siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 1895   1896   3239   3258   3260   3265   3294  
Biltr, Ernai, Rnaxs 785   1891   3123   3288  
Biltr, Ernai, Rnaxs, Sidirect 3232   3235  
Biltr, Rnaxs 21   27   53   56   61   65   280   281   331   400   461   702   703   704   705   706   711   766   767   769  
770   771   772   773   776   777   778   779   781   782   783   784   791   792   799   831   832   833   864   865  
906   907   908   909   911   1000   1001   1036   1037   1039   1105   1106   1107   1108   1109   1111   1138   1139   1141   1196  
1197   1201   1202   1203   1204   1206   1207   1228   1230   1231   1281   1282   1312   1313   1314   1315   1316   1319   1320   1374  
1377   1380   1381   1382   1383   1387   1447   1488   1489   1501   1503   1505   1506   1507   1508   1668   1669   1670   1671   1672  
1673   1675   1676   1679   1680   1720   1721   1722   1723   1879   1882   1883   1884   1885   1886   1889   1890   1892   1893   1894  
1897   1922   1928   2005   2006   2007   2050   2051   2052   2053   2107   2108   2177   2178   2179   2180   2182   2326   2327   2329  
2330   2331   2332   2333   2334   2335   2336   2337   2338   2340   2354   2356   2357   2358   2359   2360   2361   2362   2363   2364  
2365   2368   2369   2397   2403   2404   2405   2415   2505   2506   2517   2518   2574   2575   2576   2577   2578   2579   2580   2581  
2582   2615   2619   2620   2623   2624   2652   2653   2654   2672   2687   2688   2690   2691   2692   2718   2719   2720   2731   2732  
2733   2734   2739   2764   2822   2823   2824   2825   2878   2879   2890   2900   2901   2902   2950   2951   2952   2975   2976   2979  
2980   3007   3008   3010   3012   3022   3041   3043   3044   3048   3049   3050   3091   3092   3093   3120   3121   3122   3124   3128  
3129   3132   3133   3134   3146   3147   3155   3160   3161   3165   3166   3167   3168   3171   3172   3173   3174   3175   3176   3197  
3205   3229   3230   3231   3233   3234   3236   3237   3238   3240   3245   3246   3247   3250   3251   3252   3253   3254   3255   3256  
3257   3259   3261   3262   3263   3264   3266   3267   3268   3269   3284   3285   3286   3287   3289   3290   3291   3292   3293   3295  
3296   3297   3298  
Biltr, Sidirect 3126   3186   3248  
Biltr, Ernai 341   828   3142   3183  


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043GCAGACUGCACCCCAAGCU70.2041837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713061GCAGACTGCACCCCAAGCTAGCTTGGGGTGCAGTCTGC0.048900.006200.500000.750000.945700.75000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383CGCUGCUGCAACUCUACCA85.8027113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731401CGCTGCTGCAACTCTACCATGGTAGAGTTGCAGCAGCG0.361800.013600.577600.750000.934800.62500


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204CCAGGAUGUUCAGUGACUG75.2449503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2241222CCAGGATGTTCAGTGACTGCAGTCACTGAACATCCTGG0.046500.008500.560300.750001.000001.00000


Target Position: 3295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295UUCUGUAAAAAAAAAAAAA74.9928520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2603313TTCTGTAAAAAAAAAAAAATTTTTTTTTTTTTACAGAA0.973900.534400.672400.500001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377CGGAACCGCUGCUGCAACU74.7464533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1501395CGGAACCGCTGCTGCAACTAGTTGCAGCAGCGGTTCCG0.094200.010200.706900.750000.929300.75000


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252AAUAAUGAGAAAUGUAUAU81.4884241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3093270AATAATGAGAAATGTATATATATACATTTCTCATTATT0.222300.008400.465500.500001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578GUGUGGAAAUUUGGAGAAG69.7495882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092596GTGTGGAAATTTGGAGAAGCTTCTCCAAATTTCCACAC0.045700.007400.655200.500001.000001.00000


Target Position: 2879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2879CCACAUAUACAGCCCCUCC66.74441133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072897CCACATATACAGCCCCTCCGGAGGGGCTGTATATGTGG0.186500.138900.474100.500001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670GUCCUGCUUCUCCUAUGAC69.859868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631688GTCCTGCTTCTCCTATGACGTCATAGGAGAAGCAGGAC0.139700.029700.500000.500001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922CUGCUCUGCCCAGUGCCAC55.68032216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131940CTGCTCTGCCCAGTGCCACGTGGCACTGGGCAGAGCAG0.012900.001700.491400.500000.951100.62500


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928UGCCCAGUGCCACAACCAU71.7252742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791946TGCCCAGTGCCACAACCATATGGTTGTGGCACTGGGCA0.058600.001700.698300.750000.972800.75000


Target Position: 1896, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GACUUACACGUUUACAGAU90.481144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081914GACTTACACGTTTACAGATATCTGTAAACGTGTAAGTC0.053200.022600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1894-1916AGGACTTACACGTTTACAGATCCAUCUGUAAACGUGUAAGUCCUGACUUACACGUUUACAGAUCCU20.319.032


Target Position: 341, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341GACCUAUACGGCUGCCAAU85.6461120

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_434119GACCTATACGGCTGCCAAT1/1/0/091.10ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135087488..135087506(-)00ADAM8(0.002)


Target Position: 1447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447GCCAGGAGUGCAAGGUGAA87.24881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871465GCCAGGAGTGCAAGGTGAATTCACCTTGCACTCCTGGC0.210400.006600.827601.000001.000001.00000


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951CGGUUCCAGGCAGCACAGA72.7205669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1492969CGGTTCCAGGCAGCACAGATCTGTGCTGCCTGGAACCG0.292200.010100.689700.750001.000001.00000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007GGUUCCCCUGCGUGCUCUU75.2027507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1483025GGTTCCCCTGCGTGCTCTTAAGAGCACGCAGGGGAACC0.095000.013300.715501.000000.978300.75000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327GCCGCCCCCUGCUCCUCCG49.8462670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022345GCCGCCCCCTGCTCCTCCGCGGAGGAGCAGGGGGCGGC0.073900.005900.586200.500000.972800.87500


Target Position: 2330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330GCCCCCUGCUCCUCCGGUC56.05392188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1992348GCCCCCTGCTCCTCCGGTCGACCGGAGGAGCAGGGGGC0.057400.051100.681000.750000.956500.75000


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326GGCCGCCCCCUGCUCCUCC49.27782717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3042344GGCCGCCCCCTGCTCCTCCGGAGGAGCAGGGGGCGGCC0.427800.015000.629300.500000.918500.62500


Target Position: 53, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
53GCUGUCACCUCCGCCUCUG62.75181520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24871GCTGTCACCTCCGCCTCTGCAGAGGCGGAGGTGACAGC0.033800.006300.569000.750001.000001.00000


Target Position: 3298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298UGUAAAAAAAAAAAAAAAA79.1936316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
653316TGTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTACA0.993900.552400.706900.750001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107GGCAUGGACCAUGAUGAGA82.3371209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531125GGCATGGACCATGATGAGATCTCATCATGGTCCATGCC0.333700.170100.775900.750000.978300.75000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706UCGUGGACAAUGCAGAGUU70.8685798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302724TCGTGGACAATGCAGAGTTAACTCTGCATTGTCCACGA0.019500.004300.646600.750001.000001.00000


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380AACCGCUGCUGCAACUCUA85.3221127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001398AACCGCTGCTGCAACTCTATAGAGTTGCAGCAGCGGTT0.179800.011500.474100.500000.929300.75000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676CUUCUCCUAUGACAUCCUA86.973491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101694CTTCTCCTATGACATCCTATAGGATGTCATAGGAGAAG0.128000.012300.465500.750001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671UCCUGCUUCUCCUAUGACA77.8736381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811689TCCTGCTTCTCCTATGACATGTCATAGGAGAAGCAGGA0.300500.037600.663800.500001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833GGAGAUUUGGAAUAGUCAG79.6296298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
273851GGAGATTTGGAATAGTCAGCTGACTATTCCAAATCTCC0.026600.006600.586200.750001.000001.00000


Target Position: 3126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126CUUUGUGUGUGUUUAAGCU78.9283326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3124-3146AGCTTTGTGTGTGTTTAAGCTTAAGCUUAAACACACACAAAGCUCUUUGUGUGUGUUUAAGCUUAU13.719.322


Target Position: 3265, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3265GUAUAUUUUACUAAUAAAU88.154567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1153283GTATATTTTACTAATAAATATTTATTAGTAAAATATAC0.214700.065100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3263-3285ATGTATATTTTACTAATAAATTAAUUUAUUAGUAAAAUAUACAUGUAUAUUUUACUAAUAAAUUAU-7.5-8.022


Target Position: 3091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3091CUGUUUCCCAUGGGAUUCA72.8611658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2443109CTGTTTCCCATGGGATTCATGAATCCCATGGGAAACAG0.159500.002600.560300.500000.923901.00000


