siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 27   28   29   32   33   125   414   489   490   510   511   512   513   514   607   624   625   629   630   639  
640   642   643   644   652   653   663   669   670   673   674   675   676   691   692   694   695   696   697   698  
703   707   708   709   731   732   733   734   736   737   742   762   763   764   766   767   769   770   771   813  
817   829   830   831   836   837   841   844   848   849   850   853   854   855   856   859   862   863   864   867  
868   877   878   879   883   884   885   886   887   888   889   891   892   901   902   903   904   908   917   918  
919   926   927   928   940   941   950   958   961   964   967   970   971   988   993   994   995   996   997   998  
999   1000   1001   1003   1009   1056   1074   1099   1100   1101   1123   1124   1126   1127   1128   1129   1131   1132   1133   1159  
1160   1161   1162   1203   1204   1205   1206   1207   1208   1210   1237   1238   1239   1240   1241   1243   1269   1271   1272   1273  
1278   1279   1281   1283   1284   1286   1287   1288   1291   1321   1322   1323   1324   1326   1327   1335   1336   1347   1348   1380  
1385   1386   1387   1390   1391   1392   1405   1409   1411   1414   1469   1470   1471   1488   1514   1529   1556   1557   1558   1565  
1566   1567   1568   1569   1570   1571   1576   1577   1581   1616   1617   1618   1619   1621   1622   1623   1626   1629   1630   1670  
1743   1745   1750   1752   1766   1767   1769   1815   1816   1817   1873   1875   1878   1879   1880   1882   1883   1887   1890   1891  
1892   1909   1912   1913   1914   1915   1970   1971   1972   1973   1974   1979   2031   2049   2050   2054   2055   2056   2057   2093  
2094   2095   2100   2101   2115   2119   2120   2124   2126   2127   2129   2134   2141   2145   2148   2149   2150   2156   2159   2168  
2169   2170   2171   2178   2179   2180   2181   2182   2183   2185   2186   2188   2210   2211   2324   2325   2326   2327   2333   2334  
2335   2336   2353   2354   2360   2362   2363   2366   2367   2368   2374   2375   2376   2377   2400   2433   2434   2435   2436   2437  
2439   2440   2453   2454   2455   2456   2457   2458   2459   2460   2461   2493   2494   2591   2603   2604   2605   2606   2607   2608  
2609   2633   2640   2642   2643   2653   2720   2721   2722   2723   2726   2727   2728   2729   2731   2751   2752   2754   2755   2756  
2758   2759   2761   2763   2769   2770   2771   2772   2773   2774   2837   2840   2846   2848   2849   2850   2851   2852   2853   2858  
2859   2860   2863   2870   2871   2873   2876   2880   2881   2884   2886   2889   2890   2895   2896   2915   2916   2917   2919   2923  
2924   2926   2930   2931   2932   2933   2934   2937   2941   2943   2945   2947   2948   2949   2950   2951   2953   3004   3005   3006  
3007   3008   3010   3011   3014   3015   3016   3017   3018   3019   3040   3041   3042   3053   3057   3058   3068   3078   3081   3082  
3085   3103   3104   3109   3110   3111   3112   3113   3114   3116   3117   3118   3120   3121   3122   3142   3143   3149   3150   3181  
3182   3183   3184   3185   3186   3207   3209   3234   3235   3240   3248   3249   3250   3252   3255   3259   3261   3262   3313   3314  
3315   3319   3320   3322   3323   3326   3327   3328   3341   3346   3387   3388   3389   3390   3391   3392   3399   3400   3402   3403  
3406   3409   3410   3487   3488   3489   3492   3493   3495   3496   3497   3506   3507   3508   3528   3549   3550   3558   3561   3568  
3570   3571   3586   3590   3592   3593   3594   3595   3597   3605   3660   3661   3723   3724   3725   3726   3732   3740   3741   3762  
3763   3765   3766   3768   3775   3776   3808   3813   3818   3819   3820   3821   3822   3823   3826   3827   3833   3840   3841   3842  
3845   3846   3847   3848   3854   3855   3857   3858   3859   3868   3875   3876   3880   3883   3884   3886   3895   3897   3898   3901  
3904   3905   3909   3910   3922   3927   3928   3929   3936   3937   3941   3947   3948   3964   3965   3966   3970   3971   3973   3974  
3975   3976   3977   3978   3982   3987   3989   4012   4013   4015   4016   4022   4025   4026   4027   4036   4067   4068   4069   4070  
4071   4072   4075   4076   4077   4078   4087   4089   4095   4109   4110   4136   4137   4138   4139   4140   4151   4229   4230   4232  
4241   4245   4246   4247   4248   4249   4250   4251   4253   4254   4255   4259   4266   4269   4270   4273   4275   4278   4279   4284  
4285   4286   4287   4288   4291   4293   4314   4315   4316   4318   4319   4320   4321   4322   4324  
Biltr, Ernai, Rnaxs, Sidirect 3498   3587  
Biltr, Sidirect 612   654   664   715   772   815   818   820   857   942   973   1252   1349   1628   1753   1865   1889   1893   2130   2140  
2438   2620   2669   2671   2674   2694   2696   2697   2785   2827   2828   2836   2925   2928   3034   3044   3083   3094   3125   3199  
3218   3229   3462   3466   3572   3574   3576   3706   3735   3744   3761   3835   3890   3907   3923   3932   3997   3998   4002   4008  
4014   4017   4141   4222   4223   4256   4289   4297   4301   4328  
Biltr, Ernai 1081   1478   3180   3301  
Biltr, Ernai, Rnaxs 1620   2128   3321   3767  
Biltr, Rnaxs, Sidirect 30   699   700   865   890   931   1244   1282   1285   1357   1746   1747   1751   1867   1868   1874   1881   1884   1888   2142  
2172   2184   2187   2702   2732   2733   2736   2760   2762   2872   2882   2883   2885   2927   2936   2938   2942   2944   2952   2957  
3059   3063   3079   3115   3123   3124   3144   3151   3154   3210   3253   3254   3260   3562   3596   3598   3769   3770   3777   3778  
3812   3837   3860   3877   3879   3881   3885   3926   3933   3934   4023   4024   4083   4088   4090   4091   4096   4231   4260   4292  
4323  


Target Position: 4297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4297GUAAGUAAUGUAAAACUUA96.204241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4295-4317ATGTAAGTAATGTAAAACTTAAAUAAGUUUUACAUUACUUACAUGUAAGUAAUGUAAAACUUAAAU3.26.622


Target Position: 4301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4301GUAAUGUAAAACUUAAAUU83.2468708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4299-4321AAGTAATGTAAAACTTAAATTCCAAUUUAAGUUUUACAUUACUUGUAAUGUAAAACUUAAAUUCCU-4.38.512


Target Position: 3572, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3572GUGUGAUUUCCUACAGAAA95.779547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3570-3592TCGTGTGATTTCCTACAGAAATAUUUCUGUAGGAAAUCACACGAGUGUGAUUUCCUACAGAAAUAU20.320.531


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673UGCGAAAAGAACCUACAGA76.731373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997691TGCGAAAAGAACCTACAGATCTGTAGGTTCTTTTCGCA0.077300.036800.629300.500001.000001.00000


Target Position: 4014, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4014GUUGAUAAAGCUUCUUAGU76.33851421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4012-4034ATGTTGATAAAGCTTCTTAGTTGACUAAGAAGCUUUAUCAACAUGUUGAUAAAGCUUCUUAGUUGU11.78.931


Target Position: 3966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3966GCAUACUUGUCUGACAGAU84.1639619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6033984GCATACTTGTCTGACAGATATCTGTCAGACAAGTATGC0.117300.013900.672401.000001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669UUCAUGCGAAAAGAACCUA66.09982610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978687TTCATGCGAAAAGAACCTATAGGTTCTTTTCGCATGAA0.131400.074900.500000.500001.000001.00000


Target Position: 3341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3341UCAAUCAGUGCAGUGAUAC57.17213554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043359TCAATCAGTGCAGTGATACGTATCACTGCACTGATTGA0.039400.003500.543100.500000.978300.62500


Target Position: 2360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360GGUGUUGCCAUUUCUCUGC62.14123077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142378GGTGTTGCCATTTCTCTGCGCAGAGAAATGGCAACACC0.290000.003500.500000.500000.994600.75000


Target Position: 1874, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874GGAAUAUGUUCAAUGCAAA101.5484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651892GGAATATGTTCAATGCAAATTTGCATTGAACATATTCC0.284200.060800.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1872-1894TAGGAATATGTTCAATGCAAAGTUUUGCAUUGAACAUAUUCCUAGGAAUAUGUUCAAUGCAAAGUU20.08.732


Target Position: 931, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931CCUAAAACCUAGUAAUCUA101.1876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822949CCTAAAACCTAGTAATCTATAGATTACTAGGTTTTAGG0.049700.022700.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
929-951GACCTAAAACCTAGTAATCTAGCUAGAUUACUAGGUUUUAGGUCCCUAAAACCUAGUAAUCUAGCU14.54.923


Target Position: 2895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895GUAAAAAAUUAAAGCCCAU83.6688667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232913GTAAAAAATTAAAGCCCATATGGGCTTTAATTTTTTAC0.219300.189100.525900.750001.000001.00000


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182UGGAGAAGUGUCGUUUUCA80.0881991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913200TGGAGAAGTGTCGTTTTCATGAAAACGACACTTCTCCA0.029000.002200.620700.500001.000001.00000


Target Position: 3389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3389CUGAGUCAACUGGAGCAAG68.78532313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803407CTGAGTCAACTGGAGCAAGCTTGCTCCAGTTGACTCAG0.057500.010200.646600.500001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581CUGUUGAUCCCACUUCACU77.48811279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031599CTGTTGATCCCACTTCACTAGTGAAGTGGGATCAACAG0.039700.009100.577600.500001.000001.00000


Target Position: 2755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2755GCCAUCUGUUUUCAACCAA84.3334608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772773GCCATCTGTTTTCAACCAATTGGTTGAAAACAGATGGC0.244500.015700.853401.000001.000001.00000


Target Position: 4015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4015UUGAUAAAGCUUCUUAGUU68.3912352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9324033TTGATAAAGCTTCTTAGTTAACTAAGAAGCTTTATCAA0.081200.035900.500000.500001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630UGGCAGUGAAGAAGCUCUC59.69123330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996648TGGCAGTGAAGAAGCTCTCGAGAGCTTCTTCACTGCCA0.079100.002000.534500.500000.994600.75000


Target Position: 1558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1558GUCCUGAGCACCUGGUUUC64.26912835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881576GTCCTGAGCACCTGGTTTCGAAACCAGGTGCTCAGGAC0.219900.002100.646600.500001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670UCAUGCGAAAAGAACCUAC60.31363273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750688TCATGCGAAAAGAACCTACGTAGGTTCTTTTCGCATGA0.100600.060300.543100.500001.000001.00000


Target Position: 4068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068CUGUGGAUGGGUAAAGCAA88.1938334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8104086CTGTGGATGGGTAAAGCAATTGCTTTACCCATCCACAG0.052500.015000.637900.750001.000001.00000


Target Position: 3207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3207GCUGAAUUUCAGGCAUUUU79.7571030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6433225GCTGAATTTCAGGCATTTTAAAATGCCTGAAATTCAGC0.093800.012600.853401.000000.923900.62500


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391GCACAUGCCUACUUUGCUC75.64261505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791409GCACATGCCTACTTTGCTCGAGCAAAGTAGGCATGTGC0.166300.048500.543100.750000.983700.75000


Target Position: 3507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CAGUUCAAAUCCUCACCAU87.7499356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5163525CAGTTCAAATCCTCACCATATGGTGAGGATTTGAACTG0.448300.236600.629300.750001.000001.00000


Target Position: 3776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3776UGCUAUUUUAUUUGUAUUC59.87833310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783794TGCTATTTTATTTGTATTCGAATACAAATAAAATAGCA0.335600.082000.681000.500001.000001.00000


Target Position: 3847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3847GGUUAAAAUAAAGCCUAUU82.8427733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003865GGTTAAAATAAAGCCTATTAATAGGCTTTATTTTAACC0.144900.057700.844801.000001.000001.00000


Target Position: 32, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
32UCCAUAUUGGGUAAAAUCU66.62442549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74250TCCATATTGGGTAAAATCTAGATTTTACCCAATATGGA0.267700.020600.646600.500000.945700.62500


Target Position: 3399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3399UGGAGCAAGAAGGAAGGAG55.20693710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513417TGGAGCAAGAAGGAAGGAGCTCCTTCCTTCTTGCTCCA0.145800.034100.534500.500001.000001.00000


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005GGGUCUUCUUGGCAGCUUA95.759449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303023GGGTCTTCTTGGCAGCTTATAAGCTGCCAAGAAGACCC0.417500.003000.956901.000001.000001.00000


Target Position: 3932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932GGCAUUAUAUCAAUAUCCU88.4965318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3930-3952ATGGCATTATATCAATATCCTTTAGGAUAUUGAUAUAAUGCCAUGGCAUUAUAUCAAUAUCCUUUU15.415.232


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723GGAACAGGUGGAUGUAUAG84.0348636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452741GGAACAGGTGGATGTATAGCTATACATCCACCTGTTCC0.035000.012200.698300.750001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764UCUCUGGAGGAAUUCAAUG61.03573206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929782TCTCTGGAGGAATTCAATGCATTGAATTCCTCCAGAGA0.161700.004800.569000.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094GCACUAGCCUGUGAUUAAC75.08261564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9072112GCACTAGCCTGTGATTAACGTTAATCACAGGCTAGTGC0.039200.025800.706900.750000.951100.62500


Target Position: 3313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313UGUAUUUGGGCCAAGGUGU61.85713112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343331TGTATTTGGGCCAAGGTGTACACCTTGGCCCAAATACA0.050400.003400.500000.500001.000001.00000


Target Position: 4251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4251GUUGGGAAAGAAAAAAAAA87.8896346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5084269GTTGGGAAAGAAAAAAAAATTTTTTTTTCTTTCCCAAC0.844000.141300.646600.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324UGUCGACUUGCUGGAGAAG61.42763160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831342TGTCGACTTGCTGGAGAAGCTTCTCCAGCAAGTCGACA0.107700.006100.569000.500001.000001.00000


Target Position: 3497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497UCCUUUAUUGCAGUUCAAA74.18851662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2283515TCCTTTATTGCAGTTCAAATTTGAACTGCAATAAAGGA0.498900.074500.870700.750001.000001.00000


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888GAGGUCUAAAGUAUAUACA91.0196180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811906GAGGTCTAAAGTATATACATGTATATACTTTAGACCTC0.572700.053600.603400.500001.000001.00000


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629GUGGCAGUGAAGAAGCUCU79.37081076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988647GTGGCAGTGAAGAAGCTCTAGAGCTTCTTCACTGCCAC0.054200.002300.569000.500000.994600.75000


Target Position: 3976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3976CUGACAGAUCUUAAUACUA95.42354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733994CTGACAGATCTTAATACTATAGTATTAAGATCTGTCAG0.774500.179200.612100.750001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400GAGGUUUCUUGAAUAUCUG80.1523986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252418GAGGTTTCTTGAATATCTGCAGATATTCAAGAAACCTC0.049400.020900.525900.500001.000001.00000


Target Position: 4291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4291UGUGAUGUAAGUAAUGUAA86.1789475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7934309TGTGATGTAAGTAATGTAATTACATTACTTACATCACA0.055600.025800.672400.750001.000001.00000


Target Position: 3877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3877GUGAGUUUCUCAAGUUUAU85.8039502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4253895GTGAGTTTCTCAAGTTTATATAAACTTGAGAAACTCAC0.176700.086100.750000.750000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3875-3897TAGTGAGTTTCTCAAGTTTATTAAUAAACUUGAGAAACUCACUAGUGAGUUUCUCAAGUUUAUUAU4.919.222


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694ACUGCGGUUACUUAAACAU75.08141565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831712ACTGCGGTTACTTAAACATATGTTTAAGTAACCGCAGT0.132100.004800.551700.750001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127UCUCAGAUCUUGACAGUAU82.1842794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092145TCTCAGATCTTGACAGTATATACTGTCAAGATCTGAGA0.217800.022200.681000.750001.000001.00000


Target Position: 3762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3762AGAAUGAGGGAAAUUGCUA86.1989471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613780AGAATGAGGGAAATTGCTATAGCAATTTCCCTCATTCT0.240600.007300.551700.750001.000001.00000


Target Position: 2620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620GAUAUUAUGGCAAGUGAUA93.715494

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2618-2640CTGATATTATGGCAAGTGATATCUAUCACUUGCCAUAAUAUCAGGAUAUUAUGGCAAGUGAUAUCU19.2-8.622


Target Position: 3937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3937UAUAUCAAUAUCCUUUAAA80.4492959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673955TATATCAATATCCTTTAAATTTAAAGGATATTGATATA0.709600.367300.543100.500001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927GGGACCUAAAACCUAGUAA89.5444259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881945GGGACCTAAAACCTAGTAATTACTAGGTTTTAGGTCCC0.042100.025000.956901.000000.978300.75000


Target Position: 3982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3982GAUCUUAAUACUACUCCUA97.463125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8744000GATCTTAATACTACTCCTATAGGAGTAGTATTAAGATC0.476800.334600.508600.750001.000001.00000


Target Position: 3183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183GGAGAAGUGUCGUUUUCAU94.601870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633201GGAGAAGTGTCGTTTTCATATGAAAACGACACTTCTCC0.056400.002500.715501.000001.000001.00000


Target Position: 3328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3328GUGUUUCCAUUUCUCAAUC68.92962294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053346GTGTTTCCATTTCTCAATCGATTGAGAAATGGAAACAC0.266100.079600.612100.500001.000001.00000


Target Position: 2945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945UAAAUAUGAUUACUUUAAA89.19281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592963TAAATATGATTACTTTAAATTTAAAGTAATCATATTTA0.109200.091400.534500.500001.000001.00000


Target Position: 3041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041UGGGGAGAAAUAAAUUUUG61.86413111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703059TGGGGAGAAATAAATTTTGCAAAATTTATTTCTCCCCA0.131100.002700.698300.500001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972GGGCGUAGACUUGACAACA90.6965197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851990GGGCGTAGACTTGACAACATGTTGTCAAGTCTACGCCC0.344300.056000.784500.750001.000001.00000


Target Position: 3970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3970ACUUGUCUGACAGAUCUUA83.4621684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343988ACTTGTCTGACAGATCTTATAAGATCTGTCAGACAAGT0.195000.030500.672400.750001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868CCUUAUCUACCAAAUUCUC72.14511909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811886CCTTATCTACCAAATTCTCGAGAATTTGGTAGATAAGG0.721000.252500.534500.750001.000001.00000


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971GGGGCGUAGACUUGACAAC71.16952016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301989GGGGCGTAGACTTGACAACGTTGTCAAGTCTACGCCCC0.340700.020400.844800.750001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836UGUCAGAAGCUUACAGAUG67.5932448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860854TGTCAGAAGCTTACAGATGCATCTGTAAGCTTCTGACA0.044700.007300.551700.500001.000001.00000


Target Position: 1081, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081CAACCAGACAGUUGAUAUU88.3032330

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3108119CAACCAGACAGTTGATATT1/1/0/097.75MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+1NANANANA00MAPK14(0.002)


Target Position: 3006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006GGUCUUCUUGGCAGCUUAA92.8333114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733024GGTCTTCTTGGCAGCTTAATTAAGCTGCCAAGAAGACC0.416900.003900.819001.000001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817UCUGAACAACAUUGUGAAA82.7458741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750835TCTGAACAACATTGTGAAATTTCACAATGTTGTTCAGA0.064600.016300.724100.750001.000001.00000


Target Position: 3125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125CAAAUUAUUUUAAUAUUUU87.7418358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3123-3145GGCAAATTATTTTAATATTTTGTAAAAUAUUAAAAUAAUUUGCCCAAAUUAUUUUAAUAUUUUGUU-10.3-10.312


