siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai 248  
Biltr, Sidirect 423  
Biltr, Ernai, Rnaxs 79   1116   1302   1303   1304   1305   1307  
Biltr, Ernai, Rnaxs, Sidirect 1279   1280  
Biltr, Rnaxs 77   107   108   112   113   115   116   117   118   203   205   209   256   257   258   259   268   269   288   322  
323   324   325   326   378   434   436   437   443   478   480   481   484   485   531   532   533   535   536   537  
538   558   559   560   561   582   583   584   586   587   588   589   590   595   601   607   608   609   652   678  
696   697   698   699   700   706   709   710   740   741   742   825   826   832   833   834   835   836   843   844  
845   846   847   848   852   862   864   892   893   894   895   899   902   903   904   905   906   977   978   979  
984   985   986   1026   1027   1028   1029   1038   1039   1040   1044   1045   1046   1049   1050   1051   1074   1075   1076   1077  
1085   1104   1105   1106   1107   1108   1109   1110   1118   1124   1125   1148   1173   1174   1175   1176   1177   1178   1179   1180  
1181   1182   1183   1185   1187   1188   1189   1190   1191   1192   1193   1194   1195   1196   1197   1198   1199   1200   1201   1202  
1203   1204   1205   1206   1227   1233   1235   1236   1240   1242   1244   1245   1246   1277   1278   1282   1283   1288   1290   1298  
1299   1300   1301   1306   1308   1309   1310   1312   1314   1316   1317   1318  
Biltr, Rnaxs, Sidirect 262   1311   1313   1315  


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848CCUCCAGUCCCCCACCCUG62.495678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130866CCTCCAGTCCCCCACCCTGCAGGGTGGGGGACTGGAGG0.117500.039400.560300.750000.913000.62500


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201UGUGUGUGUGUGUGUGUGU72.8839334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701219TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.107100.085500.500000.500001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985CACUCUUCUUGCAGCUGUU86.992646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771003CACTCTTCTTGCAGCTGTTAACAGCTGCAAGAAGAGTG0.034400.019100.646600.750000.967400.62500


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892GGCCCCACCCUUCUCCCCU60.7777740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165910GGCCCCACCCTTCTCCCCTAGGGGAGAAGGGTGGGGCC0.294900.005000.655200.750000.983700.75000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046GCACCCGCUUCCUCCCGAC63.5241644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401064GCACCCGCTTCCTCCCGACGTCGGGAGGAAGCGGGTGC0.452800.246400.534500.750000.951100.62500


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697GCGAGGACUCCUACAAAGA86.478353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145715GCGAGGACTCCTACAAAGATCTTTGTAGGAGTCCTCGC0.485600.008500.698300.750000.989100.62500


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177GGGCUGGAGAUGGGUGUGU66.1459545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1091195GGGCTGGAGATGGGTGTGTACACACCCATCTCCAGCCC0.335300.030200.784500.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CCUGAACUUUUCCGUCUUC68.297485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71608CCTGAACTTTTCCGTCTTCGAAGACGGAAAAGTTCAGG0.310700.173800.672400.750000.967400.87500


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085CCCCUCCUCUUGCCUCCCU59.4845795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001103CCCCTCCTCTTGCCTCCCTAGGGAGGCAAGAGGAGGGG0.014100.014600.646600.750001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GAGGACUCCUACAAAGACA92.776812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138717GAGGACTCCTACAAAGACATGTCTTTGTAGGAGTCCTC0.349200.049900.603400.500001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197UGUGUGUGUGUGUGUGUGU72.8839332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1531215TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.148400.102800.500000.500001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437GAUGAAGGGUGACUACUAC83.793979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200455GATGAAGGGTGACTACTACGTAGTAGTCACCCTTCATC0.347700.002400.500000.500001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148CCUUGUGGCUGAGAACUGG66.3035539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971166CCTTGTGGCTGAGAACTGGCCAGTTCTCAGCCACAAGG0.672300.006700.500000.500001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533CAUGGACAUCAGCAAGAAG82.0903113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147551CATGGACATCAGCAAGAAGCTTCTTGCTGATGTCCATG0.180200.027500.517200.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977GGGGAUCCCACUCUUCUUG67.3172510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176995GGGGATCCCACTCTTCTTGCAAGAAGAGTGGGATCCCC0.069700.003200.844800.750000.934800.62500


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978GGGAUCCCACUCUUCUUGC61.4194717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190996GGGATCCCACTCTTCTTGCGCAAGAAGAGTGGGATCCC0.067900.003700.637900.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313CUCAAAAAAAAAAAAAAAA81.5223125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861331CTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAG0.994500.858500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1311-1333CACTCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGAGUGCUCAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117GCCGAACGCUAUGAGGACA82.9349101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171135GCCGAACGCTATGAGGACATGTCCTCATAGCGTTCGGC0.045300.005200.793100.750000.983700.75000


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325GGGAGAAGGUGGAGACUGA96.37646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158343GGGAGAAGGTGGAGACTGATCAGTCTCCACCTTCTCCC0.066700.037400.767200.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282UGUUUCCUCUCAAUAAAGU69.2555441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791300TGTTTCCTCTCAATAAAGTACTTTATTGAGAGGAAACA0.679600.003200.500000.500000.972800.62500