Target Position: 2975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2975GGCAUCCCCAGAAAGACUC60.81731697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1122993GGCATCCCCAGAAAGACTCGAGTCTTTCTGGGGATGCC0.253100.026700.689700.750000.945700.62500


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911GGCACGGCAACGGACACGG54.24532348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264929GGCACGGCAACGGACACGGCCGTGTCCGTTGCCGTGCC0.052600.010300.586200.500001.000001.00000


Target Position: 3267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3267AUAUUUUACUAAUAAAUUA93.474823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2453285ATATTTTACTAATAAATTATAATTTATTAGTAAAATAT0.165300.043300.508600.500001.000001.00000


Target Position: 3123, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123CAGCUUUGUGUGUGUUUAA93.519921

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3312319CAGCTTTGTGTGTGTTTAA1/1/0/091.46ADAM8NM_001164489.1+NM_001109.4+NM_001164490.11+1+1NANANA10:135076080..135076098(-)00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1403141CAGCTTTGTGTGTGTTTAATTAAACACACACAAAGCTG0.108400.027300.750000.750001.000001.00000


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229AGGGCUGAAAGCUUUUAUU76.0758457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2543247AGGGCTGAAAGCTTTTATTAATAAAAGCTTTCAGCCCT0.110400.002300.836200.750000.967400.87500


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316GUGUGGGAACCUGUUUGUG66.89941121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671334GTGTGGGAACCTGTTTGTGCACAAACAGGTTCCCACAC0.092300.011700.500000.500001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GCUGCCAGGAACGCUUCGA70.76807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981159GCTGCCAGGAACGCTTCGATCGAAGCGTTCCTGGCAGC0.021700.001400.560300.750000.929300.87500


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234UGAAAGCUUUUAUUCUUUA84.4364148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1633252TGAAAGCTTTTATTCTTTATAAAGAATAAAAGCTTTCA0.102000.008400.689700.750000.972800.62500


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766UGGAGGUGGUGAAUCACGU71.167784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288784TGGAGGTGGTGAATCACGTACGTGATTCACCACCTCCA0.027800.001600.569000.500000.918500.75000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381ACCGCUGCUGCAACUCUAC61.27041659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771399ACCGCTGCTGCAACTCTACGTAGAGTTGCAGCAGCGGT0.238600.009200.672400.500000.929300.62500


Target Position: 2582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582GGAAAUUUGGAGAAGUUGC66.51941158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2862600GGAAATTTGGAGAAGTTGCGCAACTTCTCCAAATTTCC0.079400.014300.517200.500001.000001.00000


Target Position: 3236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3236AAAGCUUUUAUUCUUUAAU74.7248534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2833254AAAGCTTTTATTCTTTAATATTAAAGAATAAAAGCTTT0.092200.016300.491400.500001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CCGCUGCUGCAACUCUACC60.7451707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931400CCGCTGCTGCAACTCTACCGGTAGAGTTGCAGCAGCGG0.433300.017100.560300.500000.934800.75000


Target Position: 2878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878GCCACAUAUACAGCCCCUC61.38971648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1492896GCCACATATACAGCCCCTCGAGGGGCTGTATATGTGGC0.204400.061400.689700.750000.983700.62500


Target Position: 3239, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3239GCUUUUAUUCUUUAAUAAU88.698263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1683257GCTTTTATTCTTTAATAATATTATTAAAGAATAAAAGC0.081000.047800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3237-3259AAGCTTTTATTCTTTAATAATGAAUUAUUAAAGAAUAAAAGCUUGCUUUUAUUCUUUAAUAAUGAU-7.5-4.321


Target Position: 3161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3161GGAAAGGGCUAUGUGGGAG69.8907865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3063179GGAAAGGGCTATGTGGGAGCTCCCACATAGCCCTTTCC0.045300.001200.560300.750001.000001.00000


Target Position: 3257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257UGAGAAAUGUAUAUUUUAC75.5017485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2723275TGAGAAATGTATATTTTACGTAAAATATACATTTCTCA0.154300.015600.543100.500001.000001.00000


Target Position: 1489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489CCAAGAAGGACAUGUGUGA85.9666111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401507CCAAGAAGGACATGTGTGATCACACATGTCCTTCTTGG0.254000.012100.620700.750001.000001.00000


Target Position: 2824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2824CGUGUGUGUGUACGUGUCU79.631297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2412842CGTGTGTGTGTACGTGTCTAGACACGTACACACACACG0.102600.002700.551700.750001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369CCCAGUUCCUGUCUACACC65.75211236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072387CCCAGTTCCTGTCTACACCGGTGTAGACAGGAACTGGG0.085100.006700.637900.500000.978300.75000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GGUGGUGAAUCACGUGGAC74.9702523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
260788GGTGGTGAATCACGTGGACGTCCACGTGATTCACCACC0.030800.002400.534500.750000.918500.62500


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702GUGGUCGUGGACAAUGCAG66.05571206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306720GTGGTCGTGGACAATGCAGCTGCATTGTCCACGACCAC0.103200.001300.508600.500001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506CCCUGAAGCCCCCCAUCCA77.3062407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2902524CCCTGAAGCCCCCCATCCATGGATGGGGGGCTTCAGGG0.081300.001600.646600.750001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831CUGGAGAUUUGGAAUAGUC74.9146526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311849CTGGAGATTTGGAATAGTCGACTATTCCAAATCTCCAG0.025900.005900.465500.500001.000001.00000


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250UUAAUAAUGAGAAAUGUAU74.4266552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2803268TTAATAATGAGAAATGTATATACATTTCTCATTATTAA0.038700.010100.491400.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615GCGUUCCAGCAUUCCACGG56.08022185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852633GCGTTCCAGCATTCCACGGCCGTGGAATGCTGGAACGC0.104800.002000.508600.500000.967400.62500


Target Position: 2979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2979UCCCCAGAAAGACUCCAUC55.15412272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2502997TCCCCAGAAAGACTCCATCGATGGAGTCTTTCTGGGGA0.203000.032500.689700.500001.000001.00000


Target Position: 2358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2358AGCCCACCCUUCCCAGUUC59.72311810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2462376AGCCCACCCTTCCCAGTTCGAACTGGGAAGGGTGGGCT0.050900.024800.681000.500000.967400.75000


Target Position: 1722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722GCUGACAUGUGUGGCGUUC63.23781475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011740GCTGACATGTGTGGCGTTCGAACGCCACACATGTCAGC0.019500.001400.681000.750001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312CCGUGUGUGGGAACCUGUU76.9335422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461330CCGTGTGTGGGAACCTGTTAACAGGTTCCCACACACGG0.151800.002600.767201.000001.000001.00000


Target Position: 3296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3296UCUGUAAAAAAAAAAAAAA77.691391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443314TCTGTAAAAAAAAAAAAAATTTTTTTTTTTTTTACAGA0.987100.537000.724100.750001.000001.00000


Target Position: 3092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092UGUUUCCCAUGGGAUUCAA75.3704493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2563110TGTTTCCCATGGGATTCAATTGAATCCCATGGGAAACA0.129700.002300.560300.750000.923901.00000


Target Position: 2053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2053UCUUCGUGGUGGUGGUUCU69.7567881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612071TCTTCGTGGTGGTGGTTCTAGAACCACCACCACGAAGA0.045200.008900.500000.500001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001GGUGUCCGCCAUGUGCUCC58.64921933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911019GGTGTCCGCCATGTGCTCCGGAGCACATGGCGGACACC0.099600.009200.482800.500000.972800.87500


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723CUGACAUGUGUGGCGUUCU72.9786646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951741CTGACATGTGTGGCGTTCTAGAACGCCACACATGTCAG0.020600.004100.560300.500001.000001.00000


Target Position: 3256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256AUGAGAAAUGUAUAUUUUA90.059847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2683274ATGAGAAATGTATATTTTATAAAATATACATTTCTCAT0.167300.015000.620700.500001.000001.00000


Target Position: 3142, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142GCUUAGGAAUCGCCUUUAU83.813166

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7314219GCTTAGGAATCGCCTTTAT1/1/0/090.92ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135076061..135076079(-)00ADAM8(0.002)


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397CCAAAGCAGGUCAUCAAGC61.11581673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2772415CCAAAGCAGGTCATCAAGCGCTTGATGACCTGCTTTGG0.093800.012300.491400.500000.972800.75000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129UGUGUGUGUUUAAGCUUAG68.17951017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2763147TGTGTGTGTTTAAGCTTAGCTAAGCTTAAACACACACA0.136200.035600.534500.500001.000001.00000


Target Position: 3232, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232GCUGAAAGCUUUUAUUCUU87.408478

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10323219GCTGAAAGCTTTTATTCTT1/1/0/089.21ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135075971..135075989(-)00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2163250GCTGAAAGCTTTTATTCTTAAGAATAAAAGCTTTCAGC0.153600.004200.715501.000000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3230-3252GGGCTGAAAGCTTTTATTCTTTAAAGAAUAAAAGCUUUCAGCCCGCUGAAAGCUUUUAUUCUUUAU6.916.622