Target Position: 4288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4288GCAUGUGAUGUAAGUAAUG78.89951135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7194306GCATGTGATGTAAGTAATGCATTACTTACATCACATGC0.074600.047900.698300.750001.000001.00000


Target Position: 2606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2606AUGUCACCUCAGCUGAUAU83.082719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192624ATGTCACCTCAGCTGATATATATCAGCTGAGGTGACAT0.037800.003300.612100.500000.967400.75000


Target Position: 3741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3741UCUGAACAGAAAACAAAAG61.63142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7313759TCTGAACAGAAAACAAAAGCTTTTGTTTTCTGTTCAGA0.191700.146900.586200.500001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326UCGACUUGCUGGAGAAGAU77.15891317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361344TCGACTTGCTGGAGAAGATATCTTCTCCAGCAAGTCGA0.132000.012500.612100.750001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203CACCCCCCGCUUAUCUCAU71.60781975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6051221CACCCCCCGCTTATCTCATATGAGATAAGCGGGGGGTG0.107200.023100.637900.750001.000001.00000


Target Position: 3113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3113GGGGAGAAAGGGCAAAUUA90.3208216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783131GGGGAGAAAGGGCAAATTATAATTTGCCCTTTCTCCCC0.042300.009700.956901.000001.000001.00000


Target Position: 818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CUGAACAACAUUGUGAAAU69.78352192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
816-838ATCTGAACAACATTGTGAAATGTAUUUCACAAUGUUGUUCAGAUCUGAACAACAUUGUGAAAUGUU20.520.522


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409CAGUACCACGAUCCUGAUG68.54062339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291427CAGTACCACGATCCTGATGCATCAGGATCGTGGTACTG0.155300.017800.629300.500000.945700.62500


Target Position: 2609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609UCACCUCAGCUGAUAUUAU80.743923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762627TCACCTCAGCTGATATTATATAATATCAGCTGAGGTGA0.153400.003900.681000.750000.983700.62500


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208CCCGCUUAUCUCAUUAACA86.7217433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281226CCCGCTTATCTCATTAACATGTTAATGAGATAAGCGGG0.514600.047400.784500.750001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762GGUCUCUGGAGGAAUUCAA90.6352200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934780GGTCTCTGGAGGAATTCAATTGAATTCCTCCAGAGACC0.064000.002900.706901.000001.000001.00000


Target Position: 3063, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3063CAGAAUUUUGUAUAUUGUA94.166780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083081CAGAATTTTGTATATTGTATACAATATACAAAATTCTG0.191800.027900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3061-3083TTCAGAATTTTGTATATTGTAGGUACAAUAUACAAAAUUCUGAACAGAAUUUUGUAUAUUGUAGGU6.75.321


Target Position: 3876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3876AGUGAGUUUCUCAAGUUUA90.4663206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6683894AGTGAGTTTCTCAAGTTTATAAACTTGAGAAACTCACT0.145300.010800.672400.750000.923900.75000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721GAGGAACAGGUGGAUGUAU84.5416590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962739GAGGAACAGGTGGATGTATATACATCCACCTGTTCCTC0.028200.016500.767200.750001.000001.00000


Target Position: 2919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2919CAGAAACUCCUUUUGCUGU77.40371289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952937CAGAAACTCCTTTTGCTGTACAGCAAAAGGAGTTTCTG0.153900.041500.577600.500001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GCAAGAAACUAUAUUCAGU89.7049251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891262GCAAGAAACTATATTCAGTACTGAATATAGTTTCTTGC0.041400.024500.646600.750000.983700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1242-1264AGGCAAGAAACTATATTCAGTCTACUGAAUAUAGUUUCUUGCCUGCAAGAAACUAUAUUCAGUCUU13.412.213


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951UGAUUACUUUAAAAUAAAA92.1138142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4912969TGATTACTTTAAAATAAAATTTTATTTTAAAGTAATCA0.147700.040500.724100.750001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731UGGAUGUAUAGCAUUUUUA83.711661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682749TGGATGTATAGCATTTTTATAAAAATGCTATACATCCA0.056800.002400.810300.750001.000001.00000


Target Position: 3346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3346CAGUGCAGUGAUACAUGUA98.027918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343364CAGTGCAGTGATACATGTATACATGTATCACTGCACTG0.109000.004700.603400.750000.978300.87500


Target Position: 2927, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927CCUUUUGCUGUCUUUCUCU77.72071254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482945CCTTTTGCTGTCTTTCTCTAGAGAAAGACAGCAAAAGG0.374800.125800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2925-2947CTCCTTTTGCTGTCTTTCTCTAAAGAGAAAGACAGCAAAAGGAGCCUUUUGCUGUCUUUCUCUAAU19.118.622


Target Position: 2852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852CUUCACUCCCAAUAACUAA88.8667304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932870CTTCACTCCCAATAACTAATTAGTTATTGGGAGTGAAG0.424900.224000.603400.750001.000001.00000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007GUCUUCUUGGCAGCUUAAC56.39543617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833025GTCTTCTTGGCAGCTTAACGTTAAGCTGCCAAGAAGAC0.380800.019100.672400.500001.000001.00000


Target Position: 4083, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4083GCAAAGAGCAAAUGAACGA83.7439658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254101GCAAAGAGCAAATGAACGATCGTTCATTTGCTCTTTGC0.451200.026200.560300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4081-4103AAGCAAAGAGCAAATGAACGAAGUCGUUCAUUUGCUCUUUGCUUGCAAAGAGCAAAUGAACGAAGU21.116.622


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816CCACCUUGCUCUUCUUUCU80.2235978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441834CCACCTTGCTCTTCTTTCTAGAAAGAAGAGCAAGGTGG0.065800.036700.620700.750001.000001.00000


Target Position: 4091, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4091CAAAUGAACGAAGUAUUAA91.7136152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5894109CAAATGAACGAAGTATTAATTAATACTTCGTTCATTTG0.355900.264300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4089-4111AGCAAATGAACGAAGTATTAAGCUUAAUACUUCGUUCAUUUGCUCAAAUGAACGAAGUAUUAAGCU6.37.422


Target Position: 3402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3402AGCAAGAAGGAAGGAGGCA70.50852106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583420AGCAAGAAGGAAGGAGGCATGCCTCCTTCCTTCTTGCT0.088600.079400.500000.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UGAAGACUGUGAGCUGAAG68.12882383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840976TGAAGACTGTGAGCTGAAGCTTCAGCTCACAGTCTTCA0.083600.080700.586200.500001.000001.00000


Target Position: 3042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042GGGGAGAAAUAAAUUUUGU82.7461740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993060GGGGAGAAATAAATTTTGTACAAAATTTATTTCTCCCC0.066100.002000.784500.750001.000001.00000


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605CAUGUCACCUCAGCUGAUA87.49375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852623CATGTCACCTCAGCTGATATATCAGCTGAGGTGACATG0.029900.002200.612100.750000.967400.75000


Target Position: 4026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4026UCUUAGUUGUACAUUUUUU76.84881359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9534044TCTTAGTTGTACATTTTTTAAAAAATGTACAACTAAGA0.033300.012200.724100.750001.000001.00000


Target Position: 4025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4025UUCUUAGUUGUACAUUUUU66.93672526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874043TTCTTAGTTGTACATTTTTAAAAATGTACAACTAAGAA0.056200.016000.672400.500001.000001.00000


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884UGAAAAUCAAAGUAAAAAA85.9984487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422902TGAAAATCAAAGTAAAAAATTTTTTACTTTGATTTTCA0.440400.294300.724100.750001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603CCCAUGUCACCUCAGCUGA77.80911246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922621CCCATGTCACCTCAGCTGATCAGCTGAGGTGACATGGG0.037100.002100.767200.750000.972800.62500


Target Position: 3549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3549GCCAUGUUUGGUUGUAAAU77.8671239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953567GCCATGTTTGGTTGTAAATATTTACAACCAAACATGGC0.048800.003500.991401.000000.934800.62500


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CUGUUGGACGUUUUUACAC66.23642595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997755CTGTTGGACGTTTTTACACGTGTAAAAACGTCCAACAG0.090900.008100.491400.500001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695CUGCGGUUACUUAAACAUA89.7906246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
778713CTGCGGTTACTTAAACATATATGTTTAAGTAACCGCAG0.174500.006500.741400.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941AGUAAUCUAGCUGUGAAUG66.04952616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981959AGTAATCTAGCTGTGAATGCATTCACAGCTAGATTACT0.117200.018100.551700.500001.000001.00000


Target Position: 3706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3706GGUUUCUGAGCAUAAUGCU81.7084832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3704-3726TCGGTTTCTGAGCATAATGCTCCAGCAUUAUGCUCAGAAACCGAGGUUUCUGAGCAUAAUGCUCCU15.219.233


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994GGCUCGGCACACAGAUGAU89.4433265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431012GGCTCGGCACACAGATGATATCATCTGTGTGCCGAGCC0.178800.007800.819001.000001.000001.00000


Target Position: 3947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3947UCCUUUAAACUGUGACCUG62.09833085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023965TCCTTTAAACTGTGACCTGCAGGTCACAGTTTAAAGGA0.039800.043600.586200.500001.000001.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GAAGAUGAACUUUGCGAAU84.7629573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381297GAAGATGAACTTTGCGAATATTCGCAAAGTTCATCTTC0.171100.002800.663800.750001.000001.00000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347UUGUAUUGGACUCAGAUAA77.61461269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031365TTGTATTGGACTCAGATAATTATCTGAGTCCAATACAA0.042000.003400.612100.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411GUACCACGAUCCUGAUGAU93.1435109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541429GTACCACGATCCTGATGATATCATCAGGATCGTGGTAC0.234500.022200.500000.750000.945700.62500


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904UCUCUUGUUUUUAUUUAAU73.62931741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943922TCTCTTGTTTTTATTTAATATTAAATAAAAACAAGAGA0.110500.082200.715500.750001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433AGCAGGUUCUUGAUGUCAU83.7015664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292451AGCAGGTTCTTGATGTCATATGACATCAAGAACCTGCT0.204600.034900.698300.750001.000001.00000


Target Position: 3886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3886UCAAGUUUAUUAUAUUUUU76.91571348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4833904TCAAGTTTATTATATTTTTAAAAATATAATAAACTTGA0.519500.238100.724100.750001.000001.00000


Target Position: 612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612CAAAAACGGGGUUACGUGU73.49341748

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
610-632CACAAAAACGGGGTTACGTGTGGACACGUAACCCCGUUUUUGUGCAAAAACGGGGUUACGUGUGGU21.05.533


Target Position: 2720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720AGAGGAACAGGUGGAUGUA87.3936385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672738AGAGGAACAGGTGGATGTATACATCCACCTGTTCCTCT0.031200.017000.543100.750001.000001.00000


Target Position: 2758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758AUCUGUUUUCAACCAACUA81.6175845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632776ATCTGTTTTCAACCAACTATAGTTGGTTGAAAACAGAT0.319800.024300.508600.500000.994600.75000


Target Position: 1766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766CUAUGAUCACAGUGACUUU92.3929125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561784CTATGATCACAGTGACTTTAAAGTCACTGTGATCATAG0.221400.106800.672400.750000.989100.87500


Target Position: 2128, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128CUCAGAUCUUGACAGUAUA95.162662

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10212819CTCAGATCTTGACAGTATA1/1/0/097.21MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36076788..36076806(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822146CTCAGATCTTGACAGTATATATACTGTCAAGATCTGAG0.056900.017300.767200.750001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890UCAAAGUAAAAAAUUAAAG60.25113278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102908TCAAAGTAAAAAATTAAAGCTTTAATTTTTTACTTTGA0.241100.122000.586200.500001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630CCAAAUAUUAUUCAAGUGC60.82993229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931648CCAAATATTATTCAAGTGCGCACTTGAATAATATTTGG0.253400.206200.491400.500001.000001.00000


Target Position: 3975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3975UCUGACAGAUCUUAAUACU75.2051547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473993TCTGACAGATCTTAATACTAGTATTAAGATCTGTCAGA0.766200.139900.517200.500001.000001.00000


Target Position: 1291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291UGCGAAUGUAUUUAUUGGU66.8672529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471309TGCGAATGTATTTATTGGTACCAATAAATACATTCGCA0.110300.020700.500000.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182GAGAAGAAAGUGUAGAUAG84.1882618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912200GAGAAGAAAGTGTAGATAGCTATCTACACTTTCTTCTC0.270000.151700.637900.500001.000001.00000


Target Position: 3605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3605UUUUGUAAUAAAGGUCUUU63.49752942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613623TTTTGTAATAAAGGTCTTTAAAGACCTTTATTACAAAA0.037500.017200.500000.500001.000001.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556GAGUCCUGAGCACCUGGUU77.70991257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211574GAGTCCTGAGCACCTGGTTAACCAGGTGCTCAGGACTC0.050000.006300.663800.750000.972800.62500


Target Position: 4109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4109AGCAUUGGGGCCUGUCUUA79.0881119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874127AGCATTGGGGCCTGTCTTATAAGACAGGCCCCAATGCT0.044300.003700.819000.750000.962000.62500


Target Position: 2115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2115GCUUAGUAUGGUUCUCAGA89.1623284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822133GCTTAGTATGGTTCTCAGATCTGAGAACCATACTAAGC0.126900.003800.629300.750001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GCGAAAAGAACCUACAGAG77.67151262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753692GCGAAAAGAACCTACAGAGCTCTGTAGGTTCTTTTCGC0.064200.031400.612100.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848ACAGAUGACCAUGUUCAGU71.10852022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940866ACAGATGACCATGTTCAGTACTGAACATGGTCATCTGT0.231900.014100.500000.500001.000001.00000


Target Position: 772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GGAAUUCAAUGAUGUGUAU92.3801127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
770-792GAGGAATTCAATGATGTGTATCTAUACACAUCAUUGAAUUCCUCGGAAUUCAAUGAUGUGUAUCUU20.416.322


Target Position: 3326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3326AGGUGUUUCCAUUUCUCAA91.1794173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4983344AGGTGTTTCCATTTCTCAATTGAGAAATGGAAACACCT0.205700.051000.698300.750001.000001.00000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008UCUUCUUGGCAGCUUAACA78.15551211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723026TCTTCTTGGCAGCTTAACATGTTAAGCTGCCAAGAAGA0.367400.023000.517200.500001.000001.00000


Target Position: 2896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896UAAAAAAUUAAAGCCCAUA75.04451572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962914TAAAAAATTAAAGCCCATATATGGGCTTTAATTTTTTA0.087600.078500.491400.500001.000001.00000


Target Position: 3997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3997CCUAACAUUUAGAAAAUGU79.51551058

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3995-4017CTCCTAACATTTAGAAAATGTTGACAUUUUCUAAAUGUUAGGAGCCUAACAUUUAGAAAAUGUUGU7.411.621


Target Position: 3392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392AGUCAACUGGAGCAAGAAG72.46131870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503410AGTCAACTGGAGCAAGAAGCTTCTTGCTCCAGTTGACT0.151100.004400.569000.500001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971CUGAAGAUUCUGGAUUUUG67.15572502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943989CTGAAGATTCTGGATTTTGCAAAATCCAGAATCTTCAG0.035300.009900.637900.500001.000001.00000


Target Position: 2156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156GUAAAUAUGUUUGUGCCUU76.9791339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8432174GTAAATATGTTTGTGCCTTAAGGCACAAACATATTTAC0.047100.040800.543100.750001.000001.00000


Target Position: 3857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3857AAGCCUAUUUUUCAAAUUU77.5731276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183875AAGCCTATTTTTCAAATTTAAATTTGAAAAATAGGCTT0.189700.040100.637900.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CUGUUGACUGGAAGAACAU81.9818812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7111145CTGTTGACTGGAAGAACATATGTTCTTCCAGTCAACAG0.075500.014000.629300.750001.000001.00000


Target Position: 4273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4273GUAGUAGAUUUUGUAGCAU84.7086576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8134291GTAGTAGATTTTGTAGCATATGCTACAAAATCTACTAC0.076200.064400.525900.750001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633GUGAUAUCACCUCUCUUCA88.7972308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732651GTGATATCACCTCTCTTCATGAAGAGAGGTGATATCAC0.179300.013200.569000.500000.989100.62500


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763UUUUCAACCAACUAUUUUU71.22762009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052781TTTTCAACCAACTATTTTTAAAAATAGTTGGTTGAAAA0.175200.092200.500000.500001.000001.00000


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772AACUAUUUUUGAGGAAUUA83.7973653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9992790AACTATTTTTGAGGAATTATAATTCCTCAAAAATAGTT0.156600.081300.612100.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891AAGUAAAAAAAUAUGAAUU80.6233939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6341909AAGTAAAAAAATATGAATTAATTCATATTTTTTTACTT0.151400.140300.629300.500001.000001.00000


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126UUCUCAGAUCUUGACAGUA78.94491133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832144TTCTCAGATCTTGACAGTATACTGTCAAGATCTGAGAA0.223800.027700.491400.500000.972800.62500


Target Position: 2957, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957CUUUAAAAUAAAAAAGUAA90.7838192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122975CTTTAAAATAAAAAAGTAATTACTTTTTTATTTTAAAG0.158100.053700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2955-2977TACTTTAAAATAAAAAAGTAACAUUACUUUUUUAUUUUAAAGUACUUUAAAAUAAAAAAGUAACAU4.9-9.122


Target Position: 4315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4315AAAUUCCAGUAUCCAUAAA85.6052527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9334333AAATTCCAGTATCCATAAATTTATGGATACTGGAATTT0.451300.036100.500000.500001.000001.00000


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234UGAGGACUCAUAUAUUUAA91.8137147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663252TGAGGACTCATATATTTAATTAAATATATGAGTCCTCA0.174700.007200.689700.750001.000001.00000


Target Position: 3018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3018AGCUUAACAUUGACUUCUU84.2739612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5373036AGCTTAACATTGACTTCTTAAGAAGTCAATGTTAAGCT0.176000.062600.715500.750001.000001.00000


Target Position: 3016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3016GCAGCUUAACAUUGACUUC75.3981527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3483034GCAGCTTAACATTGACTTCGAAGTCAATGTTAAGCTGC0.225200.076700.681000.750001.000001.00000


Target Position: 3103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103UCCUUUUGAUGGGGAGAAA73.01971800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8843121TCCTTTTGATGGGGAGAAATTTCTCCCCATCAAAAGGA0.094700.003800.870700.750000.983700.75000


Target Position: 3115, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115GGAGAAAGGGCAAAUUAUU87.1499402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7683133GGAGAAAGGGCAAATTATTAATAATTTGCCCTTTCTCC0.060700.009400.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3113-3135GGGGAGAAAGGGCAAATTATTTTAAUAAUUUGCCCUUUCUCCCCGGAGAAAGGGCAAAUUAUUUUU-10.319.122


Target Position: 2760, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2760CUGUUUUCAACCAACUAUU77.6551265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472778CTGTTTTCAACCAACTATTAATAGTTGGTTGAAAACAG0.655300.031700.775900.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2758-2780ATCTGTTTTCAACCAACTATTTTAAUAGUUGGUUGAAAACAGAUCUGUUUUCAACCAACUAUUUUU11.614.922


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323CUGUCGACUUGCUGGAGAA94.015186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7991341CTGTCGACTTGCTGGAGAATTCTCCAGCAAGTCGACAG0.065600.005700.612100.750001.000001.00000


Target Position: 4151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4151CCGAAAUGACAGGGCUCAG66.79632535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8044169CCGAAATGACAGGGCTCAGCTGAGCCCTGTCATTTCGG0.053800.049100.629300.750000.972800.62500


Target Position: 3910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3910GUUUUUAUUUAAUGCACAA92.2032137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833928GTTTTTATTTAATGCACAATTGTGCATTAAATAAAAAC0.029800.029500.500000.750001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283AUGAACUUUGCGAAUGUAU70.19672140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351301ATGAACTTTGCGAATGTATATACATTCGCAAAGTTCAT0.098000.014800.612100.500001.000001.00000


