA96.658458

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
578-600CAGAGGAAATATGTACTACGAAAUCGUAGUACAUAUUUCCUCUGGAGGAAAUAUGUACUACGAAAU20.818.723


Target Position: 5342, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5342CUGUAACCUGACUGGUUAA91.8658212

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5534219CTGTAACCTGACTGGTTAA1/1/0/097.75EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANANA00EGFR(0.002)


Target Position: 5259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5259UCCUAAAAUAAUUUCUCUA82.9975970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5655277TCCTAAAATAATTTCTCTATAGAGAAATTATTTTAGGA0.176100.047100.698300.750001.000001.00000


Target Position: 6103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6103CUACACAACAUUUCUAAGA79.99831358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6101-6123GACTACACAACATTTCTAAGAATUCUUAGAAAUGUUGUGUAGUCCUACACAACAUUUCUAAGAAUU11.720.4


Target Position: 5655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5655GGGUAUGAAAGAUACAAAG80.91381247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5445673GGGTATGAAAGATACAAAGCTTTGTATCTTTCATACCC0.269500.041500.853400.750001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887GGUGAGCCAAGGGAGUUUG65.55173720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981905GGTGAGCCAAGGGAGTTTGCAAACTCCCTTGGCTCACC0.129700.007400.706900.750001.000001.00000


Target Position: 4046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046CCACCUCGGGCACAUUUUG64.15953940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7774064CCACCTCGGGCACATTTTGCAAAATGTGCCCGAGGTGG0.136300.076100.698300.750000.962000.75000


Target Position: 1578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578GUCAGCCUGAACAUAACAU79.09741482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831596GTCAGCCTGAACATAACATATGTTATGTTCAGGCTGAC0.252300.051400.663800.750001.000001.00000


Target Position: 5766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5766GCCAGACAGGACCCAUCAG71.50142662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6945784GCCAGACAGGACCCATCAGCTGATGGGTCCTGTCTGGC0.144900.043400.715500.750000.923900.75000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638GUGAUAAUUUCAGGAAACA85.5491688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091656GTGATAATTTCAGGAAACATGTTTCCTGAAATTATCAC0.310400.027300.586200.500001.000001.00000


Target Position: 4143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4143GAAAUUUAUCUUUCAAAGA88.1092444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4141-4163CAGAAATTTATCTTTCAAAGAGGUCUUUGAAAGAUAAAUUUCUGGAAAUUUAUCUUUCAAAGAGGU12.2-9.722


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513UCCGAAAGCCAACAAGGAA76.4091866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992531TCCGAAAGCCAACAAGGAATTCCTTGTTGGCTTTCGGA0.124800.010100.698300.750000.989100.75000


Target Position: 1263, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263GUGUGUAACGGAAUAGGUA94.5622118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1261-1283AAGTGTGTAACGGAATAGGTATTUACCUAUUCCGUUACACACUUGUGUGUAACGGAAUAGGUAUUU18.520.433


Target Position: 4899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4899GCUGCUCUGAAAUCUCCUU79.55141407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7454917GCTGCTCTGAAATCTCCTTAAGGAGATTTCAGAGCAGC0.347900.017400.715501.000001.000001.00000


Target Position: 5355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5355GGUUAACAGCAGUCCUUUG80.71821273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9685373GGTTAACAGCAGTCCTTTGCAAAGGACTGCTGTTAACC0.255400.008100.706900.750000.967401.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593GCAUCUGCCUCACCUCCAC73.05772385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172611GCATCTGCCTCACCTCCACGTGGAGGTGAGGCAGATGC0.531400.076400.560300.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258GCAAAGUGUGUAACGGAAU80.34561317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421276GCAAAGTGTGTAACGGAATATTCCGTTACACACTTTGC0.228500.075900.844801.000001.000001.00000


Target Position: 5502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5502CUUUUAAAGUAAUUUUUGA87.0248543

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5500-5522TGCTTTTAAAGTAATTTTTGACTUCAAAAAUUACUUUAAAAGCACUUUUAAAGUAAUUUUUGACUU-3.3-9.101


Target Position: 5197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5197GGGUUUGAAAUUGAUAAUG68.77353145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7305215GGGTTTGAAATTGATAATGCATTATCAATTTCAAACCC0.222400.018300.836200.750001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639UGAUAAUUUCAGGAAACAA87.9248460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561657TGATAATTTCAGGAAACAATTGTTTCCTGAAATTATCA0.341100.037500.577600.750001.000001.00000


Target Position: 5683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5683ACAUAGUCCCUGAUUCUAA92.6351178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5495701ACATAGTCCCTGATTCTAATTAGAATCAGGGACTATGT0.180700.112900.672400.750001.000001.00000


Target Position: 5046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5046CCCCUCCUUACGCUUUGUC53.87845352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9565064CCCCTCCTTACGCTTTGTCGACAAAGCGTAAGGAGGGG0.080300.076900.672400.750001.000001.00000


Target Position: 1666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666GCUAUGCAAAUACAAUAAA88.8647385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131684GCTATGCAAATACAATAAATTTATTGTATTTGCATAGC0.537600.036000.853401.000001.000001.00000


Target Position: 4235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4235GCUAUUGAUUUUUACUUCA89.9742300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4233-4255TCGCTATTGATTTTTACTTCAATUGAAGUAAAAAUCAAUAGCGAGCUAUUGAUUUUUACUUCAAUU14.613.431


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901GCAUUGGAAUCAAUUUUAC76.31851884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322919GCATTGGAATCAATTTTACGTAAAATTGATTCCAATGC0.556300.059500.672400.750000.967400.75000


Target Position: 6105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6105ACACAACAUUUCUAAGAAU86.9951548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7426123ACACAACATTTCTAAGAATATTCTTAGAAATGTTGTGT0.282500.175100.698300.750001.000001.00000


Target Position: 6349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6349AGCUAAAAAAAAAAAAAAA84.8244767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6236367AGCTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAGCT0.990100.389100.853400.750001.000001.00000


