siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Sidirect 1157   1555  
Biltr, Ernai 601   852   1514   4782   4810   5879  
Biltr, Sidirect 578   581   622   629   631   654   656   665   721   748   784   795   805   809   814   855   858   883   893   895  
919   928   1145   1147   1166   1180   1191   1253   1292   1349   1382   1446   1448   1483   1554   1619   1678   1733   1773   1818  
1830   1840   2029   2113   2311   2312   2366   2380   2392   2404   2407   2426   2432   2442   2463   2468   2474   2567   2569   2573  
2595   2636   2637   2639   2644   2679   2682   2773   2782   2784   2787   2798   2799   2852   2856   2860   2914   2915   2918   2926  
2929   2934   3222   3223   3269   3270   3272   3302   3304   3310   3312   3313   3323   3350   3351   3353   3360   3363   3367   3372  
3376   3391   3392   3400   3404   3429   3433   3466   3467   3493   3497   3507   3539   3548   3550   3653   3660   3662   3670   3674  
3683   3685   3713   3717   3745   3754   3756   3795   3798   3803   3807   3841   3849   3851   3875   3887   3906   3913   3914   3916  
3920   3922   3925   4289   4312   4315   4324   4353   4357   4358   4363   4367   4373   4395   4404   4414   4444   4467   4478   4488  
4490   4662   4685   4751   4819   4821   4823   4829   4835   4863   4864   4874   4880   4891   4913   4921   4985   4995   5024   5033  
5068   5069   5091   5094   5095   5137   5142   5159   5218   5235   5302   5304   5305   5310   5316   5343   5391   5410   5452   5454  
5455   5461   5497   5509   5591   5593   5614   5670   5708   5777   5780   5802   5849   5850   5851   5858   5870   5893   5903   5927  
5932   5936   5937   5949   6044   6046   6054   6165   6175   6180   6241   6242   6253   6258   6262   6267   6284   6289   6297   6300  
6347   6348   6353   6361   6457   6488   6516   6554   6588   6602   6611   6628   6660   6661   6663   6667   6669   6693   6694   6775  
6783   6796   6844   6849   6868   6870   6871   6878   6892   6898   6904   6906   6938   6940   6942   6977   7016   7017   7020   7044  
7059   7067   7070   7072   7103  
Biltr, Rnaxs, Sidirect 607   747   909   1839   2354   2357   2361   2395   2402   2441   2454   2593   2669   2670   2671   3370   3397   3406   3432   3578  
3800   3839   4421   4477   4486   4686   4897   4899   5140   5595   5791   5880   5881   5883   6251   6357   6515   6614   6616   6696  
6787   6788   6883   6891   6897   6953   7105   7106   7111  
Biltr, Rnaxs 497   504   505   509   515   516   517   522   523   559   560   565   566   567   568   653   655   659   662   668  
740   741   744   753   914   915   916   917   1134   1228   1229   1485   1837   1838   1843   1992   2058   2089   2181   2182  
2183   2184   2347   2350   2351   2352   2353   2355   2356   2401   2403   2440   2500   2503   2514   2529   2535   2536   2558   2561  
2562   2564   2566   3000   3059   3369   3396   3425   3426   3427   3428   3431   3527   3577   3956   3973   3978   4054   4157   4338  
4343   4347   4348   4351   4352   4420   4612   4834   4854   4855   4858   4869   4872   4873   4876   4890   4894   4898   4938   4940  
4943   5130   5131   5132   5135   5136   5139   5158   5198   5204   5209   5210   5211   5212   5256   5544   5545   5594   5733   5734  
5758   5759   5762   5790   5882   6149   6150   6152   6153   6154   6155   6249   6250   6355   6356   6395   6397   6507   6513   6514  
6561   6609   6610   6613   6615   6638   6759   6760   6761   6762   6763   6765   6774   6782   6786   6877   6890   6896   6911   6929  
6930   6931   6981   6982   6989   7001   7100   7101   7102   7104   7110  
Biltr, Ernai, Rnaxs 2560   2563  


Target Position: 6977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6977GAAAAGUAUGCUCAAUGUU84.91481058

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6975-6997GTGAAAAGTATGCTCAATGTTTTAACAUUGAGCAUACUUUUCACGAAAAGUAUGCUCAAUGUUUUU20.54.923


Target Position: 909, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909CCUAACACCCCAACAUAAA84.75931075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601927CCTAACACCCCAACATAAATTTATGTTGGGGTGTTAGG0.847300.091100.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
907-929AACCTAACACCCCAACATAAAGAUUUAUGUUGGGGUGUUAGGUUCCUAACACCCCAACAUAAAGAU6.919.033


Target Position: 7070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7070CUGUAAUUUGCAUUAAAUA92.8729280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7068-7090TACTGTAATTTGCATTAAATAAAUAUUUAAUGCAAAUUACAGUACUGUAAUUUGCAUUAAAUAAAU-10.36.921


Target Position: 7111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7111GAAAUUAAAAAAAAAAAAA89.2234570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7297129GAAATTAAAAAAAAAAAAATTTTTTTTTTTTTAATTTC0.984300.862000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7109-7131ATGAAATTAAAAAAAAAAAAAAAUUUUUUUUUUUUUAAUUUCAUGAAAUUAAAAAAAAAAAAAAAU-11.3-9.700


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CCCAAGUCCUAAAUCAUCU78.71952076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345758CCCAAGTCCTAAATCATCTAGATGATTTAGGACTTGGG0.506100.440200.767200.750001.000001.00000


Target Position: 5858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5858GAAAGAAAAAUAGAAUGUU84.5891093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5856-5878TTGAAAGAAAAATAGAATGTTTTAACAUUCUAUUUUUCUUUCAAGAAAGAAAAAUAGAAUGUUUUU19.25.512


Target Position: 3269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GGACAUUGUAGUUAAAUAA101.74220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3267-3289GAGGACATTGTAGTTAAATAATGUUAUUUAACUACAAUGUCCUCGGACAUUGUAGUUAAAUAAUGU-7.520.532


Target Position: 2639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2639CAAAAGAAGAAAACCUUUU77.73992264

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2637-2659CACAAAAGAAGAAAACCTTTTTCAAAAGGUUUUCUUCUUUUGUGCAAAAGAAGAAAACCUUUUUCU17.35.521


Target Position: 6253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6253GUUUUCUUUCUUUUCAACU71.86153414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6251-6273GGGTTTTCTTTCTTTTCAACTGAAGUUGAAAAGAAAGAAAACCCGUUUUCUUUCUUUUCAACUGAU14.95.522


Target Position: 5881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5881CUCAAAGUAGUCCAUAUAA91.7727361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6265899CTCAAAGTAGTCCATATAATTATATGGACTACTTTGAG0.649600.087200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5879-5901GCCTCAAAGTAGTCCATATAAAAUUAUAUGGACUACUUUGAGGCCUCAAAGUAGUCCAUAUAAAAU14.019.223


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GCCGCUUCCCUUCUUCAUU73.05013157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
541584GCCGCTTCCCTTCTTCATTAATGAAGAAGGGAAGCGGC0.347300.132400.991401.000001.000001.00000


Target Position: 6878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6878GUCUUGAUAUAAAGGAAAA93.0603267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6876-6898CTGTCTTGATATAAAGGAAAAGCUUUUCCUUUAUAUCAAGACAGGUCUUGAUAUAAAGGAAAAGCU18.720.422


Target Position: 916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916CCCCAACAUAAAGACAAAA82.72091394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223934CCCCAACATAAAGACAAAATTTTGTCTTTATGTTGGGG0.831200.244300.991401.000001.000001.00000


Target Position: 6357, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6357GUAUGCUUUACAAUAAAAU82.57861416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7386375GTATGCTTTACAATAAAATATTTTATTGTAAAGCATAC0.379000.094100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6355-6377AGGTATGCTTTACAATAAAATCTAUUUUAUUGUAAAGCAUACCUGUAUGCUUUACAAUAAAAUCUU-9.719.732


Target Position: 1180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180CAUUUGGUGUGGUAUAUCA97.000394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1178-1200ATCATTTGGTGTGGTATATCAAGUGAUAUACCACACCAAAUGAUCAUUUGGUGUGGUAUAUCAAGU11.218.833


Target Position: 6457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6457CCUUUGAGAGGCUUUGAAA91.0097418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6455-6477TACCTTTGAGAGGCTTTGAAAGTUUUCAAAGCCUCUCAAAGGUACCUUUGAGAGGCUUUGAAAGUU12.216.612


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914CACCCCAACAUAAAGACAA85.22441024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940932CACCCCAACATAAAGACAATTGTCTTTATGTTGGGGTG0.848000.189900.646600.750001.000001.00000


Target Position: 3550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550GUGUAUAUAUGUUAUAUAU100.04835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3548-3570GTGTGTATATATGTTATATATACAUAUAUAACAUAUAUACACACGUGUAUAUAUGUUAUAUAUACU-5.98.211


Target Position: 6929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6929UGCCUCUGUGACUGAUUUU71.20573553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8146947TGCCTCTGTGACTGATTTTAAAATCAGTCACAGAGGCA0.360200.196400.853400.750000.929300.62500


Target Position: 4829, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4829CUUUUUGUAUAUAAUAAUA96.3409111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4827-4849ATCTTTTTGTATATAATAATAATUAUUAUUAUAUACAAAAAGAUCUUUUUGUAUAUAAUAAUAAUU-8.05.621


Target Position: 3685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3685GUAUCAGUGAACGAUGUUA91.8705349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3683-3705GTGTATCAGTGAACGATGTTAAGUAACAUCGUUCACUGAUACACGUAUCAGUGAACGAUGUUAAGU21.120.323


Target Position: 5198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5198CUCCCUGUCCACCCCCUUU68.00734155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6135216CTCCCTGTCCACCCCCTTTAAAGGGGGTGGACAGGGAG0.638400.528400.810300.750001.000001.00000


Target Position: 2442, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442CUUGUAAAAUAUCUAUAAA98.058965

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2440-2462ACCTTGTAAAATATCTATAAATAUUUAUAGAUAUUUUACAAGGUCUUGUAAAAUAUCUAUAAAUAU8.47.231


Target Position: 5310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5310CAUAUUCGUAAUUUCAUUU82.80021374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5308-5330ATCATATTCGTAATTTCATTTCGAAAUGAAAUUACGAAUAUGAUCAUAUUCGUAAUUUCAUUUCGU7.48.822


Target Position: 3304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3304CAUCUACUGGUUUAUUUUU84.29761143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3302-3324GTCATCTACTGGTTTATTTTTCAAAAAAUAAACCAGUAGAUGACCAUCUACUGGUUUAUUUUUCAU-9.718.922


Target Position: 2392, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2392GUUCAUUUUAGUGUUCAAU77.03092395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2390-2412CTGTTCATTTTAGTGTTCAATTTAUUGAACACUAAAAUGAACAGGUUCAUUUUAGUGUUCAAUUUU20.57.422


Target Position: 6883, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6883GAUAUAAAGGAAAAGCAAA95.938127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7996901GATATAAAGGAAAAGCAAATTTGCTTTTCCTTTATATC0.307400.062200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6881-6903TTGATATAAAGGAAAAGCAAAATUUUGCUUUUCCUUUAUAUCAAGAUAUAAAGGAAAAGCAAAAUU18.6-8.021


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GCUGCUUCAACCCCCACAA82.11981494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562199GCTGCTTCAACCCCCACAATTGTGGGGGTTGAAGCAGC0.718900.043400.706901.000001.000001.00000


Target Position: 3798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3798GACUAGUUUGUUUUAUACU85.36491004

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3796-3818ATGACTAGTTTGTTTTATACTTTAGUAUAAAACAAACUAGUCAUGACUAGUUUGUUUUAUACUUUU1.417.622


Target Position: 3745, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3745GAAAGCAAGGAGAAUUGAA94.1981205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3743-3765TGGAAAGCAAGGAGAATTGAAGGUUCAAUUCUCCUUGCUUUCCAGAAAGCAAGGAGAAUUGAAGGU16.318.632


Target Position: 6348, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6348GAAAAGUAGGUAUGCUUUA92.1824337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6346-6368TGGAAAAGTAGGTATGCTTTACAUAAAGCAUACCUACUUUUCCAGAAAAGUAGGUAUGCUUUACAU18.54.912


Target Position: 2312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312GAAAAACCACCAGUUACUU81.08731660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2310-2332AGGAAAAACCACCAGTTACTTGAAAGUAACUGGUGGUUUUUCCUGAAAAACCACCAGUUACUUGAU17.612.612


Target Position: 814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GUUUUUUAUAGUAUACAAA92.9802275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
812-834TTGTTTTTTATAGTATACAAAAGUUUGUAUACUAUAAAAAACAAGUUUUUUAUAGUAUACAAAAGU8.5-9.121


Target Position: 2926, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2926GUAGAUUUGUUAAGGUUUU79.71581889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2924-2946TAGTAGATTTGTTAAGGTTTTGTAAAACCUUAACAAAUCUACUAGUAGAUUUGUUAAGGUUUUGUU17.36.922


Target Position: 6602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6602GUAGACUUCCUUGUGUUAA83.38271284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6600-6622AAGTAGACTTCCTTGTGTTAATTUUAACACAAGGAAGUCUACUUGUAGACUUCCUUGUGUUAAUUU20.418.922


Target Position: 4315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4315GAUAUAUCAGAGUUUAUGA98.598358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4313-4335TGGATATATCAGAGTTTATGAGAUCAUAAACUCUGAUAUAUCCAGAUAUAUCAGAGUUUAUGAGAU6.93.232


Target Position: 3922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922GUUGUACUUUACAUUUAAA97.772772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3920-3942CAGTTGTACTTTACATTTAAAGAUUUAAAUGUAAAGUACAACUGGUUGUACUUUACAUUUAAAGAU-1.419.022


Target Position: 5936, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5936GGUUACUAUUUUUGAAACA90.0942496

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5934-5956AAGGTTACTATTTTTGAAACATCUGUUUCAAAAAUAGUAACCUUGGUUACUAUUUUUGAAACAUCU14.914.321


Target Position: 1840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840CAAACUACACAGAAUUUAA101.327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1838-1860CCCAAACTACACAGAATTTAAATUUAAAUUCUGUGUAGUUUGGGCAAACUACACAGAAUUUAAAUU2.112.932


Target Position: 601, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601CCCCGAGGAAAAUAUAAUA90.0036506

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_460119CCCCGAGGAAAATATAATA1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119812646..119812664(-)00GSK3B(0.002)


Target Position: 6940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6940CUGAUUUUUUUUUCAUUUU74.47162881

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6938-6960GACTGATTTTTTTTTCATTTTAAAAAAUGAAAAAAAAAUCAGUCCUGAUUUUUUUUUCAUUUUAAU7.47.411


Target Position: 4819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4819CUCUGAAUAUCUUUUUGUA97.606877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4817-4839GTCTCTGAATATCTTTTTGTATAUACAAAAAGAUAUUCAGAGACCUCUGAAUAUCUUUUUGUAUAU5.620.422


Target Position: 4363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4363CAAACAAAUUGAAUUUUAU92.5679302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4361-4383ATCAAACAAATTGAATTTTATGTAUAAAAUUCAAUUUGUUUGAUCAAACAAAUUGAAUUUUAUGUU-9.75.622


Target Position: 2468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468CAAUUUCAUUGUAUUCUCA96.3128113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2466-2488ACCAATTTCATTGTATTCTCACTUGAGAAUACAAUGAAAUUGGUCAAUUUCAUUGUAUUCUCACUU16.07.422


Target Position: 1157, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157CACUAAAGUGAUUGGAAAU88.4728636

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5115719CACTAAAGTGATTGGAAAT1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119720983..119721001(-)|2:124922216..124922234(+)00GSK3B(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1155-1177GACACTAAAGTGATTGGAAATGGAUUUCCAAUCACUUUAGUGUCCACUAAAGUGAUUGGAAAUGGU20.19.832


Target Position: 6761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6761GUGACCACUUCCAUCUUAA92.7531291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3476779GTGACCACTTCCATCTTAATTAAGATGGAAGTGGTCAC0.564800.250000.758600.750000.978300.75000


Target Position: 3363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363CAUUCUACACAUAGUUCUA99.792637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3361-3383CACATTCTACACATAGTTCTAATUAGAACUAUGUGUAGAAUGUGCAUUCUACACAUAGUUCUAAUU18.914.522


Target Position: 5937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5937GUUACUAUUUUUGAAACAU81.88221529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5935-5957AGGTTACTATTTTTGAAACATCGAUGUUUCAAAAAUAGUAACCUGUUACUAUUUUUGAAACAUCGU20.56.322


Target Position: 5452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5452GAGGAUAUCGAAUAGAUUA100.88429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5450-5472TGGAGGATATCGAATAGATTAAAUAAUCUAUUCGAUAUCCUCCAGAGGAUAUCGAAUAGAUUAAAU6.619.933


Target Position: 2355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355ACGUUUGGAAAGAAUAUUA85.14441033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122373ACGTTTGGAAAGAATATTATAATATTCTTTCCAAACGT0.270200.216800.741400.750001.000001.00000