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GCCCCACCCUUCUCCCCUA82.0978112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112911GCCCCACCCTTCTCCCCTATAGGGGAGAAGGGTGGGGC0.183700.029100.827601.000001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CCCACCCUUCUCCCCUAGG46.20191171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175913CCCACCCTTCTCCCCTAGGCCTAGGGGAGAAGGGTGGG0.127500.006200.646600.500000.907600.62500


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194GUGUGUGUGUGUGUGUGUG75.3763252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1551212GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.157900.107200.500000.500001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040CUCUCCGCACCCGCUUCCU57.3829862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031058CTCTCCGCACCCGCTTCCTAGGAAGCGGGTGCGGAGAG0.327700.044800.465500.500000.962001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652CCAAGACCACUUUCGACGA81.8596120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128670CCAAGACCACTTTCGACGATCGTCGAAAGTGGTCTTGG0.153100.096500.551700.750001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312ACUCAAAAAAAAAAAAAAA81.9196116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641330ACTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAGT0.992500.832000.706900.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740GCGAGACAACCUGACACUG72.4998348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98758GCGAGACAACCTGACACTGCAGTGTCAGGTTGTCTCGC0.197800.046600.637900.750001.000001.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288CUCUCAAUAAAGUUCCCCU78.5456177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021306CTCTCAATAAAGTTCCCCTAGGGGAACTTTATTGAGAG0.573100.082800.465500.500001.000001.00000


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741CGAGACAACCUGACACUGU82.1163111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103759CGAGACAACCTGACACTGTACAGTGTCAGGTTGTCTCG0.196600.049800.586200.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GUGUGUGUGUGUGUGUGUG75.3763257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631222GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.097700.054500.500000.500001.000001.00000


Target Position: 1279, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279CCAUGUUUCCUCUCAAUAA97.66643

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2127919CCATGTTTCCTCTCAATAA1/1/0/091.46SFNNM_006142.31NANANA3:96844364..96844382(-)|1:27190911..27190929(+)00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841297CCATGTTTCCTCTCAATAATTATTGAGAGGAAACATGG0.083300.002500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1277-1299GACCATGTTTCCTCTCAATAAAGUUAUUGAGAGGAAACAUGGUCCCAUGUUUCCUCUCAAUAAAGU13.412.132


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710CAAAGACAGCACCCUCAUC75.4594248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204728CAAAGACAGCACCCTCATCGATGAGGGTGCTGTCTTTG0.211700.036600.465500.500000.951100.62500


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742GAGACAACCUGACACUGUG83.940977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149760GAGACAACCTGACACTGTGCACAGTGTCAGGTTGTCTC0.079000.041900.517200.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051CGCUUCCUCCCGACCCCAG59.5185794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041069CGCTTCCTCCCGACCCCAGCTGGGGTCGGGAGGAAGCG0.012400.012300.637900.750000.962000.62500


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173GCAGGGGCUGGAGAUGGGU63.9535626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941191GCAGGGGCTGGAGATGGGTACCCATCTCCAGCCCCTGC0.338300.002000.500000.750001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178GGCUGGAGAUGGGUGUGUG77.4029208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721196GGCTGGAGATGGGTGTGTGCACACACCCATCTCCAGCC0.351200.065400.706900.750001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259CCAGUAUUGAGCAGAAAAG74.1223293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137277CCAGTATTGAGCAGAAAAGCTTTTCTGCTCAATACTGG0.104600.025000.706900.750001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311CACUCAAAAAAAAAAAAAA91.549114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241329CACTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAGTG0.991200.658800.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1309-1331GACACTCAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUGAGUGUCCACUCAAAAAAAAAAAAAAAAU-11.319.200


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029CCCCACCCCUGCUCUCCGC47.21321153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601047CCCCACCCCTGCTCTCCGCGCGGAGAGCAGGGGTGGGG0.063200.037600.569000.500000.907600.75000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847CCCUCCAGUCCCCCACCCU61.4862712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105865CCCTCCAGTCCCCCACCCTAGGGTGGGGGACTGGAGGG0.159400.049100.646600.750000.978300.75000


Target Position: 852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852CAGUCCCCCACCCUGCCGA67.2654512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188870CAGTCCCCCACCCTGCCGATCGGCAGGGTGGGGGACTG0.076900.013800.491400.500000.972800.62500


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309GACACUCAAAAAAAAAAAA89.668728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221327GACACTCAAAAAAAAAAAATTTTTTTTTTTTGAGTGTC0.988800.593200.819000.750001.000001.00000


Target Position: 423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423GUCUUCUACCUGAAGAUGA83.313492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
421-443GGGTCTTCTACCTGAAGATGAAGUCAUCUUCAGGUAGAAGACCCGUCUUCUACCUGAAGAUGAAGU20.420.222


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984CCACUCUUCUUGCAGCUGU73.2274317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761002CCACTCTTCTTGCAGCTGTACAGCTGCAAGAAGAGTGG0.036300.024000.637900.750000.967400.62500


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108CCCCUGCUGCCUCUGAUCG56.1987900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781126CCCCTGCTGCCTCTGATCGCGATCAGAGGCAGCAGGGG0.034300.034400.698300.500001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834GCCCCGCCCUGCCCCCUCC44.3521205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159852GCCCCGCCCTGCCCCCTCCGGAGGGGGCAGGGCGGGGC0.271500.064400.629300.500001.000001.00000