Target Position: 6095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6095UGAGAAGACUACACAACAU88.1835438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8976113TGAGAAGACTACACAACATATGTTGTGTAGTCTTCTCA0.356000.061500.569000.750001.000001.00000


Target Position: 6096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6096GAGAAGACUACACAACAUU87.073539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6816114GAGAAGACTACACAACATTAATGTTGTGTAGTCTTCTC0.344500.065900.801700.750001.000001.00000


Target Position: 4695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4695GAGAGGAUGACACAUCAAA96.665157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8504713GAGAGGATGACACATCAAATTTGATGTGTCATCCTCTC0.470300.011700.810300.750000.945700.87500


Target Position: 3517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3517UCCCAGUGCCUGAAUACAU73.25012350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4383535TCCCAGTGCCTGAATACATATGTATTCAGGCACTGGGA0.245100.043800.715500.750000.956500.75000


Target Position: 5406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5406CCACCCCAUCCAAUUUAUC64.28813914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5085424CCACCCCATCCAATTTATCGATAAATTGGATGGGGTGG0.748300.229400.663800.750001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626AGUGAUGGAGAUGUGAUAA88.9383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931644AGTGATGGAGATGTGATAATTATCACATCTCCATCACT0.074500.014900.672400.750001.000001.00000


Target Position: 2845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845GUGCGGAAGAGAAAGAAUA88.7775395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7212863GTGCGGAAGAGAAAGAATATATTCTTTCTCTTCCGCAC0.482400.146400.750000.750001.000001.00000


Target Position: 5188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5188AUGAAACUAGGGUUUGAAA83.3073944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9545206ATGAAACTAGGGTTTGAAATTTCAAACCCTAGTTTCAT0.080800.025100.655200.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CCUUAGCAGUCUUAUCUAA97.852335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
932628CCTTAGCAGTCTTATCTAATTAGATAAGACTGCTAAGG0.131300.009200.810301.000001.000001.00000


Target Position: 1550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550GCAACAUGGUCAGUUUUCU80.97041238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1548-1570AAGCAACATGGTCAGTTTTCTCTAGAAAACUGACCAUGUUGCUUGCAACAUGGUCAGUUUUCUCUU13.318.132


Target Position: 5436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5436GGUUCAGAAAAUAUUUUCA93.992134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8785454GGTTCAGAAAATATTTTCATGAAAATATTTTCTGAACC0.094500.023700.629300.750000.983700.62500


Target Position: 3979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3979CCCGCAUUAGCUCUUAGAC67.53023373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6383997CCCGCATTAGCTCTTAGACGTCTAAGAGCTAATGCGGG0.167200.025100.672400.750000.929300.87500


Target Position: 4133, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4133CCUUUGAGCAGAAAUUUAU83.4705922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8944151CCTTTGAGCAGAAATTTATATAAATTTCTGCTCAAAGG0.160200.010300.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4131-4153TCCCTTTGAGCAGAAATTTATCTAUAAAUUUCUGCUCAAAGGGACCUUUGAGCAGAAAUUUAUCUU-9.716.622


Target Position: 4933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4933CCCCCCAAAAUUAGUUUGU60.14354549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8314951CCCCCCAAAATTAGTTTGTACAAACTAATTTTGGGGGG0.107400.101100.784500.750001.000001.00000


Target Position: 5665, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5665GAUACAAAGAUAAAUAAAA99.140826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5735683GATACAAAGATAAATAAAATTTTATTTATCTTTGTATC0.872100.292700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5663-5685AAGATACAAAGATAAATAAAACAUUUUAUUUAUCUUUGUAUCUUGAUACAAAGAUAAAUAAAACAU-9.76.9


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318CGAAUAUUAAACACUUCAA95.312993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451336CGAATATTAAACACTTCAATTGAAGTGTTTAATATTCG0.860500.820500.646601.000001.000001.00000


Target Position: 5731, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5731CUCAUAGAUGCUAACCUUA89.739312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4635749CTCATAGATGCTAACCTTATAAGGTTAGCATCTATGAG0.218900.087100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5729-5751GACTCATAGATGCTAACCTTAAAUAAGGUUAGCAUCUAUGAGUCCUCAUAGAUGCUAACCUUAAAU18.621.4


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900GGCAUUGGAAUCAAUUUUA89.4498335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472918GGCATTGGAATCAATTTTATAAAATTGATTCCAATGCC0.181200.058800.965501.000000.967400.87500


Target Position: 4236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4236CUAUUGAUUUUUACUUCAA92.3956189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4234-4256CGCTATTGATTTTTACTTCAATGUUGAAGUAAAAAUCAAUAGCGCUAUUGAUUUUUACUUCAAUGU20.38.731


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325GGGCUCUGGAGGAAAAGAA87.4762498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985343GGGCTCTGGAGGAAAAGAATTCTTTTCCTCCAGAGCCC0.339600.007700.819001.000001.000001.00000


Target Position: 5972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5972GGUCAGUCACCCUAAACAA99.180924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4015990GGTCAGTCACCCTAAACAATTGTTTAGGGTGACTGACC0.762000.050600.706901.000000.923900.75000


Target Position: 3054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3054CUCCCUCAGCCACCCAUAU72.64612459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3403072CTCCCTCAGCCACCCATATATATGGGTGGCTGAGGGAG0.300300.090800.767200.750001.000001.00000


Target Position: 460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460CCUAUGUGCAGAGGAAUUA83.0616965

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
458-480TACCTATGTGCAGAGGAATTATGUAAUUCCUCUGCACAUAGGUACCUAUGUGCAGAGGAAUUAUGU18.717.923


Target Position: 1440, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440CUGAAAACCGUAAAGGAAA83.5764905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781458CTGAAAACCGTAAAGGAAATTTCCTTTACGGTTTTCAG0.313900.007800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1438-1460TTCTGAAAACCGTAAAGGAAATCUUUCCUUUACGGUUUUCAGAACUGAAAACCGUAAAGGAAAUCU18.714.922