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799AGAAACUCAACUUCCGUGU63.98211395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251817AGAAACTCAACTTCCGTGTACACGGAAGTTGAGTTTCT0.033500.023400.517200.500000.956500.62500


Target Position: 2823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2823GCGUGUGUGUGUACGUGUC77.0276418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2592841GCGTGTGTGTGTACGTGTCGACACGTACACACACACGC0.095700.002100.603400.750000.972800.62500


Target Position: 3293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293AGUUCUGUAAAAAAAAAAA87.241182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
873311AGTTCTGTAAAAAAAAAAATTTTTTTTTTTACAGAACT0.780700.518900.706900.750001.000001.00000


Target Position: 3259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259AGAAAUGUAUAUUUUACUA96.088910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2093277AGAAATGTATATTTTACTATAGTAAAATATACATTTCT0.137700.048400.551700.750001.000001.00000


Target Position: 2359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359GCCCACCCUUCCCAGUUCC52.34992501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2952377GCCCACCCTTCCCAGTTCCGGAACTGGGAAGGGTGGGC0.028300.013300.629300.500000.967400.87500


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900GCCACACCUGCCCCUGCUC59.27181853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2802918GCCACACCTGCCCCTGCTCGAGCAGGGGCAGGTGTGGC0.025000.019500.689700.750000.962000.75000


Target Position: 1891, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891GCCAGGACUUACACGUUUA93.362625

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6189119GCCAGGACTTACACGTTTA1/1/0/090.92ADAM8NM_001164489.1+NM_001109.4+NM_001164490.11+1+0NANANA10:135083441..135083459(-)00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741909GCCAGGACTTACACGTTTATAAACGTGTAAGTCCTGGC0.446400.007300.965501.000001.000001.00000


Target Position: 3205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3205UGAGACCUCAGAUGUGUGU65.82131233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3113223TGAGACCTCAGATGTGTGTACACACATCTGAGGTCTCA0.014800.006700.517200.500001.000001.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575CCUGUGUGGAAAUUUGGAG67.22731094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2202593CCTGTGTGGAAATTTGGAGCTCCAAATTTCCACACAGG0.079900.005700.534500.750001.000001.00000


Target Position: 3237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3237AAGCUUUUAUUCUUUAAUA90.560743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2403255AAGCTTTTATTCTTTAATATATTAAAGAATAAAAGCTT0.086700.015500.594800.500001.000001.00000


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171AUGUGGGAGAGUCAGCUAU74.393557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2613189ATGTGGGAGAGTCAGCTATATAGCTGACTCTCCCACAT0.036300.002100.612100.500001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902CACACCUGCCCCUGCUCUG64.47551351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122920CACACCTGCCCCTGCTCTGCAGAGCAGGGGCAGGTGTG0.014400.004600.508600.500000.962001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230GGGCUGAAAGCUUUUAUUC72.0381723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1773248GGGCTGAAAGCTTTTATTCGAATAAAAGCTTTCAGCCC0.281800.007000.819000.750000.962000.62500


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907GGCAGGCACGGCAACGGAC67.41411078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267925GGCAGGCACGGCAACGGACGTCCGTTGCCGTGCCTGCC0.064500.002000.681000.750001.000001.00000


Target Position: 3133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3133UGUGUUUAAGCUUAGGAAU73.0391639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1053151TGTGTTTAAGCTTAGGAATATTCCTAAGCTTAAACACA0.137400.057200.698300.750001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GCGAAGCUGCUGACUGAGG63.05711494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2322025GCGAAGCTGCTGACTGAGGCCTCAGTCAGCAGCTTCGC0.048100.007600.577600.500001.000001.00000


Target Position: 3264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3264UGUAUAUUUUACUAAUAAA96.42427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1353282TGTATATTTTACTAATAAATTTATTAGTAAAATATACA0.103600.081100.706900.750001.000001.00000


Target Position: 3240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3240CUUUUAUUCUUUAAUAAUG75.4806487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2953258CTTTTATTCTTTAATAATGCATTATTAAAGAATAAAAG0.057200.038300.482800.500001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109CAUGGACCAUGAUGAGAAC80.8412252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731127CATGGACCATGATGAGAACGTTCTCATCATGGTCCATG0.314300.168100.508600.500001.000001.00000


Target Position: 2051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2051CGUCUUCGUGGUGGUGGUU72.6668673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2642069CGTCTTCGTGGTGGTGGTTAACCACCACCACGAAGACG0.029300.005400.629301.000001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879GGAAAGGACGUUGCCAGGA75.1319512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621897GGAAAGGACGTTGCCAGGATCCTGGCAACGTCCTTTCC0.055600.006400.500000.750001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791GCUAUAUCAGAAACUCAAC76.4642436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53809GCTATATCAGAAACTCAACGTTGAGTTTCTGATATAGC0.420400.174500.706900.750001.000001.00000


Target Position: 3010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3010UCCCCUGCGUGCUCUUCGA68.4097998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2453028TCCCCTGCGTGCTCTTCGATCGAAGAGCACGCAGGGGA0.052500.018700.577600.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783GUGGACAAGCUAUAUCAGA85.1568131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
231801GTGGACAAGCTATATCAGATCTGATATAGCTTGTCCAC0.241800.024300.569000.500000.940200.75000


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361CCACCCUUCCCAGUUCCUG56.97572107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982379CCACCCTTCCCAGTTCCTGCAGGAACTGGGAAGGGTGG0.020200.010900.560300.750000.967400.75000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287UGACCGAGUUCUGUAAAAA86.5151100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1473305TGACCGAGTTCTGTAAAAATTTTTACAGAACTCGGTCA0.567200.537400.724100.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733CCCUCAGCCAAUUCCUUCU72.1753714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2362751CCCTCAGCCAATTCCTTCTAGAAGGAATTGGCTGAGGG0.589700.002900.767200.750001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146AGGAAUCGCCUUUAUGGAA83.4778178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2433164AGGAATCGCCTTTATGGAATTCCATAAAGGCGATTCCT0.035800.002900.672400.750001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624CAUUCCACGGUCCAGCUAG69.3723922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2902642CATTCCACGGTCCAGCTAGCTAGCTGGACCGTGGAATG0.063800.008300.482800.500001.000001.00000


Target Position: 3260, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3260GAAAUGUAUAUUUUACUAA98.12515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1253278GAAATGTATATTTTACTAATTAGTAAAATATACATTTC0.128400.104000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3258-3280GAGAAATGTATATTTTACTAATAUUAGUAAAAUAUACAUUUCUCGAAAUGUAUAUUUUACUAAUAU6.66.911


Target Position: 2734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734CCUCAGCCAAUUCCUUCUC58.52731946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2342752CCTCAGCCAATTCCTTCTCGAGAAGGAATTGGCTGAGG0.594900.003000.534500.750001.000001.00000


Target Position: 2357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357CAGCCCACCCUUCCCAGUU68.7232976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1282375CAGCCCACCCTTCCCAGTTAACTGGGAAGGGTGGGCTG0.156700.051500.637900.750000.967400.62500


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180CUCCAACCCCCUGUUCCAC56.36362165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2782198CTCCAACCCCCTGTTCCACGTGGAACAGGGGGTTGGAG0.125600.006500.517200.500001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890GCCCCUCCCAGCCACACCU64.57751346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1022908GCCCCTCCCAGCCACACCTAGGTGTGGCTGGGAGGGGC0.235900.092100.655200.750000.934800.62500


Target Position: 865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865UCAGCCCCGACCCCAGUGU47.70442825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307883TCAGCCCCGACCCCAGTGTACACTGGGGTCGGGGCTGA0.018700.012100.517200.500000.945700.87500


Target Position: 3266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3266UAUAUUUUACUAAUAAAUU77.9353377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2163284TATATTTTACTAATAAATTAATTTATTAGTAAAATATA0.186700.052600.534500.500001.000001.00000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362CACCCUUCCCAGUUCCUGU76.0096459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3082380CACCCTTCCCAGTTCCTGTACAGGAACTGGGAAGGGTG0.018500.010200.586200.500000.967400.62500


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039ACCAGGACCACAGCAAGAA75.608477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941057ACCAGGACCACAGCAAGAATTCTTGCTGTGGTCCTGGT0.173300.001500.681000.750001.000001.00000


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719UCCUGCUGUCCACGCCCUC47.61762833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2532737TCCTGCTGTCCACGCCCTCGAGGGCGTGGACAGCAGGA0.033000.004800.560300.500000.929300.75000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776GAAUCACGUGGACAAGCUA98.33024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272794GAATCACGTGGACAAGCTATAGCTTGTCCACGTGATTC0.077200.003900.500000.750001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574GCCUGUGUGGAAAUUUGGA82.0097221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292592GCCTGTGTGGAAATTTGGATCCAAATTTCCACACAGGC0.090500.003400.629300.750001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CCCUUCCCAGUUCCUGUCU60.6571716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2542382CCCTTCCCAGTTCCTGTCTAGACAGGAACTGGGAAGGG0.032500.014700.767200.750000.978300.87500