Target Position: 4075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4075UGGGUAAAGCAAAGAGCAA81.2816872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7694093TGGGTAAAGCAAAGAGCAATTGCTCTTTGCTTTACCCA0.060300.018300.698300.750000.945700.75000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625ACGUGUGGCAGUGAAGAAG63.70522916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879643ACGTGTGGCAGTGAAGAAGCTTCTTCACTGCCACACGT0.042200.004800.637900.500001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414GGAGAGGGUGCGGGUGCAG64.32092830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922432GGAGAGGGTGCGGGTGCAGCTGCACCCGCACCCTCTCC0.071400.003200.586200.750000.913000.62500


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732UUGGUCUGUUGGACGUUUU63.55522938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908750TTGGTCTGTTGGACGTTTTAAAACGTCCAACAGACCAA0.083700.003400.646600.500000.945700.87500


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873CUAAGAAAUGCUGAAAAUC68.53982340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882891CTAAGAAATGCTGAAAATCGATTTTCAGCATTTCTTAG0.326900.057700.491400.500001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961AGACUGUGAGCUGAAGAUU77.74971251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833979AGACTGTGAGCTGAAGATTAATCTTCAGCTCACAGTCT0.048500.044800.715500.750001.000001.00000


Target Position: 3941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3941UCAAUAUCCUUUAAACUGU71.12562020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8413959TCAATATCCTTTAAACTGTACAGTTTAAAGGATATTGA0.181300.106300.517200.500001.000001.00000


Target Position: 3883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3883UUCUCAAGUUUAUUAUAUU80.4218961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993901TTCTCAAGTTTATTATATTAATATAATAAACTTGAGAA0.465400.110900.663800.500001.000001.00000


Target Position: 995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995GCUCGGCACACAGAUGAUG68.10542385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751013GCTCGGCACACAGATGATGCATCATCTGTGTGCCGAGC0.436000.010600.698300.750001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940UAGUAAUCUAGCUGUGAAU80.6073941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791958TAGTAATCTAGCTGTGAATATTCACAGCTAGATTACTA0.128800.013800.663800.500001.000001.00000


Target Position: 2130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130CAGAUCUUGACAGUAUAUU76.8331362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2128-2150CTCAGATCTTGACAGTATATTTGAAUAUACUGUCAAGAUCUGAGCAGAUCUUGACAGUAUAUUUGU6.119.133


Target Position: 4023, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023GCUUCUUAGUUGUACAUUU90.9938182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7404041GCTTCTTAGTTGTACATTTAAATGTACAACTAAGAAGC0.072000.007900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4021-4043AAGCTTCTTAGTTGTACATTTTTAAAUGUACAACUAAGAAGCUUGCUUCUUAGUUGUACAUUUUUU14.611.722


Target Position: 4071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4071UGGAUGGGUAAAGCAAAGA66.39162571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464089TGGATGGGTAAAGCAAAGATCTTTGCTTTACCCATCCA0.046700.013600.620700.500001.000001.00000


Target Position: 4320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4320CCAGUAUCCAUAAAUAAAG75.431525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5184338CCAGTATCCATAAATAAAGCTTTATTTATGGATACTGG0.343600.070300.706900.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736UCUGUUGGACGUUUUUACA76.05231464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839754TCTGTTGGACGTTTTTACATGTAAAAACGTCCAACAGA0.220400.010000.517200.500001.000001.00000


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881UGCUGAAAAUCAAAGUAAA90.5287203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382899TGCTGAAAATCAAAGTAAATTTACTTTGATTTTCAGCA0.364700.234300.853400.750001.000001.00000


Target Position: 3884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3884UCUCAAGUUUAUUAUAUUU80.7662921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3613902TCTCAAGTTTATTATATTTAAATATAATAAACTTGAGA0.545100.113500.724100.750001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074UGCAUUACAACCAGACAGU67.24222489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701092TGCATTACAACCAGACAGTACTGTCTGGTTGTAATGCA0.045500.006600.646600.500001.000001.00000


Target Position: 4255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4255GGAAAGAAAAAAAAAGAAG74.25261653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2194273GGAAAGAAAAAAAAAGAAGCTTCTTTTTTTTTCTTTCC0.777300.333200.732800.750001.000001.00000


Target Position: 1628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628CUCCAAAUAUUAUUCAAGU80.4602958

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1626-1648CTCTCCAAATATTATTCAAGTGCACUUGAAUAAUAUUUGGAGAGCUCCAAAUAUUAUUCAAGUGCU12.020.122


Target Position: 4278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4278AGAUUUUGUAGCAUGUGAU85.2142550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8474296AGATTTTGTAGCATGTGATATCACATGCTACAAAATCT0.046500.023100.543100.750001.000001.00000


Target Position: 3593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593CUGCUCUGAAUAUUUUGUA83.3751691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6033611CTGCTCTGAATATTTTGTATACAAAATATTCAGAGCAG0.298600.084100.603400.750001.000001.00000


Target Position: 1751, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751GACAAUAUGAACAAACUAU91.5475159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751769GACAATATGAACAAACTATATAGTTTGTTCATATTGTC0.352100.041700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1749-1771AAGACAATATGAACAAACTATGAAUAGUUUGUUCAUAUUGUCUUGACAAUAUGAACAAACUAUGAU11.86.732


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626CUCUCCAAAUAUUAUUCAA92.1292141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741644CTCTCCAAATATTATTCAATTGAATAATATTTGGAGAG0.354200.172800.663800.750001.000001.00000


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967UGAGCUGAAGAUUCUGGAU77.40671288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914985TGAGCTGAAGATTCTGGATATCCAGAATCTTCAGCTCA0.038600.014800.543100.750001.000001.00000


Target Position: 2930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2930UUUGCUGUCUUUCUCUAAA77.81311244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222948TTTGCTGTCTTTCTCTAAATTTAGAGAAAGACAGCAAA0.594400.134800.500000.500001.000001.00000


Target Position: 857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857CAUGUUCAGUUCCUUAUCU83.5484675

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
855-877ACCATGTTCAGTTCCTTATCTACAGAUAAGGAACUGAACAUGGUCAUGUUCAGUUCCUUAUCUACU19.920.522


Target Position: 3120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120AAGGGCAAAUUAUUUUAAU77.60281272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383138AAGGGCAAATTATTTTAATATTAAAATAATTTGCCCTT0.126200.010300.629300.500001.000001.00000


Target Position: 4223, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4223CUAAGAAUGGCUUUUACAU84.4038598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4221-4243TGCTAAGAATGGCTTTTACATTTAUGUAAAAGCCAUUCUUAGCACUAAGAAUGGCUUUUACAUUUU7.26.911


Target Position: 4318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4318UUCCAGUAUCCAUAAAUAA82.0187807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5894336TTCCAGTATCCATAAATAATTATTTATGGATACTGGAA0.372400.022600.637900.500001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CACACAGAUGAUGAAAUGA88.1858337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751019CACACAGATGATGAAATGATCATTTCATCATCTGTGTG0.592900.145700.569000.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390UGCACAUGCCUACUUUGCU70.18122141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081408TGCACATGCCTACTTTGCTAGCAAAGTAGGCATGTGCA0.177700.054100.500000.500000.962000.75000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663CCAUCAUUCAUGCGAAAAG72.78661846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505681CCATCATTCATGCGAAAAGCTTTTCGCATGAATGATGG0.159300.065300.706900.750000.978300.62500


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UGCAAAGUAAAAAAAUAUG62.67373020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471905TGCAAAGTAAAAAAATATGCATATTTTTTTACTTTGCA0.315300.223200.698300.500001.000001.00000


Target Position: 3897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897AUAUUUUUCUCUUGUUUUU73.9261702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753915ATATTTTTCTCTTGTTTTTAAAAACAAGAGAAAAATAT0.436500.246500.543100.500001.000001.00000


Target Position: 3240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3240CUCAUAUAUUUAAGCCUUU80.5761943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853258CTCATATATTTAAGCCTTTAAAGGCTTAAATATATGAG0.029600.015600.810300.750001.000001.00000


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859CCCAAUAACUAAUGCUAAG75.08421563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592877CCCAATAACTAATGCTAAGCTTAGCATTAGTTATTGGG0.288400.120100.853400.750000.967400.75000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205CCCCCCGCUUAUCUCAUUA79.42971070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6291223CCCCCCGCTTATCTCATTATAATGAGATAAGCGGGGGG0.100500.030600.956901.000001.000001.00000


Target Position: 3323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3323CCAAGGUGUUUCCAUUUCU79.3071082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6693341CCAAGGTGTTTCCATTTCTAGAAATGGAAACACCTTGG0.163900.010800.620700.750001.000001.00000


Target Position: 3112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3112UGGGGAGAAAGGGCAAAUU64.08362866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973130TGGGGAGAAAGGGCAAATTAATTTGCCCTTTCTCCCCA0.027500.012500.836200.750001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616UUCACGGGAACUCUCCAAA68.73572319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391634TTCACGGGAACTCTCCAAATTTGGAGAGTTCCCGTGAA0.352600.002800.672400.500000.923900.87500


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617UCACGGGAACUCUCCAAAU73.42191758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211635TCACGGGAACTCTCCAAATATTTGGAGAGTTCCCGTGA0.365800.003200.715500.750000.923901.00000


Target Position: 3387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3387CCCUGAGUCAACUGGAGCA85.644522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5683405CCCTGAGTCAACTGGAGCATGCTCCAGTTGACTCAGGG0.136600.016600.637900.750000.994600.75000


Target Position: 2456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456UUCCUGUGUACUCUUUAUU64.49662807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562474TTCCTGTGTACTCTTTATTAATAAAGAGTACACAGGAA0.234300.007400.663800.500001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348UGUAUUGGACUCAGAUAAG70.37442123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611366TGTATTGGACTCAGATAAGCTTATCTGAGTCCAATACA0.042400.003500.569000.500001.000001.00000


Target Position: 3778, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3778CUAUUUUAUUUGUAUUCAU89.3182272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8593796CTATTTTATTTGTATTCATATGAATACAAATAAAATAG0.192700.091200.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3776-3798TGCTATTTTATTTGTATTCATGAAUGAAUACAAAUAAAAUAGCACUAUUUUAUUUGUAUUCAUGAU16.1-7.512


Target Position: 4012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4012AUGUUGAUAAAGCUUCUUA83.8507652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8174030ATGTTGATAAAGCTTCTTATAAGAAGCTTTATCAACAT0.086600.005100.620700.500001.000001.00000


Target Position: 4002, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4002CAUUUAGAAAAUGUUGAUA89.2368277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4000-4022AACATTTAGAAAATGTTGATAAAUAUCAACAUUUUCUAAAUGUUCAUUUAGAAAAUGUUGAUAAAU20.56.912


Target Position: 3010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3010UUCUUGGCAGCUUAACAUU65.02752738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563028TTCTTGGCAGCTTAACATTAATGTTAAGCTGCCAAGAA0.392700.035600.663800.500001.000001.00000


Target Position: 3508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508AGUUCAAAUCCUCACCAUC73.07151793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243526AGTTCAAATCCTCACCATCGATGGTGAGGATTTGAACT0.436700.354000.525900.500001.000001.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148UUGAAACUGUAAAUAUGUU73.99931692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642166TTGAAACTGTAAATATGTTAACATATTTACAGTTTCAA0.145400.010900.500000.500001.000001.00000


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250UAAGCCUUUUGUGUAAUAA79.75411031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093268TAAGCCTTTTGTGTAATAATTATTACACAAAAGGCTTA0.158600.013200.500000.500001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240UGAGGCAAGAAACUAUAUU72.87691828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071258TGAGGCAAGAAACTATATTAATATAGTTTCTTGCCTCA0.179600.003400.715500.750001.000001.00000


Target Position: 2850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CUCUUCACUCCCAAUAACU75.19431549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632868CTCTTCACTCCCAATAACTAGTTATTGGGAGTGAAGAG0.395300.185800.603400.500001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879AUGUUCAAUGCAAAGUAAA79.23011094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781897ATGTTCAATGCAAAGTAAATTTACTTTGCATTGAACAT0.623900.062200.655200.500001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743GAGGGUAAGACAAUAUGAA98.386116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651761GAGGGTAAGACAATATGAATTCATATTGTCTTACCCTC0.159100.002500.637900.750001.000001.00000


Target Position: 3598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598CUGAAUAUUUUGUAAUAAA96.763732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2703616CTGAATATTTTGTAATAAATTTATTACAAAATATTCAG0.349600.240500.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3596-3618CTCTGAATATTTTGTAATAAAGGUUUAUUACAAAAUAUUCAGAGCUGAAUAUUUUGUAAUAAAGGU1.48.722


Target Position: 3726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3726CCAUCUCCUGAUUUCUCUG74.63731619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893744CCATCTCCTGATTTCTCTGCAGAGAAATCAGGAGATGG0.056200.016200.560300.750001.000001.00000


Target Position: 3184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3184GAGAAGUGUCGUUUUCAUA97.917321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473202GAGAAGTGTCGTTTTCATATATGAAAACGACACTTCTC0.049600.002700.767200.750001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCUUACAGAUGACCAUGUU85.7065513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814862GCTTACAGATGACCATGTTAACATGGTCATCTGTAAGC0.052000.013100.706901.000001.000001.00000


Target Position: 3833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3833CAGACAAUACCACUGGUUA94.998366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953851CAGACAATACCACTGGTTATAACCAGTGGTATTGTCTG0.028600.011500.750000.750000.967400.75000


Target Position: 3059, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3059GUUUCAGAAUUUUGUAUAU89.4788264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8633077GTTTCAGAATTTTGTATATATATACAAAATTCTGAAAC0.151100.004100.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3057-3079TTGTTTCAGAATTTTGTATATTGAUAUACAAAAUUCUGAAACAAGUUUCAGAAUUUUGUAUAUUGU8.520.422


Target Position: 1478, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478CUUAUAGAUGAGUGGAAAA91.8386146

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4147819CTTATAGATGAGTGGAAAA1/1/0/097.75MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANANA00MAPK14(0.002)


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095CACUAGCCUGUGAUUAACU82.9358727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122113CACTAGCCTGTGATTAACTAGTTAATCACAGGCTAGTG0.052100.019600.586200.500000.972800.62500


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813AGUUAUGCCGUAUAGGAUG69.14332272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8593831AGTTATGCCGTATAGGATGCATCCTATACGGCATAACT0.053000.004200.551700.500001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970GCUGAAGAUUCUGGAUUUU80.6932933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699988GCTGAAGATTCTGGATTTTAAAATCCAGAATCTTCAGC0.439300.009800.853401.000001.000001.00000


Target Position: 2188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188AAAGUGUAGAUAGUUAAAA82.8295735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312206AAAGTGTAGATAGTTAAAATTTTAACTATCTACACTTT0.401700.235100.500000.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885UCCGAGGUCUAAAGUAUAU74.80511596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354903TCCGAGGTCTAAAGTATATATATACTTTAGACCTCGGA0.523200.043200.827600.750001.000001.00000


Target Position: 1747, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747GUAAGACAAUAUGAACAAA96.899630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721765GTAAGACAATATGAACAAATTTGTTCATATTGTCTTAC0.217900.010700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1745-1767GGGTAAGACAATATGAACAAACTUUUGUUCAUAUUGUCUUACCCGUAAGACAAUAUGAACAAACUU20.520.322


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162CCAUAUUAACCAGCUUCAG69.74122198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021180CCATATTAACCAGCTTCAGCTGAAGCTGGTTAATATGG0.144700.056200.560300.750001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917AUAAUUCACAGGGACCUAA78.45711176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907935ATAATTCACAGGGACCTAATTAGGTCCCTGTGAATTAT0.350200.015600.508600.500001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841GAAGCUUACAGAUGACCAU89.3823268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
962859GAAGCTTACAGATGACCATATGGTCATCTGTAAGCTTC0.031400.012400.517200.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513AGGAGCUGAACAAGACAAU76.03851466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818531AGGAGCTGAACAAGACAATATTGTCTTGTTCAGCTCCT0.103000.005000.836200.750001.000001.00000


Target Position: 3840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3840UACCACUGGUUAAAAUAAA80.5707944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343858TACCACTGGTTAAAATAAATTTATTTTAACCAGTGGTA0.280100.011200.681000.500000.967400.62500


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928GGACCUAAAACCUAGUAAU92.3531129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979946GGACCTAAAACCTAGTAATATTACTAGGTTTTAGGTCC0.030300.025900.862101.000001.000001.00000


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385GCCCUUGCACAUGCCUACU68.56082335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811403GCCCTTGCACATGCCTACTAGTAGGCATGTGCAAGGGC0.242000.037200.793100.750000.962001.00000


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252AGCCUUUUGUGUAAUAAGA82.367771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6743270AGCCTTTTGTGTAATAAGATCTTATTACACAAAAGGCT0.330000.016000.629300.500001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101GGUCAGUGGGAUGCAUAAU83.249706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861119GGTCAGTGGGATGCATAATATTATGCATCCCACTGACC0.029400.002700.844801.000001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891GUCUAAAGUAUAUACAUUC78.50881174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655909GTCTAAAGTATATACATTCGAATGTATATACTTTAGAC0.617100.361200.646600.500001.000001.00000


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460UGUGUACUCUUUAUUUCUA88.8888303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962478TGTGTACTCTTTATTTCTATAGAAATAAAGAGTACACA0.283700.047500.534500.750001.000001.00000


Target Position: 3327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3327GGUGUUUCCAUUUCUCAAU82.4294765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3673345GGTGTTTCCATTTCTCAATATTGAGAAATGGAAACACC0.216500.072600.844801.000001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GGGACCUCCUUAUAGAUGA87.6747363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531488GGGACCTCCTTATAGATGATCATCTATAAGGAGGTCCC0.402700.004300.767200.750000.989100.62500


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878UAUGUUCAAUGCAAAGUAA88.5231317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031896TATGTTCAATGCAAAGTAATTACTTTGCATTGAACATA0.566700.069300.508600.500001.000001.00000


Target Position: 4013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013UGUUGAUAAAGCUUCUUAG73.79871717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154031TGTTGATAAAGCTTCTTAGCTAAGAAGCTTTATCAACA0.078100.011300.534500.500001.000001.00000


Target Position: 3218, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218GGCAUUUUGUUCUACAUGA90.7715194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3216-3238CAGGCATTTTGTTCTACATGAGGUCAUGUAGAACAAAAUGCCUGGGCAUUUUGUUCUACAUGAGGU17.914.031


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333UGCGUCUCUCUUUCUCCCU60.76313239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712351TGCGTCTCTCTTTCTCCCTAGGGAGAAAGAGAGACGCA0.713100.318600.508600.500001.000001.00000


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185AGAAGUGUCGUUUUCAUAA90.7612195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833203AGAAGTGTCGTTTTCATAATTATGAAAACGACACTTCT0.042000.004000.689700.750001.000001.00000


Target Position: 3812, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812CAGUUAUGCCGUAUAGGAU91.1453174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453830CAGTTATGCCGTATAGGATATCCTATACGGCATAACTG0.047500.002700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3810-3832ATCAGTTATGCCGTATAGGATGTAUCCUAUACGGCAUAACUGAUCAGUUAUGCCGUAUAGGAUGUU21.011.633


Target Position: 3770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3770GGAAAUUGCUAUUUUAUUU90.3935210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3113788GGAAATTGCTATTTTATTTAAATAAAATAGCAATTTCC0.248000.117800.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3768-3790AGGGAAATTGCTATTTTATTTGTAAAUAAAAUAGCAAUUUCCCUGGAAAUUGCUAUUUUAUUUGUU-9.77.421


