Input target sequence

Length: 4353
TTCTCTCACGAAGCCCCGCCCGCGGAGAGGTTCCATATTGGGTAAAATCTCGGCTCTCGGAGAGTCCCGGGAGCTGTTCTCGCGAGAGTACTGCGGGAGGCTCCCGTTTGCTGGCTCTTGGAACCGCGACCACTGGAGCCTTAGCGGGCGCAGCAGCTGGAACGGGAGTACTGCGACGCAGCCCGGAGTCGGCCTTGTAGGGGCGAAGGTGCAGGGAGATCGCGGCGGGCGCAGTCTTGAGCGCCGGAGCGCGTCCCTGCCCTTAGCGGGGCTTGCCCCAGTCGCAGGGGCACATCCAGCCGCTGCGGCTGACAGCAGCCGCGCGCGCGGGAGTCTGCGGGGTCGCGGCAGCCGCACCTGCGCGGGCGACCAGCGCAAGGTCCCCGCCCGGCTGGGCGGGCAGCAAGGGCCGGGGAGAGGGTGCGGGTGCAGGCGGGGGCCCCACAGGGCCACCTTCTTGCCCGGCGGCTGCCGCTGGAAAATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAGTCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACATGAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAATGATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACAGGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTACAACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGAACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGCAGATTATGCGTCTGACAGGAACACCCCCCGCTTATCTCATTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAGTCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCCCAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCCGATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCCTGAGCACCTGGTTTCTGTTCTGTTGATCCCACTTCACTGTGAGGGGAAGGCCTTTTCACGGGAACTCTCCAAATATTATTCAAGTGCCTCTTGTTGCAGAGATTTCCTCCATGGTGGAAGGGGGTGTGCGTGCGTGTGCGTGCGTGTTAGTGTGTGTGCATGTGTGTGTCTGTCTTTGTGGGAGGGTAAGACAATATGAACAAACTATGATCACAGTGACTTTACAGGAGGTTGTGGATGCTCCAGGGCAGCCTCCACCTTGCTCTTCTTTCTGAGAGTTGGCTCAGGCAGACAAGAGCTGCTGTCCTTTTAGGAATATGTTCAATGCAAAGTAAAAAAATATGAATTGTCCCCAATCCCGGTCATGCTTTTGCCACTTTGGCTTCTCCTGTGACCCCACCTTGACGGTGGGGCGTAGACTTGACAACATCCCACAGTGGCACGGAGAGAAGGCCCATACCTTCTGGTTGCTTCAGACCTGACACCGTCCCTCAGTGATACGTACAGCCAAAAAGGACCAACTGGCTTCTGTGCACTAGCCTGTGATTAACTTGCTTAGTATGGTTCTCAGATCTTGACAGTATATTTGAAACTGTAAATATGTTTGTGCCTTAAAAGGAGAGAAGAAAGTGTAGATAGTTAAAAGACTGCAGCTGCTGAAGTTCTGAGCCGGGCAAGTCGAGAGGGCTGTTGGACAGCTGCTTGTGGGCCCGGAGTAATCAGGCAGCCTTCATAGGCGGTCATGTGTGCATGTGAGCACATGCGTATATGTGCGTCTCTCTTTCTCCCTCACCCCCAGGTGTTGCCATTTCTCTGCTTACCCTTCACCTTTGGTGCAGAGGTTTCTTGAATATCTGCCCCAGTAGTCAGAAGCAGGTTCTTGATGTCATGTACTTCCTGTGTACTCTTTATTTCTAGCAGAGTGAGGATGTGTTTTGCACGTCTTGCTATTTGAGCATGCACAGCTGCTTGTCCTGCTCTCTTCAGGAGGCCCTGGTGTCAGGCAGGTTTGCCAGTGAAGACTTCTTGGGTAGTTTAGATCCCATGTCACCTCAGCTGATATTATGGCAAGTGATATCACCTCTCTTCAGCCCCTAGTGCTATTCTGTGTTGAACACAATTGATACTTCAGGTGCTTTTGATGTGAAAATCATGAAAAGAGGAACAGGTGGATGTATAGCATTTTTATTCATGCCATCTGTTTTCAACCAACTATTTTTGAGGAATTATCATGGGAAAAGACCAGGGCTTTTCCCAGGAATATCCCAAACTTCGGAAACAAGTTATTCTCTTCACTCCCAATAACTAATGCTAAGAAATGCTGAAAATCAAAGTAAAAAATTAAAGCCCATAAGGCCAGAAACTCCTTTTGCTGTCTTTCTCTAAATATGATTACTTTAAAATAAAAAAGTAACAAGGTGTCTTTTCCACTCCTATGGAAAAGGGTCTTCTTGGCAGCTTAACATTGACTTCTTGGTTTGGGGAGAAATAAATTTTGTTTCAGAATTTTGTATATTGTAGGAATCCTTTGAGAATGTGATTCCTTTTGATGGGGAGAAAGGGCAAATTATTTTAATATTTTGTATTTTCAACTTTATAAAGATAAAATATCCTCAGGGGTGGAGAAGTGTCGTTTTCATAACTTGCTGAATTTCAGGCATTTTGTTCTACATGAGGACTCATATATTTAAGCCTTTTGTGTAATAAGAAAGTATAAAGTCACTTCCAGTGTTGGCTGTGTGACAGAATCTTGTATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCATAATGCTCCCATCTCCTGATTTCTCTGAACAGAAAACAAAAGAGAGAATGAGGGAAATTGCTATTTTATTTGTATTCATGAACTTGGCTGTAATCAGTTATGCCGTATAGGATGTCAGACAATACCACTGGTTAAAATAAAGCCTATTTTTCAAATTTAGTGAGTTTCTCAAGTTTATTATATTTTTCTCTTGTTTTTATTTAATGCACAATATGGCATTATATCAATATCCTTTAAACTGTGACCTGGCATACTTGTCTGACAGATCTTAATACTACTCCTAACATTTAGAAAATGTTGATAAAGCTTCTTAGTTGTACATTTTTTGGTGAAGAGTATCCAGGTCTTTGCTGTGGATGGGTAAAGCAAAGAGCAAATGAACGAAGTATTAAGCATTGGGGCCTGTCTTATCTACACTCGAGTGTAAGAGTGGCCGAAATGACAGGGCTCAGCAGACTGTGGCCTGAGGGCCAAATCTGGCCCACCACCTGTTTGGTGTAGCCTGCTAAGAATGGCTTTTACATTTTTAAATGGTTGGGAAAGAAAAAAAAAGAAGTAGTAGATTTTGTAGCATGTGATGTAAGTAATGTAAAACTTAAATTCCAGTATCCATAAATAAAGTTTTATGAGAACAGA