Target Position: 6786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6786ACCUAAAAAACAAAAUUUA83.1671314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9836804ACCTAAAAAACAAAATTTATAAATTTTGTTTTTTAGGT0.672200.605700.819000.750001.000001.00000


Target Position: 6297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6297CAUGUUAGUGAUCAUCUAA99.634439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6295-6317TTCATGTTAGTGATCATCTAATCUUAGAUGAUCACUAACAUGAACAUGUUAGUGAUCAUCUAAUCU21.411.622


Target Position: 5158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5158UGUUCUUUUUUAAAUUUUA84.11021174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7575176TGTTCTTTTTTAAATTTTATAAAATTTAAAAAAGAACA0.284600.211400.672400.750001.000001.00000


Target Position: 3353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3353GAAAUAGCCACAUUCUACA92.3637320

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3351-3373CAGAAATAGCCACATTCTACACAUGUAGAAUGUGGCUAUUUCUGGAAAUAGCCACAUUCUACACAU14.513.623


Target Position: 5595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5595GAAUUGUUUUUUUAUAAAU90.0405502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9145613GAATTGTTTTTTTATAAATATTTATAAAAAAACAATTC0.214000.061600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5593-5615GAGAATTGTTTTTTTATAAATCGAUUUAUAAAAAAACAAUUCUCGAAUUGUUUUUUUAUAAAUCGU-7.55.311


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503GGGGGUGGGAGGGGUUGUG56.81155911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542521GGGGGTGGGAGGGGTTGTGCACAACCCCTCCCACCCCC0.533800.085100.698300.750001.000001.00000


Target Position: 5780, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5780CAAUGAAAUAUCAUUUUAA102.15818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5778-5800CTCAATGAAATATCATTTTAATTUUAAAAUGAUAUUUCAUUGAGCAAUGAAAUAUCAUUUUAAUUU-1.47.422


Target Position: 852, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852GACGAAGUCUUUUUCUUUU85.7739942

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_185219GACGAAGTCTTTTTCTTTT1/1/0/0100.00GSK3BNM_002093.3+NM_001146156.11+1NANANANA00GSK3B(0.002)


Target Position: 6507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6507GGGUUAUGCCGUUUUAUUC76.4032526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8596525GGGTTATGCCGTTTTATTCGAATAAAACGGCATAACCC0.516300.078600.819000.750001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917CCCAACAUAAAGACAAAAG66.45894441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879935CCCAACATAAAGACAAAAGCTTTTGTCTTTATGTTGGG0.652100.552200.853400.750001.000001.00000


Target Position: 6149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6149GACACUGGCAUUUCAUCUA91.8221356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9456167GACACTGGCATTTCATCTATAGATGAAATGCCAGTGTC0.406400.138400.646600.750001.000001.00000


Target Position: 2404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404GUUCAAUUUUUUUAUUAUU83.82431216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2402-2424GTGTTCAATTTTTTTATTATTATAAUAAUAAAAAAAUUGAACACGUUCAAUUUUUUUAUUAUUAUU-8.07.421


Target Position: 2402, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402GUGUUCAAUUUUUUUAUUA88.5235625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592420GTGTTCAATTTTTTTATTATAATAAAAAAATTGAACAC0.479700.095200.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2400-2422TAGTGTTCAATTTTTTTATTATTUAAUAAAAAAAUUGAACACUAGUGUUCAAUUUUUUUAUUAUUU-9.720.511


Target Position: 6152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6152ACUGGCAUUUCAUCUAUUU77.24252346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8236170ACTGGCATTTCATCTATTTAAATAGATGAAATGCCAGT0.445200.187000.706900.750001.000001.00000


Target Position: 6906, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6906GUAUAACAUUAUUACUACU93.0759266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6904-6926CTGTATAACATTATTACTACTTGAGUAGUAAUAAUGUUAUACAGGUAUAACAUUAUUACUACUUGU14.38.522


Target Position: 6775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6775CUUAAAAACAAACCUAAAA83.98121192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6773-6795ATCTTAAAAACAAACCTAAAAAAUUUUAGGUUUGUUUUUAAGAUCUUAAAAACAAACCUAAAAAAU18.6-9.121


Target Position: 2799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799CAUAUCUUCGGGUAUUUAU84.17111164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2797-2819TCCATATCTTCGGGTATTTATAGAUAAAUACCCGAAGAUAUGGACAUAUCUUCGGGUAUUUAUAGU1.46.622


Target Position: 747, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747CCUAAAUCAUCUAUAUGUU90.146487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
600765CCTAAATCATCTATATGTTAACATATAGATGATTTAGG0.366800.330600.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
745-767GTCCTAAATCATCTATATGTTAAAACAUAUAGAUGAUUUAGGACCCUAAAUCAUCUAUAUGUUAAU8.26.932


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659UCACGUGAUACAUAUUUUU74.57162857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438677TCACGTGATACATATTTTTAAAAATATGTATCACGTGA0.743800.132700.724100.750001.000001.00000


Target Position: 6613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6613UGUGUUAAUUUUUAAGUUU76.22272563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9606631TGTGTTAATTTTTAAGTTTAAACTTAAAAATTAACACA0.360300.066200.706900.750001.000001.00000


Target Position: 4444, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4444GCAUAACUCCUUAAAGGUA95.7109133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4442-4464CAGCATAACTCCTTAAAGGTAGTUACCUUUAAGGAGUUAUGCUGGCAUAACUCCUUAAAGGUAGUU18.611.633


Target Position: 2567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567GACAAUCUUUUUUUAUUAA95.5478140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2565-2587ACGACAATCTTTTTTTATTAAAAUUAAUAAAAAAAGAUUGUCGUGACAAUCUUUUUUUAUUAAAAU-7.519.222


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058CCAAAUGUCAAACUACCAA87.3967761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352076CCAAATGTCAAACTACCAATTGGTAGTTTGACATTTGG0.231200.114900.698301.000001.000001.00000


Target Position: 2929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929GAUUUGUUAAGGUUUUGUU84.16961165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2927-2949TAGATTTGTTAAGGTTTTGTTTTAACAAAACCUUAACAAAUCUAGAUUUGUUAAGGUUUUGUUUUU13.35.322


Target Position: 622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622CGAAGUACUCAUUUUCAAU92.7885287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
620-642TTCGAAGTACTCATTTTCAATCAAUUGAAAAUGAGUACUUCGAACGAAGUACUCAUUUUCAAUCAU7.721.433


Target Position: 4343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4343CAUGCUCAGUCAAACCAAA96.2811114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624361CATGCTCAGTCAAACCAAATTTGGTTTGACTGAGCATG0.480000.144600.655200.750000.972800.87500


Target Position: 5095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5095CAAUGUAUAGUGUAUCUAU101.03528

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5093-5115AGCAATGTATAGTGTATCTATATAUAGAUACACUAUACAUUGCUCAAUGUAUAGUGUAUCUAUAUU15.86.722


Target Position: 5204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5204GUCCACCCCCUUUCCCUUU62.6885096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2515222GTCCACCCCCTTTCCCTTTAAAGGGAAAGGGGGTGGAC0.538200.477300.819000.750001.000001.00000


Target Position: 6610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6610CCUUGUGUUAAUUUUUAAG72.76713238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9456628CCTTGTGTTAATTTTTAAGCTTAAAAATTAACACAAGG0.378500.044900.706900.750001.000001.00000


Target Position: 2432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432CUUAUUUAACCUUGUAAAA85.8252933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2430-2452TTCTTATTTAACCTTGTAAAATAUUUUACAAGGUUAAAUAAGAACUUAUUUAACCUUGUAAAAUAU7.2-7.522


Target Position: 5068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5068CCUGUAUUAUUGUAACAAU93.213259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5066-5088GGCCTGTATTATTGTAACAATAAAUUGUUACAAUAAUACAGGCCCCUGUAUUAUUGUAACAAUAAU14.711.623


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350UGGUCACGUUUGGAAAGAA86.0106908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742368TGGTCACGTTTGGAAAGAATTCTTTCCAAACGTGACCA0.274100.053400.672400.750001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668ACAUAUUUUUUUAGGAUUU76.28562553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815686ACATATTTTTTTAGGATTTAAATCCTAAAAAAATATGT0.237400.164600.706900.750001.000001.00000


Target Position: 2679, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679GAACUUUGUUUUCUUUUAA94.2344203

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2677-2699TTGAACTTTGTTTTCTTTTAAAGUUAAAAGAAAACAAAGUUCAAGAACUUUGUUUUCUUUUAAAGU7.110.312


Target Position: 3400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400GAAUCUGUAUUUAAUUUGU87.2211780

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3398-3420TAGAATCTGTATTTAATTTGTTTACAAAUUAAAUACAGAUUCUAGAAUCUGUAUUUAAUUUGUUUU-1.419.222


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516CCUCCUACCCAUCCCCCUU69.77923824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492534CCTCCTACCCATCCCCCTTAAGGGGGATGGGTAGGAGG0.867700.851600.706901.000001.000001.00000


Target Position: 4324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4324GAGUUUAUGAGAAAGGAAA93.7026231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4322-4344CAGAGTTTATGAGAAAGGAAACAUUUCCUUUCUCAUAAACUCUGGAGUUUAUGAGAAAGGAAACAU18.74.622


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500CCAGGGGGUGGGAGGGGUU63.58964951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932518CCAGGGGGTGGGAGGGGTTAACCCCTCCCACCCCCTGG0.217000.040800.698301.000000.989100.62500


Target Position: 5708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5708CAAUAGAGGACUGUUGUUU80.65941722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5706-5728GCCAATAGAGGACTGTTGTTTTAAAACAACAGUCCUCUAUUGGCCAAUAGAGGACUGUUGUUUUAU19.311.622


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401AGUGUUCAAUUUUUUUAUU78.84742046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202419AGTGTTCAATTTTTTTATTAATAAAAAAATTGAACACT0.486300.078900.698300.750001.000001.00000


Target Position: 2558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558CUCUCCCACGACAAUCUUU76.33962541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492576CTCTCCCACGACAATCTTTAAAGATTGTCGTGGGAGAG0.299200.068000.810300.750000.978300.75000


Target Position: 5130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5130UCGCUUCCAUGUGUUUUUU63.56934954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8135148TCGCTTCCATGTGTTTTTTAAAAAACACATGGAAGCGA0.511800.060900.793100.750001.000001.00000


Target Position: 4863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4863CCAAAUUCAAGCUUGUACA85.01231048

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4861-4883CACCAAATTCAAGCTTGTACATTUGUACAAGCUUGAAUUUGGUGCCAAAUUCAAGCUUGUACAUUU19.07.422


Target Position: 3653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653CAGUUAAGAGUUUUUGUGU81.77451549

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3651-3673CCCAGTTAAGAGTTTTTGTGTCTACACAAAAACUCUUAACUGGGCAGUUAAGAGUUUUUGUGUCUU12.29.822


Target Position: 5461, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5461GAAUAGAUUAAAUUUUGCU83.1061326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5459-5481TCGAATAGATTAAATTTTGCTCGAGCAAAAUUUAAUCUAUUCGAGAAUAGAUUAAAUUUUGCUCGU14.06.623


Target Position: 3662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3662GUUUUUGUGUCUGUUUUCU73.20613131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3660-3682GAGTTTTTGTGTCTGTTTTCTTTAGAAAACAGACACAAAAACUCGUUUUUGUGUCUGUUUUCUUUU14.95.621


Target Position: 1843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843ACUACACAGAAUUUAAAUU78.72242075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471861ACTACACAGAATTTAAATTAATTTAAATTCTGTGTAGT0.432700.382600.698300.750001.000001.00000


Target Position: 2354, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354CACGUUUGGAAAGAAUAUU74.55792858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562372CACGTTTGGAAAGAATATTAATATTCTTTCCAAACGTG0.279200.221000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2352-2374GTCACGTTTGGAAAGAATATTAAAAUAUUCUUUCCAAACGUGACCACGUUUGGAAAGAAUAUUAAU6.619.823


Target Position: 895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895GCAUUUAUCGUUAACCUAA94.7171184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
893-915CTGCATTTATCGTTAACCTAACAUUAGGUUAACGAUAAAUGCAGGCAUUUAUCGUUAACCUAACAU19.8-1.832


Target Position: 5212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5212CCUUUCCCUUUGAAAUAAU79.36421953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3505230CCTTTCCCTTTGAAATAATATTATTTCAAAGGGAAAGG0.463000.422000.836201.000000.989100.75000


Target Position: 3425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425ACCUCAUGCUUUUUACAUU82.07171503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943443ACCTCATGCTTTTTACATTAATGTAAAAAGCATGAGGT0.321700.113900.844800.750000.940200.62500


Target Position: 6782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6782ACAAACCUAAAAAACAAAA75.93962608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6686800ACAAACCTAAAAAACAAAATTTTGTTTTTTAGGTTTGT0.950400.831000.706900.750001.000001.00000


Target Position: 6774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6774UCUUAAAAACAAACCUAAA83.60681252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7736792TCTTAAAAACAAACCTAAATTTAGGTTTGTTTTTAAGA0.856800.681900.724100.750001.000001.00000


Target Position: 6614, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6614GUGUUAAUUUUUAAGUUUU83.71681235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7826632GTGTTAATTTTTAAGTTTTAAAACTTAAAAATTAACAC0.362600.105700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6612-6634TTGTGTTAATTTTTAAGTTTTTTAAAACUUAAAAAUUAACACAAGUGUUAAUUUUUAAGUUUUUUU4.96.911


Target Position: 6844, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6844GUAUACAAACUAUUGCAAA92.9291277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6842-6864TTGTATACAAACTATTGCAAACAUUUGCAAUAGUUUGUAUACAAGUAUACAAACUAUUGCAAACAU20.08.533


Target Position: 7101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7101GCCUGGAAAUGAAAUUAAA95.9381126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1517119GCCTGGAAATGAAATTAAATTTAATTTCATTTCCAGGC0.872100.621101.000001.000001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352GUCACGUUUGGAAAGAAUA86.3301875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6652370GTCACGTTTGGAAAGAATATATTCTTTCCAAACGTGAC0.296500.241000.775900.750001.000001.00000


Target Position: 6515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6515CCGUUUUAUUCAAGUUUGU73.7933024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7616533CCGTTTTATTCAAGTTTGTACAAACTTGAATAAAACGG0.284400.172200.706900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6513-6535TGCCGTTTTATTCAAGTTTGTTGACAAACUUGAAUAAAACGGCACCGUUUUAUUCAAGUUUGUUGU10.37.122


Target Position: 5762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5762GCCAUCUCUACCCUUGCUC57.36325842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6225780GCCATCTCTACCCTTGCTCGAGCAAGGGTAGAGATGGC0.764700.714200.689700.750001.000001.00000


Target Position: 5791, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5791CAUUUUAAUUUCUUUUAAA97.427679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8785809CATTTTAATTTCTTTTAAATTTAAAAGAAATTAAAATG0.319200.084500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5789-5811ATCATTTTAATTTCTTTTAAAAAUUUAAAAGAAAUUAAAAUGAUCAUUUUAAUUUCUUUUAAAAAU-3.8-9.711


Target Position: 7044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7044CUUGGUUUGGAAAUAGUUA86.4824851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7042-7064GACTTGGTTTGGAAATAGTTAACUAACUAUUUCCAAACCAAGUCCUUGGUUUGGAAAUAGUUAACU4.618.822


Target Position: 6554, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6554CAAUAAAAGCAAAAUGACA94.067214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6552-6574TGCAATAAAAGCAAAATGACAACUGUCAUUUUGCUUUUAUUGCACAAUAAAAGCAAAAUGACAACU14.8-9.722


Target Position: 5140, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5140GUGUUUUUUUUUUUAAUUU78.32182143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8935158GTGTTTTTTTTTTTAATTTAAATTAAAAAAAAAAACAC0.324900.312600.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5138-5160ATGTGTTTTTTTTTTTAATTTGTAAAUUAAAAAAAAAAACACAUGUGUUUUUUUUUUUAAUUUGUU-9.75.611


Target Position: 5136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5136CCAUGUGUUUUUUUUUUUA90.894429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3855154CCATGTGTTTTTTTTTTTATAAAAAAAAAAACACATGG0.444900.215300.810301.000001.000001.00000


Target Position: 3350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350GCAGAAAUAGCCACAUUCU85.4782988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3348-3370TTGCAGAAATAGCCACATTCTACAGAAUGUGGCUAUUUCUGCAAGCAGAAAUAGCCACAUUCUACU20.512.032


Target Position: 6694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6694CUGUAAAAUUUGCAUUUAU87.3894764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6692-6714GCCTGTAAAATTTGCATTTATAAAUAAAUGCAAAUUUUACAGGCCUGUAAAAUUUGCAUUUAUAAU15.37.222


Target Position: 6361, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6361GCUUUACAAUAAAAUCUGU85.14481032