Target Position: 113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113GCAGGCCGAACGCUAUGAG67.1808515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159131GCAGGCCGAACGCTATGAGCTCATAGCGTTCGGCCTGC0.196700.006300.543100.750000.940201.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CCGCCACCGCCCCGCCCUG48.57381127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124844CCGCCACCGCCCCGCCCTGCAGGGCGGGGCGGTGGCGG0.131300.033200.629300.750000.902200.75000


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118CUCUGAUCGUAGGAAUUGA86.906247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621136CTCTGATCGTAGGAATTGATCAATTCCTACGATCAGAG0.060600.007200.586200.500001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323CCGGGAGAAGGUGGAGACU67.6576502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159341CCGGGAGAAGGTGGAGACTAGTCTCCACCTTCTCCCGG0.064200.018200.706900.750001.000001.00000


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118CCGAACGCUAUGAGGACAU71.1065385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183136CCGAACGCTATGAGGACATATGTCCTCATAGCGTTCGG0.030300.003000.758601.000001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104CCUGCCCCUGCUGCCUCUG49.3731109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911122CCTGCCCCTGCTGCCTCTGCAGAGGCAGCAGGGGCAGG0.487100.002100.560300.750000.962000.87500


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CCCCCUCCAGUCCCCCACC44.96781196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203863CCCCCTCCAGTCCCCCACCGGTGGGGGACTGGAGGGGG0.395500.072700.637900.500000.983700.62500


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027GCCCCCACCCCUGCUCUCC44.50861204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041045GCCCCCACCCCTGCTCTCCGGAGAGCAGGGGTGGGGGC0.153700.113200.629300.500001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262GUAUUGAGCAGAAAAGCAA91.984313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136280GTATTGAGCAGAAAAGCAATTGCTTTTCTGCTCAATAC0.240400.037300.534500.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
260-282CAGTATTGAGCAGAAAAGCAACGUUGCUUUUCUGCUCAAUACUGGUAUUGAGCAGAAAAGCAACGU18.613.422


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443GGGUGACUACUACCGCUAC78.3396181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192461GGGTGACTACTACCGCTACGTAGCGGTAGTAGTCACCC0.021000.004100.810300.750000.951100.62500


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203CUCAGUAGCCUAUAAGAAC74.8832269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193221CTCAGTAGCCTATAAGAACGTTCTTATAGGCTACTGAG0.251800.007700.663800.500001.000001.00000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706CCUACAAAGACAGCACCCU71.1134384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167724CCTACAAAGACAGCACCCTAGGGTGCTGTCTTTGTAGG0.132200.090600.500000.750001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074AGGCUACUUCUCCCCUCCU69.425434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601092AGGCTACTTCTCCCCTCCTAGGAGGGGAGAAGTAGCCT0.973200.042600.500000.500000.940200.62500


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240AAGACCGAGAUUGAGGGAA69.4264433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031258AAGACCGAGATTGAGGGAATTCCCTCAATCTCGGTCTT0.012600.007100.465500.500000.989100.87500


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317AAAAAAAAAAAAAAAAAAA83.583583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691335AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.998400.989200.500000.500001.000001.00000


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189GGUGUGUGUGUGUGUGUGU84.042676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1031207GGTGTGTGTGTGTGTGTGTACACACACACACACACACC0.175600.147400.646600.750001.000001.00000


Target Position: 696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696AGCGAGGACUCCUACAAAG73.183320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173714AGCGAGGACTCCTACAAAGCTTTGTAGGAGTCCTCGCT0.479300.004500.715500.500000.951100.75000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378CUGGACAGCCACCUCAUCA83.188695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202396CTGGACAGCCACCTCATCATGATGAGGTGGCTGTCCAG0.154900.049200.560300.500000.967400.62500


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536GGACAUCAGCAAGAAGGAG75.4798247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161554GGACATCAGCAAGAAGGAGCTCCTTCTTGCTGATGTCC0.063000.022000.560300.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864CUGCCGAGAGGACUAGUAU82.998100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154882CTGCCGAGAGGACTAGTATATACTAGTCCTCTCGGCAG0.148600.007100.741400.750000.951100.75000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205UGUGUGUGUGUGUGUGUGU72.8839336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841223TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.135300.043600.500000.500001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077CUACUUCUCCCCUCCUCUU77.2097214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1351095CTACTTCTCCCCTCCTCTTAAGAGGAGGGGAGAAGTAG0.965700.960300.534500.750001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044CCGCACCCGCUUCCUCCCG42.90431233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951062CCGCACCCGCTTCCTCCCGCGGGAGGAAGCGGGTGCGG0.448400.066400.500000.500000.962000.75000


Target Position: 561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
561CCCACCAACCCCAUCCGCC49.89851096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186579CCCACCAACCCCATCCGCCGGCGGATGGGGTTGGTGGG0.334400.073600.491400.500000.945700.62500


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532CCAUGGACAUCAGCAAGAA93.314511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107550CCATGGACATCAGCAAGAATTCTTGCTGATGTCCATGG0.203100.032300.672401.000001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300UUCCCCUGUGACACUCAAA73.6019307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1681318TTCCCCTGTGACACTCAAATTTGAGTGTCACAGGGGAA0.453500.365500.672400.500001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308UGACACUCAAAAAAAAAAA77.6468200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391326TGACACTCAAAAAAAAAAATTTTTTTTTTTGAGTGTCA0.986100.458000.724100.750001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CCAGUGCAAGACCGAGAUU77.154218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501251CCAGTGCAAGACCGAGATTAATCTCGGTCTTGCACTGG0.422800.101700.836201.000000.913000.62500