Target Position: 5664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5664AGAUACAAAGAUAAAUAAA93.7855140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2305682AGATACAAAGATAAATAAATTTATTTATCTTTGTATCT0.653100.277600.724100.750001.000001.00000


Target Position: 4596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4596GGUUUCCAGUCAUGAGCGU75.12682070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464614GGTTTCCAGTCATGAGCGTACGCTCATGACTGGAAACC0.391600.037700.577600.750001.000001.00000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553ACAUGGUCAGUUUUCUCUU77.72661673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711571ACATGGTCAGTTTTCTCTTAAGAGAAAACTGACCATGT0.220700.008000.569000.750001.000001.00000


Target Position: 6097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6097AGAAGACUACACAACAUUU89.8154309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2756115AGAAGACTACACAACATTTAAATGTTGTGTAGTCTTCT0.353000.090000.724100.750001.000001.00000


Target Position: 5368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5368CCUUUGUAAACAGUGUUUU72.14592559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5366-5388GTCCTTTGTAAACAGTGTTTTAAAAAACACUGUUUACAAAGGACCCUUUGUAAACAGUGUUUUAAU17.811.802


Target Position: 4228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4228CAUUGUCGCUAUUGAUUUU89.1897357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4226-4248TTCATTGTCGCTATTGATTTTTAAAAAUCAAUAGCGACAAUGAACAUUGUCGCUAUUGAUUUUUAU7.421.132


Target Position: 3572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3572GCAGAAUCCUGUCUAUCAC80.35391315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413590GCAGAATCCTGTCTATCACGTGATAGACAGGATTCTGC0.205900.015300.560300.750000.934800.62500


Target Position: 4068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068AGUUGCAUUCCUUUGUCUU77.11651754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9014086AGTTGCATTCCTTTGTCTTAAGACAAAGGAATGCAACT0.095100.014000.569000.750001.000001.00000


Target Position: 4191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4191GUGAGGAUUUUUAUUGAUU83.8205875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8574209GTGAGGATTTTTATTGATTAATCAATAAAAATCCTCAC0.099900.060800.784500.750001.000001.00000


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719UCGCAAAGGGCAUGAACUA77.7641665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832737TCGCAAAGGGCATGAACTATAGTTCATGCCCTTTGCGA0.213000.015100.620700.750001.000001.00000


Target Position: 6148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6148CCACUUUCAUUAUUCAUUC73.98912238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4216166CCACTTTCATTATTCATTCGAATGAATAATGAAAGTGG0.690300.544800.672400.750001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CCAUGCCUUUGAGAACCUA85.654675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421526CCATGCCTTTGAGAACCTATAGGTTCTCAAAGGCATGG0.165700.011900.672401.000001.000001.00000


Target Position: 2116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116GCCAUCCAAACUGCACCUA72.94462402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892134GCCATCCAAACTGCACCTATAGGTGCAGTTTGGATGGC0.612800.029100.827601.000001.000001.00000


Target Position: 4161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4161AGGUAUAUUUGAAAAAAAA94.7865110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254179AGGTATATTTGAAAAAAAATTTTTTTTCAAATATACCT0.825900.063300.844800.750001.000001.00000


Target Position: 5036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5036GCCCCCAAACCCCCUCCUU61.17294404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335054GCCCCCAAACCCCCTCCTTAAGGAGGGGGTTTGGGGGC0.895300.700400.862101.000001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CAUAAAUGCUACGAAUAUU89.5572328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491325CATAAATGCTACGAATATTAATATTCGTAGCATTTATG0.841400.252600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1305-1327TCCATAAATGCTACGAATATTAAAAUAUUCGUAGCAUUUAUGGACAUAAAUGCUACGAAUAUUAAU8.8-1.833


Target Position: 5947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5947ACUGCUAAAGUCCACAUAA88.5586418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5545965ACTGCTAAAGTCCACATAATTATGTGGACTTTAGCAGT0.179700.036900.672400.750000.983700.62500


Target Position: 5171, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5171GAAUUCAGGUAGUAAAUAU97.830437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6775189GAATTCAGGTAGTAAATATATATTTACTACCTGAATTC0.264200.036400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5169-5191TGGAATTCAGGTAGTAAATATGAAUAUUUACUACCUGAAUUCCAGAAUUCAGGUAGUAAAUAUGAU1.412.003


Target Position: 6343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6343AGCAAAAGCUAAAAAAAAA90.0339295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1986361AGCAAAAGCTAAAAAAAAATTTTTTTTTAGCTTTTGCT0.988700.165000.853400.750000.907600.62500


Target Position: 6100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6100AGACUACACAACAUUUCUA94.1583129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9596118AGACTACACAACATTTCTATAGAAATGTTGTGTAGTCT0.472700.157400.551700.750001.000001.00000


Target Position: 5709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5709ACAAUUUAGCAAAGGAAAU72.75742434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9615727ACAATTTAGCAAAGGAAATATTTCCTTTGCTAAATTGT0.100300.008300.698300.750001.000001.00000


Target Position: 5745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5745CCUUAAAACAACGUGACAA88.0952446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3235763CCTTAAAACAACGTGACAATTGTCACGTTGTTTTAAGG0.523900.384500.698301.000001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512GCCUUUGAGAACCUAGAAA87.0887536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2871530GCCTTTGAGAACCTAGAAATTTCTAGGTTCTCAAAGGC0.814400.084301.000001.000001.000001.00000


Target Position: 3063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3063CCACCCAUAUGUACCAUCG69.03553100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603081CCACCCATATGTACCATCGCGATGGTACATATGGGTGG0.115900.105500.551700.500000.994600.62500


Target Position: 5471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5471AGUCACACACACAUACAAA95.308594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7715489AGTCACACACACATACAAATTTGTATGTGTGTGTGACT0.179300.093900.706900.750001.000001.00000