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168GCUAUGUGGGAGAGUCAGC65.24251282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2763186GCTATGTGGGAGAGTCAGCGCTGACTCTCCCACATAGC0.026200.003700.500000.500001.000001.00000


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374UGCCGGAACCGCUGCUGCA73.7236594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111392TGCCGGAACCGCTGCTGCATGCAGCAGCGGTTCCGGCA0.026200.001100.500000.500000.929300.75000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721GGCUGACAUGUGUGGCGUU86.918592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041739GGCTGACATGTGTGGCGTTAACGCCACACATGTCAGCC0.018900.001500.853401.000001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906UGGCAGGCACGGCAACGGA69.3462925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301924TGGCAGGCACGGCAACGGATCCGTTGCCGTGCCTGCCA0.051800.002100.474100.500001.000001.00000


Target Position: 2404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404AGGUCAUCAAGCCAACGUU79.6168300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1182422AGGTCATCAAGCCAACGTTAACGTTGGCTTGATGACCT0.172100.044000.698300.750000.972800.75000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777AAUCACGUGGACAAGCUAU76.9468420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315795AATCACGTGGACAAGCTATATAGCTTGTCCACGTGATT0.138700.003600.465500.500001.000001.00000


Target Position: 3165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165AGGGCUAUGUGGGAGAGUC66.26261177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3113183AGGGCTATGTGGGAGAGTCGACTCTCCCACATAGCCCT0.015800.001500.525900.500001.000001.00000


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CAGGUCAUCAAGCCAACGU70.0539849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2712421CAGGTCATCAAGCCAACGTACGTTGGCTTGATGACCTG0.159400.023600.508600.500000.972800.75000


Target Position: 2687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687UCUAACCUCAGGAAUGCAU66.1791187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2862705TCTAACCTCAGGAATGCATATGCATTCCTGAGGTTAGA0.022700.002700.569000.750001.000001.00000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387GCUGCAACUCUACCACCUG74.4529551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2751405GCTGCAACTCTACCACCTGCAGGTGGTAGAGTTGCAGC0.041600.001800.569000.750001.000001.00000


Target Position: 3248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248CUUUAAUAAUGAGAAAUGU78.9933324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3246-3268TTCTTTAATAATGAGAAATGTATACAUUUCUCAUUAUUAAAGAACUUUAAUAAUGAGAAAUGUAUU12.0-7.522


Target Position: 2732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732GCCCUCAGCCAAUUCCUUC64.04791389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572750GCCCTCAGCCAATTCCTTCGAAGGAATTGGCTGAGGGC0.358400.002200.827600.750001.000001.00000


Target Position: 3285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285AUUGACCGAGUUCUGUAAA74.6453541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2493303ATTGACCGAGTTCTGTAAATTTACAGAACTCGGTCAAT0.555900.067400.508600.500001.000001.00000


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147GGAAUCGCCUUUAUGGAAA85.987110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2663165GGAATCGCCTTTATGGAAATTTCCATAAAGGCGATTCC0.031000.002000.870701.000001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319UGGGAACCUGUUUGUGGAG59.21281859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551337TGGGAACCTGTTTGTGGAGCTCCACAAACAGGTTCCCA0.086100.011400.534500.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253AUAAUGAGAAAUGUAUAUU74.8655528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2673271ATAATGAGAAATGTATATTAATATACATTTCTCATTAT0.196300.007800.534500.500001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908GCAGGCACGGCAACGGACA76.2054449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263926GCAGGCACGGCAACGGACATGTCCGTTGCCGTGCCTGC0.120300.002100.646600.750001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895GGACUUACACGUUUACAGA95.589812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401913GGACTTACACGTTTACAGATCTGTAAACGTGTAAGTCC0.100200.072100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1893-1915CAGGACTTACACGTTTACAGATCUCUGUAAACGUGUAAGUCCUGGGACUUACACGUUUACAGAUCU11.821.423


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206AGGAUGUUCAGUGACUGCA77.9429376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881224AGGATGTTCAGTGACTGCATGCAGTCACTGAACATCCT0.059400.014300.491400.500000.994600.75000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331CCCCCUGCUCCUCCGGUCA67.70851053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2142349CCCCCTGCTCCTCCGGTCATGACCGGAGGAGCAGGGGG0.051500.044200.767200.750000.956500.75000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106GGGCAUGGACCAUGAUGAG77.7468388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831124GGGCATGGACCATGATGAGCTCATCATGGTCCATGCCC0.326100.001600.681000.750000.945700.62500


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950CCGGUUCCAGGCAGCACAG63.38461458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1962968CCGGTTCCAGGCAGCACAGCTGTGCTGCCTGGAACCGG0.120600.006100.629300.750001.000001.00000


Target Position: 3247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3247UCUUUAAUAAUGAGAAAUG65.77831234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2823265TCTTTAATAATGAGAAATGCATTTCTCATTATTAAAGA0.024300.011100.569000.500001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577UGUGUGGAAAUUUGGAGAA76.2649447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2142595TGTGTGGAAATTTGGAGAATTCTCCAAATTTCCACACA0.063000.006800.534500.750001.000001.00000


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579UGUGGAAAUUUGGAGAAGU70.8603799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2582597TGTGGAAATTTGGAGAAGTACTTCTCCAAATTTCCACA0.035200.006800.500000.500001.000001.00000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720GGGCUGACAUGUGUGGCGU74.1275571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091738GGGCTGACATGTGTGGCGTACGCCACACATGTCAGCCC0.018300.001300.715500.750001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196CAGUUUCCCCAGGAUGUUC65.90161225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381214CAGTTTCCCCAGGATGTTCGAACATCCTGGGGAAACTG0.103900.002800.612100.500000.967401.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203CCCAGGAUGUUCAGUGACU78.3718354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841221CCCAGGATGTTCAGTGACTAGTCACTGAACATCCTGGG0.066900.010700.784500.750001.000001.00000


Target Position: 2006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2006CGCGAAGCUGCUGACUGAG68.9086963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022024CGCGAAGCTGCTGACTGAGCTCAGTCAGCAGCTTCGCG0.056200.006100.612100.750000.951100.75000


Target Position: 3120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120CCCCAGCUUUGUGUGUGUU72.9882645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3053138CCCCAGCTTTGTGTGTGTTAACACACACAAAGCTGGGG0.692000.001200.844801.000001.000001.00000


Target Position: 400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
400GCUUCUACCAGGGCCACGU67.85021040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309418GCTTCTACCAGGGCCACGTACGTGGCCCTGGTAGAAGC0.035100.001100.577600.750001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197AGUUUCCCCAGGAUGUUCA75.6887472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931215AGTTTCCCCAGGATGTTCATGAACATCCTGGGGAAACT0.117300.005000.482800.500000.967401.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892CCAGGACUUACACGUUUAC69.2985930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951910CCAGGACTTACACGTTTACGTAAACGTGTAAGTCCTGG0.364000.006100.663800.750001.000001.00000


Target Position: 3288, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288GACCGAGUUCUGUAAAAAA100.0512

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1328819GACCGAGTTCTGTAAAAAA1/1/0/097.75ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANANA00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1023306GACCGAGTTCTGTAAAAAATTTTTTACAGAACTCGGTC0.572500.535200.819000.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779UCACGUGGACAAGCUAUAU74.1817569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226797TCACGTGGACAAGCTATATATATAGCTTGTCCACGTGA0.140500.003700.681000.750001.000001.00000


Target Position: 3132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3132GUGUGUUUAAGCUUAGGAA93.043827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1693150GTGTGTTTAAGCTTAGGAATTCCTAAGCTTAAACACAC0.080800.050500.620700.750001.000001.00000


Target Position: 3294, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3294GUUCUGUAAAAAAAAAAAA85.2219129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1313312GTTCTGTAAAAAAAAAAAATTTTTTTTTTTTACAGAAC0.966800.521900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3292-3314GAGTTCTGTAAAAAAAAAAAAAAUUUUUUUUUUUUACAGAACUCGUUCUGUAAAAAAAAAAAAAAU-11.320.300


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501UGUGUGACCUCGAGGAGUU76.3708440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181519TGTGTGACCTCGAGGAGTTAACTCCTCGAGGTCACACA0.050000.008200.560300.750000.962000.75000


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619UCCAGCAUUCCACGGUCCA62.66431530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292637TCCAGCATTCCACGGTCCATGGACCGTGGAATGCTGGA0.115100.014200.525900.500000.967400.62500


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620CCAGCAUUCCACGGUCCAG67.73121052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1972638CCAGCATTCCACGGTCCAGCTGGACCGTGGAATGCTGG0.074400.021300.560300.750001.000001.00000


Target Position: 3186, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186CUAUCUUGUCUGGUUUUCU78.2592361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3184-3206AGCTATCTTGTCTGGTTTTCTTGAGAAAACCAGACAAGAUAGCUCUAUCUUGUCUGGUUUUCUUGU21.213.422