Target Position: 3121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121AGGGCAAAUUAUUUUAAUA94.423673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183139AGGGCAAATTATTTTAATATATTAAAATAATTTGCCCT0.104200.017400.801700.750001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514GGAGCUGAACAAGACAAUC75.43091524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917532GGAGCTGAACAAGACAATCGATTGTCTTGTTCAGCTCC0.079600.003300.689700.750001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862UCAGUUCCUUAUCUACCAA83.3291696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655880TCAGTTCCTTATCTACCAATTGGTAGATAAGGAACTGA0.473500.151800.577600.750001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003CACAGAUGAUGAAAUGACA98.600814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651021CACAGATGATGAAATGACATGTCATTTCATCATCTGTG0.311800.246000.586200.500001.000001.00000


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859UGUUCAGUUCCUUAUCUAC73.17021782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845877TGTTCAGTTCCTTATCTACGTAGATAAGGAACTGAACA0.397900.121900.525900.500001.000001.00000


Target Position: 2050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2050CCCUCAGUGAUACGUACAG69.93472176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272068CCCTCAGTGATACGTACAGCTGTACGTATCACTGAGGG0.134300.027900.706900.750001.000001.00000


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142UUGUAUUUUCAACUUUAUA78.84971142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853160TTGTATTTTCAACTTTATATATAAAGTTGAAAATACAA0.417700.021200.603400.500001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770CCAACUAUUUUUGAGGAAU78.98151130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5662788CCAACTATTTTTGAGGAATATTCCTCAAAAATAGTTGG0.122700.077500.836201.000001.000001.00000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703ACUUAAACAUAUGAAACAU83.2468707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741721ACTTAAACATATGAAACATATGTTTCATATGTTTAAGT0.273400.102900.551700.750001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767CUGGAGGAAUUCAAUGAUG72.27921887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588785CTGGAGGAATTCAATGATGCATCATTGAATTCCTCCAG0.113600.015100.629300.500001.000001.00000


Target Position: 3989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3989AUACUACUCCUAACAUUUA88.8938302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9874007ATACTACTCCTAACATTTATAAATGTTAGGAGTAGTAT0.099000.095200.508600.500001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888GCAAAGUAAAAAAAUAUGA84.3809602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221906GCAAAGTAAAAAAATATGATCATATTTTTTTACTTTGC0.309000.248100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1886-1908ATGCAAAGTAAAAAAATATGAATUCAUAUUUUUUUACUUUGCAUGCAAAGUAAAAAAAUAUGAAUU-1.811.822


Target Position: 3766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3766UGAGGGAAAUUGCUAUUUU78.63491167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6773784TGAGGGAAATTGCTATTTTAAAATAGCAATTTCCCTCA0.246100.010600.724100.750001.000001.00000


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998CGGCACACAGAUGAUGAAA86.7097435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801016CGGCACACAGATGATGAAATTTCATCATCTGTGTGCCG0.579000.057200.913801.000001.000001.00000


Target Position: 3768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3768AGGGAAAUUGCUAUUUUAU81.969814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5193786AGGGAAATTGCTATTTTATATAAAATAGCAATTTCCCT0.256600.053600.801700.750001.000001.00000


Target Position: 3493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493CAUCUCCUUUAUUGCAGUU80.7144929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913511CATCTCCTTTATTGCAGTTAACTGCAATAAAGGAGATG0.278900.048900.508600.750000.962000.62500


Target Position: 820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GAACAACAUUGUGAAAUGU84.4021600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
818-840CTGAACAACATTGTGAAATGTCAACAUUUCACAAUGUUGUUCAGGAACAACAUUGUGAAAUGUCAU13.819.323


Target Position: 3909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3909UGUUUUUAUUUAAUGCACA80.8668909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563927TGTTTTTATTTAATGCACATGTGCATTAAATAAAAACA0.035600.035400.500000.500001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181AGAGAAGAAAGUGUAGAUA88.7583310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072199AGAGAAGAAAGTGTAGATATATCTACACTTTCTTCTCT0.275900.135300.681000.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733GAUGUAUAGCAUUUUUAUU91.2864169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222751GATGTATAGCATTTTTATTAATAAAAATGCTATACATC0.082600.008700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2731-2753TGGATGTATAGCATTTTTATTCAAAUAAAAAUGCUAUACAUCCAGAUGUAUAGCAUUUUUAUUCAU-9.78.222


Target Position: 2952, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952GAUUACUUUAAAAUAAAAA91.9293144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562970GATTACTTTAAAATAAAAATTTTTATTTTAAAGTAATC0.125900.031600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2950-2972ATGATTACTTTAAAATAAAAAAGUUUUUAUUUUAAAGUAAUCAUGAUUACUUUAAAAUAAAAAAGU-9.74.611


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179GGAGAGAAGAAAGUGUAGA86.767430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892197GGAGAGAAGAAAGTGTAGATCTACACTTTCTTCTCTCC0.330300.128500.646600.750001.000001.00000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387CCUUGCACAUGCCUACUUU83.1562714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131405CCTTGCACATGCCTACTTTAAAGTAGGCATGTGCAAGG0.139300.045400.844801.000000.962001.00000


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125CGCGACCACUGGAGCCUUA85.5754530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860143CGCGACCACTGGAGCCTTATAAGGCTCCAGTGGTCGCG0.045500.004200.887901.000000.902200.75000


Target Position: 3044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044GGAGAAAUAAAUUUUGUUU87.1005404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3042-3064GGGGAGAAATAAATTTTGTTTCAAAACAAAAUUUAUUUCUCCCCGGAGAAAUAAAUUUUGUUUCAU5.614.822


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206CCCCCGCUUAUCUCAUUAA84.2424614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351224CCCCCGCTTATCTCATTAATTAATGAGATAAGCGGGGG0.097800.036100.956901.000001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867UCCUUAUCUACCAAAUUCU70.08682154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793885TCCTTATCTACCAAATTCTAGAATTTGGTAGATAAGGA0.544500.219500.646600.500001.000001.00000


Target Position: 29, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
29GGUUCCAUAUUGGGUAAAA90.2797220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88447GGTTCCATATTGGGTAAAATTTTACCCAATATGGAACC0.041900.008900.853401.000000.945701.00000


Target Position: 1817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817CACCUUGCUCUUCUUUCUG67.66252443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801835CACCTTGCTCTTCTTTCTGCAGAAAGAAGAGCAAGGTG0.042200.022000.508600.500001.000001.00000


Target Position: 4137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4137GAGUGUAAGAGUGGCCGAA89.2341278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5654155GAGTGTAAGAGTGGCCGAATTCGGCCACTCTTACACTC0.123000.048100.637900.750001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887CGAGGUCUAAAGUAUAUAC83.4806681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578905CGAGGTCTAAAGTATATACGTATATACTTTAGACCTCG0.521300.044200.612100.750001.000001.00000


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058UGUUUCAGAAUUUUGUAUA79.78181027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043076TGTTTCAGAATTTTGTATATATACAAAATTCTGAAACA0.111800.003400.663800.750001.000001.00000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GGCAAGAAACUAUAUUCAG80.0439996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181261GGCAAGAAACTATATTCAGCTGAATATAGTTTCTTGCC0.074700.028700.715500.750000.983700.75000


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594UGCUCUGAAUAUUUUGUAA89.3691270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2373612TGCTCTGAATATTTTGTAATTACAAAATATTCAGAGCA0.301100.128600.819000.750001.000001.00000


Target Position: 3104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3104CCUUUUGAUGGGGAGAAAG64.38622823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6733122CCTTTTGATGGGGAGAAAGCTTTCTCCCCATCAAAAGG0.084800.022100.706900.750001.000001.00000


Target Position: 3775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3775UUGCUAUUUUAUUUGUAUU72.95961813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983793TTGCTATTTTATTTGTATTAATACAAATAAAATAGCAA0.199000.085500.637900.500001.000001.00000


Target Position: 4241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4241UUUUUAAAUGGUUGGGAAA71.90881936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394259TTTTTAAATGGTTGGGAAATTTCCCAACCATTTAAAAA0.050300.004500.500000.500001.000001.00000


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912CCCCAAUCCCGGUCAUGCU71.54751982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8151930CCCCAATCCCGGTCATGCTAGCATGACCGGGATTGGGG0.051900.028300.637900.750000.929300.75000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GCAGGAGCUGAACAAGACA90.9691184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804529GCAGGAGCTGAACAAGACATGTCTTGTTCAGCTCCTGC0.102600.005500.646600.750000.994600.75000


Target Position: 3822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3822GUAUAGGAUGUCAGACAAU89.6146252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4613840GTATAGGATGTCAGACAATATTGTCTGACATCCTATAC0.366400.026800.672400.750001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461GUGUACUCUUUAUUUCUAG76.83091364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942479GTGTACTCTTTATTTCTAGCTAGAAATAAAGAGTACAC0.213500.009500.620700.500001.000001.00000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883UCUCCGAGGUCUAAAGUAU78.33491188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351901TCTCCGAGGTCTAAAGTATATACTTTAGACCTCGGAGA0.483900.043500.681000.750001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CGCUUAUCUCAUUAACAGG73.87341706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821228CGCTTATCTCATTAACAGGCCTGTTAATGAGATAAGCG0.084900.020100.577600.500001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180GAGAGAAGAAAGUGUAGAU95.959546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272198GAGAGAAGAAAGTGTAGATATCTACACTTTCTTCTCTC0.296900.130700.629300.750001.000001.00000


Target Position: 3528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528ACAGCAAGAUGAAUUUUAU88.566316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193546ACAGCAAGATGAATTTTATATAAAATTCATCTTGCTGT0.155700.003200.663800.750001.000001.00000


Target Position: 3740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3740CUCUGAACAGAAAACAAAA93.4151103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4213758CTCTGAACAGAAAACAAAATTTTGTTTTCTGTTCAGAG0.208800.032500.810300.750001.000001.00000


Target Position: 3562, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3562GUAAAUGCUCGUGUGAUUU76.42681407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5013580GTAAATGCTCGTGTGATTTAAATCACACGAGCATTTAC0.172700.046400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3560-3582TTGTAAATGCTCGTGTGATTTCCAAAUCACACGAGCAUUUACAAGUAAAUGCUCGUGUGAUUUCCU20.515.322


Target Position: 3860, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860CCUAUUUUUCAAAUUUAGU74.65611616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993878CCTATTTTTCAAATTTAGTACTAAATTTGAAAAATAGG0.054300.031200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3858-3880AGCCTATTTTTCAAATTTAGTGAACUAAAUUUGAAAAAUAGGCUCCUAUUUUUCAAAUUUAGUGAU-4.3-4.322


Target Position: 2438, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GUUCUUGAUGUCAUGUACU80.9952898

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2436-2458AGGTTCTTGATGTCATGTACTTCAGUACAUGACAUCAAGAACCUGUUCUUGAUGUCAUGUACUUCU20.420.432


Target Position: 4249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4249UGGUUGGGAAAGAAAAAAA79.99411006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3094267TGGTTGGGAAAGAAAAAAATTTTTTTCTTTCCCAACCA0.858800.051000.844800.750001.000001.00000


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510GGCAGGAGCUGAACAAGAC80.0296999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809528GGCAGGAGCTGAACAAGACGTCTTGTTCAGCTCCTGCC0.107100.005500.681000.750000.951100.75000


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082GGAAUCCUUUGAGAAUGUG71.22292011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6703100GGAATCCTTTGAGAATGTGCACATTCTCAAAGGATTCC0.121000.011000.577600.750000.989100.75000


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386CCCUUGCACAUGCCUACUU72.03231919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3791404CCCTTGCACATGCCTACTTAAGTAGGCATGTGCAAGGG0.219900.038200.853401.000000.962001.00000


Target Position: 3890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3890GUUUAUUAUAUUUUUCUCU79.5161057

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3888-3910AAGTTTATTATATTTTTCTCTTGAGAGAAAAAUAUAAUAAACUUGUUUAUUAUAUUUUUCUCUUGU14.8-7.521


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904ACAUUCAGCUGACAUAAUU80.495951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393922ACATTCAGCTGACATAATTAATTATGTCAGCTGAATGT0.197700.091700.698300.750001.000001.00000


Target Position: 2942, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942CUCUAAAUAUGAUUACUUU92.2783132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812960CTCTAAATATGATTACTTTAAAGTAATCATATTTAGAG0.116500.117000.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2940-2962TTCTCTAAATATGATTACTTTAAAAAGUAAUCAUAUUUAGAGAACUCUAAAUAUGAUUACUUUAAU4.66.922


Target Position: 3144, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GUAUUUUCAACUUUAUAAA91.268170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3113162GTATTTTCAACTTTATAAATTTATAAAGTTGAAAATAC0.428500.072000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164TTGTATTTTCAACTTTATAAAGAUUUAUAAAGUUGAAAAUACAAGUAUUUUCAACUUUAUAAAGAU-7.52.122


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285GUAGCAUGUGAUGUAAGUA95.181660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9214303GTAGCATGTGATGTAAGTATACTTACATCACATGCTAC0.154200.012700.500000.750001.000001.00000


Target Position: 3819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3819GCCGUAUAGGAUGUCAGAC68.8272309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5163837GCCGTATAGGATGTCAGACGTCTGACATCCTATACGGC0.278700.021700.681000.750001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618CACGGGAACUCUCCAAAUA91.3394164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771636CACGGGAACTCTCCAAATATATTTGGAGAGTTCCCGTG0.366800.003900.750000.750000.923901.00000


Target Position: 2324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2324GCGUAUAUGUGCGUCUCUC74.88711589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472342GCGTATATGTGCGTCTCTCGAGAGACGCACATATACGC0.144700.011800.612100.750001.000001.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151CAACUUUAUAAAGAUAAAA90.151232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293169CAACTTTATAAAGATAAAATTTTATCTTTATAAAGTTG0.270300.178800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3149-3171TTCAACTTTATAAAGATAAAATAUUUUAUCUUUAUAAAGUUGAACAACUUUAUAAAGAUAAAAUAU6.94.921


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GAACUCUCCAAAUAUUAUU83.7694655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3711641GAACTCTCCAAATATTATTAATAATATTTGGAGAGTTC0.899200.267500.663800.750001.000001.00000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916GGCCAGAAACUCCUUUUGC63.6252929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552934GGCCAGAAACTCCTTTTGCGCAAAAGGAGTTTCTGGCC0.145900.030500.646600.500001.000001.00000


Target Position: 4016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4016UGAUAAAGCUUCUUAGUUG77.61621268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9304034TGATAAAGCTTCTTAGTTGCAACTAAGAAGCTTTATCA0.037000.024900.577600.500001.000001.00000


Target Position: 2828, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2828CAAACUUCGGAAACAAGUU79.76031029

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2826-2848CCCAAACTTCGGAAACAAGTTATAACUUGUUUCCGAAGUUUGGGCAAACUUCGGAAACAAGUUAUU17.813.332


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953AUUACUUUAAAAUAAAAAA81.5479849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652971ATTACTTTAAAATAAAAAATTTTTTATTTTAAAGTAAT0.123800.021600.508600.500001.000001.00000


Target Position: 2774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2774CUAUUUUUGAGGAAUUAUC69.59482212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892792CTATTTTTGAGGAATTATCGATAATTCCTCAAAAATAG0.158800.059000.491400.500001.000001.00000


Target Position: 3926, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3926CAAUAUGGCAUUAUAUCAA97.236426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263944CAATATGGCATTATATCAATTGATATAATGCCATATTG0.177700.035500.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3924-3946CACAATATGGCATTATATCAATAUUGAUAUAAUGCCAUAUUGUGCAAUAUGGCAUUAUAUCAAUAU10.212.632


Target Position: 2172, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172CUUAAAAGGAGAGAAGAAA84.4418595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4912190CTTAAAAGGAGAGAAGAAATTTCTTCTCTCCTTTTAAG0.284300.056600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2170-2192GCCTTAAAAGGAGAGAAGAAAGTUUUCUUCUCUCCUUUUAAGGCCUUAAAAGGAGAGAAGAAAGUU19.1-3.812


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056GUGAUACGUACAGCCAAAA83.8771648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832074GTGATACGTACAGCCAAAATTTTGGCTGTACGTATCAC0.056900.036700.793100.750001.000001.00000


Target Position: 3842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3842CCACUGGUUAAAAUAAAGC61.42443161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853860CCACTGGTTAAAATAAAGCGCTTTATTTTAACCAGTGG0.107600.009800.491400.500001.000001.00000


Target Position: 4279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279GAUUUUGUAGCAUGUGAUG75.85591488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8204297GATTTTGTAGCATGTGATGCATCACATGCTACAAAATC0.274000.017800.525900.500001.000001.00000


Target Position: 1865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865GUCCUUUUAGGAAUAUGUU79.67381039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1863-1885CTGTCCTTTTAGGAATATGTTCAAACAUAUUCCUAAAAGGACAGGUCCUUUUAGGAAUAUGUUCAU6.718.722


Target Position: 3767, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3767GAGGGAAAUUGCUAUUUUA103.4351

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2376719GAGGGAAATTGCTATTTTA1/1/0/0100.00MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36078427..36078445(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5763785GAGGGAAATTGCTATTTTATAAAATAGCAATTTCCCTC0.181000.015900.775900.750001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000GCACACAGAUGAUGAAAUG79.96621011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581018GCACACAGATGATGAAATGCATTTCATCATCTGTGTGC0.591300.128300.698300.750001.000001.00000


Target Position: 3570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3570UCGUGUGAUUUCCUACAGA80.8241914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343588TCGTGTGATTTCCTACAGATCTGTAGGAAATCACACGA0.036700.004900.569000.500001.000001.00000


Target Position: 3254, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254CCUUUUGUGUAAUAAGAAA94.03885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4493272CCTTTTGTGTAATAAGAAATTTCTTATTACACAAAAGG0.435200.028200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3252-3274AGCCTTTTGTGTAATAAGAAAGTUUUCUUAUUACACAAAAGGCUCCUUUUGUGUAAUAAGAAAGUU6.910.332


Target Position: 2756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2756CCAUCUGUUUUCAACCAAC76.73161372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812774CCATCTGTTTTCAACCAACGTTGGTTGAAAACAGATGG0.219800.015600.698300.750000.983700.62500


Target Position: 3568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3568GCUCGUGUGAUUUCCUACA85.5935528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703586GCTCGTGTGATTTCCTACATGTAGGAAATCACACGAGC0.043200.008100.646600.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284UGAACUUUGCGAAUGUAUU74.76471603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161302TGAACTTTGCGAATGTATTAATACATTCGCAAAGTTCA0.104300.025800.715500.750001.000001.00000


Target Position: 3922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922UGCACAAUAUGGCAUUAUA90.879191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163940TGCACAATATGGCATTATATATAATGCCATATTGTGCA0.074800.011900.810300.750000.945700.62500


Target Position: 3320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3320GGGCCAAGGUGUUUCCAUU87.8226348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7763338GGGCCAAGGTGTTTCCATTAATGGAAACACCTTGGCCC0.167700.006600.982801.000001.000001.00000


Target Position: 3083, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3083GAAUCCUUUGAGAAUGUGA89.8485241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3081-3103AGGAATCCTTTGAGAATGTGATTUCACAUUCUCAAAGGAUUCCUGAAUCCUUUGAGAAUGUGAUUU20.518.722


Target Position: 3321, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3321GGCCAAGGUGUUUCCAUUU80.038997

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6332119GGCCAAGGTGTTTCCATTT1/1/0/097.75MAPK14NM_001315.2+NM_139014.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36077981..36077999(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943339GGCCAAGGTGTTTCCATTTAAATGGAAACACCTTGGCC0.159500.006001.000001.000001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762GUUUUCAACCAACUAUUUU77.20121313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4192780GTTTTCAACCAACTATTTTAAAATAGTTGGTTGAAAAC0.360200.118000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2760-2782CTGTTTTCAACCAACTATTTTTGAAAAUAGUUGGUUGAAAACAGGUUUUCAACCAACUAUUUUUGU4.67.712


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434GCAGGUUCUUGAUGUCAUG79.64251041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192452GCAGGTTCTTGATGTCATGCATGACATCAAGAACCTGC0.145200.013100.698300.750001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100UGGUCAGUGGGAUGCAUAA86.3557462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371118TGGTCAGTGGGATGCATAATTATGCATCCCACTGACCA0.053800.002800.810300.750001.000001.00000