Target Position: 3515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3515CCUCCCAGUGCCUGAAUAC68.53323190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5693533CCTCCCAGTGCCTGAATACGTATTCAGGCACTGGGAGG0.174500.031100.663800.750000.956501.00000


Target Position: 6173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6173GGACAUGCAGAAAUAUUUC78.33341591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8736191GGACATGCAGAAATATTTCGAAATATTTCTGCATGTCC0.094800.033100.698300.750001.000001.00000


Target Position: 5598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5598UCAUUUCCACUCUAUUAUG68.08693263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8875616TCATTTCCACTCTATTATGCATAATAGAGTGGAAATGA0.353400.232000.569000.500001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625CUAACUAUGAUGCAAAUAA92.4022188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643643CTAACTATGATGCAAATAATTATTTGCATCATAGTTAG0.230900.100500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
623-645ATCTAACTATGATGCAAATAAAAUUAUUUGCAUCAUAGUUAGAUCUAACUAUGAUGCAAAUAAAAU15.36.322


Target Position: 5039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5039CCCAAACCCCCUCCUUACG52.43945508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9735057CCCAAACCCCCTCCTTACGCGTAAGGAGGGGGTTTGGG0.225500.206600.715500.500001.000001.00000


Target Position: 1315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315CUACGAAUAUUAAACACUU89.4047340

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1313-1335TGCTACGAATATTAAACACTTCAAAGUGUUUAAUAUUCGUAGCACUACGAAUAUUAAACACUUCAU17.816.533


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663CCCGAGUAUCUCAACACUG72.49682482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643681CCCGAGTATCTCAACACTGCAGTGTTGAGATACTCGGG0.124800.029300.706900.750000.923900.62500


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620GAGAUAAGUGAUGGAGAUG76.61251837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411638GAGATAAGTGATGGAGATGCATCTCCATCACTTATCTC0.082500.028400.655200.500001.000001.00000


Target Position: 5597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5597UUCAUUUCCACUCUAUUAU65.47193728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9265615TTCATTTCCACTCTATTATATAATAGAGTGGAAATGAA0.443900.264500.629300.500001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444GGGAAUUUGGAAAUUACCU77.12941752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
950462GGGAATTTGGAAATTACCTAGGTAATTTCCAAATTCCC0.081600.013800.646600.750000.945700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
442-464TTGGGAATTTGGAAATTACCTATAGGUAAUUUCCAAAUUCCCAAGGGAAUUUGGAAAUUACCUAUU13.914.223


Target Position: 2963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963GACUGUUUGGGAGUUGAUG70.60982820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102981GACTGTTTGGGAGTTGATGCATCAACTCCCAAACAGTC0.126000.009800.663800.500001.000001.00000


Target Position: 3732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732CAGAAAGGCAGCCACCAAA88.6922403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053750CAGAAAGGCAGCCACCAAATTTGGTGGCTGCCTTTCTG0.745500.014100.784500.750000.907600.87500


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196GGCCCCCUGACUCCGUCCA66.8563483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824214GGCCCCCTGACTCCGTCCATGGACGGAGTCAGGGGGCC0.109200.013700.655200.750000.956500.62500


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534CCUCGAUGAAGCCUACGUG73.34682328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802552CCTCGATGAAGCCTACGTGCACGTAGGCTTCATCGAGG0.138300.037600.551700.750001.000001.00000


Target Position: 4393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4393CACUGCAAAACACUAAAGA82.6821996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9474411CACTGCAAAACACTAAAGATCTTTAGTGTTTTGCAGTG0.554100.131500.569000.500000.994600.62500


Target Position: 5582, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5582GAAAAUAAAACUAUAUUCA93.6936144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5580-5602ATGAAAATAAAACTATATTCATTUGAAUAUAGUUUUAUUUUCAUGAAAAUAAAACUAUAUUCAUUU3.5-9.701


Target Position: 2371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371GGAUCUUGAAGGAAACUGA95.0841101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2369-2391GAGGATCTTGAAGGAAACTGAATUCAGUUUCCUUCAAGAUCCUCGGAUCUUGAAGGAAACUGAAUU19.220.422


Target Position: 5496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5496CUUUUGCUUUUAAAGUAAU79.53041411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8765514CTTTTGCTTTTAAAGTAATATTACTTTAAAAGCAAAAG0.094600.019600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5494-5516TCCTTTTGCTTTTAAAGTAATTTAUUACUUUAAAAGCAAAAGGACUUUUGCUUUUAAAGUAAUUUU4.918.602


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CGAAAAUUCCUAUGCCUUA92.2409194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259614CGAAAATTCCTATGCCTTATAAGGCATAGGAATTTTCG0.352900.144900.758601.000001.000001.00000


Target Position: 5313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5313CCCACCUUUUUUCCUAAUC57.40684959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6695331CCCACCTTTTTTCCTAATCGATTAGGAAAAAAGGTGGG0.262700.022500.810300.750001.000001.00000


Target Position: 4986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4986CACUUCAAAAGCUUUUUAC68.89683125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9875004CACTTCAAAAGCTTTTTACGTAAAAAGCTTTTGAAGTG0.090700.095000.612100.500001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656GGAGCUGCCCAUGAGAAAU82.34991037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
666674GGAGCTGCCCATGAGAAATATTTCTCATGGGCAGCTCC0.175800.023400.862101.000001.000001.00000


Target Position: 4964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4964AGAUAGUUUUCUCCUUUUA90.0181298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6224982AGATAGTTTTCTCCTTTTATAAAAGGAGAAAACTATCT0.161900.038000.689700.750001.000001.00000


Target Position: 3863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863ACAAAGCAGUGAAUUUAUU78.2691599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643881ACAAAGCAGTGAATTTATTAATAAATTCACTGCTTTGT0.095800.021200.698300.750001.000001.00000


Target Position: 5654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5654UGGGUAUGAAAGAUACAAA89.2779350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6465672TGGGTATGAAAGATACAAATTTGTATCTTTCATACCCA0.273500.024800.844800.750001.000001.00000