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331GCUACACAGAGACCUAUAC75.2613502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135349GCTACACAGAGACCTATACGTATAGGTCTCTGTGTAGC0.115200.040900.672400.750000.918500.62500


Target Position: 27, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
27GCAGGAACCAGACCGUGUC68.9854958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26245GCAGGAACCAGACCGTGTCGACACGGTCTGGTTCCTGC0.068300.002100.534500.750000.978300.62500


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GCACAACUUCACCCUCCAC74.1132573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195299GCACAACTTCACCCTCCACGTGGAGGGTGAAGTTGTGC0.059200.020300.560300.750001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731CGCCCUCAGCCAAUUCCUU75.3299497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842749CGCCCTCAGCCAATTCCTTAAGGAATTGGCTGAGGGCG0.293700.001600.784501.000000.934800.62500


Target Position: 3048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3048CUGCACCCCAAGCUCCCGA64.75871327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2813066CTGCACCCCAAGCTCCCGATCGGGAGCTTGGGGTGCAG0.233300.020000.491400.500000.945700.75000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692CCUCAGGAAUGCAUCUACC71.0235793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3152710CCTCAGGAATGCATCTACCGGTAGATGCATTCCTGAGG0.061700.001000.491400.500001.000001.00000


Target Position: 3124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3124AGCUUUGUGUGUGUUUAAG67.22621096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2633142AGCTTTGTGTGTGTTTAAGCTTAAACACACACAAAGCT0.086300.018900.715500.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680UCCUAUGACAUCCUACCAG62.09731581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401698TCCTATGACATCCTACCAGCTGGTAGGATGTCATAGGA0.036400.013000.586200.500001.000001.00000


Target Position: 3246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3246UUCUUUAAUAAUGAGAAAU65.20041285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2493264TTCTTTAATAATGAGAAATATTTCTCATTATTAAAGAA0.033600.014700.663800.500001.000001.00000


Target Position: 3041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041GAGCAGACUGCACCCCAAG72.1677716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043059GAGCAGACTGCACCCCAAGCTTGGGGTGCAGTCTGCTC0.030800.001200.672400.500000.951100.75000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679CUCCUAUGACAUCCUACCA84.904136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131697CTCCTATGACATCCTACCATGGTAGGATGTCATAGGAG0.099800.022500.465500.500001.000001.00000


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334CCUGCUCCUCCGGUCACUG63.36021461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2872352CCTGCTCCTCCGGTCACTGCAGTGACCGGAGGAGCAGG0.022200.019900.560300.750000.962000.62500


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228AGGCCUACCUGGAGAGCUU78.5589341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311246AGGCCTACCTGGAGAGCTTAAGCTCTCCAGGTAGGCCT0.088000.003400.706900.750000.962000.62500


Target Position: 61, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
61CUCCGCCUCUGCUCCCCGA69.7098885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
30779CTCCGCCTCTGCTCCCCGATCGGGGAGCAGAGGCGGAG0.020600.001200.517200.500000.967401.00000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56GUCACCUCCGCCUCUGCUC57.62732047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28274GTCACCTCCGCCTCTGCTCGAGCAGAGGCGGAGGTGAC0.085900.012100.508600.500000.967400.75000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UGGUGAAUCACGUGGACAA87.582175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
233790TGGTGAATCACGTGGACAATTGTCCACGTGATTCACCA0.089400.003000.698300.750001.000001.00000


Target Position: 785, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785GGACAAGCUAUAUCAGAAA98.65143

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_578519GGACAAGCTATATCAGAAA1/1/0/091.10ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135086078,135086302..135086089,135086308(-)00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37803GGACAAGCTATATCAGAAATTTCTGATATAGCTTGTCC0.333100.109500.870701.000000.940200.62500


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GAACCAGGACCACAGCAAG78.9997323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931055GAACCAGGACCACAGCAAGCTTGCTGTGGTCCTGGTTC0.029300.001500.534500.500001.000001.00000


Target Position: 2623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2623GCAUUCCACGGUCCAGCUA80.7861254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612641GCATTCCACGGTCCAGCTATAGCTGGACCGTGGAATGC0.030400.006700.681001.000001.000001.00000


Target Position: 3233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3233CUGAAAGCUUUUAUUCUUU80.0483280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2353251CTGAAAGCTTTTATTCTTTAAAGAATAAAAGCTTTCAG0.113000.003000.784500.750000.972800.62500


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703UGGUCGUGGACAAUGCAGA75.9774461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313721TGGTCGTGGACAATGCAGATCTGCATTGTCCACGACCA0.230500.005000.620700.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GUGUGUGGGAACCUGUUUG69.212940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061332GTGTGTGGGAACCTGTTTGCAAACAGGTTCCCACACAC0.125900.005400.646600.500001.000001.00000


Target Position: 2654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2654CCUAGACCCUGACUUUGCA87.643773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2782672CCTAGACCCTGACTTTGCATGCAAAGTCAGGGTCTAGG0.034300.012800.491400.750001.000001.00000


Target Position: 2340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2340CCUCCGGUCACUGUGUCCA75.0055519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2642358CCTCCGGTCACTGTGTCCATGGACACAGTGACCGGAGG0.045900.003700.500000.750000.978300.62500


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174UGGGAGAGUCAGCUAUCUU79.4986304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2743192TGGGAGAGTCAGCTATCTTAAGATAGCTGACTCTCCCA0.041700.001800.706900.750001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711GACAAUGCAGAGUUCCAGA89.832451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314729GACAATGCAGAGTTCCAGATCTGGAACTCTGCATTGTC0.012800.001400.594800.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CCUACCUGGAGAGCUUUUU66.08731201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771249CCTACCTGGAGAGCTTTTTAAAAAGCTCTCCAGGTAGG0.081300.001700.844801.000001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UGCUCCUCCGGUCACUGUG56.01342192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2382354TGCTCCTCCGGTCACTGTGCACAGTGACCGGAGGAGCA0.050200.014400.560300.500000.962000.75000


Target Position: 3269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269AUUUUACUAAUAAAUUAUU75.7673468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2653287ATTTTACTAATAAATTATTAATAATTTATTAGTAAAAT0.149500.026100.500000.500001.000001.00000


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044CAGACUGCACCCCAAGCUC67.91541032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3053062CAGACTGCACCCCAAGCTCGAGCTTGGGGTGCAGTCTG0.070900.010000.474100.500000.945700.75000


Target Position: 3012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3012CCCUGCGUGCUCUUCGAGA76.7966427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1223030CCCTGCGTGCTCTTCGAGATCTCGAAGAGCACGCAGGG0.119900.013000.767200.750001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201UCCCCAGGAUGUUCAGUGA75.9589462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421219TCCCCAGGATGTTCAGTGATCACTGAACATCCTGGGGA0.064200.006000.646600.500000.994600.62500


Target Position: 3167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167GGCUAUGUGGGAGAGUCAG71.208781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2653185GGCTATGTGGGAGAGTCAGCTGACTCTCCCACATAGCC0.029000.003800.715500.750001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885GACGUUGCCAGGACUUACA85.6437121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731903GACGTTGCCAGGACTTACATGTAAGTCCTGGCAACGTC0.041800.001800.612100.500001.000001.00000


Target Position: 2576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576CUGUGUGGAAAUUUGGAGA80.5873262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2472594CTGTGTGGAAATTTGGAGATCTCCAAATTTCCACACAG0.068500.005400.560300.500001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111UGGACCAUGAUGAGAACGU63.39821455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151129TGGACCATGATGAGAACGTACGTTCTCATCATGGTCCA0.011600.001600.569000.500001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773GGUGAAUCACGUGGACAAG75.7565469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251791GGTGAATCACGTGGACAAGCTTGTCCACGTGATTCACC0.053900.002400.715500.750001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505UGACCUCGAGGAGUUCUGU67.54321070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531523TGACCTCGAGGAGTTCTGTACAGAACTCCTCGAGGTCA0.059000.002300.517200.500000.902200.62500


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282CCCCUGACCUCAGCCACCU64.6011342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831300CCCCTGACCTCAGCCACCTAGGTGGCTGAGGTCAGGGG0.481400.006700.646600.750000.902200.87500


Target Position: 2822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2822UGCGUGUGUGUGUACGUGU70.7288810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852840TGCGTGTGTGTGTACGTGTACACGTACACACACACGCA0.174200.001600.646600.500000.972800.62500


Target Position: 3290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3290CCGAGUUCUGUAAAAAAAA87.74272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203308CCGAGTTCTGTAAAAAAAATTTTTTTTACAGAACTCGG0.598600.528100.913801.000001.000001.00000


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354GUCCAGCCCACCCUUCCCA69.8086877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3032372GTCCAGCCCACCCTTCCCATGGGAAGGGTGGGCTGGAC0.420700.094900.474100.500001.000001.00000


Target Position: 828, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GGCCUGGAGAUUUGGAAUA83.2908181