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6359-6381ATGCTTTACAATAAAATCTGTCTACAGAUUUUAUUGUAAAGCAUGCUUUACAAUAAAAUCUGUCUU12.011.822


Target Position: 2560, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560CUCCCACGACAAUCUUUUU79.02382015

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8256019CTCCCACGACAATCTTTTT1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANANA00GSK3B(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472578CTCCCACGACAATCTTTTTAAAAAGATTGTCGTGGGAG0.283300.068100.810300.750001.000001.00000


Target Position: 2563, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563CCACGACAAUCUUUUUUUA94.6381190

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2256319CCACGACAATCTTTTTTTA1/1/0/0100.00GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119545339..119545357(-)00GSK3B(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312581CCACGACAATCTTTTTTTATAAAAAAAGATTGTCGTGG0.272200.191300.810301.000001.000001.00000


Target Position: 5142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5142GUUUUUUUUUUUAAUUUGU70.91163604

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5140-5162GTGTTTTTTTTTTTAATTTGTTCACAAAUUAAAAAAAAAAACACGUUUUUUUUUUUAAUUUGUUCU-1.4-11.310


Target Position: 6982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6982GUAUGCUCAAUGUUUUUUU78.41782125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6467000GTATGCTCAATGTTTTTTTAAAAAAACATTGAGCATAC0.461800.365800.681000.750001.000001.00000


Target Position: 3497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497GAUACAGUCACUUAUACCU85.23851020

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3495-3517ATGATACAGTCACTTATACCTGCAGGUAUAAGUGACUGUAUCAUGAUACAGUCACUUAUACCUGCU15.319.022


Target Position: 2454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454CUAUAAAUACAAACCAAUU87.3195771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342472CTATAAATACAAACCAATTAATTGGTTTGTATTTATAG0.297100.057600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474ATCTATAAATACAAACCAATTTCAAUUGGUUUGUAUUUAUAGAUCUAUAAAUACAAACCAAUUUCU18.8-8.012


Target Position: 919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919CAACAUAAAGACAAAAGGA89.4019558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
917-939CCCAACATAAAGACAAAAGGAAGUCCUUUUGUCUUUAUGUUGGGCAACAUAAAGACAAAAGGAAGU16.16.922


Target Position: 3548, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548GUGUGUAUAUAUGUUAUAU94.1178213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3546-3568ATGTGTGTATATATGTTATATATAUAUAACAUAUAUACACACAUGUGUGUAUAUAUGUUAUAUAUU8.520.421


Target Position: 3270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270GACAUUGUAGUUAAAUAAU87.3933763

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3268-3290AGGACATTGTAGTTAAATAATGTAUUAUUUAACUACAAUGUCCUGACAUUGUAGUUAAAUAAUGUU-7.519.322


Target Position: 6763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6763GACCACUUCCAUCUUAAAA89.2305569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5316781GACCACTTCCATCTTAAAATTTTAAGATGGAAGTGGTC0.680300.308600.819000.750001.000001.00000


Target Position: 4289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289CACAAAAGGGGUUUCACAA90.3598472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4287-4309GCCACAAAAGGGGTTTCACAAACUUGUGAAACCCCUUUUGUGGCCACAAAAGGGGUUUCACAAACU20.510.322


Target Position: 5218, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5218CCUUUGAAAUAAUAACUCA95.0219164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5216-5238TCCCTTTGAAATAATAACTCACTUGAGUUAUUAUUUCAAAGGGACCUUUGAAAUAAUAACUCACUU14.512.232


Target Position: 3717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3717CUUUUUGAAGAAAAAGCAA83.58691256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3715-3737CTCTTTTTGAAGAAAAAGCAATAUUGCUUUUUCUUCAAAAAGAGCUUUUUGAAGAAAAAGCAAUAU18.67.722


Target Position: 4874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4874CUUGUACAUUAUAUUUUCU84.00761189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4872-4894AGCTTGTACATTATATTTTCTTTAGAAAAUAUAAUGUACAAGCUCUUGUACAUUAUAUUUUCUUUU2.120.422


Target Position: 6242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6242GAAUUUGGGGGGUUUUCUU79.8231869

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6240-6262AGGAATTTGGGGGGTTTTCTTTCAAGAAAACCCCCCAAAUUCCUGAAUUUGGGGGGUUUUCUUUCU13.311.322


Target Position: 3887, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3887CAUUACUUGACCUAUGAAU84.231156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3885-3907GCCATTACTTGACCTATGAATCTAUUCAUAGGUCAAGUAAUGGCCAUUACUUGACCUAUGAAUCUU13.44.613


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228UCGCCAUCAAGAAAGUAUU70.31213722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541246TCGCCATCAAGAAAGTATTAATACTTTCTTGATGGCGA0.332800.052600.784500.750001.000001.00000


Target Position: 3059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3059GACCAAAGUUCUUUGCAAA98.04966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863077GACCAAAGTTCTTTGCAAATTTGCAAAGAACTTTGGTC0.194200.137200.819000.750000.989100.87500


Target Position: 2595, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GUUGUAUACUUUAAAAACA91.3686389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2593-2615CTGTTGTATACTTTAAAAACAGGUGUUUUUAAAGUAUACAACAGGUUGUAUACUUUAAAAACAGGU0.08.511


Target Position: 3312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3312GGUUUAUUUUUCAUAUUUU92.5371305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3310-3332CTGGTTTATTTTTCATATTTTTTAAAAUAUGAAAAAUAAACCAGGGUUUAUUUUUCAUAUUUUUUU-1.8-0.311


Target Position: 2357, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357GUUUGGAAAGAAUAUUAAA95.0687162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192375GTTTGGAAAGAATATTAAATTTAATATTCTTTCCAAAC0.274500.197200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2355-2377ACGTTTGGAAAGAATATTAAAAAUUUAAUAUUCUUUCCAAACGUGUUUGGAAAGAAUAUUAAAAAU-8.020.121


Target Position: 5391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5391GUUUCAUUUCAUACUUAGU81.79141542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5389-5411CGGTTTCATTTCATACTTAGTCCACUAAGUAUGAAAUGAAACCGGUUUCAUUUCAUACUUAGUCCU11.37.431


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CUGCAUUUAUCGUUAACCU80.19311809

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913TGCTGCATTTATCGTTAACCTAAAGGUUAACGAUAAAUGCAGCACUGCAUUUAUCGUUAACCUAAU21.120.033


Target Position: 4352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4352UCAAACCAAAUCAAACAAA74.05192964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5344370TCAAACCAAATCAAACAAATTTGTTTGATTTGGTTTGA0.353000.189500.724100.750001.000001.00000


Target Position: 631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CAUUUUCAAUCAAGUAUUU85.8533928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
629-651CTCATTTTCAATCAAGTATTTGCAAAUACUUGAUUGAAAAUGAGCAUUUUCAAUCAAGUAUUUGCU4.67.422


Target Position: 6155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6155GGCAUUUCAUCUAUUUUUC73.21963127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5346173GGCATTTCATCTATTTTTCGAAAAATAGATGAAATGCC0.542800.320400.827600.750001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517CUCCUACCCAUCCCCCUUU65.09554671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431535CTCCTACCCATCCCCCTTTAAAGGGGGATGGGTAGGAG0.682700.672600.810300.750001.000001.00000


Target Position: 4395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4395CUUCUGAAAGCUAAGAUUU78.88172036

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4393-4415TGCTTCTGAAAGCTAAGATTTGAAAAUCUUAGCUUUCAGAAGCACUUCUGAAAGCUAAGAUUUGAU6.920.422


Target Position: 4367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4367CAAAUUGAAUUUUAUGUUU83.22261305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4365-4387AACAAATTGAATTTTATGTTTTAAAACAUAAAAUUCAAUUUGUUCAAAUUGAAUUUUAUGUUUUAU6.97.412


Target Position: 4782, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4782GGAUCACAGAACUCUUUUA101.32226

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9478219GGATCACAGAACTCTTTTA1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119543120..119543138(-)00GSK3B(0.002)


Target Position: 4821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4821CUGAAUAUCUUUUUGUAUA93.1565262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4819-4841CTCTGAATATCTTTTTGTATATAUAUACAAAAAGAUAUUCAGAGCUGAAUAUCUUUUUGUAUAUAU6.98.722


Target Position: 3426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3426CCUCAUGCUUUUUACAUUU82.08981499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5443444CCTCATGCTTTTTACATTTAAATGTAAAAAGCATGAGG0.412900.102200.844801.000000.940200.75000


Target Position: 4373, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4373GAAUUUUAUGUUUUAUAAA97.395280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4371-4393TTGAATTTTATGTTTTATAAAGTUUUAUAAAACAUAAAAUUCAAGAAUUUUAUGUUUUAUAAAGUU-7.5-9.721


Target Position: 4157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4157CCCUGUCCUGCUCCUUAAC63.35134997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8984175CCCTGTCCTGCTCCTTAACGTTAAGGAGCAGGACAGGG0.455900.071700.844800.750001.000001.00000


Target Position: 6891, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6891GGAAAAGCAAAAUCUGUAU86.4387856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8146909GGAAAAGCAAAATCTGTATATACAGATTTTGCTTTTCC0.237700.111400.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6889-6911AAGGAAAAGCAAAATCTGTATAAAUACAGAUUUUGCUUUUCCUUGGAAAAGCAAAAUCUGUAUAAU20.321.022


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089CACCUGCACUCUUCAACUU83.69861239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722107CACCTGCACTCTTCAACTTAAGTTGAAGAGTGCAGGTG0.505600.141600.655200.750001.000001.00000


Target Position: 3427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3427CUCAUGCUUUUUACAUUUA85.425993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343445CTCATGCTTTTTACATTTATAAATGTAAAAAGCATGAG0.412000.092700.775900.750000.940200.75000


Target Position: 7103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7103CUGGAAAUGAAAUUAAAAA88.8874595

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7101-7123GCCTGGAAATGAAATTAAAAAAAUUUUUAAUUUCAUUUCCAGGCCUGGAAAUGAAAUUAAAAAAAU-9.720.122


Target Position: 2669, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669GGGUUUUUUUGAACUUUGU78.20522173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062687GGGTTTTTTTGAACTTTGTACAAAGTTCAAAAAAACCC0.316100.142400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2667-2689ATGGGTTTTTTTGAACTTTGTTTACAAAGUUCAAAAAAACCCAUGGGUUUUUUUGAACUUUGUUUU10.312.622


Target Position: 5410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5410CCAUUCAGGGACUUAGUGU76.60232477

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5408-5430GTCCATTCAGGGACTTAGTGTAGACACUAAGUCCCUGAAUGGACCCAUUCAGGGACUUAGUGUAGU16.418.133


Target Position: 4357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4357CCAAAUCAAACAAAUUGAA86.2682880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4355-4377AACCAAATCAAACAAATTGAATTUUCAAUUUGUUUGAUUUGGUUCCAAAUCAAACAAAUUGAAUUU7.413.813


Target Position: 3367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367CUACACAUAGUUCUAAUUU79.87641864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3365-3387TTCTACACATAGTTCTAATTTTAAAAUUAGAACUAUGUGUAGAACUACACAUAGUUCUAAUUUUAU6.920.432


Target Position: 4872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4872AGCUUGUACAUUAUAUUUU78.98722021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3574890AGCTTGTACATTATATTTTAAAATATAATGTACAAGCT0.502300.174000.853400.750001.000001.00000


Target Position: 2347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2347CACUGGUCACGUUUGGAAA91.7818358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612365CACTGGTCACGTTTGGAAATTTCCAAACGTGACCAGTG0.555400.054600.793100.750001.000001.00000


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CCCUCCUACCCAUCCCCCU60.72685405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924533CCCTCCTACCCATCCCCCTAGGGGGATGGGTAGGAGGG0.867900.854400.646600.750001.000001.00000


Target Position: 5893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5893CAUAUAAAAUGUCUUGAAU91.2882396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5891-5913TCCATATAAAATGTCTTGAATAGAUUCAAGACAUUUUAUAUGGACAUAUAAAAUGUCUUGAAUAGU20.4-8.012


Target Position: 6347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6347GGAAAAGUAGGUAUGCUUU87.5146741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6345-6367GTGGAAAAGTAGGTATGCTTTACAAAGCAUACCUACUUUUCCACGGAAAAGUAGGUAUGCUUUACU19.713.322


Target Position: 5883, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5883CAAAGUAGUCCAUAUAAAA102.49317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8955901CAAAGTAGTCCATATAAAATTTTATATGGACTACTTTG0.654600.092700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5881-5903CTCAAAGTAGTCCATATAAAATGUUUUAUAUGGACUACUUUGAGCAAAGUAGUCCAUAUAAAAUGU-8.09.822


Target Position: 6289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6289CUACUGUUCAUGUUAGUGA85.8694925

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6287-6309TCCTACTGTTCATGTTAGTGATCUCACUAACAUGAACAGUAGGACUACUGUUCAUGUUAGUGAUCU19.019.032


Target Position: 5802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5802CUUUUAAAAAAAAUCAGUU78.1922178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5800-5822TTCTTTTAAAAAAAATCAGTTTAAACUGAUUUUUUUUAAAAGAACUUUUAAAAAAAAUCAGUUUAU19.2-9.121


Target Position: 3493, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493GAAUGAUACAGUCACUUAU95.8972131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3491-3513CAGAATGATACAGTCACTTATACAUAAGUGACUGUAUCAUUCUGGAAUGAUACAGUCACUUAUACU20.38.722


Target Position: 5316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5316CGUAAUUUCAUUUCGUUGA79.90381857

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5314-5336TTCGTAATTTCATTTCGTTGAAGUCAACGAAAUGAAAUUACGAACGUAAUUUCAUUUCGUUGAAGU21.1-0.332


Target Position: 5880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5880CCUCAAAGUAGUCCAUAUA93.8532221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8935898CCTCAAAGTAGTCCATATATATATGGACTACTTTGAGG0.393100.051800.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5878-5900TGCCTCAAAGTAGTCCATATAAAUAUAUGGACUACUUUGAGGCACCUCAAAGUAGUCCAUAUAAAU21.216.622


Target Position: 2914, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914GGAAGAUUCUUAGUAGAUU91.5076382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2912-2934AGGGAAGATTCTTAGTAGATTTGAAUCUACUAAGAAUCUUCCCUGGAAGAUUCUUAGUAGAUUUGU18.914.822


Target Position: 721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721GGAAAGAAUUGUAUUUUUU89.6685538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
719-741GGGGAAAGAATTGTATTTTTTCCAAAAAAUACAAUUCUUUCCCCGGAAAGAAUUGUAUUUUUUCCU-9.714.812


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GGGGAAGCAGCAAGCAAGA82.25671476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593018GGGGAAGCAGCAAGCAAGATCTTGCTTGCTGCTTCCCC0.256100.043100.767200.750000.945701.00000


Target Position: 7059, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7059GUUAACUGGUACUGUAAUU82.44031443

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7057-7079TAGTTAACTGGTACTGTAATTTGAAUUACAGUACCAGUUAACUAGUUAACUGGUACUGUAAUUUGU11.611.832


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744AGUCCUAAAUCAUCUAUAU92.5561303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959762AGTCCTAAATCATCTATATATATAGATGATTTAGGACT0.384900.320300.663800.750001.000001.00000


Target Position: 6300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6300GUUAGUGAUCAUCUAAUCA92.8545283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6298-6320ATGTTAGTGATCATCTAATCACAUGAUUAGAUGAUCACUAACAUGUUAGUGAUCAUCUAAUCACAU16.020.333


Target Position: 1839, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CCAAACUACACAGAAUUUA81.23761639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761857CCAAACTACACAGAATTTATAAATTCTGTGTAGTTTGG0.450200.445800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1837-1859ACCCAAACTACACAGAATTTAAAUAAAUUCUGUGUAGUUUGGGUCCAAACUACACAGAAUUUAAAU5.311.832


Target Position: 5211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5211CCCUUUCCCUUUGAAAUAA81.44321602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3075229CCCTTTCCCTTTGAAATAATTATTTCAAAGGGAAAGGG0.491300.458300.956901.000000.989100.75000


Target Position: 6765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6765CCACUUCCAUCUUAAAAAC73.43243089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5746783CCACTTCCATCTTAAAAACGTTTTTAAGATGGAAGTGG0.735400.517300.698300.750001.000001.00000


Target Position: 4880, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4880CAUUAUAUUUUCUUUCUGU87.948695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4878-4900TACATTATATTTTCTTTCTGTGTACAGAAAGAAAAUAUAAUGUACAUUAUAUUUUCUUUCUGUGUU16.6-8.621


Target Position: 4348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4348UCAGUCAAACCAAAUCAAA79.12111997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9064366TCAGTCAAACCAAATCAAATTTGATTTGGTTTGACTGA0.423400.164800.724100.750001.000001.00000


Target Position: 4913, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4913GUUUUAUUGUUUUGUAUGU77.51472304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4911-4933AAGTTTTATTGTTTTGTATGTAAACAUACAAAACAAUAAAACUUGUUUUAUUGUUUUGUAUGUAAU13.5-9.722