Target Position: 4270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4270GAAGUAGUAGAUUUUGUAG83.8551651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9414288GAAGTAGTAGATTTTGTAGCTACAAAATCTACTACTTC0.131600.123800.500000.500001.000001.00000


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149UGAAACUGUAAAUAUGUUU71.87811940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622167TGAAACTGTAAATATGTTTAAACATATTTACAGTTTCA0.130900.011000.724100.750001.000001.00000


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CAACUAUUUUUGAGGAAUU86.9436418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632789CAACTATTTTTGAGGAATTAATTCCTCAAAAATAGTTG0.123400.076700.637900.750001.000001.00000


Target Position: 3492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492UCAUCUCCUUUAUUGCAGU70.81042072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513510TCATCTCCTTTATTGCAGTACTGCAATAAAGGAGATGA0.276400.044600.517200.500000.962000.75000


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354CCCCCAGGUGUUGCCAUUU66.44252566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002372CCCCCAGGTGTTGCCATTTAAATGGCAACACCTGGGGG0.347600.003500.991401.000001.000001.00000


Target Position: 3301, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301GUGACAGAAUCUUGUAUUU87.2414395

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1330119GTGACAGAATCTTGTATTT1/1/0/0100.00MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36077961..36077979(+)00MAPK14(0.002)


Target Position: 3735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3735GAUUUCUCUGAACAGAAAA90.2754223

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3733-3755CTGATTTCTCTGAACAGAAAACAUUUUCUGUUCAGAGAAAUCAGGAUUUCUCUGAACAGAAAACAU19.214.822


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GAGGCAAGAAACUAUAUUC82.6834749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101259GAGGCAAGAAACTATATTCGAATATAGTTTCTTGCCTC0.147700.005400.637900.500000.983700.62500


Target Position: 3117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3117AGAAAGGGCAAAUUAUUUU75.85041490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943135AGAAAGGGCAAATTATTTTAAAATAATTTGCCCTTTCT0.078900.010400.724100.750001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767UAUGAUCACAGUGACUUUA79.99781003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751785TATGATCACAGTGACTTTATAAAGTCACTGTGATCATA0.245800.109500.508600.500000.989101.00000


Target Position: 4008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4008GAAAAUGUUGAUAAAGCUU84.129623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4006-4028TAGAAAATGTTGATAAAGCTTCTAAGCUUUAUCAACAUUUUCUAGAAAAUGUUGAUAAAGCUUCUU18.35.322


Target Position: 3114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114GGGAGAAAGGGCAAAUUAU89.8932240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773132GGGAGAAAGGGCAAATTATATAATTTGCCCTTTCTCCC0.058500.007500.948301.000001.000001.00000


Target Position: 3858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3858AGCCUAUUUUUCAAAUUUA90.2788221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753876AGCCTATTTTTCAAATTTATAAATTTGAAAAATAGGCT0.152900.040600.819000.750001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879AAAUUCUCCGAGGUCUAAA79.56371049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
950897AAATTCTCCGAGGTCTAAATTTAGACCTCGGAGAATTT0.056800.049500.500000.500001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892AGUAAAAAAAUAUGAAUUG70.2292136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171910AGTAAAAAAATATGAATTGCAATTCATATTTTTTTACT0.128500.121800.560300.500001.000001.00000


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149UUCAACUUUAUAAAGAUAA70.67882085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433167TTCAACTTTATAAAGATAATTATCTTTATAAAGTTGAA0.260000.185800.637900.500001.000001.00000


Target Position: 1893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893GUAAAAAAAUAUGAAUUGU78.64031165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1891-1913AAGTAAAAAAATATGAATTGTCCACAAUUCAUAUUUUUUUACUUGUAAAAAAAUAUGAAUUGUCCU13.8-9.122


Target Position: 2697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697CUUUUGAUGUGAAAAUCAU85.7653508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2695-2717TGCTTTTGATGTGAAAATCATGAAUGAUUUUCACAUCAAAAGCACUUUUGAUGUGAAAAUCAUGAU7.47.422


Target Position: 3592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592ACUGCUCUGAAUAUUUUGU69.36262244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9423610ACTGCTCTGAATATTTTGTACAAAATATTCAGAGCAGT0.286800.074200.500000.500001.000001.00000


Target Position: 2643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643CUCUCUUCAGCCCCUAGUG65.08722731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382661CTCTCTTCAGCCCCTAGTGCACTAGGGGCTGAAGAGAG0.074000.051700.517200.500001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568CCUGGUUUCUGUUCUGUUG72.79971844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401586CCTGGTTTCTGTTCTGTTGCAACAGAACAGAAACCAGG0.066500.002800.698300.750001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CAAAUUCUCCGAGGUCUAA86.6481436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761896CAAATTCTCCGAGGTCTAATTAGACCTCGGAGAATTTG0.062100.055100.612100.750001.000001.00000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850AGAUGACCAUGUUCAGUUC78.00051228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741868AGATGACCATGTTCAGTTCGAACTGAACATGGTCATCT0.234200.013600.551700.500001.000001.00000


Target Position: 2726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726ACAGGUGGAUGUAUAGCAU85.4692535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982744ACAGGTGGATGTATAGCATATGCTATACATCCACCTGT0.064400.005700.551700.750001.000001.00000


Target Position: 4139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4139GUGUAAGAGUGGCCGAAAU84.0563633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4664157GTGTAAGAGTGGCCGAAATATTTCGGCCACTCTTACAC0.252200.067400.784500.750001.000001.00000


Target Position: 4077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4077GGUAAAGCAAAGAGCAAAU85.1899553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6984095GGTAAAGCAAAGAGCAAATATTTGCTCTTTGCTTTACC0.077800.022900.844801.000000.945701.00000


Target Position: 2870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2870AUGCUAAGAAAUGCUGAAA77.53991277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932888ATGCTAAGAAATGCTGAAATTTCAGCATTTCTTAGCAT0.103700.047700.655200.500000.951100.75000


Target Position: 4036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4036ACAUUUUUUGGUGAAGAGU64.70252777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604054ACATTTTTTGGTGAAGAGTACTCTTCACCAAAAAATGT0.220600.006900.500000.500001.000001.00000


Target Position: 2696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696GCUUUUGAUGUGAAAAUCA90.2078229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2694-2716GTGCTTTTGATGTGAAAATCATGUGAUUUUCACAUCAAAAGCACGCUUUUGAUGUGAAAAUCAUGU10.412.222


Target Position: 3973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3973UGUCUGACAGAUCUUAAUA87.1511401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3783991TGTCTGACAGATCTTAATATATTAAGATCTGTCAGACA0.684400.065800.663800.750001.000001.00000


Target Position: 3934, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3934CAUUAUAUCAAUAUCCUUU90.0203237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023952CATTATATCAATATCCTTTAAAGGATATTGATATAATG0.572000.127900.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3932-3954GGCATTATATCAATATCCTTTAAAAAGGAUAUUGAUAUAAUGCCCAUUAUAUCAAUAUCCUUUAAU19.9-8.623


Target Position: 4087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4087AGAGCAAAUGAACGAAGUA91.0041181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7744105AGAGCAAATGAACGAAGTATACTTCGTTCATTTGCTCT0.400200.067100.543100.750001.000001.00000


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437GGUUCUUGAUGUCAUGUAC83.6376670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252455GGTTCTTGATGTCATGTACGTACATGACATCAAGAACC0.144400.084100.672400.750001.000001.00000


Target Position: 3315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315UAUUUGGGCCAAGGUGUUU61.84593115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043333TATTTGGGCCAAGGTGTTTAAACACCTTGGCCCAAATA0.039900.004000.543100.500001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621GGGAACUCUCCAAAUAUUA91.3313166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171639GGGAACTCTCCAAATATTATAATATTTGGAGAGTTCCC0.618300.049100.956901.000000.923900.62500


Target Position: 4232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4232GCUUUUACAUUUUUAAAUG75.91371479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844250GCTTTTACATTTTTAAATGCATTTAAAAATGTAAAAGC0.132600.010400.698300.750001.000001.00000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855ACCAUGUUCAGUUCCUUAU72.25491888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326873ACCATGTTCAGTTCCTTATATAAGGAACTGAACATGGT0.269800.052100.810300.750001.000001.00000


Target Position: 4017, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4017GAUAAAGCUUCUUAGUUGU84.6016585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4015-4037TTGATAAAGCTTCTTAGTTGTACACAACUAAGAAGCUUUAUCAAGAUAAAGCUUCUUAGUUGUACU11.813.632


Target Position: 1285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GAACUUUGCGAAUGUAUUU85.0912559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5971303GAACTTTGCGAATGTATTTAAATACATTCGCAAAGTTC0.109700.050600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1283-1305ATGAACTTTGCGAATGTATTTATAAAUACAUUCGCAAAGUUCAUGAACUUUGCGAAUGUAUUUAUU6.710.323


Target Position: 3964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3964UGGCAUACUUGUCUGACAG70.02412165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9683982TGGCATACTTGTCTGACAGCTGTCAGACAAGTATGCCA0.043800.006200.560300.500001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863CAGUUCCUUAUCUACCAAA90.3957209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141881CAGTTCCTTATCTACCAAATTTGGTAGATAAGGAACTG0.467000.230400.784500.750001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902AUACAUUCAGCUGACAUAA82.715745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879920ATACATTCAGCTGACATAATTATGTCAGCTGAATGTAT0.137600.117100.508600.500001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455CUUCCUGUGUACUCUUUAU87.774355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692473CTTCCTGTGTACTCTTTATATAAAGAGTACACAGGAAG0.084400.006900.594800.750001.000001.00000


Target Position: 2119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119AGUAUGGUUCUCAGAUCUU80.9846901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6812137AGTATGGTTCTCAGATCTTAAGATCTGAGAACCATACT0.132000.039100.569000.750001.000001.00000


Target Position: 2915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2915AGGCCAGAAACUCCUUUUG61.68733132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572933AGGCCAGAAACTCCTTTTGCAAAAGGAGTTTCTGGCCT0.174300.002600.698300.500000.994600.62500


Target Position: 4027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4027CUUAGUUGUACAUUUUUUG69.3762243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984045CTTAGTTGTACATTTTTTGCAAAAAATGTACAACTAAG0.027300.011800.491400.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253GCCUUUUGUGUAAUAAGAA91.8461145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5613271GCCTTTTGTGTAATAAGAATTCTTATTACACAAAAGGC0.340200.017100.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3251-3273AAGCCTTTTGTGTAATAAGAAAGUUCUUAUUACACAAAAGGCUUGCCUUUUGUGUAAUAAGAAAGU6.916.132


Target Position: 4072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4072GGAUGGGUAAAGCAAAGAG78.72691156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154090GGATGGGTAAAGCAAAGAGCTCTTTGCTTTACCCATCC0.038600.013700.560300.750001.000001.00000


Target Position: 2759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2759UCUGUUUUCAACCAACUAU71.66681969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592777TCTGTTTTCAACCAACTATATAGTTGGTTGAAAACAGA0.663200.027100.681000.750000.994600.75000


Target Position: 27, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
27GAGGUUCCAUAUUGGGUAA92.2565134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95245GAGGTTCCATATTGGGTAATTACCCAATATGGAACCTC0.033600.005400.775900.750000.945701.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903UACAUUCAGCUGACAUAAU76.811366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861921TACATTCAGCTGACATAATATTATGTCAGCTGAATGTA0.143900.107000.672400.500001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837GUCAGAAGCUUACAGAUGA90.6947198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862855GTCAGAAGCTTACAGATGATCATCTGTAAGCTTCTGAC0.044400.006300.594800.500001.000001.00000


Target Position: 4250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4250GGUUGGGAAAGAAAAAAAA91.5733157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1984268GGTTGGGAAAGAAAAAAAATTTTTTTTCTTTCCCAACC0.898900.088900.853401.000001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159AGACCAUAUUAACCAGCUU83.7643657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381177AGACCATATTAACCAGCTTAAGCTGGTTAATATGGTCT0.221700.058600.586200.750001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877CCAAAUUCUCCGAGGUCUA85.6627520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767895CCAAATTCTCCGAGGTCTATAGACCTCGGAGAATTTGG0.060700.054300.672401.000001.000001.00000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692GAACUGCGGUUACUUAAAC74.97131582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925710GAACTGCGGTTACTTAAACGTTTAAGTAACCGCAGTTC0.099600.003100.525900.500001.000001.00000


Target Position: 2941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2941UCUCUAAAUAUGAUUACUU78.17711205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252959TCTCTAAATATGATTACTTAAGTAATCATATTTAGAGA0.123700.127400.586200.750001.000001.00000


Target Position: 3859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3859GCCUAUUUUUCAAAUUUAG75.37521528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5283877GCCTATTTTTCAAATTTAGCTAAATTTGAAAAATAGGC0.133900.075700.827600.750001.000001.00000


Target Position: 654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654CAUUUCAGUCCAUCAUUCA90.9637185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
652-674ACCATTTCAGTCCATCATTCATGUGAAUGAUGGACUGAAAUGGUCAUUUCAGUCCAUCAUUCAUGU16.212.022


Target Position: 4259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4259AGAAAAAAAAAGAAGUAGU76.1691452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8484277AGAAAAAAAAAGAAGTAGTACTACTTCTTTTTTTTTCT0.730900.712400.517200.500001.000001.00000


Target Position: 3085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3085AUCCUUUGAGAAUGUGAUU70.96712040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9323103ATCCTTTGAGAATGTGATTAATCACATTCTCAAAGGAT0.036800.004300.672400.500001.000001.00000


Target Position: 3948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3948CCUUUAAACUGUGACCUGG66.41942567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933966CCTTTAAACTGTGACCTGGCCAGGTCACAGTTTAAAGG0.028800.030100.500000.500001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590AUACUGCUCUGAAUAUUUU80.6826934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603608ATACTGCTCTGAATATTTTAAAATATTCAGAGCAGTAT0.332600.051900.543100.500001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GUCAUCAGCUUUGUGCCAC61.75413124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801532GTCATCAGCTTTGTGCCACGTGGCACAAAGCTGATGAC0.073900.003800.525900.500000.913000.75000


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950AUGAUUACUUUAAAAUAAA86.8705423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022968ATGATTACTTTAAAATAAATTTATTTTAAAGTAATCAT0.976500.044400.655200.500001.000001.00000


Target Position: 3587, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3587GAAAUACUGCUCUGAAUAU93.816393

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8358719GAAATACTGCTCTGAATAT1/1/0/097.75MAPK14NM_001315.2+NM_139014.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36078247..36078265(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5393605GAAATACTGCTCTGAATATATATTCAGAGCAGTATTTC0.254800.050000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3585-3607CAGAAATACTGCTCTGAATATTTAUAUUCAGAGCAGUAUUUCUGGAAAUACUGCUCUGAAUAUUUU13.44.622


Target Position: 2849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2849UCUCUUCACUCCCAAUAAC64.22642841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532867TCTCTTCACTCCCAATAACGTTATTGGGAGTGAAGAGA0.331600.181300.577600.500001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239AUGAGGCAAGAAACUAUAU77.13651321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931257ATGAGGCAAGAAACTATATATATAGTTTCTTGCCTCAT0.357000.007700.612100.500001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160GACCAUAUUAACCAGCUUC73.09611791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621178GACCATATTAACCAGCTTCGAAGCTGGTTAATATGGTC0.207900.061400.646600.500001.000001.00000


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314GUAUUUGGGCCAAGGUGUU74.44281638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883332GTATTTGGGCCAAGGTGTTAACACCTTGGCCCAAATAC0.055100.003700.534500.750001.000001.00000


Target Position: 2120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120GUAUGGUUCUCAGAUCUUG76.67751377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912138GTATGGTTCTCAGATCTTGCAAGATCTGAGAACCATAC0.128400.035700.534500.500001.000001.00000


Target Position: 3661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661UCUGGAAGCCUGGACUCUA80.3294968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813679TCTGGAAGCCTGGACTCTATAGAGTCCAGGCTTCCAGA0.098700.002200.551700.750000.962000.75000


Target Position: 849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849CAGAUGACCAUGUUCAGUU85.5028533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599867CAGATGACCATGTTCAGTTAACTGAACATGGTCATCTG0.184100.014200.637900.750001.000001.00000


Target Position: 4096, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4096GAACGAAGUAUUAAGCAUU90.2816219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5404114GAACGAAGTATTAAGCATTAATGCTTAATACTTCGTTC0.208600.114400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4094-4116ATGAACGAAGTATTAAGCATTGGAAUGCUUAAUACUUCGUUCAUGAACGAAGUAUUAAGCAUUGGU19.719.723


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GAGGAAUUCAAUGAUGUGU76.88891351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
607788GAGGAATTCAATGATGTGTACACATCATTGAATTCCTC0.129200.046100.603400.500001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964CUGUGAGCUGAAGAUUCUG70.89162060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
913982CTGTGAGCTGAAGATTCTGCAGAATCTTCAGCTCACAG0.038600.024800.500000.500001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733UGGUCUGUUGGACGUUUUU69.29252253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802751TGGTCTGTTGGACGTTTTTAAAAACGTCCAACAGACCA0.102000.005600.844800.750000.945700.75000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766UCUGGAGGAAUUCAAUGAU73.04511797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758784TCTGGAGGAATTCAATGATATCATTGAATTCCTCCAGA0.211200.009300.543100.750001.000001.00000


Target Position: 2853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2853UUCACUCCCAAUAACUAAU66.94622524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162871TTCACTCCCAATAACTAATATTAGTTATTGGGAGTGAA0.410900.228100.663800.500001.000001.00000


Target Position: 1629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629UCCAAAUAUUAUUCAAGUG65.93752635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881647TCCAAATATTATTCAAGTGCACTTGAATAATATTTGGA0.282800.228900.577600.500001.000001.00000


Target Position: 2917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2917GCCAGAAACUCCUUUUGCU83.0243722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392935GCCAGAAACTCCTTTTGCTAGCAAAAGGAGTTTCTGGC0.228200.030000.646600.750001.000001.00000


Target Position: 3078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3078UGUAGGAAUCCUUUGAGAA86.8978419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853096TGTAGGAATCCTTTGAGAATTCTCAAAGGATTCCTACA0.363000.003700.534500.750000.972800.87500


Target Position: 700, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700GUUACUUAAACAUAUGAAA90.6887199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581718GTTACTTAAACATATGAAATTTCATATGTTTAAGTAAC0.327100.075000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
698-720CGGTTACTTAAACATATGAAACAUUUCAUAUGUUUAAGUAACCGGUUACUUAAACAUAUGAAACAU8.76.622


Target Position: 3496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496CUCCUUUAUUGCAGUUCAA88.1884336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843514CTCCTTTATTGCAGTTCAATTGAACTGCAATAAAGGAG0.409700.059700.663800.750000.994600.62500


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288CUUUGCGAAUGUAUUUAUU79.45591064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391306CTTTGCGAATGTATTTATTAATAAATACATTCGCAAAG0.095300.022600.629300.750001.000001.00000


Target Position: 2883, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2883CUGAAAAUCAAAGUAAAAA84.7927572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562901CTGAAAATCAAAGTAAAAATTTTTACTTTGATTTTCAG0.437900.285200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2881-2903TGCTGAAAATCAAAGTAAAAAATUUUUUACUUUGAUUUUCAGCACUGAAAAUCAAAGUAAAAAAUU4.97.422


Target Position: 2141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141AGUAUAUUUGAAACUGUAA91.3567163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712159AGTATATTTGAAACTGTAATTACAGTTTCAAATATACT0.078100.003900.672400.750001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734GGUCUGUUGGACGUUUUUA88.2735331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729752GGTCTGTTGGACGTTTTTATAAAAACGTCCAACAGACC0.104200.008300.819001.000000.945700.62500