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_282819GGCCTGGAGATTTGGAATA1/1/0/091.46ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135086035..135086053(-)00ADAM8(0.002)


Target Position: 2005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2005GCGCGAAGCUGCUGACUGA94.615617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2562023GCGCGAAGCTGCTGACTGATCAGTCAGCAGCTTCGCGC0.032000.008700.698300.750000.951100.75000


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909CAGGCACGGCAACGGACAC67.32291085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279927CAGGCACGGCAACGGACACGTGTCCGTTGCCGTGCCTG0.093800.002500.491400.500001.000001.00000


Target Position: 3155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155CUUUAUGGAAAGGGCUAUG61.82861608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2963173CTTTATGGAAAGGGCTATGCATAGCCCTTTCCATAAAG0.025600.003900.482800.500001.000001.00000


Target Position: 1315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315UGUGUGGGAACCUGUUUGU64.71461332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601333TGTGTGGGAACCTGTTTGTACAAACAGGTTCCCACACA0.112400.012800.500000.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781ACGUGGACAAGCUAUAUCA87.877770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
208799ACGTGGACAAGCTATATCATGATATAGCTTGTCCACGT0.180900.015700.551700.500000.940200.62500


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177GCGCUCCAACCCCCUGUUC55.27652262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572195GCGCTCCAACCCCCTGTTCGAACAGGGGGTTGGAGCGC0.031000.006000.750000.750001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675GCUUCUCCUAUGACAUCCU80.4665269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501693GCTTCTCCTATGACATCCTAGGATGTCATAGGAGAAGC0.156000.012900.508600.750001.000001.00000


Target Position: 3263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3263AUGUAUAUUUUACUAAUAA93.167326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2023281ATGTATATTTTACTAATAATTATTAGTAAAATATACAT0.117700.094200.620700.500001.000001.00000


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202CCCCAGGAUGUUCAGUGAC63.39051457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931220CCCCAGGATGTTCAGTGACGTCACTGAACATCCTGGGG0.061000.007200.672400.750001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CCCAAGAAGGACAUGUGUG69.7227884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301506CCCAAGAAGGACATGTGTGCACACATGTCCTTCTTGGG0.045100.011700.698300.750000.934800.75000


Target Position: 2580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2580GUGGAAAUUUGGAGAAGUU85.7803116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2322598GTGGAAATTTGGAGAAGTTAACTTCTCCAAATTTCCAC0.043200.006000.646600.750001.000001.00000


Target Position: 3238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3238AGCUUUUAUUCUUUAAUAA92.697530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1703256AGCTTTTATTCTTTAATAATTATTAAAGAATAAAAGCT0.080100.055700.819000.750001.000001.00000


Target Position: 3197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197GGUUUUCUUGAGACCUCAG77.7934385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2283215GGTTTTCTTGAGACCTCAGCTGAGGTCTCAAGAAAACC0.096100.003500.569000.750001.000001.00000


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286UUGACCGAGUUCUGUAAAA74.541545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2413304TTGACCGAGTTCTGTAAAATTTTACAGAACTCGGTCAA0.553600.154500.646600.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507ACCUCGAGGAGUUCUGUGA76.6125434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971525ACCTCGAGGAGTTCTGTGATCACAGAACTCCTCGAGGT0.058700.008300.629300.500000.962000.75000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231GGCUGAAAGCUUUUAUUCU86.857494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1353249GGCTGAAAGCTTTTATTCTAGAATAAAAGCTTTCAGCC0.292800.011700.775900.750000.967400.62500


Target Position: 2652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652GCCCUAGACCCUGACUUUG65.48791257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3002670GCCCTAGACCCTGACTTTGCAAAGTCAGGGTCTAGGGC0.019800.012800.853400.750001.000001.00000


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668GAGUCCUGCUUCUCCUAUG78.8203329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031686GAGTCCTGCTTCTCCTATGCATAGGAGAAGCAGGACTC0.143400.016800.655200.500000.994600.62500


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GGUCGUGGACAAUGCAGAG80.9142251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
213722GGTCGTGGACAATGCAGAGCTCTGCATTGTCCACGACC0.073100.012600.543100.750001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461CGGCCUCAGGGGUUUCUUC66.91171120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191479CGGCCTCAGGGGTTTCTTCGAAGAAACCCCTGAGGCCG0.099200.006200.741400.750001.000001.00000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825GUGUGUGUGUACGUGUCUC74.0636575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942843GTGTGTGTGTACGTGTCTCGAGACACGTACACACACAC0.075000.026000.482800.500001.000001.00000


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320GGGAACCUGUUUGUGGAGC53.05622439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121338GGGAACCTGTTTGTGGAGCGCTCCACAAACAGGTTCCC0.077400.022900.637900.500001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230GCCUACCUGGAGAGCUUUU73.6001603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811248GCCTACCTGGAGAGCTTTTAAAAGCTCTCCAGGTAGGC0.141200.006801.000001.000001.000001.00000


Target Position: 3255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255AAUGAGAAAUGUAUAUUUU86.3129103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2483273AATGAGAAATGTATATTTTAAAATATACATTTCTCATT0.177900.015300.508600.500001.000001.00000


Target Position: 3245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3245AUUCUUUAAUAAUGAGAAA86.1366107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2893263ATTCTTTAATAATGAGAAATTTCTCATTATTAAAGAAT0.022100.014400.508600.500001.000001.00000


Target Position: 3291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3291CGAGUUCUGUAAAAAAAAA95.619311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253309CGAGTTCTGTAAAAAAAAATTTTTTTTTACAGAACTCG0.629300.523200.793101.000001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832UGGAGAUUUGGAAUAGUCA83.722172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310850TGGAGATTTGGAATAGTCATGACTATTCCAAATCTCCA0.038000.006000.620700.500001.000001.00000


Target Position: 1886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886ACGUUGCCAGGACUUACAC61.53431631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921904ACGTTGCCAGGACTTACACGTGTAAGTCCTGGCAACGT0.049200.001700.482800.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313CGUGUGUGGGAACCUGUUU76.9667419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301331CGTGTGTGGGAACCTGTTTAAACAGGTTCCCACACACG0.135800.003400.775901.000001.000001.00000


Target Position: 2108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108CAUCAUCGUCUACCGCAAA90.305345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1522126CATCATCGTCTACCGCAAATTTGCGGTAGACGATGATG0.273200.091300.655200.750000.972801.00000


Target Position: 3254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254UAAUGAGAAAUGUAUAUUU84.015159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3023272TAATGAGAAATGTATATTTAAATATACATTTCTCATTA0.180200.008300.534500.500001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769AGGUGGUGAAUCACGUGGA80.4218271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299787AGGTGGTGAATCACGTGGATCCACGTGATTCACCACCT0.027300.001600.474100.500000.918500.75000


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338CUCCUCCGGUCACUGUGUC59.3051849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2762356CTCCTCCGGTCACTGTGTCGACACAGTGACCGGAGGAG0.045900.008200.491400.500001.000001.00000


Target Position: 3050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050GCACCCCAAGCUCCCGACU63.27191471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1213068GCACCCCAAGCTCCCGACTAGTCGGGAGCTTGGGGTGC0.274900.027400.646600.750001.000001.00000


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138GCCGCUGCCAGGAACGCUU70.0127855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3121156GCCGCTGCCAGGAACGCTTAAGCGTTCCTGGCAGCGGC0.023300.001100.862101.000000.913000.62500


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329CGCCCCCUGCUCCUCCGGU57.15282090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1922347CGCCCCCTGCTCCTCCGGTACCGGAGGAGCAGGGGGCG0.061300.048000.569000.750000.956500.75000


Target Position: 21, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
21AGGAGCGCAGGAACCAGAC59.31111847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
22839AGGAGCGCAGGAACCAGACGTCTGGTTCCTGCGCTCCT0.062100.005800.525900.500001.000001.00000


Target Position: 3183, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183CAGCUAUCUUGUCUGGUUU85.1802130

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8318319CAGCTATCTTGTCTGGTTT1/1/0/090.56ADAM8NM_001164489.1+NM_001164490.1+NM_001109.41+1+1NANANA10:135076020..135076038(-)00ADAM8(0.002)


Target Position: 3258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3258GAGAAAUGUAUAUUUUACU87.07587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2973276GAGAAATGTATATTTTACTAGTAAAATATACATTTCTC0.144500.020800.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3256-3278ATGAGAAATGTATATTTTACTAAAGUAAAAUAUACAUUUCUCAUGAGAAAUGUAUAUUUUACUAAU-0.312.021


Target Position: 3289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289ACCGAGUUCUGUAAAAAAA85.1024132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1433307ACCGAGTTCTGTAAAAAAATTTTTTTACAGAACTCGGT0.579700.532300.853400.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864GUCAGCCCCGACCCCAGUG54.51312329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303882GTCAGCCCCGACCCCAGTGCACTGGGGTCGGGGCTGAC0.019200.019200.525900.500000.945700.75000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000GGGUGUCCGCCAUGUGCUC68.9858957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691018GGGTGTCCGCCATGTGCTCGAGCACATGGCGGACACCC0.107100.008000.681000.750000.972800.75000