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038UGCUCUCCGCACCCGCUUC53.7068988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441056TGCTCTCCGCACCCGCTTCGAAGCGGGTGCGGAGAGCA0.344000.034100.681000.500000.902200.62500


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106UGCCCCUGCUGCCUCUGAU68.8811458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911124TGCCCCTGCTGCCTCTGATATCAGAGGCAGCAGGGGCA0.519600.067000.672400.750000.962000.75000


Target Position: 248, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248GAGGGUGCUGUCCAGUAUU83.624581

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_724819GAGGGTGCTGTCCAGTATT1/1/0/088.67SFNNM_006142.31NANANA1:27189880..27189898(+)00SFN(0.002)&RNF216(0.007)


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906CCCCUAGGCGCUGUUCUUG59.3371804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197924CCCCTAGGCGCTGTTCTTGCAAGAACAGCGCCTAGGGG0.018100.001600.844800.750001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905UCCCCUAGGCGCUGUUCUU65.444569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189923TCCCCTAGGCGCTGTTCTTAAGAACAGCGCCTAGGGGA0.034100.002200.732800.750001.000001.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298AGUUCCCCUGUGACACUCA81.8502121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911316AGTTCCCCTGTGACACTCATGAGTGTCACAGGGGAACT0.412500.365900.482800.500001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301UCCCCUGUGACACUCAAAA73.4791312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661319TCCCCTGTGACACTCAAAATTTTGAGTGTCACAGGGGA0.594800.364400.870700.750001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257GUCCAGUAUUGAGCAGAAA87.644441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129275GTCCAGTATTGAGCAGAAATTTCTGCTCAATACTGGAC0.131300.015300.819000.750001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835CCCCGCCCUGCCCCCUCCA54.6506957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92853CCCCGCCCTGCCCCCTCCATGGAGGGGGCAGGGCGGGG0.279500.040000.646600.750001.000001.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700AGGACUCCUACAAAGACAG68.2563488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118718AGGACTCCTACAAAGACAGCTGTCTTTGTAGGAGTCCT0.283500.234100.560300.500001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203UGUGUGUGUGUGUGUGUGU72.8839335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991221TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.095900.067500.500000.500001.000001.00000


Target Position: 1305, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305CUGUGACACUCAAAAAAAA96.81155

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1130519CTGTGACACTCAAAAAAAA1/1/0/097.21SFNNM_006142.31NANANANA00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321323CTGTGACACTCAAAAAAAATTTTTTTTGAGTGTCACAG0.857300.398700.784500.750001.000001.00000


Target Position: 1116, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116GCCUCUGAUCGUAGGAAUU81.6039123

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8111619GCCTCTGATCGTAGGAATT1/1/0/088.67SFNNM_006142.31NANANA1:27190748..27190766(+)00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041134GCCTCTGATCGTAGGAATTAATTCCTACGATCAGAGGC0.060300.001000.991401.000000.940200.62500


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202GUGUGUGUGUGUGUGUGUG75.3763256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581220GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.098600.073700.500000.500001.000001.00000


Target Position: 1302, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302CCCCUGUGACACUCAAAAA91.015417

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3130219CCCCTGTGACACTCAAAAA1/1/0/091.46SFNNM_006142.31NANANANA00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
231320CCCCTGTGACACTCAAAAATTTTTGAGTGTCACAGGGG0.597800.365700.991401.000001.000001.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326GGAGAAGGUGGAGACUGAG77.5174205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188344GGAGAAGGTGGAGACTGAGCTCAGTCTCCACCTTCTCC0.027200.016400.560300.750001.000001.00000


Target Position: 1304, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304CCUGUGACACUCAAAAAAA93.398810

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10130419CCTGTGACACTCAAAAAAA1/1/0/088.67SFNNM_006142.31NANANANA00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181322CCTGTGACACTCAAAAAAATTTTTTTGAGTGTCACAGG0.831700.397300.844801.000001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904CUCCCCUAGGCGCUGUUCU61.6625708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181922CTCCCCTAGGCGCTGTTCTAGAACAGCGCCTAGGGGAG0.045100.003000.586200.500001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125CGUAGGAAUUGAGGAGUGU78.1365189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441143CGTAGGAATTGAGGAGTGTACACTCCTCAATTCCTACG0.086700.033700.569000.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CCGCUUCCUCCCGACCCCA67.2005514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1151068CCGCTTCCTCCCGACCCCATGGGGTCGGGAGGAAGCGG0.216500.037000.569000.750000.967400.75000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436AGAUGAAGGGUGACUACUA97.36314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199454AGATGAAGGGTGACTACTATAGTAGTCACCCTTCATCT0.150800.001400.551700.750001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306UGUGACACUCAAAAAAAAA82.6622103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411324TGTGACACTCAAAAAAAAATTTTTTTTTGAGTGTCACA0.972000.404900.706900.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026UGCCCCCACCCCUGCUCUC46.01471177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011044TGCCCCCACCCCTGCTCTCGAGAGCAGGGGTGGGGGCA0.155200.102800.543100.500001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322ACCGGGAGAAGGUGGAGAC59.5236793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188340ACCGGGAGAAGGTGGAGACGTCTCCACCTTCTCCCGGT0.073800.024200.534500.500000.962000.62500