Target Position: 4351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4351GUCAAACCAAAUCAAACAA84.63821086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514369GTCAAACCAAATCAAACAATTGTTTGATTTGGTTTGAC0.397800.223200.672400.750001.000001.00000


Target Position: 2474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474CAUUGUAUUCUCACUUUGA94.1876207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2472-2494TTCATTGTATTCTCACTTTGAGGUCAAAGUGAGAAUACAAUGAACAUUGUAUUCUCACUUUGAGGU16.76.722


Target Position: 4054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4054UGCCCUCACCCUCCUCAUU65.57964597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5914072TGCCCTCACCCTCCTCATTAATGAGGAGGGTGAGGGCA0.651800.093600.844800.750001.000001.00000


Target Position: 3674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674GUUUUCUUUGUGUAUCAGU74.43292887

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3672-3694CTGTTTTCTTTGTGTATCAGTGAACUGAUACACAAAGAAAACAGGUUUUCUUUGUGUAUCAGUGAU20.35.521


Target Position: 6284, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6284GAUUCCUACUGUUCAUGUU89.1687577

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6282-6304CTGATTCCTACTGTTCATGTTAGAACAUGAACAGUAGGAAUCAGGAUUCCUACUGUUCAUGUUAGU20.519.923


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514GGGUUGUGGGGAGGGGGAA72.97543173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762532GGGTTGTGGGGAGGGGGAATTCCCCCTCCCCACAACCC0.196300.077300.819001.000001.000001.00000


Target Position: 4940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4940GGACCCAGGAACUGUUAUU83.04071342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8494958GGACCCAGGAACTGTTATTAATAACAGTTCCTGGGTCC0.224000.108500.862101.000000.978301.00000


Target Position: 5509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5509CUUAAAAACAGCAGAUUCU77.71912272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5507-5529GTCTTAAAAACAGCAGATTCTGGAGAAUCUGCUGUUUUUAAGACCUUAAAAACAGCAGAUUCUGGU20.4-9.122


Target Position: 7017, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7017CUUGUAAAUACAUUUUGUU80.40451767

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7015-7037CCCTTGTAAATACATTTTGTTCTAACAAAAUGUAUUUACAAGGGCUUGUAAAUACAUUUUGUUCUU5.37.221


Target Position: 4467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4467CGUUGAUAGACCAUUUUCA94.1434210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4465-4487GGCGTTGATAGACCATTTTCAGAUGAAAAUGGUCUAUCAACGCCCGUUGAUAGACCAUUUUCAGAU7.416.132


Target Position: 858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858GUCUUUUUCUUUUUCUUCU76.50542504

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
856-878AAGTCTTTTTCTTTTTCTTCTGTAGAAGAAAAAGAAAAAGACUUGUCUUUUUCUUUUUCUUCUGUU14.85.511


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440ACCUUGUAAAAUAUCUAUA85.9339917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372458ACCTTGTAAAATATCTATATATAGATATTTTACAAGGT0.473500.155200.810300.750001.000001.00000


Target Position: 2852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852CAGACAAAGAAAUGUGUAU87.845703

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2850-2872GGCAGACAAAGAAATGTGTATCAAUACACAUUUCUUUGUCUGCCCAGACAAAGAAAUGUGUAUCAU20.419.222


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505CCCUCUCCCUCCCUCCUAC65.34744631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861523CCCTCTCCCTCCCTCCTACGTAGGAGGGAGGGAGAGGG0.978300.899800.810300.750001.000001.00000


Target Position: 6663, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6663GAUACAGAUAGUUGUAUGA94.7452181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6661-6683CAGATACAGATAGTTGTATGAAAUCAUACAACUAUCUGUAUCUGGAUACAGAUAGUUGUAUGAAAU13.520.322


Target Position: 6615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6615UGUUAAUUUUUAAGUUUUU74.95632793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6316633TGTTAATTTTTAAGTTTTTAAAAACTTAAAAATTAACA0.357400.282700.706900.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536GGAGCACUAGAACAUACAA101.62523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372554GGAGCACTAGAACATACAATTGTATGTTCTAGTGCTCC0.528900.223400.724101.000000.913000.62500


Target Position: 5235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5235CACUCAUAACAGUAUCUUU96.1667117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5233-5255CTCACTCATAACAGTATCTTTGCAAAGAUACUGUUAUGAGUGAGCACUCAUAACAGUAUCUUUGCU14.520.333


Target Position: 5137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5137CAUGUGUUUUUUUUUUUAA90.547461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5135-5157TCCATGTGTTTTTTTTTTTAATTUUAAAAAAAAAAACACAUGGACAUGUGUUUUUUUUUUUAAUUU-9.119.311


Target Position: 2593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593CUGUUGUAUACUUUAAAAA89.5579547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882611CTGTTGTATACTTTAAAAATTTTTAAAGTATACAACAG0.443900.052200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2591-2613TGCTGTTGTATACTTTAAAAACAUUUUUAAAGUAUACAACAGCACUGUUGUAUACUUUAAAAACAU-9.120.422


Target Position: 2784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2784CUUGUAAAAUUAAUCCAUA94.4461196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2782-2804CACTTGTAAAATTAATCCATATCUAUGGAUUAAUUUUACAAGUGCUUGUAAAAUUAAUCCAUAUCU20.17.222


Target Position: 3428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428UCAUGCUUUUUACAUUUAU73.24843116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473446TCATGCTTTTTACATTTATATAAATGTAAAAAGCATGA0.406800.088300.681000.750000.940200.75000


Target Position: 6514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6514GCCGUUUUAUUCAAGUUUG69.69373839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3446532GCCGTTTTATTCAAGTTTGCAAACTTGAATAAAACGGC0.504700.296700.853400.750001.000001.00000


Target Position: 7100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7100AGCCUGGAAAUGAAAUUAA84.3731129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4607118AGCCTGGAAATGAAATTAATTAATTTCATTTCCAGGCT0.860000.201300.819000.750001.000001.00000


Target Position: 5932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5932CAAAGGUUACUAUUUUUGA88.4685637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5930-5952ACCAAAGGTTACTATTTTTGAAAUCAAAAAUAGUAACCUUUGGUCAAAGGUUACUAUUUUUGAAAU-3.317.322


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562CCCACGACAAUCUUUUUUU75.1642755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402580CCCACGACAATCTTTTTTTAAAAAAAGATTGTCGTGGG0.269200.198800.991401.000001.000001.00000


Target Position: 6669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6669GAUAGUUGUAUGAAAAUCU88.8579600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6667-6689CAGATAGTTGTATGAAAATCTGCAGAUUUUCAUACAACUAUCUGGAUAGUUGUAUGAAAAUCUGCU10.411.622


Target Position: 6898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6898CAAAAUCUGUAUAACAUUA98.713656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6896-6918AGCAAAATCTGTATAACATTATTUAAUGUUAUACAGAUUUUGCUCAAAAUCUGUAUAACAUUAUUU6.95.322


Target Position: 3397, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397CUAGAAUCUGUAUUUAAUU85.9768912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183415CTAGAATCTGTATTTAATTAATTAAATACAGATTCTAG0.516600.068200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3395-3417ATCTAGAATCTGTATTTAATTTGAAUUAAAUACAGAUUCUAGAUCUAGAAUCUGUAUUUAAUUUGU-10.316.022


Target Position: 5949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5949GAAACAUCGUGUGUUCAUU87.4538750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5947-5969TTGAAACATCGTGTGTTCATTCCAAUGAACACACGAUGUUUCAAGAAACAUCGUGUGUUCAUUCCU20.514.832


Target Position: 3467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467GUAGAAAUAUUAAAAACUA99.679938

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3465-3487TGGTAGAAATATTAAAAACTACAUAGUUUUUAAUAUUUCUACCAGUAGAAAUAUUAAAAACUACAU3.26.912


Target Position: 2644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644GAAGAAAACCUUUUUCUGU83.20941311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2642-2664AAGAAGAAAACCTTTTTCTGTGCACAGAAAAAGGUUUUCUUCUUGAAGAAAACCUUUUUCUGUGCU12.25.522


Target Position: 6513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6513UGCCGUUUUAUUCAAGUUU65.21354651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4926531TGCCGTTTTATTCAAGTTTAAACTTGAATAAAACGGCA0.556200.114100.853400.750001.000001.00000


Target Position: 4478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4478CAUUUUCAGACAGAAUUUA86.9889801

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4476-4498ACCATTTTCAGACAGAATTTATAUAAAUUCUGUCUGAAAAUGGUCAUUUUCAGACAGAAUUUAUAU5.37.422


Target Position: 5131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5131CGCUUCCAUGUGUUUUUUU75.94952606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5075149CGCTTCCATGTGTTTTTTTAAAAAAACACATGGAAGCG0.544500.110400.922401.000001.000001.00000


Target Position: 3803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3803GUUUGUUUUAUACUUUUAA88.0488682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3801-3823TAGTTTGTTTTATACTTTTAAGGUUAAAAGUAUAAAACAAACUAGUUUGUUUUAUACUUUUAAGGU4.95.622


Target Position: 5545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5545UCUCUCUCUCCUCUUUUAU68.66264027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6545563TCTCTCTCTCCTCTTTTATATAAAAGAGGAGAGAGAGA0.393200.090300.681000.750001.000001.00000


Target Position: 6355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6355AGGUAUGCUUUACAAUAAA91.9953345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7416373AGGTATGCTTTACAATAAATTTATTGTAAAGCATACCT0.501800.068800.844800.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145CAGCUAUACAGACACUAAA97.082388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1143-1165GTCAGCTATACAGACACTAAAGTUUUAGUGUCUGUAUAGCUGACCAGCUAUACAGACACUAAAGUU19.019.532


Target Position: 7104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7104UGGAAAUGAAAUUAAAAAA82.89611365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8567122TGGAAATGAAATTAAAAAATTTTTTAATTTCATTTCCA0.875700.812800.844800.750001.000001.00000


Target Position: 6488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6488GUUUGGAUUAUUUUCACAA90.2693483

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6486-6508GGGTTTGGATTATTTTCACAAGGUUGUGAAAAUAAUCCAAACCCGUUUGGAUUAUUUUCACAAGGU20.520.121


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CUUAUACCUGCUGACUUUA83.62811247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527CACTTATACCTGCTGACTTTATAUAAAGUCAGCAGGUAUAAGUGCUUAUACCUGCUGACUUUAUAU19.215.323


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529GGAAAGCGGAGCACUAGAA92.3106325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622547GGAAAGCGGAGCACTAGAATTCTAGTGCTCCGCTTTCC0.401800.176800.698301.000000.967401.00000


Target Position: 6267, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6267CAACUGAAAUUGUAUCUGA96.8123101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6265-6287TTCAACTGAAATTGTATCTGATTUCAGAUACAAUUUCAGUUGAACAACUGAAAUUGUAUCUGAUUU20.319.232


Target Position: 3396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3396UCUAGAAUCUGUAUUUAAU85.25491016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833414TCTAGAATCTGTATTTAATATTAAATACAGATTCTAGA0.216000.061400.715500.750001.000001.00000


Target Position: 3310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3310CUGGUUUAUUUUUCAUAUU79.73571885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3308-3330TACTGGTTTATTTTTCATATTTTAAUAUGAAAAAUAAACCAGUACUGGUUUAUUUUUCAUAUUUUU8.720.021


Target Position: 4414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4414GAAAGAAGUCUGAAAUCAA105.4218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4412-4434TTGAAAGAAGTCTGAAATCAAAGUUGAUUUCAGACUUCUUUCAAGAAAGAAGUCUGAAAUCAAAGU16.310.322


Target Position: 654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654CCGUUUCACGUGAUACAUA92.8699281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
652-674CCCCGTTTCACGTGATACATATTUAUGUAUCACGUGAAACGGGGCCGUUUCACGUGAUACAUAUUU16.021.133


Target Position: 5091, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5091CUAGCAAUGUAUAGUGUAU92.0374343

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5089-5111CTCTAGCAATGTATAGTGTATCTAUACACUAUACAUUGCUAGAGCUAGCAAUGUAUAGUGUAUCUU20.219.733


Target Position: 4890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4890UCUUUCUGUGUUUUUAAAU67.93834166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4434908TCTTTCTGTGTTTTTAAATATTTAAAAACACAGAAAGA0.750100.435200.715500.750001.000001.00000


Target Position: 6696, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6696GUAAAAUUUGCAUUUAUAA92.8982279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9526714GTAAAATTTGCATTTATAATTATAAATGCAAATTTTAC0.202400.074600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6694-6716CTGTAAAATTTGCATTTATAAATUUAUAAAUGCAAAUUUUACAGGUAAAAUUUGCAUUUAUAAAUU-8.0-9.722


Target Position: 6262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6262CUUUUCAACUGAAAUUGUA88.411648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6260-6282TTCTTTTCAACTGAAATTGTATCUACAAUUUCAGUUGAAAAGAACUUUUCAACUGAAAUUGUAUCU5.37.712


Target Position: 3351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351CAGAAAUAGCCACAUUCUA93.274254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3349-3371TGCAGAAATAGCCACATTCTACAUAGAAUGUGGCUAUUUCUGCACAGAAAUAGCCACAUUCUACAU19.26.922


Target Position: 3578, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578CAAUACUGCCUUUUUUUUU78.81612056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583596CAATACTGCCTTTTTTTTTAAAAAAAAAGGCAGTATTG0.643900.174900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3576-3598TTCAATACTGCCTTTTTTTTTGTAAAAAAAAAGGCAGUAUUGAACAAUACUGCCUUUUUUUUUGUU-11.311.611


Target Position: 5870, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5870GAAUGUUUUGCCUCAAAGU82.75631382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5868-5890TAGAATGTTTTGCCTCAAAGTAGACUUUGAGGCAAAACAUUCUAGAAUGUUUUGCCUCAAAGUAGU16.65.332


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741CCAAGUCCUAAAUCAUCUA90.7715441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
795759CCAAGTCCTAAATCATCTATAGATGATTTAGGACTTGG0.433100.380100.672401.000001.000001.00000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560CCUUCCGCCGCUUCCCUUC52.20176427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715578CCTTCCGCCGCTTCCCTTCGAAGGGAAGCGGCGGAAGG0.376900.117900.672400.750001.000001.00000


Target Position: 2670, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2670GGUUUUUUUGAACUUUGUU80.25581802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842688GGTTTTTTTGAACTTTGTTAACAAAGTTCAAAAAAACC0.325500.141700.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2668-2690TGGGTTTTTTTGAACTTTGTTTTAACAAAGUUCAAAAAAACCCAGGUUUUUUUGAACUUUGUUUUU17.8-1.811


Target Position: 7020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7020GUAAAUACAUUUUGUUCUA92.262332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7018-7040TTGTAAATACATTTTGTTCTATGUAGAACAAAAUGUAUUUACAAGUAAAUACAUUUUGUUCUAUGU19.21.422


Target Position: 3849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3849CUCUAAAAUGAACUUUAGU77.16162360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3847-3869TACTCTAAAATGAACTTTAGTCAACUAAAGUUCAUUUUAGAGUACUCUAAAAUGAACUUUAGUCAU9.87.123


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403UGUUCAAUUUUUUUAUUAU84.191161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9072421TGTTCAATTTTTTTATTATATAATAAAAAAATTGAACA0.434400.124800.663800.750001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566CGACAAUCUUUUUUUAUUA97.840170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922584CGACAATCTTTTTTTATTATAATAAAAAAAGATTGTCG0.246500.159300.758601.000001.000001.00000


Target Position: 4347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4347CUCAGUCAAACCAAAUCAA87.3577768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8234365CTCAGTCAAACCAAATCAATTGATTTGGTTTGACTGAG0.361600.128100.663800.750001.000001.00000


Target Position: 7016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7016CCUUGUAAAUACAUUUUGU85.5658976

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7014-7036TCCCTTGTAAATACATTTTGTTCACAAAAUGUAUUUACAAGGGACCUUGUAAAUACAUUUUGUUCU4.211.812


Target Position: 6150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6150ACACUGGCAUUUCAUCUAU79.89191862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8556168ACACTGGCATTTCATCTATATAGATGAAATGCCAGTGT0.409300.141900.663800.750001.000001.00000


Target Position: 2798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798CCAUAUCUUCGGGUAUUUA90.6376452

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2796-2818ATCCATATCTTCGGGTATTTATAUAAAUACCCGAAGAUAUGGAUCCAUAUCUUCGGGUAUUUAUAU13.913.332


Target Position: 3433, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3433CUUUUUACAUUUAUUUAUU82.33281463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3431-3453TGCTTTTTACATTTATTTATTGAAAUAAAUAAAUGUAAAAAGCACUUUUUACAUUUAUUUAUUGAU-8.00.011


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535CGGAGCACUAGAACAUACA88.0006690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062553CGGAGCACTAGAACATACATGTATGTTCTAGTGCTCCG0.366400.189300.706900.750000.913000.62500


Target Position: 6044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6044CACAUUUUUGGUUUAUGUU79.79331874