Target Position: 5538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5538GCCCCUACAGCAUUGUUAA89.8498307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6185556GCCCCTACAGCATTGTTAATTAACAATGCTGTAGGGGC0.163200.109200.965501.000000.951100.62500


Target Position: 2902, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902CAUUGGAAUCAAUUUUACA95.492384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2900-2922GGCATTGGAATCAATTTTACACAUGUAAAAUUGAUUCCAAUGCCCAUUGGAAUCAAUUUUACACAU-0.320.123


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517UGAGAACCUAGAAAUCAUA88.3133433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151535TGAGAACCTAGAAATCATATATGATTTCTAGGTTCTCA0.327300.151200.681000.750001.000001.00000


Target Position: 6322, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6322GAAACAGUAACUUAAUAAA99.437219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6146340GAAACAGTAACTTAATAAATTTATTAAGTTACTGTTTC0.233300.130000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6320-6342TTGAAACAGTAACTTAATAAAAGUUUAUUAAGUUACUGUUUCAAGAAACAGUAACUUAAUAAAAGU-7.517.8


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433GGAUAUUCUGAAAACCGUA97.370344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551451GGATATTCTGAAAACCGTATACGGTTTTCAGAATATCC0.335600.042100.689701.000001.000001.00000


Target Position: 5167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5167UGUGGAAUUCAGGUAGUAA89.3172346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7935185TGTGGAATTCAGGTAGTAATTACTACCTGAATTCCACA0.256900.014600.672400.750001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459AGGUGAGAAAGUUAAAAUU83.4984918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392477AGGTGAGAAAGTTAAAATTAATTTTAACTTTCTCACCT0.250100.032800.836200.750001.000001.00000


Target Position: 5491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5491UGUUCCUUUUGCUUUUAAA82.8585982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8295509TGTTCCTTTTGCTTTTAAATTTAAAAGCAAAAGGAACA0.108300.036400.706900.750001.000001.00000


Target Position: 5363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5363GCAGUCCUUUGUAAACAGU77.66921681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9895381GCAGTCCTTTGTAAACAGTACTGTTTACAAAGGACTGC0.075200.021600.646600.750001.000001.00000


Target Position: 4499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4499UCCUGGGCAAAGAAGAAAC56.14265128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8364517TCCTGGGCAAAGAAGAAACGTTTCTTCTTTGCCCAGGA0.296300.231900.724100.500001.000001.00000


Target Position: 2382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2382GAAACUGAAUUCAAAAAGA93.3936157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2380-2402AGGAAACTGAATTCAAAAAGATCUCUUUUUGAAUUCAGUUUCCUGAAACUGAAUUCAAAAAGAUCU2.119.222


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624UCUAACUAUGAUGCAAAUA73.40222316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540642TCTAACTATGATGCAAATATATTTGCATCATAGTTAGA0.184000.090900.681000.750001.000001.00000


Target Position: 4694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4694AGAGAGGAUGACACAUCAA94.7211111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9764712AGAGAGGATGACACATCAATTGATGTGTCATCCTCTCT0.439000.007900.577600.750000.945700.75000


Target Position: 5051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5051CCUUACGCUUUGUCACACA86.4114612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6485069CCTTACGCTTTGTCACACATGTGTGACAAAGCGTAAGG0.544600.028000.637900.750001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204GACUCCGUCCAGUAUUGAU88.8657384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823222GACTCCGTCCAGTATTGATATCAATACTGGACGGAGTC0.109400.015100.637900.750000.978300.62500


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619GGAGAUAAGUGAUGGAGAU95.091100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751637GGAGATAAGTGATGGAGATATCTCCATCACTTATCTCC0.094700.028300.689701.000001.000001.00000


Target Position: 6139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6139GUCAGUUAACCACUUUCAU81.2011208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5226157GTCAGTTAACCACTTTCATATGAAAGTGGTTAACTGAC0.641000.155900.663800.750000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6137-6159TTGTCAGTTAACCACTTTCATTAAUGAAAGUGGUUAACUGACAAGUCAGUUAACCACUUUCAUUAU19.220.3


Target Position: 879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CAGAAACUGACCAAAAUCA89.9519303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
877-899GCCAGAAACTGACCAAAATCATCUGAUUUUGGUCAGUUUCUGGCCAGAAACUGACCAAAAUCAUCU7.417.712


Target Position: 2479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479CCGUCGCUAUCAAGGAAUU79.35531443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8592497CCGTCGCTATCAAGGAATTAATTCCTTGATAGCGACGG0.268300.011400.905201.000000.994600.62500


Target Position: 5730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5730ACUCAUAGAUGCUAACCUU87.465501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9075748ACTCATAGATGCTAACCTTAAGGTTAGCATCTATGAGT0.201600.075600.569000.750001.000001.00000


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066CCCAUAUGUACCAUCGAUG71.24532715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383084CCCATATGTACCATCGATGCATCGATGGTACATATGGG0.105600.049500.836200.750000.983700.62500


Target Position: 5541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5541CCUACAGCAUUGUUAAGAA98.74931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7125559CCTACAGCATTGTTAAGAATTCTTAACAATGCTGTAGG0.139700.083100.672401.000001.000001.00000


Target Position: 5607, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5607CUCUAUUAUGCUCUCAAAU81.67961123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4005625CTCTATTATGCTCTCAAATATTTGAGAGCATAATAGAG0.246800.179600.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5605-5627CACTCTATTATGCTCTCAAATACAUUUGAGAGCAUAAUAGAGUGCUCUAUUAUGCUCUCAAAUACU20.48.4


Target Position: 3758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3758GGACAACCCUGACUACCAG82.24041051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153776GGACAACCCTGACTACCAGCTGGTAGTCAGGGTTGTCC0.376300.026700.586200.750000.929300.62500


Target Position: 5452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5452UCAGCCUACAGUUAUGUUC57.4794944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9665470TCAGCCTACAGTTATGTTCGAACATAACTGTAGGCTGA0.164800.032600.551700.500001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CCAGAAACUGACCAAAAUC73.69622281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484896CCAGAAACTGACCAAAATCGATTTTGGTCAGTTTCTGG0.223200.061300.663800.750000.983700.62500