Target Position: 2142, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142GUAUAUUUGAAACUGUAAA90.2563225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382160GTATATTTGAAACTGTAAATTTACAGTTTCAAATATAC0.080400.007900.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2140-2162CAGTATATTTGAAACTGTAAATAUUUACAGUUUCAAAUAUACUGGUAUAUUUGAAACUGUAAAUAU19.0-8.012


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110GAUGGGGAGAAAGGGCAAA79.19591101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373128GATGGGGAGAAAGGGCAAATTTGCCCTTTCTCCCCATC0.036200.009500.681000.750001.000001.00000


Target Position: 3124, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3124GCAAAUUAUUUUAAUAUUU85.3167548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783142GCAAATTATTTTAATATTTAAATATTAAAATAATTTGC0.030300.020800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3122-3144GGGCAAATTATTTTAATATTTTGAAAUAUUAAAAUAAUUUGCCCGCAAAUUAUUUUAAUAUUUUGU-8.0-1.421


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697GCGGUUACUUAAACAUAUG76.82911365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570715GCGGTTACTTAAACATATGCATATGTTTAAGTAACCGC0.410300.016500.767200.750001.000001.00000


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905CUCUUGUUUUUAUUUAAUG70.94462043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733923CTCTTGTTTTTATTTAATGCATTAAATAAAAACAAGAG0.072700.066800.655200.500001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494GUUUUGCACGUCUUGCUAU82.0323806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012512GTTTTGCACGTCTTGCTATATAGCAAGACGTGCAAAAC0.093600.003500.603400.750000.913000.87500


Target Position: 3837, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3837CAAUACCACUGGUUAAAAU90.3166217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063855CAATACCACTGGTTAAAATATTTTAACCAGTGGTATTG0.053200.013500.637900.750000.967401.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3835-3857GACAATACCACTGGTTAAAATAAAUUUUAACCAGUGGUAUUGUCCAAUACCACUGGUUAAAAUAAU0.020.023


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974GCGUAGACUUGACAACAUC79.15481107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2361992GCGTAGACTTGACAACATCGATGTTGTCAAGTCTACGC0.352200.069800.741400.750000.978300.62500


Target Position: 4286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4286UAGCAUGUGAUGUAAGUAA86.5067451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574304TAGCATGTGATGTAAGTAATTACTTACATCACATGCTA0.086900.012800.637900.500001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752ACAAUAUGAACAAACUAUG70.04062161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271770ACAATATGAACAAACTATGCATAGTTTGTTCATATTGT0.344900.096400.551700.500001.000001.00000


Target Position: 1875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875GAAUAUGUUCAAUGCAAAG81.3032868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841893GAATATGTTCAATGCAAAGCTTTGCATTGAACATATTC0.415300.060500.534500.500001.000001.00000


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109UGAUGGGGAGAAAGGGCAA77.01411335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233127TGATGGGGAGAAAGGGCAATTGCCCTTTCTCCCCATCA0.037600.007700.577600.750001.000001.00000


Target Position: 2732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732GGAUGUAUAGCAUUUUUAU96.857231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932750GGATGTATAGCATTTTTATATAAAAATGCTATACATCC0.068800.003600.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2730-2752GTGGATGTATAGCATTTTTATTCAUAAAAAUGCUAUACAUCCACGGAUGUAUAGCAUUUUUAUUCU-9.716.022


Target Position: 3835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3835GACAAUACCACUGGUUAAA85.4398537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3833-3855CAGACAATACCACTGGTTAAAATUUUAACCAGUGGUAUUGUCUGGACAAUACCACUGGUUAAAAUU20.014.622


Target Position: 2736, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GUAUAGCAUUUUUAUUCAU89.1425287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262754GTATAGCATTTTTATTCATATGAATAAAAATGCTATAC0.092200.009700.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2734-2756ATGTATAGCATTTTTATTCATGCAUGAAUAAAAAUGCUAUACAUGUAUAGCAUUUUUAUUCAUGCU8.920.922


Target Position: 3845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3845CUGGUUAAAAUAAAGCCUA82.5441760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5683863CTGGTTAAAATAAAGCCTATAGGCTTTATTTTAACCAG0.133700.017300.612100.750001.000001.00000


Target Position: 4067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4067GCUGUGGAUGGGUAAAGCA87.7799353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574085GCTGTGGATGGGTAAAGCATGCTTTACCCATCCACAGC0.063600.020200.500000.750001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271CAGAUGCCGAAGAUGAACU77.20911311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661289CAGATGCCGAAGATGAACTAGTTCATCTTCGGCATCTG0.056100.004000.577600.500001.000001.00000


Target Position: 2785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2785GAAUUAUCAUGGGAAAAGA93.0102113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2783-2805AGGAATTATCATGGGAAAAGACCUCUUUUCCCAUGAUAAUUCCUGAAUUAUCAUGGGAAAAGACCU18.71.823


Target Position: 3586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3586AGAAAUACUGCUCUGAAUA89.2238280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3453604AGAAATACTGCTCTGAATATATTCAGAGCAGTATTTCT0.291600.043900.681000.750001.000001.00000


Target Position: 3550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550CCAUGUUUGGUUGUAAAUG67.84472417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543568CCATGTTTGGTTGTAAATGCATTTACAACCAAACATGG0.053600.004300.689700.750000.967400.62500


Target Position: 2054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2054CAGUGAUACGUACAGCCAA96.645934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382072CAGTGATACGTACAGCCAATTGGCTGTACGTATCACTG0.067100.031300.637900.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GGAGGAAUUCAAUGAUGUG85.1291555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644787GGAGGAATTCAATGATGTGCACATCATTGAATTCCTCC0.128600.038700.577600.750001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169UGCCUUAAAAGGAGAGAAG61.62613141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122187TGCCTTAAAAGGAGAGAAGCTTCTCTCCTTTTAAGGCA0.128300.027500.715500.500000.972800.75000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128UGUUGACUGGAAGAACAUU75.94951474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831146TGTTGACTGGAAGAACATTAATGTTCTTCCAGTCAACA0.081500.012500.698300.750001.000001.00000


Target Position: 4247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4247AAUGGUUGGGAAAGAAAAA82.5653758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8644265AATGGTTGGGAAAGAAAAATTTTTCTTTCCCAACCATT0.516600.033600.508600.500001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639AGAAGCUCUCCAGACCAUU72.61111861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
663657AGAAGCTCTCCAGACCATTAATGGTCTGGAGAGCTTCT0.087600.024800.715500.750000.978300.87500


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890AAAGUAAAAAAAUAUGAAU82.0079809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871908AAAGTAAAAAAATATGAATATTCATATTTTTTTACTTT0.223500.182700.491400.500001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150UCAACUUUAUAAAGAUAAA86.2797469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5033168TCAACTTTATAAAGATAAATTTATCTTTATAAAGTTGA0.263400.180500.724100.750001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363GUUGCCAUUUCUCUGCUUA85.7132512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862381GTTGCCATTTCTCTGCTTATAAGCAGAGAAATGGCAAC0.252400.138600.612100.750001.000001.00000


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761UGUUUUCAACCAACUAUUU73.39311764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3012779TGTTTTCAACCAACTATTTAAATAGTTGGTTGAAAACA0.669900.052600.706900.750000.994600.62500


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622GGAACUCUCCAAAUAUUAU94.169779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1541640GGAACTCTCCAAATATTATATAATATTTGGAGAGTTCC0.625200.117700.827601.000000.967400.62500


Target Position: 3808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3808UAAUCAGUUAUGCCGUAUA84.3402607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843826TAATCAGTTATGCCGTATATATACGGCATAACTGATTA0.058000.002200.491400.500001.000001.00000


Target Position: 664, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664CAUCAUUCAUGCGAAAAGA87.4807377

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
662-684TCCATCATTCATGCGAAAAGAACUCUUUUCGCAUGAAUGAUGGACAUCAUUCAUGCGAAAAGAACU12.416.233


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CUCUCCAGACCAUUUCAGU74.49081633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687662CTCTCCAGACCATTTCAGTACTGAAATGGTCTGGAGAG0.200400.039300.603400.500001.000001.00000


Target Position: 3855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3855UAAAGCCUAUUUUUCAAAU72.31791880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253873TAAAGCCTATTTTTCAAATATTTGAAAAATAGGCTTTA0.238400.053600.525900.500001.000001.00000


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607UGUCACCUCAGCUGAUAUU72.90521823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972625TGTCACCTCAGCTGATATTAATATCAGCTGAGGTGACA0.033200.002000.698300.750000.967400.75000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557AGUCCUGAGCACCUGGUUU76.3221428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531575AGTCCTGAGCACCTGGTTTAAACCAGGTGCTCAGGACT0.226900.002700.706900.750000.994600.62500


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829UGUGAAAUGUCAGAAGCUU75.32091537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857847TGTGAAATGTCAGAAGCTTAAGCTTCTGACATTTCACA0.075000.004300.569000.750001.000001.00000


Target Position: 3971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3971CUUGUCUGACAGAUCUUAA91.8089148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003989CTTGTCTGACAGATCTTAATTAAGATCTGTCAGACAAG0.226200.035900.603400.750001.000001.00000


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380CCCAAGCCCUUGCACAUGC55.44483691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821398CCCAAGCCCTTGCACATGCGCATGTGCAAGGGCTTGGG0.114500.009900.637900.500000.945700.75000


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566CACCUGGUUUCUGUUCUGU73.21271780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701584CACCTGGTTTCTGTTCTGTACAGAACAGAAACCAGGTG0.214000.002400.586200.500001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126GCUGUUGACUGGAAGAACA92.6933117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721144GCTGTTGACTGGAAGAACATGTTCTTCCAGTCAACAGC0.067800.003900.646600.750001.000001.00000


Target Position: 1979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979GACUUGACAACAUCCCACA89.5513258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951997GACTTGACAACATCCCACATGTGGGATGTTGTCAAGTC0.274700.171900.612100.500001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970UGGGGCGUAGACUUGACAA79.29781085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731988TGGGGCGTAGACTTGACAATTGTCAAGTCTACGCCCCA0.381500.006600.698300.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AGCUCUCCAGACCAUUUCA84.0293637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768660AGCTCTCCAGACCATTTCATGAAATGGTCTGGAGAGCT0.103900.041500.629300.500000.978300.75000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529CCACCACCCCUUGACCAAG64.44612814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971547CCACCACCCCTTGACCAAGCTTGGTCAAGGGGTGGTGG0.256500.141400.706900.750001.000001.00000


Target Position: 2923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2923AACUCCUUUUGCUGUCUUU75.93261477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112941AACTCCTTTTGCTGTCTTTAAAGACAGCAAAAGGAGTT0.227100.087900.646600.500001.000001.00000


Target Position: 30, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
30GUUCCAUAUUGGGUAAAAU85.802503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77448GTTCCATATTGGGTAAAATATTTTACCCAATATGGAAC0.059500.010500.637900.750000.945700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
28-50AGGTTCCATATTGGGTAAAATCTAUUUUACCCAAUAUGGAACCUGUUCCAUAUUGGGUAAAAUCUU14.021.222


Target Position: 2932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932UGCUGUCUUUCUCUAAAUA87.7389360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3492950TGCTGTCTTTCTCTAAATATATTTAGAGAAAGACAGCA0.665400.214000.810300.750001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GGUCUAAAGUAUAUACAUU99.72819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110908GGTCTAAAGTATATACATTAATGTATATACTTTAGACC0.632200.149100.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
888-910GAGGTCTAAAGTATATACATTCAAAUGUAUAUACUUUAGACCUCGGUCUAAAGUAUAUACAUUCAU8.214.632


Target Position: 3574, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3574GUGAUUUCCUACAGAAAUA93.842891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3572-3594GTGTGATTTCCTACAGAAATACTUAUUUCUGUAGGAAAUCACACGUGAUUUCCUACAGAAAUACUU12.016.322


Target Position: 2885, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885GAAAAUCAAAGUAAAAAAU84.893568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3722903GAAAATCAAAGTAAAAAATATTTTTTACTTTGATTTTC0.441600.304300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2883-2905CTGAAAATCAAAGTAAAAAATTAAUUUUUUACUUUGAUUUUCAGGAAAAUCAAAGUAAAAAAUUAU-9.17.421


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170GCCUUAAAAGGAGAGAAGA81.3963861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702188GCCTTAAAAGGAGAGAAGATCTTCTCTCCTTTTAAGGC0.295800.039700.775900.750000.972800.62500


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490GGAGAGGCCCACGUUCUAC72.0411918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868508GGAGAGGCCCACGTTCTACGTAGAACGTGGGCCTCTCC0.167200.004000.689700.750001.000001.00000


Target Position: 2325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325CGUAUAUGUGCGUCUCUCU87.4571381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482343CGTATATGTGCGTCTCTCTAGAGAGACGCACATATACG0.457000.017300.551700.750001.000001.00000


Target Position: 3123, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123GGCAAAUUAUUUUAAUAUU89.1025291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093141GGCAAATTATTTTAATATTAATATTAAAATAATTTGCC0.039100.022800.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3121-3143AGGGCAAATTATTTTAATATTTTAAUAUUAAAAUAAUUUGCCCUGGCAAAUUAUUUUAAUAUUUUU-8.014.021


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334GCGUCUCUCUUUCUCCCUC70.62712097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912352GCGTCTCTCTTTCTCCCTCGAGGGAGAAAGAGAGACGC0.307500.177700.612100.750001.000001.00000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731AUUGGUCUGUUGGACGUUU68.6592326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991749ATTGGTCTGTTGGACGTTTAAACGTCCAACAGACCAAT0.076900.002100.508600.500000.945701.00000


Target Position: 3974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3974GUCUGACAGAUCUUAAUAC79.41831071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073992GTCTGACAGATCTTAATACGTATTAAGATCTGTCAGAC0.735600.127600.637900.500001.000001.00000


Target Position: 1576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1576CUGUUCUGUUGAUCCCACU76.47511401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451594CTGTTCTGTTGATCCCACTAGTGGGATCAACAGAACAG0.148100.020800.577600.500001.000001.00000


Target Position: 1753, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753CAAUAUGAACAAACUAUGA93.4649101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1751-1773GACAATATGAACAAACTATGATCUCAUAGUUUGUUCAUAUUGUCCAAUAUGAACAAACUAUGAUCU11.68.722


Target Position: 3116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3116GAGAAAGGGCAAAUUAUUU85.703515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7253134GAGAAAGGGCAAATTATTTAAATAATTTGCCCTTTCTC0.072400.010200.810300.750001.000001.00000


Target Position: 2642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642CCUCUCUUCAGCCCCUAGU63.94232880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392660CCTCTCTTCAGCCCCTAGTACTAGGGGCTGAAGAGAGG0.066900.065900.637900.750001.000001.00000


Target Position: 3400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400GGAGCAAGAAGGAAGGAGG70.83632070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533418GGAGCAAGAAGGAAGGAGGCCTCCTTCCTTCTTGCTCC0.120200.059300.525900.500001.000001.00000


Target Position: 3322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3322GCCAAGGUGUUUCCAUUUC62.75313008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7833340GCCAAGGTGTTTCCATTTCGAAATGGAAACACCTTGGC0.158600.006400.827600.750001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884CUCCGAGGUCUAAAGUAUA91.8048149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455902CTCCGAGGTCTAAAGTATATATACTTTAGACCTCGGAG0.523000.043400.767200.750001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709ACAUAUGAAACAUGAAAAU79.44321066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654727ACATATGAAACATGAAAATATTTTCATGTTTCATATGT0.090400.076000.698300.750000.978300.62500


Target Position: 2925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925CUCCUUUUGCUGUCUUUCU72.16121904

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2923-2945AACTCCTTTTGCTGTCTTTCTCTAGAAAGACAGCAAAAGGAGUUCUCCUUUUGCUGUCUUUCUCUU21.518.722


Target Position: 4260, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260GAAAAAAAAAGAAGUAGUA94.294776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9824278GAAAAAAAAAGAAGTAGTATACTACTTCTTTTTTTTTC0.728500.705200.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4258-4280AAGAAAAAAAAAGAAGTAGTAGAUACUACUUCUUUUUUUUUCUUGAAAAAAAAAGAAGUAGUAGAU17.6-11.322


Target Position: 4141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141GUAAGAGUGGCCGAAAUGA81.6338841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161GTGTAAGAGTGGCCGAAATGACAUCAUUUCGGCCACUCUUACACGUAAGAGUGGCCGAAAUGACAU14.118.932


Target Position: 3895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3895UUAUAUUUUUCUCUUGUUU70.04072160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873913TTATATTTTTCTCTTGTTTAAACAAGAGAAAAATATAA0.472200.261100.534500.500001.000001.00000


Target Position: 2773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773ACUAUUUUUGAGGAAUUAU74.94621585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232791ACTATTTTTGAGGAATTATATAATTCCTCAAAAATAGT0.136500.062300.663800.750001.000001.00000


Target Position: 2640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640CACCUCUCUUCAGCCCCUA78.00961226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202658CACCTCTCTTCAGCCCCTATAGGGGCTGAAGAGAGGTG0.103700.052900.620700.750001.000001.00000


Target Position: 2926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2926UCCUUUUGCUGUCUUUCUC57.69513505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692944TCCTTTTGCTGTCTTTCTCGAGAAAGACAGCAAAAGGA0.362500.114500.560300.500001.000001.00000


Target Position: 3079, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079GUAGGAAUCCUUUGAGAAU87.3531389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9153097GTAGGAATCCTTTGAGAATATTCTCAAAGGATTCCTAC0.432400.003300.672400.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3077-3099TTGTAGGAATCCTTTGAGAATGTAUUCUCAAAGGAUUCCUACAAGUAGGAAUCCUUUGAGAAUGUU20.419.932


Target Position: 4322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4322AGUAUCCAUAAAUAAAGUU76.94151345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7134340AGTATCCATAAATAAAGTTAACTTTATTTATGGATACT0.297600.214700.560300.750001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099UUGGUCAGUGGGAUGCAUA74.80881595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271117TTGGTCAGTGGGATGCATATATGCATCCCACTGACCAA0.052300.003000.603400.500001.000001.00000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512CAGGAGCUGAACAAGACAA91.7933150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801530CAGGAGCTGAACAAGACAATTGTCTTGTTCAGCTCCTG0.097600.005700.637900.750001.000001.00000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763GUCUCUGGAGGAAUUCAAU84.8746569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824781GTCTCTGGAGGAATTCAATATTGAATTCCTCCAGAGAC0.237500.004900.810300.750001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880UGUUCAAUGCAAAGUAAAA87.9908345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271898TGTTCAATGCAAAGTAAAATTTTACTTTGCATTGAACA0.692700.070500.706900.750001.000001.00000


Target Position: 2944, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944CUAAAUAUGAUUACUUUAA89.6255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5752962CTAAATATGATTACTTTAATTAAAGTAATCATATTTAG0.118800.101300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2942-2964CTCTAAATATGATTACTTTAAAAUUAAAGUAAUCAUAUUUAGAGCUAAAUAUGAUUACUUUAAAAU6.6-8.022


Target Position: 3391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3391GAGUCAACUGGAGCAAGAA96.295639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783409GAGTCAACTGGAGCAAGAATTCTTGCTCCAGTTGACTC0.114800.010500.637900.750001.000001.00000


Target Position: 865, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865GUUCCUUAUCUACCAAAUU80.5012949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457883GTTCCTTATCTACCAAATTAATTTGGTAGATAAGGAAC0.605600.259200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
863-885CAGTTCCTTATCTACCAAATTCTAAUUUGGUAGAUAAGGAACUGGUUCCUUAUCUACCAAAUUCUU18.819.932


Target Position: 2728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728AGGUGGAUGUAUAGCAUUU85.6869517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612746AGGTGGATGTATAGCATTTAAATGCTATACATCCACCT0.076000.002500.844800.750001.000001.00000


Target Position: 2836, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836GGAAACAAGUUAUUCUCUU86.1971472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2834-2856TCGGAAACAAGTTATTCTCTTCAAAGAGAAUAACUUGUUUCCGAGGAAACAAGUUAUUCUCUUCAU19.114.922