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6042-6064GACACATTTTTGGTTTATGTTTTAACAUAAACCAAAAAUGUGUCCACAUUUUUGGUUUAUGUUUUU6.95.322


Target Position: 4486, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486GACAGAAUUUAUAAAGAAU96.3214112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454504GACAGAATTTATAAAGAATATTCTTTATAAATTCTGTC0.203800.096800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4484-4506CAGACAGAATTTATAAAGAATCTAUUCUUUAUAAAUUCUGUCUGGACAGAAUUUAUAAAGAAUCUU7.119.222


Target Position: 6251, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6251GGGUUUUCUUUCUUUUCAA95.0098165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9906269GGGTTTTCTTTCTTTTCAATTGAAAAGAAAGAAAACCC0.193200.101700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6249-6271GGGGGTTTTCTTTCTTTTCAACTUUGAAAAGAAAGAAAACCCCCGGGUUUUCUUUCUUUUCAACUU12.221.222


Target Position: 6638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6638CCUUAACUAUAUCUGUCUA98.36859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7566656CCTTAACTATATCTGTCTATAGACAGATATAGTTAAGG0.376900.148300.672401.000001.000001.00000


Target Position: 809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GUUUUGUUUUUUAUAGUAU84.89291065

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
807-829TTGTTTTGTTTTTTATAGTATACAUACUAUAAAAAACAAAACAAGUUUUGUUUUUUAUAGUAUACU7.95.621


Target Position: 1253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CAAGAGAUUUAAGAAUCGA86.2069886

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1251-1273GACAAGAGATTTAAGAATCGAGAUCGAUUCUUAAAUCUCUUGUCCAAGAGAUUUAAGAAUCGAGAU21.019.123


Target Position: 4898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4898UGUUUUUAAAUUUAAGUUU69.373894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7544916TGTTTTTAAATTTAAGTTTAAACTTAAATTTAAAAACA0.263400.243400.706900.750001.000001.00000


Target Position: 4420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4420AGUCUGAAAUCAAAGUAUU84.94171056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9684438AGTCTGAAATCAAAGTATTAATACTTTGATTTCAGACT0.279900.055900.698300.750000.994600.75000


Target Position: 3875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3875GUGCUUAUGGGCCAUUACU75.3632710

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3873-3895TGGTGCTTATGGGCCATTACTTGAGUAAUGGCCCAUAAGCACCAGUGCUUAUGGGCCAUUACUUGU20.019.733


Target Position: 1446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446GUGAUUUAUGUCAAGUUGU76.00482600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1444-1466CTGTGATTTATGTCAAGTTGTATACAACUUGACAUAAAUCACAGGUGAUUUAUGUCAAGUUGUAUU16.78.922


Target Position: 6516, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6516CGUUUUAUUCAAGUUUGUU80.84851693

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6514-6536GCCGTTTTATTCAAGTTTGTTGCAACAAACUUGAAUAAAACGGCCGUUUUAUUCAAGUUUGUUGCU17.8-0.321


Target Position: 6788, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6788CUAAAAAACAAAAUUUAUU79.13581992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8566806CTAAAAAACAAAATTTATTAATAAATTTTGTTTTTTAG0.221900.227200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6786-6808ACCTAAAAAACAAAATTTATTATAAUAAAUUUUGUUUUUUAGGUCUAAAAAACAAAAUUUAUUAUU-10.3-9.111


Target Position: 4876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4876UGUACAUUAUAUUUUCUUU83.82471215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5654894TGTACATTATATTTTCTTTAAAGAAAATATAATGTACA0.700800.267100.706900.750001.000001.00000


Target Position: 2860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860GAAAUGUGUAUCAUUCGUA96.7784102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2858-2880AAGAAATGTGTATCATTCGTAACUACGAAUGAUACACAUUUCUUGAAAUGUGUAUCAUUCGUAACU21.112.122


Target Position: 6783, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6783CAAACCUAAAAAACAAAAU76.98952404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6781-6803AACAAACCTAAAAAACAAAATTTAUUUUGUUUUUUAGGUUUGUUCAAACCUAAAAAACAAAAUUUU5.618.611


Target Position: 4421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4421GUCUGAAAUCAAAGUAUUU87.6687724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9664439GTCTGAAATCAAAGTATTTAAATACTTTGATTTCAGAC0.198300.049900.819000.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4419-4441AAGTCTGAAATCAAAGTATTTGGAAAUACUUUGAUUUCAGACUUGUCUGAAAUCAAAGUAUUUGGU4.620.421


Target Position: 855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855GAAGUCUUUUUCUUUUUCU80.98331672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
853-875ACGAAGTCTTTTTCTTTTTCTTCAGAAAAAGAAAAAGACUUCGUGAAGUCUUUUUCUUUUUCUUCU5.517.711


Target Position: 3376, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3376GUUCUAAUUUUAAAUCCAA94.7253183

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3374-3396TAGTTCTAATTTTAAATCCAAATUUGGAUUUAAAAUUAGAACUAGUUCUAAUUUUAAAUCCAAAUU20.16.922


Target Position: 1349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349GAAAGAUGAGGUCUAUCUU91.7782360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1347-1369AAGAAAGATGAGGTCTATCTTAAAAGAUAGACCUCAUCUUUCUUGAAAGAUGAGGUCUAUCUUAAU20.212.033


Target Position: 3372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3372CAUAGUUCUAAUUUUAAAU87.4156757

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3370-3392CACATAGTTCTAATTTTAAATCCAUUUAAAAUUAGAACUAUGUGCAUAGUUCUAAUUUUAAAUCCU-9.114.523


Target Position: 6395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6395CCUGAGCCACUGAAAAUAA92.2801330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8426413CCTGAGCCACTGAAAATAATTATTTTCAGTGGCTCAGG0.355600.056300.810301.000001.000001.00000


Target Position: 915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915ACCCCAACAUAAAGACAAA88.4484643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562933ACCCCAACATAAAGACAAATTTGTCTTTATGTTGGGGT0.848500.204300.853400.750001.000001.00000


Target Position: 5777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5777GCUCAAUGAAAUAUCAUUU86.9119806

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5775-5797TTGCTCAATGAAATATCATTTTAAAAUGAUAUUUCAUUGAGCAAGCUCAAUGAAAUAUCAUUUUAU8.718.122


Target Position: 5734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5734GGAACUCUUAGCCCAUUUC71.07673577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5585752GGAACTCTTAGCCCATTTCGAAATGGGCTAAGAGTTCC0.723900.327800.698300.750000.918500.62500


Target Position: 3323, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3323CAUAUUUUUUAAUUGAAAA93.7293229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3321-3343TTCATATTTTTTAATTGAAAATTUUUUCAAUUAAAAAAUAUGAACAUAUUUUUUAAUUGAAAAUUU7.4-10.311


Target Position: 7106, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7106GAAAUGAAAUUAAAAAAAA95.99122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9907124GAAATGAAATTAAAAAAAATTTTTTTTAATTTCATTTC0.920700.808200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7104-7126TGGAAATGAAATTAAAAAAAAAAUUUUUUUUAAUUUCAUUUCCAGAAAUGAAAUUAAAAAAAAAAU-11.37.411


Target Position: 578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578CUUCAUUGACUCGGAAAAA83.33751293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
576-598TTCTTCATTGACTCGGAAAAAAAUUUUUCCGAGUCAAUGAAGAACUUCAUUGACUCGGAAAAAAAU20.713.832


Target Position: 4899, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4899GUUUUUAAAUUUAAGUUUU79.97661841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9304917GTTTTTAAATTTAAGTTTTAAAACTTAAATTTAAAAAC0.243400.223900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4897-4919GTGTTTTTAAATTTAAGTTTTATAAAACUUAAAUUUAAAAACACGUUUUUAAAUUUAAGUUUUAUU4.9-9.111


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485AGUUUAGCCUAUAUCCAUU86.8628815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351503AGTTTAGCCTATATCCATTAATGGATATAGGCTAAACT0.419600.413100.698300.750001.000001.00000


Target Position: 3577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3577UCAAUACUGCCUUUUUUUU68.66764026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803595TCAATACTGCCTTTTTTTTAAAAAAAAGGCAGTATTGA0.650100.195700.724100.750001.000001.00000


Target Position: 6628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6628GUUUUUUUUUCCUUAACUA91.028417

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6626-6648AAGTTTTTTTTTCCTTAACTATAUAGUUAAGGAAAAAAAAACUUGUUUUUUUUUCCUUAACUAUAU9.8-11.322


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559UCCUUCCGCCGCUUCCCUU56.21285995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
780577TCCTTCCGCCGCTTCCCTTAAGGGAAGCGGCGGAAGGA0.312300.108600.732800.750001.000001.00000


Target Position: 2380, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380GAAAAAAAUCCUGUUCAUU83.49311269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2378-2400GAGAAAAAAATCCTGTTCATTTTAAUGAACAGGAUUUUUUUCUCGAAAAAAAUCCUGUUCAUUUUU20.5-11.321


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653CCCGUUUCACGUGAUACAU74.81312815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914671CCCGTTTCACGTGATACATATGTATCACGTGAAACGGG0.209900.099700.836201.000000.983700.75000


Target Position: 5210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5210CCCCUUUCCCUUUGAAAUA79.24761977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3115228CCCCTTTCCCTTTGAAATATATTTCAAAGGGAAAGGGG0.490100.459100.948301.000000.989100.75000


Target Position: 3222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222CCAGAUUUUUUUCUAAAGU75.43932692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3220-3242GTCCAGATTTTTTTCTAAAGTTAACUUUAGAAAAAAAUCUGGACCCAGAUUUUUUUCUAAAGUUAU11.712.022


Target Position: 6667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6667CAGAUAGUUGUAUGAAAAU88.5128628

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6665-6687TACAGATAGTTGTATGAAAATCTAUUUUCAUACAACUAUCUGUACAGAUAGUUGUAUGAAAAUCUU7.418.923


Target Position: 2915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2915GAAGAUUCUUAGUAGAUUU95.7076134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2913-2935GGGAAGATTCTTAGTAGATTTGTAAAUCUACUAAGAAUCUUCCCGAAGAUUCUUAGUAGAUUUGUU14.514.823


Target Position: 5094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5094GCAAUGUAUAGUGUAUCUA91.1879402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5092-5114TAGCAATGTATAGTGTATCTATAUAGAUACACUAUACAUUGCUAGCAAUGUAUAGUGUAUCUAUAU20.313.532


Target Position: 6989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6989CAAUGUUUUUUUUCCCUUU82.34391457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9667007CAATGTTTTTTTTCCCTTTAAAGGGAAAAAAAACATTG0.725800.430200.646600.750001.000001.00000


Target Position: 2366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366GAAUAUUAAAAAGAGAAAA91.5505378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2364-2386AAGAATATTAAAAAGAGAAAAAAUUUUCUCUUUUUAAUAUUCUUGAAUAUUAAAAAGAGAAAAAAU19.1-8.021


Target Position: 5033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5033GCCAUAUAGUUUUAACUCU84.60381091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5031-5053AAGCCATATAGTTTTAACTCTGTAGAGUUAAAACUAUAUGGCUUGCCAUAUAGUUUUAACUCUGUU14.614.032


Target Position: 3527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3527AGGAAAGCUGAUGAUAUAA88.256662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893545AGGAAAGCTGATGATATAATTATATCATCAGCTTTCCT0.193500.067300.810300.750001.000001.00000


Target Position: 5850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5850CCUUUUUUGAAAGAAAAAU71.8313427

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5848-5870GGCCTTTTTTGAAAGAAAAATAGAUUUUUCUUUCAAAAAAGGCCCCUUUUUUGAAAGAAAAAUAGU5.5-5.911


Target Position: 5733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5733GGGAACUCUUAGCCCAUUU78.97552024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9065751GGGAACTCTTAGCCCATTTAAATGGGCTAAGAGTTCCC0.700800.050000.991401.000000.918500.75000


Target Position: 4894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4894UCUGUGUUUUUAAAUUUAA80.67111719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9114912TCTGTGTTTTTAAATTTAATTAAATTTAAAAACACAGA0.399900.208000.689700.750001.000001.00000


Target Position: 3839, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3839GCCUUAUAUACUCUAAAAU86.7863826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763857GCCTTATATACTCTAAAATATTTTAGAGTATATAAGGC0.254900.041800.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3837-3859GGGCCTTATATACTCTAAAATGAAUUUUAGAGUAUAUAAGGCCCGCCUUAUAUACUCUAAAAUGAU7.112.322


Target Position: 3223, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223CAGAUUUUUUUCUAAAGUU86.0138907

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3221-3243TCCAGATTTTTTTCTAAAGTTACAACUUUAGAAAAAAAUCUGGACAGAUUUUUUUCUAAAGUUACU9.85.322


Target Position: 2441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441CCUUGUAAAAUAUCUAUAA96.7629103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432459CCTTGTAAAATATCTATAATTATAGATATTTTACAAGG0.346700.108800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2439-2461AACCTTGTAAAATATCTATAAATUUAUAGAUAUUUUACAAGGUUCCUUGUAAAAUAUCUAUAAAUU8.211.821


Target Position: 5455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5455GAUAUCGAAUAGAUUAAAU92.0114344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5453-5475AGGATATCGAATAGATTAAATTTAUUUAAUCUAUUCGAUAUCCUGAUAUCGAAUAGAUUAAAUUUU2.117.823


Target Position: 6180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6180CUUUUUAAAGGAUUUAACU76.86262435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6178-6200TCCTTTTTAAAGGATTTAACTTTAGUUAAAUCCUUUAAAAAGGACUUUUUAAAGGAUUUAACUUUU-0.3-9.122


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509CUCCCUCCCUCCUACCCAU75.64062659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864527CTCCCTCCCTCCTACCCATATGGGTAGGAGGGAGGGAG0.915700.895100.655200.750001.000001.00000


Target Position: 1292, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292GCUAGAUCACUGUAACAUA103.81512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1290-1312AAGCTAGATCACTGTAACATAGTUAUGUUACAGUGAUCUAGCUUGCUAGAUCACUGUAACAUAGUU14.620.233


Target Position: 6896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6896AGCAAAAUCUGUAUAACAU88.5638624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9876914AGCAAAATCTGTATAACATATGTTATACAGATTTTGCT0.193900.106300.698300.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GUCUUGAAGGAGAAAUAUA94.8184177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
782-804CTGTCTTGAAGGAGAAATATATCUAUAUUUCUCCUUCAAGACAGGUCUUGAAGGAGAAAUAUAUCU1.820.422


Target Position: 5343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5343CUUUGUUUUGGUUCUGAAU78.62952093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5341-5363GCCTTTGTTTTGGTTCTGAATGTAUUCAGAACCAAAACAAAGGCCUUUGUUUUGGUUCUGAAUGUU20.45.622


Target Position: 2569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569CAAUCUUUUUUUAUUAAAA96.1874116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2567-2589GACAATCTTTTTTTATTAAAAGTUUUUAAUAAAAAAAGAUUGUCCAAUCUUUUUUUAUUAAAAGUU-7.55.322


Target Position: 6760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6760CGUGACCACUUCCAUCUUA91.8266355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3676778CGTGACCACTTCCATCTTATAAGATGGAAGTGGTCACG0.561200.206200.741401.000000.978300.75000


Target Position: 3800, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3800CUAGUUUGUUUUAUACUUU84.73631078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333818CTAGTTTGTTTTATACTTTAAAGTATAAAACAAACTAG0.467000.169700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3798-3820GACTAGTTTGTTTTATACTTTTAAAAGUAUAAAACAAACUAGUCCUAGUUUGUUUUAUACUUUUAU6.311.822


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351GGUCACGUUUGGAAAGAAU86.634839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992369GGTCACGTTTGGAAAGAATATTCTTTCCAAACGTGACC0.283100.252800.844801.000001.000001.00000


Target Position: 6870, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6870GCAAAUCUGUCUUGAUAUA96.1313118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6868-6890GTGCAAATCTGTCTTGATATAAAUAUAUCAAGACAGAUUUGCACGCAAAUCUGUCUUGAUAUAAAU8.712.022


Target Position: 3913, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3913GCACAAUCAGUUGUACUUU82.8511371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3911-3933AGGCACAATCAGTTGTACTTTACAAAGUACAACUGAUUGUGCCUGCACAAUCAGUUGUACUUUACU19.020.532


Target Position: 1555, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555CUGAUACUGCUGUAUUAAA94.8576176

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7155519CTGATACTGCTGTATTAAA1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119634909..119634927(-)00GSK3B(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1553-1575TCCTGATACTGCTGTATTAAAACUUUAAUACAGCAGUAUCAGGACUGAUACUGCUGUAUUAAAACU1.420.332


Target Position: 1678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CUGAUUAUACCUCUAGUAU86.1187897

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1676-1698CACTGATTATACCTCTAGTATAGAUACUAGAGGUAUAAUCAGUGCUGAUUAUACCUCUAGUAUAGU20.18.732


Target Position: 5849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5849GCCUUUUUUGAAAGAAAAA84.16381168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5847-5869AGGCCTTTTTTGAAAGAAAAATAUUUUUCUUUCAAAAAAGGCCUGCCUUUUUUGAAAGAAAAAUAU5.59.521