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377UGAAGGAAACUGAAUUCAA88.672408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472395TGAAGGAAACTGAATTCAATTGAATTCAGTTTCCTTCA0.162500.055500.577600.750001.000001.00000


Target Position: 4527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4527GGAAUUCUUCCUUAGACUU85.7118669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4525-4547ATGGAATTCTTCCTTAGACTTACAAGUCUAAGGAAGAAUUCCAUGGAAUUCUUCCUUAGACUUACU18.914.822


Target Position: 2804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2804GCAUGUCAAGAUCACAGAU91.1846237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352822GCATGTCAAGATCACAGATATCTGTGATCTTGACATGC0.084100.013700.672401.000000.994600.75000


Target Position: 4874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4874UAGAUCAGAAGACUACAAA82.42721027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9124892TAGATCAGAAGACTACAAATTTGTAGTCTTCTGATCTA0.196400.024500.672400.500000.972800.87500


Target Position: 6062, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6062GGAUUUUGAGCUAUCAUCU87.6722478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8336080GGATTTTGAGCTATCATCTAGATGATAGCTCAAAATCC0.107100.033100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6060-6082GGGGATTTTGAGCTATCATCTCTAGAUGAUAGCUCAAAAUCCCCGGAUUUUGAGCUAUCAUCUCUU17.47.4


Target Position: 2906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2906GGAAUCAAUUUUACACAGA89.3163347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462924GGAATCAATTTTACACAGATCTGTGTAAAATTGATTCC0.282500.118200.646600.750001.000001.00000


Target Position: 4776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776AGAAUGUGGAAUACCUAAG69.52163019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9464794AGAATGTGGAATACCTAAGCTTAGGTATTCCACATTCT0.081900.015200.586200.500000.956501.00000


Target Position: 6317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6317AGUUUGAAACAGUAACUUA96.674456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5806335AGTTTGAAACAGTAACTTATAAGTTACTGTTTCAAACT0.332600.029400.672400.750001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201GCUAUGAGAUGGAGGAAGA90.704257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301219GCTATGAGATGGAGGAAGATCTTCCTCCATCTCATAGC0.197200.058500.629300.750001.000001.00000


Target Position: 5605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5605CACUCUAUUAUGCUCUCAA96.391659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5625623CACTCTATTATGCTCTCAATTGAGAGCATAATAGAGTG0.310200.291800.646600.750001.000001.00000


Target Position: 4937, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4937CCAAAAUUAGUUUGUGUUA87.1841530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9624955CCAAAATTAGTTTGTGTTATAACACAAACTAATTTTGG0.079400.078500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4935-4957CCCCAAAATTAGTTTGTGTTACTUAACACAAACUAAUUUUGGGGCCAAAAUUAGUUUGUGUUACUU19.3-3.322


Target Position: 4104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4104ACAGAAACGCAUCCAGCAA83.5739907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454122ACAGAAACGCATCCAGCAATTGCTGGATGCGTTTCTGT0.114800.031000.560300.750000.929300.75000


Target Position: 4539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4539UAGACUUACUUUUGUAAAA85.2233716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9284557TAGACTTACTTTTGTAAAATTTTACAAAAGTAAGTCTA0.085700.025300.672400.500000.945700.62500


Target Position: 4160, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4160GAGGUAUAUUUGAAAAAAA101.4869

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4158-4180AAGAGGTATATTTGAAAAAAAAAUUUUUUUCAAAUAUACCUCUUGAGGUAUAUUUGAAAAAAAAAU0.719.822


Target Position: 3912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912CUAAAAAUCCAGACUCUUU85.5999683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7623930CTAAAAATCCAGACTCTTTAAAGAGTCTGGATTTTTAG0.241600.115300.672400.750001.000001.00000


Target Position: 5718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5718CAAAGGAAAUGGACUCAUA100.24517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7885736CAAAGGAAATGGACTCATATATGAGTCCATTTCCTTTG0.174200.098900.603400.750001.000001.00000


Target Position: 5696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5696UUCUAAGAAAUUCACAAUU65.97973638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9605714TTCTAAGAAATTCACAATTAATTGTGAATTTCTTAGAA0.277400.132600.663800.500001.000001.00000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721GCAAAGGGCAUGAACUACU78.23781602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162739GCAAAGGGCATGAACTACTAGTAGTTCATGCCCTTTGC0.222600.019200.646600.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583GAAAUAUGUACUACGAAAA95.915674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446601GAAATATGTACTACGAAAATTTTCGTAGTACATATTTC0.463500.397100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
581-603AGGAAATATGTACTACGAAAATTUUUUCGUAGUACAUAUUUCCUGAAAUAUGUACUACGAAAAUUU16.5-1.822


Target Position: 5737, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5737GAUGCUAACCUUAAAACAA97.70238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5735-5757TAGATGCTAACCTTAAAACAACGUUGUUUUAAGGUUAGCAUCUAGAUGCUAACCUUAAAACAACGU7.219.7


Target Position: 3575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3575GAAUCCUGUCUAUCACAAU92.116198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733593GAATCCTGTCTATCACAATATTGTGATAGACAGGATTC0.270800.030100.663800.750000.956500.62500


Target Position: 480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480GAUCUUUCCUUCUUAAAGA93.0496169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
478-500ATGATCTTTCCTTCTTAAAGACCUCUUUAAGAAGGAAAGAUCAUGAUCUUUCCUUCUUAAAGACCU1.314.822


Target Position: 6345, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345CAAAAGCUAAAAAAAAAAA86.3681616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6716363CAAAAGCTAAAAAAAAAAATTTTTTTTTTTAGCTTTTG0.986500.170000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6343-6365AGCAAAAGCTAAAAAAAAAAAAAUUUUUUUUUUUAGCUUUUGCUCAAAAGCUAAAAAAAAAAAAAU-11.317.01