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195UGUGUGUGUGUGUGUGUGU72.8839331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621213TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.175400.110700.500000.500001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246GAGAUUGAGGGAAAGCAUG72.5014346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961264GAGATTGAGGGAAAGCATGCATGCTTTCCCTCAATCTC0.016000.002000.655200.500001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862CCCUGCCGAGAGGACUAGU66.1002546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198880CCCTGCCGAGAGGACTAGTACTAGTCCTCTCGGCAGGG0.034200.001600.784500.750000.913000.62500


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107GGCAGAGCAGGCCGAACGC59.4102799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202125GGCAGAGCAGGCCGAACGCGCGTTCGGCCTGCTCTGCC0.013100.003200.577600.500000.902200.62500


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GACAUCAGCAAGAAGGAGA83.825578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164555GACATCAGCAAGAAGGAGATCTCCTTCTTGCTGATGTC0.057700.018200.594800.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979GGAUCCCACUCUUCUUGCA90.116823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164997GGATCCCACTCTTCTTGCATGCAAGAAGAGTGGGATCC0.078100.005100.517200.750001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310ACACUCAAAAAAAAAAAAA77.9866193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1051328ACACTCAAAAAAAAAAAAATTTTTTTTTTTTTGAGTGT0.990000.597400.706900.750001.000001.00000


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175AGGGGCUGGAGAUGGGUGU58.2249843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441193AGGGGCTGGAGATGGGTGTACACCCATCTCCAGCCCCT0.326900.008500.637900.500001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836CCCGCCCUGCCCCCUCCAG44.56551202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117854CCCGCCCTGCCCCCTCCAGCTGGAGGGGGCAGGGCGGG0.205400.024900.706900.750000.907600.62500


Target Position: 1307, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307GUGACACUCAAAAAAAAAA89.910125

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4130719GTGACACTCAAAAAAAAAA1/1/0/091.19SFNNM_006142.31NANANA4:81898783..81898801(-)|2:74138601..74138619(+)00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501325GTGACACTCAAAAAAAAAATTTTTTTTTTGAGTGTCAC0.979500.417500.793100.750001.000001.00000


Target Position: 1315, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315CAAAAAAAAAAAAAAAAAA86.775948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831333CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.997600.978300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1313-1335CTCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGAGCAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582GGCCUGGCCCUGAACUUUU76.4979229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152600GGCCTGGCCCTGAACTTTTAAAAGTTCAGGGCCAGGCC0.447500.007201.000001.000000.929300.62500


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588GCCCUGAACUUUUCCGUCU73.8723301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95606GCCCTGAACTTTTCCGTCTAGACGGAAAAGTTCAGGGC0.311100.121700.775900.750000.967400.62500


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531GCCAUGGACAUCAGCAAGA79.4643162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141549GCCATGGACATCAGCAAGATCTTGCTGATGTCCATGGC0.096600.038200.775900.750001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277GACCAUGUUUCCUCUCAAU90.331720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931295GACCATGTTTCCTCTCAATATTGAGAGGAAACATGGTC0.023700.002000.810300.750001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825CCCGCCACCGCCCCGCCCU45.08171191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111843CCCGCCACCGCCCCGCCCTAGGGCGGGGCGGTGGCGGG0.172400.029500.646600.750000.902200.87500


Target Position: 269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
269GCAGAAAAGCAACGAGGAG72.9779325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184287GCAGAAAAGCAACGAGGAGCTCCTCGTTGCTTTTCTGC0.029500.006900.543100.750000.994600.75000


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288GGCUCGGAGGAGAAGGGGC56.8689875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201306GGCTCGGAGGAGAAGGGGCGCCCCTTCTCCTCCGAGCC0.026600.001200.500000.500000.972800.75000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205CAGUAGCCUAUAAGAACGU75.9811238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147223CAGTAGCCTATAAGAACGTACGTTCTTATAGGCTACTG0.420200.009100.508600.500001.000001.00000


Target Position: 1303, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303CCCUGUGACACUCAAAAAA87.390944

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9130319CCCTGTGACACTCAAAAAA1/1/0/088.67SFNNM_006142.31NANANANA00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221321CCCTGTGACACTCAAAAAATTTTTTGAGTGTCACAGGG0.644500.380600.991401.000001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CGCACCCGCUUCCUCCCGA71.0118390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911063CGCACCCGCTTCCTCCCGATCGGGAGGAAGCGGGTGCG0.450500.116300.629300.750000.951100.62500


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485CGACAAGAAGCGCAUCAUU86.537952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182503CGACAAGAAGCGCATCATTAATGATGCGCTTCTTGTCG0.031200.014900.784501.000001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559CGCCCACCAACCCCAUCCG54.8032947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156577CGCCCACCAACCCCATCCGCGGATGGGGTTGGTGGGCG0.372400.034500.508600.500000.994600.62500


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109CCCUGCUGCCUCUGAUCGU69.9308426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871127CCCTGCTGCCTCTGATCGTACGATCAGAGGCAGCAGGG0.027500.020700.715500.750001.000001.00000


Target Position: 79, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79GAGCCAGUCUGAUCCAGAA102.0421

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_67919GAGCCAGTCTGATCCAGAA1/1/0/089.21SFNNM_006142.31NANANA1:27189711..27189729(+)00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
18797GAGCCAGTCTGATCCAGAATTCTGGATCAGACTGGCTC0.081700.002300.637900.750000.923900.62500