Target Position: 2029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029CACAUUCAUUUUUUGAUGA85.5455978

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2027-2049TGCACATTCATTTTTTGATGAATUCAUCAAAAAAUGAAUGUGCACACAUUCAUUUUUUGAUGAAUU13.820.522


Target Position: 5497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5497CUAACCAUGGGUCUUAAAA82.48251438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5495-5517CCCTAACCATGGGTCTTAAAAACUUUUAAGACCCAUGGUUAGGGCUAACCAUGGGUCUUAAAAACU7.120.033


Target Position: 581, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CAUUGACUCGGAAAAAAAA95.3797149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
579-601TTCATTGACTCGGAAAAAAAATCUUUUUUUUCCGAGUCAAUGAACAUUGACUCGGAAAAAAAAUCU-11.319.222


Target Position: 4686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4686GCUUUUCUCUCAUUUCAUU86.7117833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6434704GCTTTTCTCTCATTTCATTAATGAAATGAGAGAAAAGC0.301800.089400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4684-4706ACGCTTTTCTCTCATTTCATTGTAAUGAAAUGAGAGAAAAGCGUGCUUUUCUCUCAUUUCAUUGUU7.210.322


Target Position: 6046, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6046CAUUUUUGGUUUAUGUUUU81.69981562

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6044-6066CACATTTTTGGTTTATGTTTTAAAAAACAUAAACCAAAAAUGUGCAUUUUUGGUUUAUGUUUUAAU6.9-3.322


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497CCCUCCCUCCCUCUCCCUC51.04996521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
686515CCCTCCCTCCCTCTCCCTCGAGGGAGAGGGAGGGAGGG0.925800.748500.681000.750001.000001.00000


Target Position: 6397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6397UGAGCCACUGAAAAUAAAA82.52741425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6856415TGAGCCACTGAAAATAAAATTTTATTTTCAGTGGCTCA0.538300.076800.724100.750001.000001.00000


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183UGCUUCAACCCCCACAAAU67.61954230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4262201TGCTTCAACCCCCACAAATATTTGTGGGGGTTGAAGCA0.819100.138400.844800.750001.000001.00000


Target Position: 5256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5256CCCUUCCACAGUUAAGUUU71.88793408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9045274CCCTTCCACAGTTAAGTTTAAACTTAACTGTGGAAGGG0.212100.068100.991401.000001.000001.00000


Target Position: 1773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773GAUCAGUUGGUAGAAAUAA92.9915273

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1771-1793TGGATCAGTTGGTAGAAATAATCUUAUUUCUACCAACUGAUCCAGAUCAGUUGGUAGAAAUAAUCU6.919.222


Target Position: 5132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5132GCUUCCAUGUGUUUUUUUU81.01211667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5195150GCTTCCATGTGTTTTTTTTAAAAAAAACACATGGAAGC0.704900.107500.853401.000001.000001.00000


Target Position: 1818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818GAGCAAAUCAGAGAAAUGA89.0947583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1816-1838GGGAGCAAATCAGAGAAATGAACUCAUUUCUCUGAUUUGCUCCCGAGCAAAUCAGAGAAAUGAACU12.018.522


Target Position: 3754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3754GAGAAUUGAAGGACUAUGU82.34411456

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3752-3774AGGAGAATTGAAGGACTATGTTTACAUAGUCCUUCAAUUCUCCUGAGAAUUGAAGGACUAUGUUUU20.312.031


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353UCACGUUUGGAAAGAAUAU73.17613136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672371TCACGTTTGGAAAGAATATATATTCTTTCCAAACGTGA0.296200.230100.681000.750001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182CUGCUUCAACCCCCACAAA81.9171523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882200CTGCTTCAACCCCCACAAATTTGTGGGGGTTGAAGCAG0.778100.075400.784500.750001.000001.00000


Target Position: 883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883GAACUUAAUGCUGCAUUUA90.3474473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
881-903GAGAACTTAATGCTGCATTTATCUAAAUGCAGCAUUAAGUUCUCGAACUUAAUGCUGCAUUUAUCU20.04.922


Target Position: 5790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5790UCAUUUUAAUUUCUUUUAA80.53881738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9635808TCATTTTAATTTCTTTTAATTAAAAGAAATTAAAATGA0.312300.042900.689700.750001.000001.00000


Target Position: 805, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GCUUGUUUUGUUUUUUAUA90.3842469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
803-825TCGCTTGTTTTGTTTTTTATAGTUAUAAAAAACAAAACAAGCGAGCUUGUUUUGUUUUUUAUAGUU-9.710.322


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369ACACAUAGUUCUAAUUUUA93.805224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953387ACACATAGTTCTAATTTTATAAAATTAGAACTATGTGT0.192200.056700.672400.750001.000001.00000


Target Position: 2934, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934GUUAAGGUUUUGUUUUGCU73.71273041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2932-2954TTGTTAAGGTTTTGTTTTGCTCTAGCAAAACAAAACCUUAACAAGUUAAGGUUUUGUUUUGCUCUU21.118.623


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753UCAUCUAUAUGUUAAAUAU89.538548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
670771TCATCTATATGTTAAATATATATTTAACATATAGATGA0.363300.267300.681000.750001.000001.00000


Target Position: 5069, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5069CUGUAUUAUUGUAACAAUA97.006493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5067-5089GCCTGTATTATTGTAACAATAACUAUUGUUACAAUAAUACAGGCCUGUAUUAUUGUAACAAUAACU6.98.533


Target Position: 2782, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2782CACUUGUAAAAUUAAUCCA87.427754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2780-2802GTCACTTGTAAAATTAATCCATAUGGAUUAAUUUUACAAGUGACCACUUGUAAAAUUAAUCCAUAU15.519.032


Target Position: 4823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4823GAAUAUCUUUUUGUAUAUA99.161345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4821-4843CTGAATATCTTTTTGTATATAATUAUAUACAAAAAGAUAUUCAGGAAUAUCUUUUUGUAUAUAAUU8.26.622


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522ACCCAUCCCCCUUUCUCUU65.32574634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549540ACCCATCCCCCTTTCTCTTAAGAGAAAGGGGGATGGGT0.613200.576300.715500.750001.000001.00000


Target Position: 6353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6353GUAGGUAUGCUUUACAAUA96.504109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6351-6373AAGTAGGTATGCTTTACAATAAAUAUUGUAAAGCAUACCUACUUGUAGGUAUGCUUUACAAUAAAU6.919.822


Target Position: 629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629CUCAUUUUCAAUCAAGUAU76.1262580

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
627-649TACTCATTTTCAATCAAGTATTTAUACUUGAUUGAAAAUGAGUACUCAUUUUCAAUCAAGUAUUUU20.37.422


Target Position: 568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568CGCUUCCCUUCUUCAUUGA80.20591806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972586CGCTTCCCTTCTTCATTGATCAATGAAGAAGGGAAGCG0.298500.149000.698300.750001.000001.00000


Target Position: 5879, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5879GCCUCAAAGUAGUCCAUAU94.9264171

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3587919GCCTCAAAGTAGTCCATAT1/1/0/0100.00GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119542023..119542041(-)00GSK3B(0.002)


Target Position: 5135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5135UCCAUGUGUUUUUUUUUUU65.57334599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3515153TCCATGTGTTTTTTTTTTTAAAAAAAAAAACACATGGA0.637400.167300.870700.750001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356CGUUUGGAAAGAAUAUUAA93.1702261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7342374CGTTTGGAAAGAATATTAATTAATATTCTTTCCAAACG0.271300.206900.741401.000001.000001.00000


Target Position: 6241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6241GGAAUUUGGGGGGUUUUCU70.11673756

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6239-6261CAGGAATTTGGGGGGTTTTCTTTAGAAAACCCCCCAAAUUCCUGGGAAUUUGGGGGGUUUUCUUUU21.27.422


Target Position: 4869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4869UCAAGCUUGUACAUUAUAU79.11172000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6834887TCAAGCTTGTACATTATATATATAATGTACAAGCTTGA0.315900.157800.681000.750001.000001.00000


Target Position: 5209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5209CCCCCUUUCCCUUUGAAAU72.05523383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3155227CCCCCTTTCCCTTTGAAATATTTCAAAGGGAAAGGGGG0.487900.459800.982801.000000.989100.62500


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655CGUUUCACGUGAUACAUAU90.5018464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
605673CGTTTCACGTGATACATATATATGTATCACGTGAAACG0.316200.113800.732801.000000.994600.75000


Target Position: 3539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3539GAUAUAAAUGUGUGUAUAU96.882698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3537-3559ATGATATAAATGTGTGTATATATAUAUACACACAUUUAUAUCAUGAUAUAAAUGUGUGUAUAUAUU15.8-8.021


Target Position: 6154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6154UGGCAUUUCAUCUAUUUUU73.12553145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3346172TGGCATTTCATCTATTTTTAAAAATAGATGAAATGCCA0.531200.308900.844800.750001.000001.00000


Target Position: 4751, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4751GUGUGAUUUUUCUUUCUCA95.9238130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4749-4771ATGTGTGATTTTTCTTTCTCAAGUGAGAAAGAAAAAUCACACAUGUGUGAUUUUUCUUUCUCAAGU19.120.522


Target Position: 6892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6892GAAAAGCAAAAUCUGUAUA90.5643458

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6890-6912AGGAAAAGCAAAATCTGTATAACUAUACAGAUUUUGCUUUUCCUGAAAAGCAAAAUCUGUAUAACU20.318.621


Target Position: 2682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682CUUUGUUUUCUUUUAAAGU74.17012940

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2680-2702AACTTTGTTTTCTTTTAAAGTCTACUUUAAAAGAAAACAAAGUUCUUUGUUUUCUUUUAAAGUCUU-3.85.621


Target Position: 6890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6890AGGAAAAGCAAAAUCUGUA88.3711650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8246908AGGAAAAGCAAAATCTGTATACAGATTTTGCTTTTCCT0.236700.089600.663800.750001.000001.00000


Target Position: 6849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6849CAAACUAUUGCAAACACUU85.08471041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6847-6869TACAAACTATTGCAAACACTTGTAAGUGUUUGCAAUAGUUUGUACAAACUAUUGCAAACACUUGUU17.84.622


Target Position: 4873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4873GCUUGUACAUUAUAUUUUC80.95551674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9374891GCTTGTACATTATATTTTCGAAAATATAATGTACAAGC0.502800.182200.681000.750001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565CGCCGCUUCCCUUCUUCAU73.20783129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417583CGCCGCTTCCCTTCTTCATATGAAGAAGGGAAGCGGCG0.428300.157000.767201.000001.000001.00000


Target Position: 6953, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6953CAUUUUAAAUAUAAACUUU91.2108401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8566971CATTTTAAATATAAACTTTAAAGTTTATATTTAAAATG0.241400.195600.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6951-6973TTCATTTTAAATATAAACTTTTTAAAGUUUAUAUUUAAAAUGAACAUUUUAAAUAUAAACUUUUUU4.9-9.722


Target Position: 3713, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3713CUCUCUUUUUGAAGAAAAA89.5221552

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3711-3733GTCTCTCTTTTTGAAGAAAAAGCUUUUUCUUCAAAAAGAGAGACCUCUCUUUUUGAAGAAAAAGCU5.519.112


Target Position: 5882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5882UCAAAGUAGUCCAUAUAAA88.6384616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6225900TCAAAGTAGTCCATATAAATTTATATGGACTACTTTGA0.661400.088600.724100.750001.000001.00000


Target Position: 3914, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3914CACAAUCAGUUGUACUUUA96.614107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3912-3934GGCACAATCAGTTGTACTTTACAUAAAGUACAACUGAUUGUGCCCACAAUCAGUUGUACUUUACAU12.920.532


Target Position: 6762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6762UGACCACUUCCAUCUUAAA88.6122619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7096780TGACCACTTCCATCTTAAATTTAAGATGGAAGTGGTCA0.607600.274400.724100.750000.978300.62500


Target Position: 6588, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6588GUUAGCUUGACAAAGUAGA77.98242216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6586-6608GGGTTAGCTTGACAAAGTAGACTUCUACUUUGUCAAGCUAACCCGUUAGCUUGACAAAGUAGACUU9.818.332


Target Position: 3406, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406GUAUUUAAUUUGUUUUUUA95.4199146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283424GTATTTAATTTGTTTTTTATAAAAAACAAATTAAATAC0.459300.378700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3404-3426CTGTATTTAATTTGTTTTTTAACUAAAAAACAAAUUAAAUACAGGUAUUUAAUUUGUUUUUUAACU-1.8-7.511


Target Position: 5903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5903GUCUUGAAUAGAAGAAAAA89.6451539

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5901-5923ATGTCTTGAATAGAAGAAAAAACUUUUUCUUCUAUUCAAGACAUGUCUUGAAUAGAAGAAAAAACU5.520.422


Target Position: 4477, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4477CCAUUUUCAGACAGAAUUU82.88821368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6784495CCATTTTCAGACAGAATTTAAATTCTGTCTGAAAATGG0.481300.077300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4475-4497GACCATTTTCAGACAGAATTTATAAAUUCUGUCUGAAAAUGGUCCCAUUUUCAGACAGAAUUUAUU12.07.422


Target Position: 928, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928GACAAAAGGAAGAAAAGGA87.9062698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
926-948AAGACAAAAGGAAGAAAAGGAGGUCCUUUUCUUCCUUUUGUCUUGACAAAAGGAAGAAAAGGAGGU18.710.322


Target Position: 6911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6911ACAUUAUUACUACUUGAAU83.00781350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5806929ACATTATTACTACTTGAATATTCAAGTAGTAATAATGT0.326800.108000.698300.750001.000001.00000


Target Position: 6249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6249GGGGGUUUUCUUUCUUUUC68.00674156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9566267GGGGGTTTTCTTTCTTTTCGAAAAGAAAGAAAACCCCC0.272500.096600.819000.750001.000001.00000


Target Position: 2637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637CACAAAAGAAGAAAACCUU82.6051411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2635-2657TCCACAAAAGAAGAAAACCTTTTAAGGUUUUCUUCUUUUGUGGACACAAAAGAAGAAAACCUUUUU17.310.322


Target Position: 4338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4338GGAAACAUGCUCAGUCAAA94.0304217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244356GGAAACATGCTCAGTCAAATTTGACTGAGCATGTTTCC0.207300.122600.870701.000001.000001.00000


Target Position: 2426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426GUUGUUCUUAUUUAACCUU76.98482405

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2424-2446TTGTTGTTCTTATTTAACCTTGTAAGGUUAAAUAAGAACAACAAGUUGUUCUUAUUUAACCUUGUU18.619.232


Target Position: 1830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830GAAAUGAACCCAAACUACA92.2297334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1828-1850GAGAAATGAACCCAAACTACACAUGUAGUUUGGGUUCAUUUCUCGAAAUGAACCCAAACUACACAU12.97.421


Target Position: 567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
567CCGCUUCCCUUCUUCAUUG68.77344009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640585CCGCTTCCCTTCTTCATTGCAATGAAGAAGGGAAGCGG0.303700.135400.767200.750001.000001.00000


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992ACACCAACUGCCCGACUAA86.03905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282010ACACCAACTGCCCGACTAATTAGTCGGGCAGTTGGTGT0.205700.154300.672400.750001.000001.00000


Target Position: 5024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5024CUUUUUAAAGCCAUAUAGU77.25792343

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5022-5044AGCTTTTTAAAGCCATATAGTTTACUAUAUGGCUUUAAAAAGCUCUUUUUAAAGCCAUAUAGUUUU4.9-9.122


Target Position: 2773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773CUUAAAUGUCACUUGUAAA95.2487155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2771-2793GACTTAAATGTCACTTGTAAAATUUUACAAGUGACAUUUAAGUCCUUAAAUGUCACUUGUAAAAUU11.8-1.422


Target Position: 3807, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3807GUUUUAUACUUUUAAGGUU84.9941051

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3805-3827TTGTTTTATACTTTTAAGGTTGGAACCUUAAAAGUAUAAAACAAGUUUUAUACUUUUAAGGUUGGU18.6-7.522


Target Position: 6868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6868GUGCAAAUCUGUCUUGAUA95.7967132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6866-6888TTGTGCAAATCTGTCTTGATATAUAUCAAGACAGAUUUGCACAAGUGCAAAUCUGUCUUGAUAUAU20.420.022


Target Position: 3683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3683GUGUAUCAGUGAACGAUGU81.06611663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3681-3703TTGTGTATCAGTGAACGATGTTAACAUCGUUCACUGAUACACAAGUGUAUCAGUGAACGAUGUUAU21.121.533


Target Position: 6258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6258CUUUCUUUUCAACUGAAAU80.0981821

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6256-6278TTCTTTCTTTTCAACTGAAATTGAUUUCAGUUGAAAAGAAAGAACUUUCUUUUCAACUGAAAUUGU19.25.522


Target Position: 2463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463CAAACCAAUUUCAUUGUAU86.8765813