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570UGGUUUCUGUUCUGUUGAU78.03611219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6571588TGGTTTCTGTTCTGTTGATATCAACAGAACAGAAACCA0.088900.015100.663800.750001.000001.00000


Target Position: 3987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3987UAAUACUACUCCUAACAUU83.1464715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8174005TAATACTACTCCTAACATTAATGTTAGGAGTAGTATTA0.406300.361100.525900.500001.000001.00000


Target Position: 3558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3558GGUUGUAAAUGCUCGUGUG84.2625613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093576GGTTGTAAATGCTCGTGTGCACACGAGCATTTACAACC0.150900.022900.560300.750001.000001.00000


Target Position: 4321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4321CAGUAUCCAUAAAUAAAGU87.0191415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9804339CAGTATCCATAAATAAAGTACTTTATTTATGGATACTG0.306300.070200.577600.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488AGUGGAAAAGCCUGACCUA90.2304227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471506AGTGGAAAAGCCTGACCTATAGGTCAGGCTTTTCCACT0.147400.004400.534500.750001.000001.00000


Target Position: 3595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595GCUCUGAAUAUUUUGUAAU84.5618588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2283613GCTCTGAATATTTTGTAATATTACAAAATATTCAGAGC0.313100.141800.844801.000001.000001.00000


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183AGAAGAAAGUGUAGAUAGU85.063561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8432201AGAAGAAAGTGTAGATAGTACTATCTACACTTTCTTCT0.267800.186600.517200.500001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691AGAACUGCGGUUACUUAAA84.2252616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959709AGAACTGCGGTTACTTAAATTTAAGTAACCGCAGTTCT0.054300.002500.724100.750001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACUGGAAGAACAUUGUUUC67.39842472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621151ACTGGAAGAACATTGTTTCGAAACAATGTTCTTCCAGT0.062300.003900.534500.500001.000001.00000


Target Position: 4231, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4231GGCUUUUACAUUUUUAAAU82.0531804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7804249GGCTTTTACATTTTTAAATATTTAAAAATGTAAAAGCC0.103600.006500.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4229-4251ATGGCTTTTACATTTTTAAATGGAUUUAAAAAUGUAAAAGCCAUGGCUUUUACAUUUUUAAAUGGU-9.113.711


Target Position: 1868, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868CUUUUAGGAAUAUGUUCAA87.8069349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991886CTTTTAGGAATATGTTCAATTGAACATATTCCTAAAAG0.138100.008500.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1866-1888TCCTTTTAGGAATATGTTCAATGUUGAACAUAUUCCUAAAAGGACUUUUAGGAAUAUGUUCAAUGU20.511.032


Target Position: 3927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3927AAUAUGGCAUUAUAUCAAU84.6867579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493945AATATGGCATTATATCAATATTGATATAATGCCATATT0.232200.043800.500000.500001.000001.00000


Target Position: 3965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3965GGCAUACUUGUCUGACAGA91.5792155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713983GGCATACTTGTCTGACAGATCTGTCAGACAAGTATGCC0.060100.010000.775900.750001.000001.00000


Target Position: 4230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4230UGGCUUUUACAUUUUUAAA81.5088850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9264248TGGCTTTTACATTTTTAAATTTAAAAATGTAAAAGCCA0.080900.003100.844800.750001.000001.00000


Target Position: 3907, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3907CUUGUUUUUAUUUAAUGCA76.40681409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3905-3927CTCTTGTTTTTATTTAATGCACAUGCAUUAAAUAAAAACAAGAGCUUGUUUUUAUUUAAUGCACAU15.35.622


Target Position: 4095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4095UGAACGAAGUAUUAAGCAU82.0349805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6914113TGAACGAAGTATTAAGCATATGCTTAATACTTCGTTCA0.216500.129000.569000.750001.000001.00000


Target Position: 3111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111AUGGGGAGAAAGGGCAAAU63.79512905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643129ATGGGGAGAAAGGGCAAATATTTGCCCTTTCTCCCCAT0.031300.016700.646600.500001.000001.00000


Target Position: 3466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3466GAAAGUGAACCUUUAAAGU82.7432742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3464-3486AGGAAAGTGAACCTTTAAAGTAAACUUUAAAGGUUCACUUUCCUGAAAGUGAACCUUUAAAGUAAU-3.819.223


Target Position: 4078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4078GUAAAGCAAAGAGCAAAUG63.03532979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8224096GTAAAGCAAAGAGCAAATGCATTTGCTCTTTGCTTTAC0.101000.025300.525900.500000.945701.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UGAAAUGUCAGAAGCUUAC63.0022982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749849TGAAATGTCAGAAGCTTACGTAAGCTTCTGACATTTCA0.149800.009200.543100.500001.000001.00000


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856CCAUGUUCAGUUCCUUAUC69.22522261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383874CCATGTTCAGTTCCTTATCGATAAGGAACTGAACATGG0.298400.054900.663800.750001.000001.00000


Target Position: 2694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694GUGCUUUUGAUGUGAAAAU78.66521161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2692-2714AGGTGCTTTTGATGTGAAAATCAAUUUUCACAUCAAAAGCACCUGUGCUUUUGAUGUGAAAAUCAU14.918.622


Target Position: 3390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3390UGAGUCAACUGGAGCAAGA79.67221040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623408TGAGTCAACTGGAGCAAGATCTTGCTCCAGTTGACTCA0.065000.010600.500000.500001.000001.00000


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769UGAUCACAGUGACUUUACA90.0842234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451787TGATCACAGTGACTTTACATGTAAAGTCACTGTGATCA0.320900.116700.517200.500000.989100.75000


Target Position: 3209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209UGAAUUUCAGGCAUUUUGU67.35612480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503227TGAATTTCAGGCATTTTGTACAAAATGCCTGAAATTCA0.066300.015500.517200.500001.000001.00000


Target Position: 3210, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3210GAAUUUCAGGCAUUUUGUU82.8727730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163228GAATTTCAGGCATTTTGTTAACAAAATGCCTGAAATTC0.085200.019000.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3208-3230CTGAATTTCAGGCATTTTGTTCTAACAAAAUGCCUGAAAUUCAGGAAUUUCAGGCAUUUUGUUCUU5.37.422


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948AUAUGAUUACUUUAAAAUA93.571597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202966ATATGATTACTTTAAAATATATTTTAAAGTAATCATAT0.112300.062100.500000.500001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854GACCAUGUUCAGUUCCUUA97.945820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445872GACCATGTTCAGTTCCTTATAAGGAACTGAACATGGTC0.187800.028800.784500.750001.000001.00000


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591GGUAGUUUAGAUCCCAUGU79.88561019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422609GGTAGTTTAGATCCCATGTACATGGGATCTAAACTACC0.094700.023700.646600.750000.989100.62500


Target Position: 3040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3040UUGGGGAGAAAUAAAUUUU66.40332569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9903058TTGGGGAGAAATAAATTTTAAAATTTATTTCTCCCCAA0.135800.002100.646600.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771AGGAAUUCAAUGAUGUGUA86.825425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
670789AGGAATTCAATGATGTGTATACACATCATTGAATTCCT0.085100.044800.663800.750001.000001.00000


Target Position: 3011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3011UCUUGGCAGCUUAACAUUG61.67973134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6433029TCTTGGCAGCTTAACATTGCAATGTTAAGCTGCCAAGA0.412400.025500.577600.500001.000001.00000


Target Position: 2436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436AGGUUCUUGAUGUCAUGUA84.9944565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652454AGGTTCTTGATGTCATGTATACATGACATCAAGAACCT0.156700.078300.663800.750001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853UGACCAUGUUCAGUUCCUU77.44031283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630871TGACCATGTTCAGTTCCTTAAGGAACTGAACATGGTCA0.171600.025200.586200.750001.000001.00000


Target Position: 3388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3388CCUGAGUCAACUGGAGCAA79.21421096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7763406CCTGAGTCAACTGGAGCAATTGCTCCAGTTGACTCAGG0.058800.008200.698301.000001.000001.00000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886AAAAUCAAAGUAAAAAAUU72.11591914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862904AAAATCAAAGTAAAAAATTAATTTTTTACTTTGATTTT0.524600.308800.491400.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619ACGGGAACUCUCCAAAUAU81.0594893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321637ACGGGAACTCTCCAAATATATATTTGGAGAGTTCCCGT0.374200.004700.732800.750000.923900.87500


Target Position: 4256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256GAAAGAAAAAAAAAGAAGU80.1803984

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4254-4276GGGAAAGAAAAAAAAAGAAGTAGACUUCUUUUUUUUUCUUUCCCGAAAGAAAAAAAAAGAAGUAGU10.35.511


Target Position: 1252, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CUAUAUUCAGUCUUUGACU82.1518796

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1250-1272AACTATATTCAGTCTTTGACTCAAGUCAAAGACUGAAUAUAGUUCUAUAUUCAGUCUUUGACUCAU19.23.522


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742GGACGUUUUUACACCUGCA95.312157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854760GGACGTTTTTACACCTGCATGCAGGTGTAAAAACGTCC0.045700.006500.517200.750000.962000.62500


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858UCCCAAUAACUAAUGCUAA82.1939791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792876TCCCAATAACTAATGCTAATTAGCATTAGTTATTGGGA0.301100.123500.836200.750000.967400.62500


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846UAUUCUCUUCACUCCCAAU80.5625945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732864TATTCTCTTCACTCCCAATATTGGGAGTGAAGAGAATA0.299700.120600.534500.500001.000001.00000


Target Position: 2376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376UGCUUACCCUUCACCUUUG63.91412884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912394TGCTTACCCTTCACCTTTGCAAAGGTGAAGGGTAAGCA0.041000.040800.706900.500001.000001.00000


Target Position: 2669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669GUGUUGAACACAAUUGAUA90.7111196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2667-2689CTGTGTTGAACACAATTGATACTUAUCAAUUGUGUUCAACACAGGUGUUGAACACAAUUGAUACUU7.220.522


Target Position: 3259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259UGUGUAAUAAGAAAGUAUA88.6571314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3853277TGTGTAATAAGAAAGTATATATACTTTCTTATTACACA0.529400.142700.663800.750001.000001.00000


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287ACUUUGCGAAUGUAUUUAU78.03031222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471305ACTTTGCGAATGTATTTATATAAATACATTCGCAAAGT0.092300.030100.663800.750001.000001.00000


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934CUGUCUUUCUCUAAAUAUG78.31681193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542952CTGTCTTTCTCTAAATATGCATATTTAGAGAAAGACAG0.453200.172900.629300.500001.000001.00000


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319UGGGCCAAGGUGUUUCCAU66.93852525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123337TGGGCCAAGGTGTTTCCATATGGAAACACCTTGGCCCA0.177800.005400.689700.750001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161ACCAUAUUAACCAGCUUCA77.34461296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771179ACCATATTAACCAGCTTCATGAAGCTGGTTAATATGGT0.222200.088600.629300.500001.000001.00000


Target Position: 3409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3409AGGAAGGAGGCAGACUGAU71.78541948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003427AGGAAGGAGGCAGACTGATATCAGTCTGCCTCCTTCCT0.158300.022900.663800.750001.000001.00000


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880AUGCUGAAAAUCAAAGUAA82.9238728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902898ATGCTGAAAATCAAAGTAATTACTTTGATTTTCAGCAT0.346400.061600.620700.500001.000001.00000


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565GCACCUGGUUUCUGUUCUG76.46071403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731583GCACCTGGTTTCTGTTCTGCAGAACAGAAACCAGGTGC0.045400.002400.569000.750001.000001.00000


Target Position: 4275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4275AGUAGAUUUUGUAGCAUGU80.9874900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274293AGTAGATTTTGTAGCATGTACATGCTACAAAATCTACT0.084600.048500.500000.500001.000001.00000


Target Position: 3506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3506GCAGUUCAAAUCCUCACCA83.8563650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8983524GCAGTTCAAATCCTCACCATGGTGAGGATTTGAACTGC0.460100.217400.508600.750001.000001.00000


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335UGGAGAAGAUGCUUGUAUU86.0279484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801353TGGAGAAGATGCTTGTATTAATACAAGCATCTTCTCCA0.049400.002300.836200.750001.000001.00000


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999GGCACACAGAUGAUGAAAU88.9626297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841017GGCACACAGATGATGAAATATTTCATCATCTGTGTGCC0.570200.099600.991401.000001.000001.00000


Target Position: 3761, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3761GAGAAUGAGGGAAAUUGCU79.21631095

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3759-3781GAGAGAATGAGGGAAATTGCTATAGCAAUUUCCCUCAUUCUCUCGAGAAUGAGGGAAAUUGCUAUU14.020.432


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439UUCUUGAUGUCAUGUACUU72.18151902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892457TTCTTGATGTCATGTACTTAAGTACATGACATCAAGAA0.155300.085000.534500.500001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366GCCAUUUCUCUGCUUACCC60.49673260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822384GCCATTTCTCTGCTTACCCGGGTAAGCAGAGAAATGGC0.188700.168000.508600.500001.000001.00000


Target Position: 3094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094GAAUGUGAUUCCUUUUGAU96.298838

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3092-3114GAGAATGTGATTCCTTTTGATGGAUCAAAAGGAAUCACAUUCUCGAAUGUGAUUCCUUUUGAUGGU12.220.523


Target Position: 3936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936UUAUAUCAAUAUCCUUUAA84.6176583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893954TTATATCAATATCCTTTAATTAAAGGATATTGATATAA0.700200.364300.500000.500001.000001.00000


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708AACAUAUGAAACAUGAAAA88.9147299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677726AACATATGAAACATGAAAATTTTCATGTTTCATATGTT0.221800.176000.646600.500000.978300.75000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129GUUGACUGGAAGAACAUUG68.49322346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551147GTTGACTGGAAGAACATTGCAATGTTCTTCCAGTCAAC0.199300.015200.500000.500001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056AGAUCAUGCUGAACUGGAU90.7782193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621074AGATCATGCTGAACTGGATATCCAGTTCAGCATGATCT0.096000.002500.543100.750001.000001.00000


Target Position: 4090, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090GCAAAUGAACGAAGUAUUA92.1715139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1894108GCAAATGAACGAAGTATTATAATACTTCGTTCATTTGC0.354200.267900.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4088-4110GAGCAAATGAACGAAGTATTAAGUAAUACUUCGUUCAUUUGCUCGCAAAUGAACGAAGUAUUAAGU4.613.822


Target Position: 3017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3017CAGCUUAACAUUGACUUCU75.6271507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7043035CAGCTTAACATTGACTTCTAGAAGTCAATGTTAAGCTG0.196400.066400.560300.500001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973GGCGUAGACUUGACAACAU92.2329136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541991GGCGTAGACTTGACAACATATGTTGTCAAGTCTACGCC0.313000.064200.844801.000001.000001.00000


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185AAGAAAGUGUAGAUAGUUA96.321737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152203AAGAAAGTGTAGATAGTTATAACTATCTACACTTTCTT0.289500.220200.603400.500001.000001.00000


Target Position: 3260, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3260GUGUAAUAAGAAAGUAUAA97.544824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803278GTGTAATAAGAAAGTATAATTATACTTTCTTATTACAC0.545900.257400.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3258-3280TTGTGTAATAAGAAAGTATAAAGUUAUACUUUCUUAUUACACAAGUGUAAUAAGAAAGUAUAAAGU6.38.522


Target Position: 3488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3488GGCCUCAUCUCCUUUAUUG75.90291483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643506GGCCTCATCTCCTTTATTGCAATAAAGGAGATGAGGCC0.061500.029600.853400.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GAAAAGAACCUACAGAGAA96.167942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946694GAAAAGAACCTACAGAGAATTCTCTGTAGGTTCTTTTC0.051700.032900.500000.750001.000001.00000


Target Position: 3406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406AGAAGGAAGGAGGCAGACU71.43291994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663424AGAAGGAAGGAGGCAGACTAGTCTGCCTCCTTCCTTCT0.064200.033400.517200.500001.000001.00000


Target Position: 2949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2949UAUGAUUACUUUAAAAUAA89.5048262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762967TATGATTACTTTAAAATAATTATTTTAAAGTAATCATA0.138700.052700.508600.500001.000001.00000


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UGACACAAAAACGGGGUUA68.83252308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988625TGACACAAAAACGGGGTTATAACCCCGTTTTTGTGTCA0.029200.004800.689700.750001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675CGAAAAGAACCUACAGAGA89.0462293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763693CGAAAAGAACCTACAGAGATCTCTGTAGGTTCTTTTCG0.061800.032400.569000.750001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435CAGGUUCUUGAUGUCAUGU74.75461607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672453CAGGTTCTTGATGTCATGTACATGACATCAAGAACCTG0.162100.007500.577600.500001.000001.00000


Target Position: 1321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1321GGCUGUCGACUUGCUGGAG70.43212117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281339GGCTGTCGACTTGCTGGAGCTCCAGCAAGTCGACAGCC0.049300.008400.689700.750001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CAGAUCUGAACAACAUUGU73.99841693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984831CAGATCTGAACAACATTGTACAATGTTGTTCAGATCTG0.053200.002300.577600.500001.000001.00000


Target Position: 3487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3487AGGCCUCAUCUCCUUUAUU78.27761195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7583505AGGCCTCATCTCCTTTATTAATAAAGGAGATGAGGCCT0.063500.022500.836200.750000.945700.62500


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604CCAUGUCACCUCAGCUGAU87.7403359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802622CCATGTCACCTCAGCTGATATCAGCTGAGGTGACATGG0.030200.004400.663801.000000.967400.62500


Target Position: 4222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4222GCUAAGAAUGGCUUUUACA90.1259233

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4220-4242CTGCTAAGAATGGCTTTTACATTUGUAAAAGCCAUUCUUAGCAGGCUAAGAAUGGCUUUUACAUUU4.911.721


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362UGUUGCCAUUUCUCUGCUU72.21731898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802380TGTTGCCATTTCTCTGCTTAAGCAGAGAAATGGCAACA0.264000.148500.569000.750001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101CCUGUGAUUAACUUGCUUA91.3141167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622119CCTGTGATTAACTTGCTTATAAGCAAGTTAATCACAGG0.084900.007200.810301.000001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567ACCUGGUUUCUGUUCUGUU77.58551275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761585ACCTGGTTTCTGTTCTGTTAACAGAACAGAAACCAGGT0.220200.002300.706900.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889CAAAGUAAAAAAAUAUGAA95.721850

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1887-1909TGCAAAGTAAAAAAATATGAATTUUCAUAUUUUUUUACUUUGCACAAAGUAAAAAAAUAUGAAUUU8.74.922


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918UAAUUCACAGGGACCUAAA81.1918879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951936TAATTCACAGGGACCTAAATTTAGGTCCCTGTGAATTA0.505200.013600.534500.500001.000001.00000


Target Position: 3765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3765AUGAGGGAAAUUGCUAUUU62.78543001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813783ATGAGGGAAATTGCTATTTAAATAGCAATTTCCCTCAT0.252600.007700.655200.500001.000001.00000


Target Position: 28, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28AGGUUCCAUAUUGGGUAAA71.86781941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94146AGGTTCCATATTGGGTAAATTTACCCAATATGGAACCT0.035600.007700.844800.750000.945701.00000


Target Position: 3821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3821CGUAUAGGAUGUCAGACAA99.7638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5333839CGTATAGGATGTCAGACAATTGTCTGACATCCTATACG0.351600.026100.629301.000001.000001.00000


Target Position: 3498, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498CCUUUAUUGCAGUUCAAAU87.2151398

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7349819CCTTTATTGCAGTTCAAAT1/1/0/097.75MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36078158..36078176(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1423516CCTTTATTGCAGTTCAAATATTTGAACTGCAATAAAGG0.509800.122100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3496-3518CTCCTTTATTGCAGTTCAAATCCAUUUGAACUGCAAUAAAGGAGCCUUUAUUGCAGUUCAAAUCCU14.9-4.322