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124UCGUAGGAAUUGAGGAGUG63.0607660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871142TCGTAGGAATTGAGGAGTGCACTCCTCAATTCCTACGA0.081600.029600.500000.500001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480GGUGACGACAAGAAGCGCA85.291667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161498GGTGACGACAAGAAGCGCATGCGCTTCTTGTCGTCACC0.136500.009700.500000.750000.951100.62500


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028CCCCCACCCCUGCUCUCCG52.49071023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771046CCCCCACCCCTGCTCTCCGCGGAGAGCAGGGGTGGGGG0.057400.040300.577600.500001.000001.00000


Target Position: 1198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198GUGUGUGUGUGUGUGUGUG75.3763254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1591216GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.132500.093900.500000.500001.000001.00000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77GAGAGCCAGUCUGAUCCAG71.5749372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
20095GAGAGCCAGTCTGATCCAGCTGGATCAGACTGGCTCTC0.040000.001400.525900.500001.000001.00000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190GUGUGUGUGUGUGUGUGUG75.3763250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741208GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.159800.134100.500000.500001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608CCACUACGAGAUCGCCAAC69.2111442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154626CCACTACGAGATCGCCAACGTTGGCGATCTCGTAGTGG0.069900.009700.698300.750000.923901.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UGGCCCUGAACUUUUCCGU56.0533904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161604TGGCCCTGAACTTTTCCGTACGGAAAAGTTCAGGGCCA0.312000.119800.569000.500001.000001.00000


Target Position: 1180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180CUGGAGAUGGGUGUGUGUG63.5696643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871198CTGGAGATGGGTGTGTGTGCACACACACCCATCTCCAG0.345400.084700.491400.500001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185GAUGGGUGUGUGUGUGUGU83.457689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991203GATGGGTGTGTGTGTGTGTACACACACACACACCCATC0.231700.189000.474100.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CCCUGAACUUUUCCGUCUU77.1828216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73607CCCTGAACTTTTCCGTCTTAAGACGGAAAAGTTCAGGG0.308900.174800.853401.000000.967400.75000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583GCCUGGCCCUGAACUUUUC66.6047533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153601GCCTGGCCCTGAACTTTTCGAAAAGTTCAGGGCCAGGC0.540900.007200.827600.750001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258UCCAGUAUUGAGCAGAAAA81.1985136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127276TCCAGTATTGAGCAGAAAATTTTCTGCTCAATACTGGA0.125300.030800.870700.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601CCGUCUUCCACUACGAGAU79.028170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195619CCGTCTTCCACTACGAGATATCTCGTAGTGGAAGACGG0.016100.007900.732801.000000.940200.62500


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108GCAGAGCAGGCCGAACGCU70.0415423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190126GCAGAGCAGGCCGAACGCTAGCGTTCGGCCTGCTCTGC0.024500.002900.500000.750000.940200.75000


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183GAGAUGGGUGUGUGUGUGU80.1587154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461201GAGATGGGTGTGTGTGTGTACACACACACACCCATCTC0.303500.214900.603400.500001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235AGUGCAAGACCGAGAUUGA88.713433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941253AGTGCAAGACCGAGATTGATCAATCTCGGTCTTGCACT0.365800.008100.482800.500001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076GCUACUUCUCCCCUCCUCU77.2023215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951094GCTACTTCTCCCCTCCTCTAGAGGAGGGGAGAAGTAGC0.968300.960200.629300.750001.000001.00000


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316AAAAAAAAAAAAAAAAAAA83.583582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1681334AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.998100.985400.500000.500001.000001.00000


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299GUUCCCCUGUGACACUCAA86.307854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791317GTTCCCCTGTGACACTCAATTGAGTGTCACAGGGGAAC0.422300.366900.500000.750001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242GACCGAGAUUGAGGGAAAG72.8516337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991260GACCGAGATTGAGGGAAAGCTTTCCCTCAATCTCGGTC0.014200.003500.681000.500000.989100.75000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CCCGCUUCCUCCCGACCCC47.99651141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1521067CCCGCTTCCTCCCGACCCCGGGGTCGGGAGGAAGCGGG0.129800.061100.500000.500000.951100.62500


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GGCCCUGAACUUUUCCGUC67.8129499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72605GGCCCTGAACTTTTCCGTCGACGGAAAAGTTCAGGGCC0.309100.122400.681000.750001.000001.00000


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174CAGGGGCUGGAGAUGGGUG65.6071565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921192CAGGGGCTGGAGATGGGTGCACCCATCTCCAGCCCCTG0.330500.003600.491400.500001.000001.00000


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209AGCCUAUAAGAACGUGGUG64.1452617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198227AGCCTATAAGAACGTGGTGCACCACGTTCTTATAGGCT0.014400.012300.560300.500001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902UUCUCCCCUAGGCGCUGUU52.16291034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170920TTCTCCCCTAGGCGCTGTTAACAGCGCCTAGGGGAGAA0.056500.003700.525900.500000.994600.87500


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115AGGCCGAACGCUAUGAGGA76.9554221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197133AGGCCGAACGCTATGAGGATCCTCATAGCGTTCGGCCT0.214600.013200.474100.500000.940200.75000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182GGAGAUGGGUGUGUGUGUG76.2008235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1071200GGAGATGGGTGTGTGTGTGCACACACACACCCATCTCC0.353200.235400.577600.750001.000001.00000


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227CGCGCGCCAGUGCAAGACC58.7972825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961245CGCGCGCCAGTGCAAGACCGGTCTTGCACTGGCGCGCG0.137800.001800.569000.500000.907600.62500