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2461-2483TACAAACCAATTTCATTGTATTCAUACAAUGAAAUUGGUUUGUACAAACCAAUUUCAUUGUAUUCU13.518.822


Target Position: 4685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4685CGCUUUUCUCUCAUUUCAU85.2851008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4683-4705CACGCTTTTCTCTCATTTCATTGAUGAAAUGAGAGAAAAGCGUGCGCUUUUCUCUCAUUUCAUUGU13.821.032


Target Position: 5304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5304GGAAAUCAUAUUCGUAAUU81.27381627

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5302-5324GAGGAAATCATATTCGTAATTTCAAUUACGAAUAUGAUUUCCUCGGAAAUCAUAUUCGUAAUUUCU16.516.322


Target Position: 4891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4891CUUUCUGUGUUUUUAAAUU81.10461657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4889-4911TTCTTTCTGTGTTTTTAAATTTAAAUUUAAAAACACAGAAAGAACUUUCUGUGUUUUUAAAUUUAU-9.719.211


Target Position: 5594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5594AGAAUUGUUUUUUUAUAAA89.8497521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9355612AGAATTGTTTTTTTATAAATTTATAAAAAAACAATTCT0.205000.048300.724100.750001.000001.00000


Target Position: 4943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4943CCCAGGAACUGUUAUUAAU87.0275797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9094961CCCAGGAACTGTTATTAATATTAATAACAGTTCCTGGG0.367100.049500.982801.000000.978300.75000


Target Position: 4897, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4897GUGUUUUUAAAUUUAAGUU78.41512126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9594915GTGTTTTTAAATTTAAGTTAACTTAAATTTAAAAACAC0.270900.198900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4895-4917CTGTGTTTTTAAATTTAAGTTTTAACUUAAAUUUAAAAACACAGGUGUUUUUAAAUUUAAGUUUUU4.95.621


Target Position: 3973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3973ACCCGCUCCUUCCCCACAU62.58855111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153991ACCCGCTCCTTCCCCACATATGTGGGGAAGGAGCGGGT0.675300.060900.698300.750001.000001.00000


Target Position: 2573, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573CUUUUUUUAUUAAAAGUCU76.58192482

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2571-2593ATCTTTTTTTATTAAAAGTCTGCAGACUUUUAAUAAAAAAAGAUCUUUUUUUAUUAAAAGUCUGCU13.3-11.321


Target Position: 6796, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6796CAAAAUUUAUUAUAUAUAU95.6647136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6794-6816AACAAAATTTATTATATATATATAUAUAUAUAAUAAAUUUUGUUCAAAAUUUAUUAUAUAUAUAUU-6.4-12.011


Target Position: 3670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3670GUCUGUUUUCUUUGUGUAU82.61341410

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3668-3690GTGTCTGTTTTCTTTGTGTATCAAUACACAAAGAAAACAGACACGUCUGUUUUCUUUGUGUAUCAU20.419.222


Target Position: 4404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4404GCUAAGAUUUGAAAGAAGU81.38931612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4402-4424AAGCTAAGATTTGAAAGAAGTCTACUUCUUUCAAAUCUUAGCUUGCUAAGAUUUGAAAGAAGUCUU10.311.622


Target Position: 5302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5302GAGGAAAUCAUAUUCGUAA97.62276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5300-5322AAGAGGAAATCATATTCGTAATTUUACGAAUAUGAUUUCCUCUUGAGGAAAUCAUAUUCGUAAUUU16.518.723


Target Position: 6759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6759GCGUGACCACUUCCAUCUU82.50261436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5396777GCGTGACCACTTCCATCTTAAGATGGAAGTGGTCACGC0.555400.103400.784501.000000.945700.62500


Target Position: 5614, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5614CGAAGUUUCUUAAUAGUAU93.2984253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5612-5634ATCGAAGTTTCTTAATAGTATCAAUACUAUUAAGAAACUUCGAUCGAAGUUUCUUAAUAGUAUCAU6.313.322


Target Position: 4490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4490GAAUUUAUAAAGAAUCUGA95.3991147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4488-4510CAGAATTTATAAAGAATCTGAAAUCAGAUUCUUUAUAAAUUCUGGAAUUUAUAAAGAAUCUGAAAU20.4-10.322


Target Position: 5670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5670GCAAUUACUAGCAGUUACU81.57031588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5668-5690GTGCAATTACTAGCAGTTACTGCAGUAACUGCUAGUAAUUGCACGCAAUUACUAGCAGUUACUGCU19.06.933


Target Position: 7105, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7105GGAAAUGAAAUUAAAAAAA90.8018440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1807123GGAAATGAAATTAAAAAAATTTTTTTAATTTCATTTCC0.900100.810300.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7103-7125CTGGAAATGAAATTAAAAAAAAAUUUUUUUAAUUUCAUUUCCAGGGAAAUGAAAUUAAAAAAAAAU-9.116.321


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504UCCCUCUCCCUCCCUCCUA62.06335192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572522TCCCTCTCCCTCCCTCCTATAGGAGGGAGGGAGAGGGA0.965100.899600.698300.750001.000001.00000


Target Position: 3432, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3432GCUUUUUACAUUUAUUUAU83.08151332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3933450GCTTTTTACATTTATTTATATAAATAAATGTAAAAAGC0.439400.242900.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3430-3452ATGCTTTTTACATTTATTTATTGAUAAAUAAAUGUAAAAAGCAUGCUUUUUACAUUUAUUUAUUGU-7.5-3.821


Target Position: 4612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4612CCAUAAAAAUCAGUGCUUA93.4805242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5424630CCATAAAAATCAGTGCTTATAAGCACTGATTTTTATGG0.346800.130600.810301.000001.000001.00000


Target Position: 3956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3956GGCCGCCUUUCCCUCCUAC63.84434908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233974GGCCGCCTTTCCCTCCTACGTAGGAGGGAAAGGCGGCC0.235900.143600.819000.750000.967400.62500


Target Position: 6904, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6904CUGUAUAACAUUAUUACUA93.6525233

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6902-6924ATCTGTATAACATTATTACTACTUAGUAAUAAUGUUAUACAGAUCUGUAUAACAUUAUUACUACUU6.38.522


Target Position: 4662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662GGUAAAAGAAGAGAGAAAA93.38245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4660-4682GGGGTAAAAGAAGAGAGAAAAGTUUUUCUCUCUUCUUUUACCCCGGUAAAAGAAGAGAGAAAAGUU19.14.911


Target Position: 3920, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3920CAGUUGUACUUUACAUUUA96.955195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3918-3940ATCAGTTGTACTTTACATTTAAAUAAAUGUAAAGUACAACUGAUCAGUUGUACUUUACAUUUAAAU6.919.023


Target Position: 2918, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2918GAUUCUUAGUAGAUUUGUU95.3763150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2916-2938AAGATTCTTAGTAGATTTGTTAAAACAAAUCUACUAAGAAUCUUGAUUCUUAGUAGAUUUGUUAAU14.86.933


Target Position: 7001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7001UCCCUUUCCCCAUUCCCUU57.66045802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5577019TCCCTTTCCCCATTCCCTTAAGGGAATGGGGAAAGGGA0.339100.352200.732800.750001.000001.00000


Target Position: 1448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448GAUUUAUGUCAAGUUGUAU90.6613447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1446-1468GTGATTTATGTCAAGTTGTATATAUACAACUUGACAUAAAUCACGAUUUAUGUCAAGUUGUAUAUU19.0-1.822


Target Position: 5139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5139UGUGUUUUUUUUUUUAAUU70.71493643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8515157TGTGTTTTTTTTTTTAATTAATTAAAAAAAAAAACACA0.336300.179600.698300.750001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CCACAAGAAGUCAGCUAUA94.3281199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591152CCACAAGAAGTCAGCTATATATAGCTGACTTCTTGTGG0.298400.102400.801701.000001.000001.00000


Target Position: 3466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3466GGUAGAAAUAUUAAAAACU87.9471696

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3464-3486ATGGTAGAAATATTAAAAACTACAGUUUUUAAUAUUUCUACCAUGGUAGAAAUAUUAAAAACUACU0.014.622


Target Position: 5759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5759CCCGCCAUCUCUACCCUUG62.27445154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4575777CCCGCCATCTCTACCCTTGCAAGGGTAGAGATGGCGGG0.769000.698700.844800.750001.000001.00000


Target Position: 3404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3404CUGUAUUUAAUUUGUUUUU74.212929

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3402-3424ATCTGTATTTAATTTGTTTTTTAAAAAACAAAUUAAAUACAGAUCUGUAUUUAAUUUGUUUUUUAU5.66.921


Target Position: 3431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3431UGCUUUUUACAUUUAUUUA83.75161227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5883449TGCTTTTTACATTTATTTATAAATAAATGTAAAAAGCA0.438700.251900.819000.750001.000001.00000


Target Position: 4358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4358CAAAUCAAACAAAUUGAAU82.0741502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4356-4378ACCAAATCAAACAAATTGAATTTAUUCAAUUUGUUUGAUUUGGUCAAAUCAAACAAAUUGAAUUUU7.47.422


Target Position: 3370, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3370CACAUAGUUCUAAUUUUAA95.9561124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973388CACATAGTTCTAATTTTAATTAAAATTAGAACTATGTG0.192200.048100.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3368-3390TACACATAGTTCTAATTTTAAATUUAAAAUUAGAACUAUGUGUACACAUAGUUCUAAUUUUAAAUU-9.719.022


Target Position: 4312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4312CUGGAUAUAUCAGAGUUUA91.1531405

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4310-4332CTCTGGATATATCAGAGTTTATGUAAACUCUGAUAUAUCCAGAGCUGGAUAUAUCAGAGUUUAUGU17.721.232


Target Position: 3302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3302GUCAUCUACUGGUUUAUUU82.3351462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3300-3322CAGTCATCTACTGGTTTATTTTTAAAUAAACCAGUAGAUGACUGGUCAUCUACUGGUUUAUUUUUU-0.321.432


Target Position: 3756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3756GAAUUGAAGGACUAUGUUU90.9795422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3754-3776GAGAATTGAAGGACTATGTTTGCAAACAUAGUCCUUCAAUUCUCGAAUUGAAGGACUAUGUUUGCU11.67.422


Target Position: 665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665GAUACAUAUUUUUUUAGGA92.2866328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
663-685GTGATACATATTTTTTTAGGATTUCCUAAAAAAAUAUGUAUCACGAUACAUAUUUUUUUAGGAUUU11.08.222


Target Position: 6938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6938GACUGAUUUUUUUUUCAUU89.686535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6936-6958GTGACTGATTTTTTTTTCATTTTAAUGAAAAAAAAAUCAGUCACGACUGAUUUUUUUUUCAUUUUU7.419.211


Target Position: 6616, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6616GUUAAUUUUUAAGUUUUUU74.53132866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9316634GTTAATTTTTAAGTTTTTTAAAAAACTTAAAAATTAAC0.356000.284900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6614-6636GTGTTAATTTTTAAGTTTTTTTTAAAAAACUUAAAAAUUAACACGUUAAUUUUUAAGUUUUUUUUU3.2-9.710


Target Position: 5305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5305GAAAUCAUAUUCGUAAUUU83.89871205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5303-5325AGGAAATCATATTCGTAATTTCAAAAUUACGAAUAUGAUUUCCUGAAAUCAUAUUCGUAAUUUCAU6.97.233


Target Position: 4353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4353CAAACCAAAUCAAACAAAU84.43121118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4351-4373GTCAAACCAAATCAAACAAATTGAUUUGUUUGAUUUGGUUUGACCAAACCAAAUCAAACAAAUUGU5.618.812


Target Position: 6931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6931CCUCUGUGACUGAUUUUUU83.71891233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9916949CCTCTGTGACTGATTTTTTAAAAAATCAGTCACAGAGG0.193100.115400.844801.000001.000001.00000


Target Position: 6897, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6897GCAAAAUCUGUAUAACAUU88.0119688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7776915GCAAAATCTGTATAACATTAATGTTATACAGATTTTGC0.255000.130600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6895-6917AAGCAAAATCTGTATAACATTATAAUGUUAUACAGAUUUUGCUUGCAAAAUCUGUAUAACAUUAUU6.77.432


Target Position: 2361, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361GGAAAGAAUAUUAAAAAGA89.4221555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212379GGAAAGAATATTAAAAAGATCTTTTTAATATTCTTTCC0.301500.186400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2359-2381TTGGAAAGAATATTAAAAAGAGAUCUUUUUAAUAUUCUUUCCAAGGAAAGAAUAUUAAAAAGAGAU-3.814.812


Target Position: 1733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733GUUACUAGGACAACCAAUA89.5849545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1731-1753CTGTTACTAGGACAACCAATATTUAUUGGUUGUCCUAGUAACAGGUUACUAGGACAACCAAUAUUU18.811.333


Target Position: 523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
523CCCAUCCCCCUUUCUCUUC53.04756356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
612541CCCATCCCCCTTTCTCTTCGAAGAGAAAGGGGGATGGG0.610800.570100.819000.750001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184GCUUCAACCCCCACAAAUG75.02972774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322202GCTTCAACCCCCACAAATGCATTTGTGGGGGTTGAAGC0.655700.503000.698300.750001.000001.00000


Target Position: 5593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5593GAGAAUUGUUUUUUUAUAA97.796271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5591-5613CAGAGAATTGTTTTTTTATAAATUUAUAAAAAAACAAUUCUCUGGAGAAUUGUUUUUUUAUAAAUU-7.512.022


Target Position: 3841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3841CUUAUAUACUCUAAAAUGA92.053341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3839-3861GCCTTATATACTCTAAAATGAACUCAUUUUAGAGUAUAUAAGGCCUUAUAUACUCUAAAAUGAACU-1.4-5.922


Target Position: 5758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5758UCCCGCCAUCUCUACCCUU62.08965188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5205776TCCCGCCATCTCTACCCTTAAGGGTAGAGATGGCGGGA0.871700.688400.732800.750001.000001.00000


Target Position: 4855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4855GCUCCUCACCAAAUUCAAG76.1632577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8674873GCTCCTCACCAAATTCAAGCTTGAATTTGGTGAGGAGC0.321400.123900.715500.750001.000001.00000


Target Position: 6877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6877UGUCUUGAUAUAAAGGAAA81.17581648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9956895TGTCTTGATATAAAGGAAATTTCCTTTATATCAAGACA0.211000.040600.706900.750001.000001.00000


Target Position: 6693, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6693CCUGUAAAAUUUGCAUUUA87.0499794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6691-6713TGCCTGTAAAATTTGCATTTATAUAAAUGCAAAUUUUACAGGCACCUGUAAAAUUUGCAUUUAUAU20.011.822


Target Position: 6660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6660GCAGAUACAGAUAGUUGUA97.039991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6658-6680AGGCAGATACAGATAGTTGTATGUACAACUAUCUGUAUCUGCCUGCAGAUACAGAUAGUUGUAUGU19.020.322


Target Position: 1166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166GAUUGGAAAUGGAUCAUUU95.008166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1164-1186GTGATTGGAAATGGATCATTTGGAAAUGAUCCAUUUCCAAUCACGAUUGGAAAUGGAUCAUUUGGU16.220.122


Target Position: 2113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113CUCAAGAACUGUCAAGUAA91.7941357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2111-2133CACTCAAGAACTGTCAAGTAATCUUACUUGACAGUUCUUGAGUGCUCAAGAACUGUCAAGUAAUCU20.320.433


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564CACGACAAUCUUUUUUUAU80.72061710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262582CACGACAATCTTTTTTTATATAAAAAAAGATTGTCGTG0.234800.169300.750000.750001.000001.00000


Target Position: 3906, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906CUUUAAGGCACAAUCAGUU79.7951873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3904-3926ATCTTTAAGGCACAATCAGTTGTAACUGAUUGUGCCUUAAAGAUCUUUAAGGCACAAUCAGUUGUU19.211.021


Target Position: 7102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7102CCUGGAAAUGAAAUUAAAA93.8515222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1177120CCTGGAAATGAAATTAAAATTTTAATTTCATTTCCAGG0.872700.645500.844801.000001.000001.00000


Target Position: 6175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6175CUUUCCUUUUUAAAGGAUU72.68043261

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6173-6195CCCTTTCCTTTTTAAAGGATTTAAAUCCUUUAAAAAGGAAAGGGCUUUCCUUUUUAAAGGAUUUAU18.718.712


Target Position: 3272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272CAUUGUAGUUAAAUAAUGU91.6459375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3270-3292GACATTGTAGTTAAATAATGTGAACAUUAUUUAACUACAAUGUCCAUUGUAGUUAAAUAAUGUGAU-1.811.623


Target Position: 3925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925GUACUUUACAUUUAAAGAU84.38261125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3923-3945TTGTACTTTACATTTAAAGATCAAUCUUUAAAUGUAAAGUACAAGUACUUUACAUUUAAAGAUCAU7.16.632