Target Position: 3862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862CACAAAGCAGUGAAUUUAU86.4487610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083880CACAAAGCAGTGAATTTATATAAATTCACTGCTTTGTG0.165100.039000.750000.750000.940200.62500


Target Position: 5722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5722GGAAAUGGACUCAUAGAUG82.53411011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8115740GGAAATGGACTCATAGATGCATCTATGAGTCCATTTCC0.112700.040700.715500.750001.000001.00000


Target Position: 5733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5733CAUAGAUGCUAACCUUAAA99.959318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5285751CATAGATGCTAACCTTAAATTTAAGGTTAGCATCTATG0.387300.132500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5731-5753CTCATAGATGCTAACCTTAAAACUUUAAGGUUAGCAUCUAUGAGCAUAGAUGCUAACCUUAAAACU18.613.3


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880AGAAACUGACCAAAAUCAU79.44821426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877898AGAAACTGACCAAAATCATATGATTTTGGTCAGTTTCT0.246700.076500.569000.750000.956500.62500


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522GUCCUCAUUGCCCUCAACA78.29281597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975540GTCCTCATTGCCCTCAACATGTTGAGGGCAATGAGGAC0.162600.014200.612100.500000.978300.62500


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595ACGAAAAUUCCUAUGCCUU73.67242284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660613ACGAAAATTCCTATGCCTTAAGGCATAGGAATTTTCGT0.224700.140000.637900.750001.000001.00000


Target Position: 6149, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6149CACUUUCAUUAUUCAUUCA93.3927158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6147-6169ACCACTTTCATTATTCATTCACCUGAAUGAAUAAUGAAAGUGGUCACUUUCAUUAUUCAUUCACCU16.319.2


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582GCCUGAACAUAACAUCCUU89.1262364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911600GCCTGAACATAACATCCTTAAGGATGTTATGTTCAGGC0.117200.037400.862101.000000.983700.75000


Target Position: 4163, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4163GUAUAUUUGAAAAAAAAAA89.148361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3894181GTATATTTGAAAAAAAAAATTTTTTTTTTCAAATATAC0.832400.073500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4161-4183AGGTATATTTGAAAAAAAAAAAAUUUUUUUUUUCAAAUAUACCUGUAUAUUUGAAAAAAAAAAAAU-11.3-8.011


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492GGAAUUAAGAGAAGCAACA89.0286375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882510GGAATTAAGAGAAGCAACATGTTGCTTCTCTTAATTCC0.092600.030400.663800.750001.000001.00000


Target Position: 2843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843GGGUGCGGAAGAGAAAGAA85.4207699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2252861GGGTGCGGAAGAGAAAGAATTCTTTCTCTTCCGCACCC0.793500.113200.819001.000001.000001.00000


Target Position: 4045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045UCCACCUCGGGCACAUUUU58.32354824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5264063TCCACCTCGGGCACATTTTAAAATGTGCCCGAGGTGGA0.230300.082700.870700.750000.962000.87500


Target Position: 2381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381GGAAACUGAAUUCAAAAAG69.61763001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422399GGAAACTGAATTCAAAAAGCTTTTTGAATTCAGTTTCC0.157900.059900.732800.750001.000001.00000


Target Position: 3056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056CCCUCAGCCACCCAUAUGU71.60842647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183074CCCTCAGCCACCCATATGTACATATGGGTGGCTGAGGG0.237800.128600.784500.750000.994600.62500


Target Position: 4977, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4977CUUUUACUUCACUUCAAAA94.0059133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6584995CTTTTACTTCACTTCAAAATTTTGAAGTGAAGTAAAAG0.269200.209300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4975-4997TCCTTTTACTTCACTTCAAAAGCUUUUGAAGUGAAGUAAAAGGACUUUUACUUCACUUCAAAAGCU12.24.922


Target Position: 2969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2969UUGGGAGUUGAUGACCUUU64.46873892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962987TTGGGAGTTGATGACCTTTAAAGGTCATCAACTCCCAA0.170300.010200.646600.500001.000001.00000


Target Position: 5311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5311AGCCCACCUUUUUUCCUAA85.7213668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8625329AGCCCACCTTTTTTCCTAATTAGGAAAAAAGGTGGGCT0.272400.011200.819000.750001.000001.00000


Target Position: 5175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5175UCAGGUAGUAAAUAUGAAA87.3657512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6045193TCAGGTAGTAAATATGAAATTTCATATTTACTACCTGA0.165700.073900.724100.750001.000001.00000


Target Position: 5657, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5657GUAUGAAAGAUACAAAGAU89.9684302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5655-5677GGGTATGAAAGATACAAAGATAAAUCUUUGUAUCUUUCAUACCCGUAUGAAAGAUACAAAGAUAAU19.28.9


Target Position: 570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570CAGAUCAUCAGAGGAAAUA84.8785752

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
568-590TGCAGATCATCAGAGGAAATATGUAUUUCCUCUGAUGAUCUGCACAGAUCAUCAGAGGAAAUAUGU18.720.422


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042ACACCUGCCCCCCACUCAU70.98892751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931060ACACCTGCCCCCCACTCATATGAGTGGGGGGCAGGTGT0.545200.106600.551700.750001.000001.00000


Target Position: 6101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6101GACUACACAACAUUUCUAA94.6665115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2626119GACTACACAACATTTCTAATTAGAAATGTTGTGTAGTC0.420700.156500.784500.750001.000001.00000


Target Position: 6292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6292UAGCAUUAAAUUCUAGUAU74.93782093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7886310TAGCATTAAATTCTAGTATATACTAGAATTTAATGCTA0.262000.115200.629300.500001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150AUCAUCGAAUUCUCCAAAA77.80471663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673168ATCATCGAATTCTCCAAAATTTTGGAGAATTCGATGAT0.257100.011000.681000.500001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319GAAUAUUAAACACUUCAAA95.579881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251337GAATATTAAACACTTCAAATTTGAAGTGTTTAATATTC0.863000.830600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1317-1339ACGAATATTAAACACTTCAAAAAUUUGAAGUGUUUAAUAUUCGUGAAUAUUAAACACUUCAAAAAU19.2-8.021