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609CACUACGAGAUCGCCAACA76.615227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163627CACTACGAGATCGCCAACATGTTGGCGATCTCGTAGTG0.102300.009900.586200.500000.923901.00000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256UGUCCAGUAUUGAGCAGAA91.248216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142274TGTCCAGTATTGAGCAGAATTCTGCTCAATACTGGACA0.114300.009600.534500.750001.000001.00000


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193UGUGUGUGUGUGUGUGUGU72.8839330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1541211TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.174300.116000.500000.500001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CCGCCCACCAACCCCAUCC46.70951167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154576CCGCCCACCAACCCCATCCGGATGGGGTTGGTGGGCGG0.414700.040600.543100.500000.994600.75000


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244CCGAGAUUGAGGGAAAGCA79.664159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971262CCGAGATTGAGGGAAAGCATGCTTTCCCTCAATCTCGG0.014700.002200.560300.750001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191UGUGUGUGUGUGUGUGUGU72.8839329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1511209TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.165300.129300.500000.500001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UGCCCCCUCCAGUCCCCCA60.4134760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148861TGCCCCCTCCAGTCCCCCATGGGGGACTGGAGGGGGCA0.114700.093400.508600.500001.000001.00000


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268AGCAGAAAAGCAACGAGGA78.6691176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195286AGCAGAAAAGCAACGAGGATCCTCGTTGCTTTTCTGCT0.392600.071600.482800.500000.929300.75000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CCUGGCCCUGAACUUUUCC52.60951019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196602CCTGGCCCTGAACTTTTCCGGAAAAGTTCAGGGCCAGG0.437200.006800.474100.500001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105CUGCCCCUGCUGCCUCUGA69.3163438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571123CTGCCCCTGCTGCCTCTGATCAGAGGCAGCAGGGGCAG0.474100.076800.560300.500000.962000.75000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278ACCAUGUUUCCUCUCAAUA80.343148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861296ACCATGTTTCCTCTCAATATATTGAGAGGAAACATGGT0.050200.002300.810300.750001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187UGGGUGUGUGUGUGUGUGU70.0057424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1191205TGGGTGTGTGTGTGTGTGTACACACACACACACACCCA0.199700.163800.637900.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678GCUGAUCUGCACACCCUCA89.80827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181696GCTGATCTGCACACCCTCATGAGGGTGTGCAGATCAGC0.034000.003700.629300.750000.978300.87500


Target Position: 324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
324CGGGAGAAGGUGGAGACUG66.1742544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156342CGGGAGAAGGTGGAGACTGCAGTCTCCACCTTCTCCCG0.069000.015300.629300.750001.000001.00000


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039GCUCUCCGCACCCGCUUCC49.69991103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931057GCTCTCCGCACCCGCTTCCGGAAGCGGGTGCGGAGAGC0.342200.036200.482800.500000.962001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196GUGUGUGUGUGUGUGUGUG75.3763253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651214GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.155400.101200.500000.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903UCUCCCCUAGGCGCUGUUC43.70241219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175921TCTCCCCTAGGCGCTGTTCGAACAGCGCCTAGGGGAGA0.048000.003300.551700.500000.994600.75000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478CCGGUGACGACAAGAAGCG59.0788815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202496CCGGTGACGACAAGAAGCGCGCTTCTTGTCGTCACCGG0.105700.001200.491400.500001.000001.00000


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116GGCCGAACGCUAUGAGGAC72.9709326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179134GGCCGAACGCTATGAGGACGTCCTCATAGCGTTCGGCC0.071200.003100.681000.750000.940200.75000


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484ACGACAAGAAGCGCAUCAU74.811272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143502ACGACAAGAAGCGCATCATATGATGCGCTTCTTGTCGT0.095200.046400.620700.750000.967400.62500


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188GGGUGUGUGUGUGUGUGUG78.956173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931206GGGTGTGTGTGTGTGTGTGCACACACACACACACACCC0.181300.152000.698300.750001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535UGGACAUCAGCAAGAAGGA76.7742224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200553TGGACATCAGCAAGAAGGATCCTTCTTGCTGATGTCCA0.165500.028600.474100.500001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846CCCCUCCAGUCCCCCACCC41.9821242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164864CCCCTCCAGTCCCCCACCCGGGTGGGGGACTGGAGGGG0.147600.060400.500000.500000.978300.62500


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GCCCACCAACCCCAUCCGC46.99681162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134578GCCCACCAACCCCATCCGCGCGGATGGGGTTGGTGGGC0.367500.037200.577600.500000.951100.62500


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112AGCAGGCCGAACGCUAUGA68.7998461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161130AGCAGGCCGAACGCTATGATCATAGCGTTCGGCCTGCT0.219500.005400.629300.500000.940201.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698CGAGGACUCCUACAAAGAC78.9352174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198716CGAGGACTCCTACAAAGACGTCTTTGTAGGAGTCCTCG0.492100.022400.474100.750000.994600.62500


Target Position: 1280, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280CAUGUUUCCUCUCAAUAAA94.49558

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5128019CATGTTTCCTCTCAATAAA1/1/0/090.92SFNNM_006142.31NANANA3:96844363..96844381(-)00SFN(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831298CATGTTTCCTCTCAATAAATTTATTGAGAGGAAACATG0.107200.002500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1278-1300ACCATGTTTCCTCTCAATAAAGTUUUAUUGAGAGGAAACAUGGUCAUGUUUCCUCUCAAUAAAGUU8.914.822