Target Position: 6981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6981AGUAUGCUCAAUGUUUUUU70.63753660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7146999AGTATGCTCAATGTTTTTTAAAAAACATTGAGCATACT0.457100.352200.706900.750001.000001.00000


Target Position: 5454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5454GGAUAUCGAAUAGAUUAAA95.5041143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5452-5474GAGGATATCGAATAGATTAAATTUUUAAUCUAUUCGAUAUCCUCGGAUAUCGAAUAGAUUAAAUUU6.917.832


Target Position: 6942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6942GAUUUUUUUUUCAUUUUAA95.1703159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6940-6962CTGATTTTTTTTTCATTTTAAATUUAAAAUGAAAAAAAAAUCAGGAUUUUUUUUUCAUUUUAAAUU-1.4-12.010


Target Position: 6871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6871CAAAUCUGUCUUGAUAUAA89.9114518

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6869-6891TGCAAATCTGTCTTGATATAAAGUUAUAUCAAGACAGAUUUGCACAAAUCUGUCUUGAUAUAAAGU10.212.022


Target Position: 607, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607GGAAAAUAUAAUAUUCGAA98.923352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865625GGAAAATATAATATTCGAATTCGAATATTATATTTTCC0.219300.068200.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
605-627GAGGAAAATATAATATTCGAAGTUUCGAAUAUUAUAUUUUCCUCGGAAAAUAUAAUAUUCGAAGUU17.92.122


Target Position: 1191, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191GUAUAUCAAGCCAAACUUU85.8487929

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1189-1211TGGTATATCAAGCCAAACTTTGTAAAGUUUGGCUUGAUAUACCAGUAUAUCAAGCCAAACUUUGUU10.310.232


Target Position: 6356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6356GGUAUGCUUUACAAUAAAA100.67132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5326374GGTATGCTTTACAATAAAATTTTATTGTAAAGCATACC0.354500.112900.853401.000001.000001.00000


Target Position: 3313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313GUUUAUUUUUCAUAUUUUU83.65321244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3311-3333TGGTTTATTTTTCATATTTTTTAAAAAAUAUGAAAAAUAAACCAGUUUAUUUUUCAUAUUUUUUAU-10.3-9.711


Target Position: 1554, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554CCUGAUACUGCUGUAUUAA90.6565449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1552-1574ATCCTGATACTGCTGTATTAAAAUUAAUACAGCAGUAUCAGGAUCCUGAUACUGCUGUAUUAAAAU8.520.322


Target Position: 6930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6930GCCUCUGUGACUGAUUUUU75.15392758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7366948GCCTCTGTGACTGATTTTTAAAAATCAGTCACAGAGGC0.271200.151901.000001.000001.000001.00000


Target Position: 3360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3360CCACAUUCUACACAUAGUU82.12861493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3358-3380AGCCACATTCTACACATAGTTCTAACUAUGUGUAGAAUGUGGCUCCACAUUCUACACAUAGUUCUU19.020.531


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838CCCAAACUACACAGAAUUU82.50571435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641856CCCAAACTACACAGAATTTAAATTCTGTGTAGTTTGGG0.457100.374300.991401.000001.000001.00000


Target Position: 1514, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514CUGCCAUCGGGAUAUUAAA88.5072631

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6151419CTGCCATCGGGATATTAAA1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119634950..119634968(-)00GSK3B(0.002)


Target Position: 6250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6250GGGGUUUUCUUUCUUUUCA84.82851069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8516268GGGGTTTTCTTTCTTTTCATGAAAAGAAAGAAAACCCC0.223800.113500.767200.750001.000001.00000


Target Position: 4488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4488CAGAAUUUAUAAAGAAUCU85.6833957

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4486-4508GACAGAATTTATAAAGAATCTGAAGAUUCUUUAUAAAUUCUGUCCAGAAUUUAUAAAGAAUCUGAU14.85.321


Target Position: 7072, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7072GUAAUUUGCAUUAAAUAAA88.3677651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7070-7092CTGTAATTTGCATTAAATAAAAAUUUAUUUAAUGCAAAUUACAGGUAAUUUGCAUUAAAUAAAAAU-7.5-1.421


Target Position: 4985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4985CAGUGAUUCUGUUUAAUAA106.2867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4983-5005GGCAGTGATTCTGTTTAATAATCUUAUUAAACAGAAUCACUGCCCAGUGAUUCUGUUUAAUAAUCU-7.519.222


Target Position: 4835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4835GUAUAUAAUAAUAAUAAAA100.50333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4833-4855TTGTATATAATAATAATAAAAAGUUUUAUUAUUAUUAUAUACAAGUAUAUAAUAAUAAUAAAAAGU-7.5-5.921


Target Position: 1619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619CAAUGUUUCGUAUAUCUGU85.1911026

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1617-1639CCCAATGTTTCGTATATCTGTTCACAGAUAUACGAAACAUUGGGCAAUGUUUCGUAUAUCUGUUCU13.35.333


Target Position: 3916, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3916CAAUCAGUUGUACUUUACA94.0667215

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3914-3936CACAATCAGTTGTACTTTACATTUGUAAAGUACAACUGAUUGUGCAAUCAGUUGUACUUUACAUUU12.919.222


Target Position: 656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656GUUUCACGUGAUACAUAUU88.0404685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
654-676CCGTTTCACGTGATACATATTTTAAUAUGUAUCACGUGAAACGGGUUUCACGUGAUACAUAUUUUU8.221.133


Target Position: 5159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5159GUUCUUUUUUAAAUUUUAA89.73530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5157-5179TTGTTCTTTTTTAAATTTTAATTUUAAAAUUUAAAAAAGAACAAGUUCUUUUUUAAAUUUUAAUUU-9.75.512


Target Position: 1147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147GCUAUACAGACACUAAAGU78.90712031

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1145-1167CAGCTATACAGACACTAAAGTGAACUUUAGUGUCUGUAUAGCUGGCUAUACAGACACUAAAGUGAU9.813.123


Target Position: 2311, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311GGAAAAACCACCAGUUACU82.16131490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2309-2331CAGGAAAAACCACCAGTTACTTGAGUAACUGGUGGUUUUUCCUGGGAAAAACCACCAGUUACUUGU19.08.722


Target Position: 5591, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5591CAGAGAAUUGUUUUUUUAU88.5137627

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5589-5611GACAGAGAATTGTTTTTTTATAAAUAAAAAAACAAUUCUCUGUCCAGAGAAUUGUUUUUUUAUAAU-9.119.122


Target Position: 6661, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6661CAGAUACAGAUAGUUGUAU83.8831208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6659-6681GGCAGATACAGATAGTTGTATGAAUACAACUAUCUGUAUCUGCCCAGAUACAGAUAGUUGUAUGAU19.020.323


Target Position: 748, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748CUAAAUCAUCUAUAUGUUA94.6579188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
746-768TCCTAAATCATCTATATGTTAAAUAACAUAUAGAUGAUUUAGGACUAAAUCAUCUAUAUGUUAAAU6.78.932


Target Position: 1483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483GAAGUUUAGCCUAUAUCCA89.8561520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1481-1503CCGAAGTTTAGCCTATATCCATTUGGAUAUAGGCUAAACUUCGGGAAGUUUAGCCUAUAUCCAUUU16.74.933


Target Position: 2856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856CAAAGAAAUGUGUAUCAUU93.693232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2854-2876GACAAAGAAATGTGTATCATTCGAAUGAUACACAUUUCUUUGUCCAAAGAAAUGUGUAUCAUUCGU16.05.522


Target Position: 6165, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6165CUAUUUUUCCCUUUCCUUU76.59052479

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6163-6185ATCTATTTTTCCCTTTCCTTTTTAAAGGAAAGGGAAAAAUAGAUCUAUUUUUCCCUUUCCUUUUUU18.7-9.711


Target Position: 3978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3978CUCCUUCCCCACAUGCCUU70.9643595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923996CTCCTTCCCCACATGCCTTAAGGCATGTGGGGAAGGAG0.435400.063300.672400.750001.000001.00000


Target Position: 2407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407CAAUUUUUUUAUUAUUAUU88.8622599

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2405-2427TTCAATTTTTTTATTATTATTGTAAUAAUAAUAAAAAAAUUGAACAAUUUUUUUAUUAUUAUUGUU-8.0-12.011


Target Position: 4834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4834UGUAUAUAAUAAUAAUAAA97.940169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624852TGTATATAATAATAATAAATTTATTATTATTATATACA0.385800.054600.706900.750001.000001.00000


Target Position: 2671, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2671GUUUUUUUGAACUUUGUUU75.10262765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172689GTTTTTTTGAACTTTGTTTAAACAAAGTTCAAAAAAAC0.330200.141100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2669-2691GGGTTTTTTTGAACTTTGTTTTCAAACAAAGUUCAAAAAAACCCGUUUUUUUGAACUUUGUUUUCU10.3-11.321


Target Position: 6609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6609UCCUUGUGUUAAUUUUUAA83.02221347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9696627TCCTTGTGTTAATTTTTAATTAAAAATTAACACAAGGA0.371500.042500.836200.750001.000001.00000


Target Position: 4995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4995GUUUAAUAAUCAGACAAAA93.3649248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4993-5015CTGTTTAATAATCAGACAAAATGUUUUGUCUGAUUAUUAAACAGGUUUAAUAAUCAGACAAAAUGU19.2-7.521


Target Position: 7067, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7067GUACUGUAAUUUGCAUUAA89.6395540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7065-7087TGGTACTGTAATTTGCATTAAATUUAAUGCAAAUUACAGUACCAGUACUGUAAUUUGCAUUAAAUU21.120.222


Target Position: 4810, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4810GAUCCAGGUCUCUGAAUAU96.5199108

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10481019GATCCAGGTCTCTGAATAT1/1/0/097.75GSK3BNM_002093.3+NM_001146156.11+1NANANA3:119543092..119543110(-)00GSK3B(0.002)


Target Position: 3392, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392CAAAUCUAGAAUCUGUAUU78.51942105

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3390-3412TCCAAATCTAGAATCTGTATTTAAAUACAGAUUCUAGAUUUGGACAAAUCUAGAAUCUGUAUUUAU20.36.932


Target Position: 3851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3851CUAAAAUGAACUUUAGUCA86.8465819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3849-3871CTCTAAAATGAACTTTAGTCACCUGACUAAAGUUCAUUUUAGAGCUAAAAUGAACUUUAGUCACCU14.6-1.422


Target Position: 3660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3660GAGUUUUUGUGUCUGUUUU84.66531085

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3658-3680AAGAGTTTTTGTGTCTGTTTTCTAAAACAGACACAAAAACUCUUGAGUUUUUGUGUCUGUUUUCUU19.23.211


Target Position: 3429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3429CAUGCUUUUUACAUUUAUU89.2736565

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3427-3449CTCATGCTTTTTACATTTATTTAAAUAAAUGUAAAAAGCAUGAGCAUGCUUUUUACAUUUAUUUAU-1.818.522


Target Position: 5851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5851CUUUUUUGAAAGAAAAAUA86.5496843

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5849-5871GCCTTTTTTGAAAGAAAAATAGAUAUUUUUCUUUCAAAAAAGGCCUUUUUUGAAAGAAAAAUAGAU0.4-2.912


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229CGCCAUCAAGAAAGUAUUG71.53733488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531247CGCCATCAAGAAAGTATTGCAATACTTTCTTGATGGCG0.333900.174500.775900.750001.000001.00000


Target Position: 6611, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6611CUUGUGUUAAUUUUUAAGU69.16643922

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6609-6631TCCTTGTGTTAATTTTTAAGTTTACUUAAAAAUUAACACAAGGACUUGUGUUAAUUUUUAAGUUUU-3.819.322


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837ACCCAAACUACACAGAAUU72.87383211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471855ACCCAAACTACACAGAATTAATTCTGTGTAGTTTGGGT0.465500.277100.844800.750001.000001.00000


Target Position: 4938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4938GUGGACCCAGGAACUGUUA79.79581872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9794956GTGGACCCAGGAACTGTTATAACAGTTCCTGGGTCCAC0.195300.089900.758600.750000.978300.87500


Target Position: 4921, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4921GUUUUGUAUGUAAAUAUGU78.1512183

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4919-4941TTGTTTTGTATGTAAATATGTGGACAUAUUUACAUACAAAACAAGUUUUGUAUGUAAAUAUGUGGU-1.87.222


Target Position: 2787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2787GUAAAAUUAAUCCAUAUCU80.94881676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2785-2807TTGTAAAATTAATCCATATCTTCAGAUAUGGAUUAAUUUUACAAGUAAAAUUAAUCCAUAUCUUCU21.2-9.731


Target Position: 2636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636CCACAAAAGAAGAAAACCU79.91191854

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2634-2656TTCCACAAAAGAAGAAAACCTTTAGGUUUUCUUCUUUUGUGGAACCACAAAAGAAGAAAACCUUUU21.212.222


Target Position: 3391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3391CCAAAUCUAGAAUCUGUAU85.562977

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3389-3411ATCCAAATCTAGAATCTGTATTTAUACAGAUUCUAGAUUUGGAUCCAAAUCUAGAAUCUGUAUUUU20.312.022


Target Position: 6561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6561AGCAAAAUGACAACCAGUA84.71591079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9866579AGCAAAATGACAACCAGTATACTGGTTGTCATTTTGCT0.197800.041100.672400.750001.000001.00000


Target Position: 1382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CUAUGUUCCGGAAACAGUA90.6079455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1380-1402GACTATGTTCCGGAAACAGTATAUACUGUUUCCGGAACAUAGUCCUAUGUUCCGGAAACAGUAUAU17.816.123


Target Position: 6787, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6787CCUAAAAAACAAAAUUUAU85.24211018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4396805CCTAAAAAACAAAATTTATATAAATTTTGTTTTTTAGG0.409100.386000.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6785-6807AACCTAAAAAACAAAATTTATTAAUAAAUUUUGUUUUUUAGGUUCCUAAAAAACAAAAUUUAUUAU-9.7-3.822


Target Position: 5927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5927CAAACCAAAGGUUACUAUU81.9151524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5925-5947ACCAAACCAAAGGTTACTATTTTAAUAGUAACCUUUGGUUUGGUCAAACCAAAGGUUACUAUUUUU6.318.832


Target Position: 7110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7110UGAAAUUAAAAAAAAAAAA77.98042217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3987128TGAAATTAAAAAAAAAAAATTTTTTTTTTTTAATTTCA0.983100.853600.724100.750001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662CGUGAUACAUAUUUUUUUA99.255443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398680CGTGATACATATTTTTTTATAAAAAAATATGTATCACG0.500400.149900.741401.000001.000001.00000


Target Position: 6153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6153CUGGCAUUUCAUCUAUUUU81.53611592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7436171CTGGCATTTCATCTATTTTAAAATAGATGAAATGCCAG0.485000.195000.784500.750001.000001.00000


Target Position: 4858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4858CCUCACCAAAUUCAAGCUU68.17444129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6414876CCTCACCAAATTCAAGCTTAAGCTTGAATTTGGTGAGG0.303700.115800.706901.000001.000001.00000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561UCCCACGACAAUCUUUUUU57.69195796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652579TCCCACGACAATCTTTTTTAAAAAAGATTGTCGTGGGA0.274200.202000.870700.750001.000001.00000


Target Position: 4864, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4864CAAAUUCAAGCUUGUACAU82.67731400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4862-4884ACCAAATTCAAGCTTGTACATTAAUGUACAAGCUUGAAUUUGGUCAAAUUCAAGCUUGUACAUUAU20.47.422


Target Position: 795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GAAAUAUAUCGCUUGUUUU90.1135492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815GAGAAATATATCGCTTGTTTTGTAAAACAAGCGAUAUAUUUCUCGAAAUAUAUCGCUUGUUUUGUU10.3-8.023


Target Position: 2395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395CAUUUUAGUGUUCAAUUUU83.42491280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202413CATTTTAGTGTTCAATTTTAAAATTGAACACTAAAATG0.219000.047600.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2393-2415TTCATTTTAGTGTTCAATTTTTTAAAAUUGAACACUAAAAUGAACAUUUUAGUGUUCAAUUUUUUU7.4-4.322


Target Position: 5544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5544CUCUCUCUCUCCUCUUUUA93.3648249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8605562CTCTCTCTCTCCTCTTTTATAAAAGAGGAGAGAGAGAG0.378400.091800.775900.750001.000001.00000


Target Position: 3795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3795CAUGACUAGUUUGUUUUAU80.05541829

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3793-3815TTCATGACTAGTTTGTTTTATACAUAAAACAAACUAGUCAUGAACAUGACUAGUUUGUUUUAUACU7.220.313


Target Position: 4854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4854AGCUCCUCACCAAAUUCAA83.36881289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924872AGCTCCTCACCAAATTCAATTGAATTTGGTGAGGAGCT0.376900.183200.706900.750001.000001.00000


Target Position: 6054, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6054GUUUAUGUUUUAACAAUGU78.27862154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6052-6074TGGTTTATGTTTTAACAATGTATACAUUGUUAAAACAUAAACCAGUUUAUGUUUUAACAAUGUAUU12.16.921