Target Position: 2720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720CCUGCUGUCCACGCCCUCA78.1613366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2522738CCTGCTGTCCACGCCCTCATGAGGGCGTGGACAGCAGG0.033300.002700.620700.750000.940200.87500


Target Position: 3297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3297CUGUAAAAAAAAAAAAAAA86.721996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1273315CTGTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTACAG0.991500.531400.784500.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894AGGACUUACACGUUUACAG72.0217725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081912AGGACTTACACGTTTACAGCTGTAAACGTGTAAGTCCT0.102100.020000.560300.500001.000001.00000


Target Position: 3268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268UAUUUUACUAAUAAAUUAU80.6221261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3123286TATTTTACTAATAAATTATATAATTTATTAGTAAAATA0.152500.033800.500000.500001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669AGUCCUGCUUCUCCUAUGA82.6151199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991687AGTCCTGCTTCTCCTATGATCATAGGAGAAGCAGGACT0.157100.026000.482800.500001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333CCCUGCUCCUCCGGUCACU64.97881305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2442351CCCTGCTCCTCCGGTCACTAGTGACCGGAGGAGCAGGG0.035700.029400.784500.750000.956500.75000


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517CCCAUCCAGAGGAAGCAAG60.06421775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2752535CCCATCCAGAGGAAGCAAGCTTGCTTCCTCTGGATGGG0.026300.002400.853400.750000.951100.87500


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CCUCGAGGAGUUCUGUGAC71.2744776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421526CCTCGAGGAGTTCTGTGACGTCACAGAACTCCTCGAGG0.036300.006200.525900.750000.962000.62500


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160UGGAAAGGGCUAUGUGGGA69.857869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3133178TGGAAAGGGCTATGTGGGATCCCACATAGCCCTTTCCA0.053700.001000.474100.500001.000001.00000


Target Position: 2581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581UGGAAAUUUGGAGAAGUUG58.75831918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2132599TGGAAATTTGGAGAAGTTGCAACTTCTCCAAATTTCCA0.051700.019200.698300.500001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105UGGGCAUGGACCAUGAUGA77.153413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581123TGGGCATGGACCATGATGATCATCATGGTCCATGCCCA0.394600.002200.620700.500000.945700.75000


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673CUGCUUCUCCUAUGACAUC69.3874920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951691CTGCTTCTCCTATGACATCGATGTCATAGGAGAAGCAG0.300200.023300.603400.500001.000001.00000


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690AACCUCAGGAAUGCAUCUA74.3924558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3062708AACCTCAGGAATGCATCTATAGATGCATTCCTGAGGTT0.486300.001600.474100.500001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897ACUUACACGUUUACAGAUC64.00961392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301915ACTTACACGTTTACAGATCGATCTGTAAACGTGTAAGT0.053300.016500.525900.500001.000001.00000


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251UAAUAAUGAGAAAUGUAUA92.567932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2843269TAATAATGAGAAATGTATATATACATTTCTCATTATTA0.118200.010000.491400.500001.000001.00000


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335CUGCUCCUCCGGUCACUGU69.157943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932353CTGCTCCTCCGGTCACTGTACAGTGACCGGAGGAGCAG0.021300.017100.577600.500000.962000.62500


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179GCUCCAACCCCCUGUUCCA83.7488171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2562197GCTCCAACCCCCTGTTCCATGGAACAGGGGGTTGGAGC0.086200.006000.508600.750001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415CCAACGUUCGCACCCCCAG59.55221831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2362433CCAACGTTCGCACCCCCAGCTGGGGGTGCGAACGTTGG0.040900.021400.560300.750000.983700.62500


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGAACCAGGACCACAGCAA78.0196372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051054TGAACCAGGACCACAGCAATTGCTGTGGTCCTGGTTCA0.018800.001500.577600.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889UUGCCAGGACUUACACGUU69.2751933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691907TTGCCAGGACTTACACGTTAACGTGTAAGTCCTGGCAA0.358300.003200.500000.500001.000001.00000


Target Position: 3093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093GUUUCCCAUGGGAUUCAAG68.30791002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3143111GTTTCCCATGGGATTCAAGCTTGAATCCCATGGGAAAC0.106600.001800.508600.500000.923900.87500


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705GUCGUGGACAAUGCAGAGU65.39041267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225723GTCGTGGACAATGCAGAGTACTCTGCATTGTCCACGAC0.049200.008900.612100.500001.000001.00000


Target Position: 2739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739GCCAAUUCCUUCUCCCCGC54.58932321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1732757GCCAATTCCTTCTCCCCGCGCGGGGAGAAGGAATTGGC0.397500.108300.577600.500001.000001.00000


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166GGGCUAUGUGGGAGAGUCA92.609131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2853184GGGCTATGTGGGAGAGTCATGACTCTCCCACATAGCCC0.022800.001800.767200.750001.000001.00000


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107GCAUCAUCGUCUACCGCAA95.282115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
722125GCATCATCGTCTACCGCAATTGCGGTAGACGATGATGC0.193200.065000.706901.000000.972800.87500


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890UGCCAGGACUUACACGUUU70.432825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141908TGCCAGGACTTACACGTTTAAACGTGTAAGTCCTGGCA0.458200.004400.853400.750001.000001.00000


Target Position: 3172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3172UGUGGGAGAGUCAGCUAUC67.06821108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2943190TGTGGGAGAGTCAGCTATCGATAGCTGACTCTCCCACA0.021200.001900.525900.500001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503UGUGACCUCGAGGAGUUCU63.23611477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891521TGTGACCTCGAGGAGTTCTAGAACTCCTCGAGGTCACA0.067800.006800.482800.500000.902200.62500


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GGAGGUGGUGAAUCACGUG79.9134288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302785GGAGGTGGTGAATCACGTGCACGTGATTCACCACCTCC0.028900.001300.577600.750000.918500.87500


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653CCCUAGACCCUGACUUUGC61.3771651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2972671CCCTAGACCCTGACTTTGCGCAAAGTCAGGGTCTAGGG0.020500.012800.637900.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332CCCCUGCUCCUCCGGUCAC55.34462251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2372350CCCCTGCTCCTCCGGTCACGTGACCGGAGGAGCAGGGG0.038900.034200.698300.750000.951100.75000


Target Position: 65, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
65GCCUCUGCUCCCCGACCCG55.77252208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28183GCCTCTGCTCCCCGACCCGCGGGTCGGGGAGCAGAGGC0.024500.002400.586200.500001.000001.00000


Target Position: 3128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3128UUGUGUGUGUUUAAGCUUA80.2695273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2263146TTGTGTGTGTTTAAGCTTATAAGCTTAAACACACACAA0.110700.029200.612100.500001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506GACCUCGAGGAGUUCUGUG71.3251773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721524GACCTCGAGGAGTTCTGTGCACAGAACTCCTCGAGGTC0.052500.001800.525900.500000.962000.87500


Target Position: 2976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976GCAUCCCCAGAAAGACUCC62.19861570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982994GCATCCCCAGAAAGACTCCGGAGTCTTTCTGGGGATGC0.242200.028900.482800.500000.945700.62500


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182CCAACCCCCUGUUCCACCA74.2945564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2682200CCAACCCCCTGTTCCACCATGGTGGAACAGGGGGTTGG0.161200.008600.500000.750001.000001.00000


Target Position: 2050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2050CCGUCUUCGUGGUGGUGGU73.3657618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2992068CCGTCTTCGTGGTGGTGGTACCACCACCACGAAGACGG0.019800.003900.560300.750001.000001.00000


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901CCACACCUGCCCCUGCUCU66.81751127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3062919CCACACCTGCCCCTGCTCTAGAGCAGGGGCAGGTGTGG0.018700.013600.620700.750000.962000.87500


Target Position: 2052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052GUCUUCGUGGUGGUGGUUC54.38472337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2552070GTCTTCGTGGTGGTGGTTCGAACCACCACCACGAAGAC0.032100.007000.646600.500001.000001.00000


Target Position: 3261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261AAAUGUAUAUUUUACUAAU91.854738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2753279AAATGTATATTTTACTAATATTAGTAAAATATACATTT0.121600.098400.491400.500001.000001.00000


Target Position: 2718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718CUCCUGCUGUCCACGCCCU67.23861092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122736CTCCTGCTGTCCACGCCCTAGGGCGTGGACAGCAGGAG0.306700.004800.465500.500000.929300.87500


Target Position: 3176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3176GGAGAGUCAGCUAUCUUGU83.7748169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3083194GGAGAGTCAGCTATCTTGTACAAGATAGCTGACTCTCC0.022100.001100.663800.750001.000001.00000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207GGAUGUUCAGUGACUGCAG82.1018219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821225GGATGTTCAGTGACTGCAGCTGCAGTCACTGAACATCC0.067900.019600.586200.750000.994600.87500