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206GUGUGUGUGUGUGUGUGUG75.3763258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751224GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.039600.025900.500000.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314UCAAAAAAAAAAAAAAAAA74.8393271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1011332TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.996700.970900.724100.750001.000001.00000


Target Position: 1290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290CUCAAUAAAGUUCCCCUGU66.074548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821308CTCAATAAAGTTCCCCTGTACAGGGGAACTTTATTGAG0.495000.469200.603400.500001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CCGCCCCGCCCUGCCCCCU41.67151245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111850CCGCCCCGCCCTGCCCCCTAGGGGGCAGGGCGGGGCGG0.155700.043100.569000.750000.951100.75000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107GCCCCUGCUGCCUCUGAUC63.6814634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1071125GCCCCTGCTGCCTCTGATCGATCAGAGGCAGCAGGGGC0.537100.052900.819000.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538ACAUCAGCAAGAAGGAGAU79.1699167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167556ACATCAGCAAGAAGGAGATATCTCCTTCTTGCTGATGT0.051100.014700.525900.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CGCCCCGCCCUGCCCCCUC42.52341234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99851CGCCCCGCCCTGCCCCCTCGAGGGGGCAGGGCGGGGCG0.168700.067700.612100.750000.951100.75000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245CGAGAUUGAGGGAAAGCAU87.021645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951263CGAGATTGAGGGAAAGCATATGCTTTCCCTCAATCTCG0.018200.002000.637901.000001.000001.00000


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UCCACUACGAGAUCGCCAA74.1422292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173625TCCACTACGAGATCGCCAATTGGCGATCTCGTAGTGGA0.043500.009900.724100.750000.923900.87500


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595ACUUUUCCGUCUUCCACUA81.6134122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137613ACTTTTCCGTCTTCCACTATAGTGGAAGACGGAAAAGT0.379500.219000.534500.750001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176GGGGCUGGAGAUGGGUGUG62.8675664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221194GGGGCTGGAGATGGGTGTGCACACCCATCTCCAGCCCC0.323300.021900.698300.750001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986ACUCUUCUUGCAGCUGUUG57.3804863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011004ACTCTTCTTGCAGCTGTTGCAACAGCTGCAAGAAGAGT0.013500.008300.560300.500000.978300.62500


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCCCCCUCCAGUCCCCCAC46.71171166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73862GCCCCCTCCAGTCCCCCACGTGGGGGACTGGAGGGGGC0.383000.085300.706900.750001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709ACAAAGACAGCACCCUCAU73.3054316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130727ACAAAGACAGCACCCTCATATGAGGGTGCTGTCTTTGT0.163600.046500.551700.750000.967400.62500


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434GAAGAUGAAGGGUGACUAC80.35147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203452GAAGATGAAGGGTGACTACGTAGTCACCCTTCATCTTC0.085100.001200.491400.500001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075GGCUACUUCUCCCCUCCUC66.2773540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1001093GGCTACTTCTCCCCTCCTCGAGGAGGGGAGAAGTAGCC0.973000.960000.689700.750001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110CCUGCUGCCUCUGAUCGUA86.077955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861128CCTGCTGCCTCTGATCGTATACGATCAGAGGCAGCAGG0.028300.008100.663801.000001.000001.00000


Target Position: 1200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1200GUGUGUGUGUGUGUGUGUG75.3763255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891218GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.113000.086000.500000.500001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199UGUGUGUGUGUGUGUGUGU72.8839333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801217TGTGTGTGTGTGTGTGTGTACACACACACACACACACA0.124900.094100.500000.500001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283GUUUCCUCUCAAUAAAGUU81.4063127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771301GTTTCCTCTCAATAAAGTTAACTTTATTGAGAGGAAAC0.662800.004900.500000.750000.972800.75000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CCCCACCCUUCUCCCCUAG54.3898968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162912CCCCACCCTTCTCCCCTAGCTAGGGGAGAAGGGTGGGG0.122300.005200.819000.750001.000001.00000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192GUGUGUGUGUGUGUGUGUG75.3763251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711210GTGTGTGTGTGTGTGTGTGCACACACACACACACACAC0.153300.118500.500000.500001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318AAAAAAAAAAAAAAAAAAA83.583584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1561336AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.998700.991500.500000.500001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179GCUGGAGAUGGGUGUGUGU80.205150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041197GCTGGAGATGGGTGTGTGTACACACACCCATCTCCAGC0.332600.073700.646600.750001.000001.00000


Target Position: 481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
481GUGACGACAAGAAGCGCAU77.2824212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123499GTGACGACAAGAAGCGCATATGCGCTTCTTGTCGTCAC0.161900.021000.637900.750000.951100.62500


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181UGGAGAUGGGUGUGUGUGU70.9654392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811199TGGAGATGGGTGTGTGTGTACACACACACCCATCTCCA0.366300.240400.637900.500001.000001.00000


Target Position: 1236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236GUGCAAGACCGAGAUUGAG71.613370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921254GTGCAAGACCGAGATTGAGCTCAATCTCGGTCTTGCAC0.047200.004400.482800.500001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899CCCUUCUCCCCUAGGCGCU57.8866850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190917CCCTTCTCCCCTAGGCGCTAGCGCCTAGGGGAGAAGGG0.028800.002100.637900.750000.902200.62500