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514CCGAAAGCCAACAAGGAAA82.61281002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592532CCGAAAGCCAACAAGGAAATTTCCTTGTTGGCTTTCGG0.115600.008300.913801.000000.989100.87500


Target Position: 4875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4875AGAUCAGAAGACUACAAAA100.74713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6554893AGATCAGAAGACTACAAAATTTTGTAGTCTTCTGATCT0.210400.024000.724100.750000.972800.75000


Target Position: 3988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3988GCUCUUAGACCCACAGACU83.7034892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5954006GCTCTTAGACCCACAGACTAGTCTGTGGGTCTAAGAGC0.409300.033400.646600.750001.000001.00000


Target Position: 6142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6142AGUUAACCACUUUCAUUAU85.2155717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4976160AGTTAACCACTTTCATTATATAATGAAAGTGGTTAACT0.659700.445800.663800.750001.000001.00000


Target Position: 4946, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4946GUUUGUGUUACUUAUGGAA90.613265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4944-4966TAGTTTGTGTTACTTATGGAAGAUUCCAUAAGUAACACAAACUAGUUUGUGUUACUUAUGGAAGAU21.219.322


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575GUCGUCAGCCUGAACAUAA89.9714301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7111593GTCGTCAGCCTGAACATAATTATGTTCAGGCTGACGAC0.140000.081400.784500.750001.000001.00000


Target Position: 877, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GCCAGAAACUGACCAAAAU86.5457600

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_787719GCCAGAAACTGACCAAAAT1/1/0/097.21EGFRNM_201283.1+NM_201284.1+NM_005228.3+NM_201282.11+1+1+1NANANA7:55219047,55220239..55219055,55220248(+)00EGFR(0.002)


Target Position: 2454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454CCAGAAGGUGAGAAAGUUA95.494383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522472CCAGAAGGTGAGAAAGTTATAACTTTCTCACCTTCTGG0.368000.031500.810301.000000.983700.75000


Target Position: 4934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4934CCCCCAAAAUUAGUUUGUG66.24463588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9084952CCCCCAAAATTAGTTTGTGCACAAACTAATTTTGGGGG0.088200.087800.698300.750001.000001.00000


Target Position: 3613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613CCAGCAGAGACCCACACUA89.6648317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173631CCAGCAGAGACCCACACTATAGTGTGGGTCTCTGCTGG0.499800.013500.672401.000000.923900.87500


Target Position: 6171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6171CAGGACAUGCAGAAAUAUU86.2425632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8206189CAGGACATGCAGAAATATTAATATTTCTGCATGTCCTG0.110600.028800.775900.750001.000001.00000


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898GGAUAGUAUGAGCCCUAAA98.865229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4243916GGATAGTATGAGCCCTAAATTTAGGGCTCATACTATCC0.562400.046100.870701.000000.962000.62500


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893CCAAGGGAGUUUGUGGAGA75.40812034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241911CCAAGGGAGTTTGTGGAGATCTCCACAAACTCCCTTGG0.239600.075700.620700.750001.000001.00000


Target Position: 616, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616CAGUCUUAUCUAACUAUGA94.484122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
614-636AGCAGTCTTATCTAACTATGATGUCAUAGUUAGAUAAGACUGCUCAGUCUUAUCUAACUAUGAUGU11.618.933


Target Position: 768, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GACUUUCUCAGCAACAUGU81.47961171

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
766-788GTGACTTTCTCAGCAACATGTCGACAUGUUGCUGAGAAAGUCACGACUUUCUCAGCAACAUGUCGU18.117.722


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329UCUGGAGGAAAAGAAAGUU67.32923409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861347TCTGGAGGAAAAGAAAGTTAACTTTCTTTTCCTCCAGA0.379500.057000.577600.750001.000001.00000


Target Position: 4699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4699GGAUGACACAUCAAAUAAU97.897834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1494717GGATGACACATCAAATAATATTATTTGATGTGTCATCC0.534600.357400.862101.000000.945700.62500


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574AGUCGUCAGCCUGAACAUA86.786572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171592AGTCGTCAGCCTGAACATATATGTTCAGGCTGACGACT0.137800.079400.663800.750001.000001.00000


Target Position: 6167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6167ACCUCAGGACAUGCAGAAA83.4042933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7496185ACCTCAGGACATGCAGAAATTTCTGCATGTCCTGAGGT0.128100.031700.853400.750001.000001.00000


Target Position: 4817, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4817CAAAAACGUAUCUCCUAAU86.789571

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3481719CAAAAACGTATCTCCTAAT1/1/0/097.75EGFRNM_005228.3+NM_201283.1+NM_201284.1+NM_201282.11+0+0+0NANANANA00EGFR(0.002)


Target Position: 4630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4630GUCUUCCAUUCCAUUGUUU77.40291720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5564648GTCTTCCATTCCATTGTTTAAACAATGGAATGGAAGAC0.332900.196000.819000.750001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432UGGAUAUUCUGAAAACCGU72.00172589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571450TGGATATTCTGAAAACCGTACGGTTTTCAGAATATCCA0.342700.010200.569000.500001.000001.00000


Target Position: 4537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4537CUUAGACUUACUUUUGUAA90.4973274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4535-4557TCCTTAGACTTACTTTTGTAAAAUUACAAAAGUAAGUCUAAGGACUUAGACUUACUUUUGUAAAAU7.218.933


Target Position: 5661, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5661GAAAGAUACAAAGAUAAAU88.9248381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6105679GAAAGATACAAAGATAAATATTTATCTTTGTATCTTTC0.619400.247100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5659-5681ATGAAAGATACAAAGATAAATAAAUUUAUCUUUGUAUCUUUCAUGAAAGAUACAAAGAUAAAUAAU6.96.9