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505GCCCUGAAGCCCCCCAUCC51.2362586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142523GCCCTGAAGCCCCCCATCCGGATGGGGGGCTTCAGGGC0.051300.001000.629300.500000.994600.62500


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672CCUGCUUCUCCUAUGACAU83.3899179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681690CCTGCTTCTCCTATGACATATGTCATAGGAGAAGCAGG0.307800.035400.689701.000001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CGUGGACAAGCUAUAUCAG81.6103235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282800CGTGGACAAGCTATATCAGCTGATATAGCTTGTCCACG0.217700.024000.491400.750000.940200.75000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356CCAGCCCACCCUUCCCAGU61.50651635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1582374CCAGCCCACCCTTCCCAGTACTGGGAAGGGTGGGCTGG0.162800.031000.637900.750000.989100.62500


Target Position: 3175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175GGGAGAGUCAGCUAUCUUG82.6706197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2863193GGGAGAGTCAGCTATCTTGCAAGATAGCTGACTCTCCC0.026900.001600.844800.750001.000001.00000


Target Position: 2691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2691ACCUCAGGAAUGCAUCUAC68.15971020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2952709ACCTCAGGAATGCATCTACGTAGATGCATTCCTGAGGT0.110400.001500.672400.500001.000001.00000


Target Position: 3235, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3235GAAAGCUUUUAUUCUUUAA93.992118

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9323519GAAAGCTTTTATTCTTTAA1/1/0/089.93ADAM8NM_001164489.1+NM_001109.4+NM_001164490.11+1+1NANANA10:135075968..135075986(-)00ADAM8(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1493253GAAAGCTTTTATTCTTTAATTAAAGAATAAAAGCTTTC0.094500.017600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3233-3255CTGAAAGCTTTTATTCTTTAATAUUAAAGAAUAAAAGCUUUCAGGAAAGCUUUUAUUCUUUAAUAU7.117.012


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952GGUUCCAGGCAGCACAGAC75.4425490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2182970GGTTCCAGGCAGCACAGACGTCTGTGCTGCCTGGAACC0.262100.011400.534500.750001.000001.00000


Target Position: 3292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3292GAGUUCUGUAAAAAAAAAA90.287546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1543310GAGTTCTGTAAAAAAAAAATTTTTTTTTTACAGAACTC0.718700.518600.810300.750001.000001.00000


Target Position: 3022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022UCUUCGAGAGGGUGUCAGU70.2103836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2923040TCTTCGAGAGGGTGTCAGTACTGACACCCTCTCGAAGA0.021300.002600.517200.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GUGGUGAAUCACGUGGACA83.9944161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250789GTGGTGAATCACGTGGACATGTCCACGTGATTCACCAC0.033600.002700.586200.500000.962000.62500


Target Position: 3049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3049UGCACCCCAAGCUCCCGAC48.45152780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2843067TGCACCCCAAGCTCCCGACGTCGGGAGCTTGGGGTGCA0.245600.024300.534500.500000.945700.75000


Target Position: 2980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2980CCCCAGAAAGACUCCAUCC63.22581480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912998CCCCAGAAAGACTCCATCCGGATGGAGTCTTTCTGGGG0.197400.040300.620700.500001.000001.00000


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262AAUGUAUAUUUUACUAAUA94.740716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3083280AATGTATATTTTACTAATATATTAGTAAAATATACATT0.116300.094100.465500.500001.000001.00000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008GUUCCCCUGCGUGCUCUUC54.79082302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043026GTTCCCCTGCGTGCTCTTCGAAGAGCACGCAGGGGAAC0.084100.015500.474100.500001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178CGCUCCAACCCCCUGUUCC57.02972098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912196CGCTCCAACCCCCTGTTCCGGAACAGGGGGTTGGAGCG0.021400.003900.551700.500001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CCUUCCCAGUUCCUGUCUA84.0301158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742383CCTTCCCAGTTCCTGTCTATAGACAGGAACTGGGAAGG0.026400.012800.672401.000000.978301.00000


Target Position: 3134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3134GUGUUUAAGCUUAGGAAUC67.81081045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2133152GTGTTTAAGCTTAGGAATCGATTCCTAAGCTTAAACAC0.206600.064900.612100.500001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GCAUGGACCAUGAUGAGAA97.52676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851126GCATGGACCATGATGAGAATTCTCATCATGGTCCATGC0.324200.170300.681001.000000.978300.62500


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363ACCCUUCCCAGUUCCUGUC52.67172478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3002381ACCCTTCCCAGTTCCTGTCGACAGGAACTGGGAAGGGT0.028400.016200.534500.500000.978300.75000


Target Position: 3122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3122CCAGCUUUGUGUGUGUUUA87.478877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1253140CCAGCTTTGTGTGTGTTTATAAACACACACAAAGCTGG0.111900.036000.810301.000001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764CACGUGUAGCCCCAGCUGU71.9562732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2482782CACGTGTAGCCCCAGCTGTACAGCTGGGGCTACACGTG0.085300.002800.586200.500000.934800.75000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882AAGGACGUUGCCAGGACUU66.08441202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661900AAGGACGTTGCCAGGACTTAAGTCCTGGCAACGTCCTT0.098500.002000.500000.500001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337GCUCCUCCGGUCACUGUGU73.0298642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2042355GCTCCTCCGGTCACTGTGTACACAGTGACCGGAGGAGC0.054700.011500.646600.750001.000001.00000


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688CUAACCUCAGGAAUGCAUC63.82931411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852706CTAACCTCAGGAATGCATCGATGCATTCCTGAGGTTAG0.461000.002300.491400.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280GGCACAACUUCACCCUCCA88.31665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109298GGCACAACTTCACCCTCCATGGAGGGTGAAGTTGTGCC0.205500.136000.655200.750000.967400.62500


Target Position: 2360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360CCCACCCUUCCCAGUUCCU61.20161665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832378CCCACCCTTCCCAGTTCCTAGGAACTGGGAAGGGTGGG0.023800.013400.646600.750000.967400.87500


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AGGACGUUGCCAGGACUUA78.5191345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701901AGGACGTTGCCAGGACTTATAAGTCCTGGCAACGTCCT0.105400.001900.810300.750001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281GCCCCUGACCUCAGCCACC59.02221884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891299GCCCCTGACCTCAGCCACCGGTGGCTGAGGTCAGGGGC0.490500.009200.646600.500000.902200.75000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792CUAUAUCAGAAACUCAACU78.8637328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314810CTATATCAGAAACTCAACTAGTTGAGTTTCTGATATAG0.334900.170200.465500.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368UCCCAGUUCCUGUCUACAC60.44261738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2312386TCCCAGTTCCTGTCTACACGTGTAGACAGGAACTGGGA0.044200.007700.577600.500000.978300.87500


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893CAGGACUUACACGUUUACA84.0507157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701911CAGGACTTACACGTTTACATGTAAACGTGTAAGTCCTG0.146800.011200.577600.500001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405GGUCAUCAAGCCAACGUUC73.3872616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1432423GGTCATCAAGCCAACGTTCGAACGTTGGCTTGATGACC0.099600.038000.681000.750001.000001.00000


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139CCGCUGCCAGGAACGCUUC57.862019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101157CCGCTGCCAGGAACGCTTCGAAGCGTTCCTGGCAGCGG0.027200.001100.741400.750000.913000.62500


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884GGACGUUGCCAGGACUUAC76.6421432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821902GGACGTTGCCAGGACTTACGTAAGTCCTGGCAACGTCC0.062300.001600.689700.750001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778AUCACGUGGACAAGCUAUA77.6405394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
217796ATCACGTGGACAAGCTATATATAGCTTGTCCACGTGAT0.141200.004100.637900.500001.000001.00000


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173GUGGGAGAGUCAGCUAUCU79.0495320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2693191GTGGGAGAGTCAGCTATCTAGATAGCTGACTCTCCCAC0.057200.001900.569000.500001.000001.00000


Target Position: 2518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518CCAUCCAGAGGAAGCAAGG60.78821701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702536CCATCCAGAGGAAGCAAGGCCTTGCTTCCTCTGGATGG0.029700.002500.500000.500000.951100.75000


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672AGGCUCAGCUGCUGUUCUA88.063269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2992690AGGCTCAGCTGCTGTTCTATAGAACAGCAGCTGAGCCT0.047700.001400.672400.750000.972800.75000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784UGGACAAGCUAUAUCAGAA95.297414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88802TGGACAAGCTATATCAGAATTCTGATATAGCTTGTCCA0.257400.037700.672400.750000.940200.75000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284UAUUGACCGAGUUCUGUAA84.3549150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2443302TATTGACCGAGTTCTGTAATTACAGAACTCGGTCAATA0.561900.052500.508600.500001.000001.00000


Target Position: 3121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121CCCAGCUUUGUGUGUGUUU71.966730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1533139CCCAGCTTTGTGTGTGTTTAAACACACACAAAGCTGGG0.585400.009200.991401.000001.000001.00000