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652ACCAUUUCAGUCCAUCAUU71.62551973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585670ACCATTTCAGTCCATCATTAATGATGGACTGAAATGGT0.199400.090600.844800.750001.000001.00000


Target Position: 2057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057UGAUACGUACAGCCAAAAA82.9519725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312075TGATACGTACAGCCAAAAATTTTTGGCTGTACGTATCA0.048700.031300.724100.750001.000001.00000


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353ACCCCCAGGUGUUGCCAUU65.51652684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962371ACCCCCAGGTGTTGCCATTAATGGCAACACCTGGGGGT0.409700.003500.844800.750000.962000.62500


Target Position: 4070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4070GUGGAUGGGUAAAGCAAAG70.71832081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9444088GTGGATGGGTAAAGCAAAGCTTTGCTTTACCCATCCAC0.044900.012200.655200.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892UCUAAAGUAUAUACAUUCA86.1809474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917910TCTAAAGTATATACATTCATGAATGTATATACTTTAGA0.616900.381000.500000.500001.000001.00000


Target Position: 3034, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034CUUGGUUUGGGGAGAAAUA83.7688656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3032-3054TTCTTGGTTTGGGGAGAAATAAAUAUUUCUCCCCAAACCAAGAACUUGGUUUGGGGAGAAAUAAAU14.818.832


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993UGGCUCGGCACACAGAUGA67.78272424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581011TGGCTCGGCACACAGATGATCATCTGTGTGCCGAGCCA0.159900.005900.620700.500001.000001.00000


Target Position: 3823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3823UAUAGGAUGUCAGACAAUA87.0369410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633841TATAGGATGTCAGACAATATATTGTCTGACATCCTATA0.247900.027500.500000.500001.000001.00000


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159AAUAUGUUUGUGCCUUAAA82.2907779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212177AATATGTTTGTGCCTTAAATTTAAGGCACAAACATATT0.061100.020500.508600.500001.000001.00000


Target Position: 2876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2876AGAAAUGCUGAAAAUCAAA88.399324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922894AGAAATGCTGAAAATCAAATTTGATTTTCAGCATTTCT0.361000.053500.724100.750001.000001.00000


Target Position: 4138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4138AGUGUAAGAGUGGCCGAAA83.7966654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5114156AGTGTAAGAGTGGCCGAAATTTCGGCCACTCTTACACT0.140000.057700.706900.750001.000001.00000


Target Position: 3769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3769GGGAAAUUGCUAUUUUAUU85.7809506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3003787GGGAAATTGCTATTTTATTAATAAAATAGCAATTTCCC0.255000.129200.982801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3767-3789GAGGGAAATTGCTATTTTATTTGAAUAAAAUAGCAAUUUCCCUCGGGAAAUUGCUAUUUUAUUUGU-10.314.232


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262GUAAUAAGAAAGUAUAAAG82.579756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713280GTAATAAGAAAGTATAAAGCTTTATACTTTCTTATTAC0.179900.104600.543100.500001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237CCAUGAGGCAAGAAACUAU91.4757161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601255CCATGAGGCAAGAAACTATATAGTTTCTTGCCTCATGG0.445600.007300.801701.000001.000001.00000


Target Position: 3777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3777GCUAUUUUAUUUGUAUUCA85.906492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313795GCTATTTTATTTGTATTCATGAATACAAATAAAATAGC0.182400.085700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3775-3797TTGCTATTTTATTTGTATTCATGUGAAUACAAAUAAAAUAGCAAGCUAUUUUAUUUGUAUUCAUGU16.1-4.311


Target Position: 2049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2049UCCCUCAGUGAUACGUACA72.22241896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222067TCCCTCAGTGATACGTACATGTACGTATCACTGAGGGA0.150600.032600.663800.500001.000001.00000


Target Position: 4328, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4328CAUAAAUAAAGUUUUAUGA89.122289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4326-4348TCCATAAATAAAGTTTTATGAGAUCAUAAAACUUUAUUUAUGGACAUAAAUAAAGUUUUAUGAGAU-1.4-8.011


Target Position: 4229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4229AUGGCUUUUACAUUUUUAA78.9741132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674247ATGGCTTTTACATTTTTAATTAAAAATGTAAAAGCCAT0.047900.002700.620700.500001.000001.00000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883UCAAUGCAAAGUAAAAAAA76.18361451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921901TCAATGCAAAGTAAAAAAATTTTTTTACTTTGCATTGA0.605800.351300.724100.750001.000001.00000


Target Position: 3846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3846UGGUUAAAAUAAAGCCUAU81.4413855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5053864TGGTTAAAATAAAGCCTATATAGGCTTTATTTTAACCA0.143400.036600.801700.750001.000001.00000


Target Position: 2722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722AGGAACAGGUGGAUGUAUA90.2757222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942740AGGAACAGGTGGATGTATATATACATCCACCTGTTCCT0.040800.014400.801700.750001.000001.00000


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873AGGAAUAUGUUCAAUGCAA91.6558153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601891AGGAATATGTTCAATGCAATTGCATTGAACATATTCCT0.124300.023800.698300.750001.000001.00000


Target Position: 2931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931UUGCUGUCUUUCUCUAAAU72.82321838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8922949TTGCTGTCTTTCTCTAAATATTTAGAGAAAGACAGCAA0.618300.175300.637900.500001.000001.00000


Target Position: 3818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3818UGCCGUAUAGGAUGUCAGA79.37631075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103836TGCCGTATAGGATGTCAGATCTGACATCCTATACGGCA0.329200.017000.629300.500001.000001.00000


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830GUGAAAUGUCAGAAGCUUA96.368536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774848GTGAAATGTCAGAAGCTTATAAGCTTCTGACATTTCAC0.115600.006600.758600.750001.000001.00000


Target Position: 4088, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4088GAGCAAAUGAACGAAGUAU86.5236449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5364106GAGCAAATGAACGAAGTATATACTTCGTTCATTTGCTC0.374200.068900.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4086-4108AAGAGCAAATGAACGAAGTATTAAUACUUCGUUCAUUUGCUCUUGAGCAAAUGAACGAAGUAUUAU20.918.522


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707AAACAUAUGAAACAUGAAA87.0332411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923725AAACATATGAAACATGAAATTTCATGTTTCATATGTTT0.312400.172600.500000.500000.978300.75000


Target Position: 3576, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3576GAUUUCCUACAGAAAUACU85.8632495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3574-3596GTGATTTCCTACAGAAATACTGCAGUAUUUCUGUAGGAAAUCACGAUUUCCUACAGAAAUACUGCU10.018.722


Target Position: 4076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4076GGGUAAAGCAAAGAGCAAA91.5585158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304094GGGTAAAGCAAAGAGCAAATTTGCTCTTTGCTTTACCC0.069000.020400.991401.000000.945700.87500


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886CCGAGGUCUAAAGUAUAUA87.5498373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348904CCGAGGTCTAAAGTATATATATATACTTTAGACCTCGG0.524500.043700.870701.000001.000001.00000


Target Position: 2754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2754UGCCAUCUGUUUUCAACCA76.32831425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642772TGCCATCTGTTTTCAACCATGGTTGAAAACAGATGGCA0.252200.014600.508600.500001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336GUCUCUCUUUCUCCCUCAC69.63562208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982354GTCTCTCTTTCTCCCTCACGTGAGGGAGAAAGAGAGAC0.278500.218000.525900.500001.000001.00000


Target Position: 3255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255CUUUUGUGUAAUAAGAAAG70.49912109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443273CTTTTGTGTAATAAGAAAGCTTTCTTATTACACAAAAG0.440400.050600.500000.500001.000001.00000


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009UGAUGAAAUGACAGGCUAC74.12591671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651027TGATGAAATGACAGGCTACGTAGCCTGTCATTTCATCA0.043600.044900.543100.500001.000001.00000


Target Position: 3596, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3596CUCUGAAUAUUUUGUAAUA96.759133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2223614CTCTGAATATTTTGTAATATATTACAAAATATTCAGAG0.325100.153600.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3594-3616TGCTCTGAATATTTTGTAATAAAUAUUACAAAAUAUUCAGAGCACUCUGAAUAUUUUGUAAUAAAU6.920.412


Target Position: 3923, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3923GCACAAUAUGGCAUUAUAU93.826292

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3921-3943ATGCACAATATGGCATTATATCAAUAUAAUGCCAUAUUGUGCAUGCACAAUAUGGCAUUAUAUCAU0.013.532


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131UGACUGGAAGAACAUUGUU74.25641652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631149TGACTGGAAGAACATTGTTAACAATGTTCTTCCAGTCA0.077000.007200.577600.750001.000001.00000


Target Position: 4253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4253UGGGAAAGAAAAAAAAAGA75.33631536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5944271TGGGAAAGAAAAAAAAAGATCTTTTTTTTTCTTTCCCA0.788400.340000.620700.500001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238CAUGAGGCAAGAAACUAUA92.147140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651256CATGAGGCAAGAAACTATATATAGTTTCTTGCCTCATG0.588700.010900.612100.750001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909UGUCCCCAAUCCCGGUCAU63.71052915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8501927TGTCCCCAATCCCGGTCATATGACCGGGATTGGGGACA0.046100.010300.551700.750000.929301.00000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124GGUUCUCAGAUCUUGACAG80.6643936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952142GGTTCTCAGATCTTGACAGCTGTCAAGATCTGAGAACC0.233500.037800.569000.750000.972800.62500


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110GCAUUGGGGCCUGUCUUAU76.86641357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9324128GCATTGGGGCCTGTCTTATATAAGACAGGCCCCAATGC0.037400.002900.810301.000001.000001.00000


Target Position: 4287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4287AGCAUGUGAUGUAAGUAAU85.378542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7294305AGCATGTGATGTAAGTAATATTACTTACATCACATGCT0.070900.066500.844800.750001.000001.00000


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914CCAAUCCCGGUCAUGCUUU68.31682362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431932CCAATCCCGGTCATGCTTTAAAGCATGACCGGGATTGG0.129300.035300.844801.000000.994600.62500


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GGAGAAGAUGCUUGUAUUG80.00631002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841354GGAGAAGATGCTTGTATTGCAATACAAGCATCTTCTCC0.043900.002200.724100.750001.000001.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997UCGGCACACAGAUGAUGAA82.6517750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621015TCGGCACACAGATGATGAATTCATCATCTGTGTGCCGA0.503200.046100.620700.750001.000001.00000


Target Position: 4324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4324UAUCCAUAAAUAAAGUUUU74.52561626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514342TATCCATAAATAAAGTTTTAAAACTTTATTTATGGATA0.140400.120200.543100.500001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729GGUGGAUGUAUAGCAUUUU84.2891610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952747GGTGGATGTATAGCATTTTAAAATGCTATACATCCACC0.080600.002000.853401.000001.000001.00000


Target Position: 3885, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885CUCAAGUUUAUUAUAUUUU76.73761371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1373903CTCAAGTTTATTATATTTTAAAATATAATAAACTTGAG0.490300.149300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3883-3905TTCTCAAGTTTATTATATTTTTCAAAAUAUAAUAAACUUGAGAACUCAAGUUUAUUAUAUUUUUCU-8.019.221


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134UCUUGACAGUAUAUUUGAA91.1241177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442152TCTTGACAGTATATTTGAATTCAAATATACTGTCAAGA0.265700.002700.551700.750001.000001.00000


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943UCUAAAUAUGAUUACUUUA86.4031458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642961TCTAAATATGATTACTTTATAAAGTAATCATATTTAGA0.123200.111400.689700.750001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459CUGUGUACUCUUUAUUUCU83.5644674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182477CTGTGTACTCTTTATTTCTAGAAATAAAGAGTACACAG0.286500.007200.560300.500001.000001.00000


Target Position: 2837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2837GAAACAAGUUAUUCUCUUC84.3407606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192855GAAACAAGTTATTCTCTTCGAAGAGAATAACTTGTTTC0.158600.027500.500000.500001.000001.00000


Target Position: 4284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4284UGUAGCAUGUGAUGUAAGU73.04611795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9524302TGTAGCATGTGATGTAAGTACTTACATCACATGCTACA0.169600.012600.500000.500001.000001.00000


Target Position: 4319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4319UCCAGUAUCCAUAAAUAAA85.9587488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4774337TCCAGTATCCATAAATAAATTTATTTATGGATACTGGA0.344300.029800.870700.750001.000001.00000


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453UACUUCCUGUGUACUCUUU71.76111952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862471TACTTCCTGTGTACTCTTTAAAGAGTACACAGGAAGTA0.054800.004000.681000.500001.000001.00000


Target Position: 2827, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827CCAAACUUCGGAAACAAGU67.88722407

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2825-2847TCCCAAACTTCGGAAACAAGTTAACUUGUUUCCGAAGUUUGGGACCAAACUUCGGAAACAAGUUAU10.310.333


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827GGAUGUCAGACAAUACCAC81.1715881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6513845GGATGTCAGACAATACCACGTGGTATTGTCTGACATCC0.118800.058800.577600.750001.000001.00000


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171CCUUAAAAGGAGAGAAGAA94.75268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3622189CCTTAAAAGGAGAGAAGAATTCTTCTCTCCTTTTAAGG0.287500.053900.672401.000000.994600.62500


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150GAAACUGUAAAUAUGUUUG76.04451465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182168GAAACTGTAAATATGTTTGCAAACATATTTACAGTTTC0.127600.012200.525900.500001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750AGACAAUAUGAACAAACUA94.054184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371768AGACAATATGAACAAACTATAGTTTGTTCATATTGTCT0.366100.013000.551700.750001.000001.00000


Target Position: 3998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3998CUAACAUUUAGAAAAUGUU82.4416764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3996-4018TCCTAACATTTAGAAAATGTTGAAACAUUUUCUAAAUGUUAGGACUAACAUUUAGAAAAUGUUGAU5.36.922


Target Position: 696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696UGCGGUUACUUAAACAUAU79.10451114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656714TGCGGTTACTTAAACATATATATGTTTAAGTAACCGCA0.423800.011200.810300.750001.000001.00000


Target Position: 3597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3597UCUGAAUAUUUUGUAAUAA83.9448641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3673615TCTGAATATTTTGTAATAATTATTACAAAATATTCAGA0.338300.173900.689700.750001.000001.00000


Target Position: 2031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031GCUUCAGACCUGACACCGU81.998810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452049GCTTCAGACCTGACACCGTACGGTGTCAGGTCTGAAGC0.075300.007800.577600.750000.962000.62500


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727CAGGUGGAUGUAUAGCAUU84.2842611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162745CAGGTGGATGTATAGCATTAATGCTATACATCCACCTG0.068300.003300.775900.750001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908UCAGCUGACAUAAUUCACA79.19751099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849926TCAGCTGACATAATTCACATGTGAATTATGTCAGCTGA0.081800.038100.517200.500001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640GAAGCUCUCCAGACCAUUU88.7359312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649658GAAGCTCTCCAGACCATTTAAATGGTCTGGAGAGCTTC0.091100.026600.672400.750000.978300.87500


Target Position: 3571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3571CGUGUGAUUUCCUACAGAA101.355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403589CGTGTGATTTCCTACAGAATTCTGTAGGAAATCACACG0.035700.005700.603401.000001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272AGAUGCCGAAGAUGAACUU76.49771398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441290AGATGCCGAAGATGAACTTAAGTTCATCTTCGGCATCT0.082300.004500.586200.750001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405UGCUCAGUACCACGAUCCU71.29412002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721423TGCTCAGTACCACGATCCTAGGATCGTGGTACTGAGCA0.080400.018300.508600.500001.000001.00000


Target Position: 2938, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938CUUUCUCUAAAUAUGAUUA91.2274171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6102956CTTTCTCTAAATATGATTATAATCATATTTAGAGAAAG0.164900.118800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2936-2958GTCTTTCTCTAAATATGATTACTUAAUCAUAUUUAGAGAAAGACCUUUCUCUAAAUAUGAUUACUU8.719.122


Target Position: 3881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3881GUUUCUCAAGUUUAUUAUA93.0106112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143899GTTTCTCAAGTTTATTATATATAATAAACTTGAGAAAC0.415200.107800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3879-3901GAGTTTCTCAAGTTTATTATATTUAUAAUAAACUUGAGAAACUCGUUUCUCAAGUUUAUUAUAUUU-8.020.421


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186GAAGUGUCGUUUUCAUAAC76.84491360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953204GAAGTGTCGTTTTCATAACGTTATGAAAACGACACTTC0.040700.003800.525900.500001.000001.00000


Target Position: 815, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815GAUCUGAACAACAUUGUGA92.3492130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
813-835CAGATCTGAACAACATTGTGAAAUCACAAUGUUGUUCAGAUCUGGAUCUGAACAACAUUGUGAAAU18.120.432


Target Position: 4266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4266AAAAGAAGUAGUAGAUUUU83.2766702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9104284AAAAGAAGTAGTAGATTTTAAAATCTACTACTTCTTTT0.316100.265000.500000.500001.000001.00000


Target Position: 3763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3763GAAUGAGGGAAAUUGCUAU91.6154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653781GAATGAGGGAAATTGCTATATAGCAATTTCCCTCATTC0.219600.004100.629300.750001.000001.00000


Target Position: 2933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2933GCUGUCUUUCUCUAAAUAU86.8165427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1172951GCTGTCTTTCTCTAAATATATATTTAGAGAAAGACAGC0.564600.162800.810301.000001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458CCUGUGUACUCUUUAUUUC74.74891609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512476CCTGTGTACTCTTTATTTCGAAATAAAGAGTACACAGG0.233200.007600.672400.750001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132GACUGGAAGAACAUUGUUU87.3539388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191150GACTGGAAGAACATTGTTTAAACAATGTTCTTCCAGTC0.056500.005000.819000.750001.000001.00000


Target Position: 3723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3723CUCCCAUCUCCUGAUUUCU71.89651938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583741CTCCCATCTCCTGATTTCTAGAAATCAGGAGATGGGAG0.039400.022700.586200.500001.000001.00000


Target Position: 3879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3879GAGUUUCUCAAGUUUAUUA97.684623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4583897GAGTTTCTCAAGTTTATTATAATAAACTTGAGAAACTC0.268600.107300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3877-3899GTGAGTTTCTCAAGTTTATTATAUAAUAAACUUGAGAAACUCACGAGUUUCUCAAGUUUAUUAUAU-0.317.722


Target Position: 4024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024CUUCUUAGUUGUACAUUUU84.9739566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7674042CTTCTTAGTTGTACATTTTAAAATGTACAACTAAGAAG0.067900.007100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4022-4044AGCTTCTTAGTTGTACATTTTTTAAAAUGUACAACUAAGAAGCUCUUCUUAGUUGUACAUUUUUUU6.911.731


Target Position: 3841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3841ACCACUGGUUAAAAUAAAG69.57092214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213859ACCACTGGTTAAAATAAAGCTTTATTTTAACCAGTGGT0.228700.013400.715500.500001.000001.00000


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898UAUUUUUCUCUUGUUUUUA75.4971519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913916TATTTTTCTCTTGTTTTTATAAAAACAAGAGAAAAATA0.368100.215200.508600.500001.000001.00000


Target Position: 3561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3561UGUAAAUGCUCGUGUGAUU79.90861016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5433579TGTAAATGCTCGTGTGATTAATCACACGAGCATTTACA0.161000.040100.698300.750001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489AGGAGAGGCCCACGUUCUA82.6278753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
987507AGGAGAGGCCCACGTTCTATAGAACGTGGGCCTCTCCT0.186700.002200.672400.750000.967400.75000


Target Position: 1349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349GUAUUGGACUCAGAUAAGA87.39387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1347-1369TTGTATTGGACTCAGATAAGAGAUCUUAUCUGAGUCCAAUACAAGUAUUGGACUCAGAUAAGAGAU11.621.233


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926AGGGACCUAAAACCUAGUA77.41081287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874944AGGGACCTAAAACCTAGTATACTAGGTTTTAGGTCCCT0.042700.022700.663800.750000.978300.75000


Target Position: 3235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3235GAGGACUCAUAUAUUUAAG81.1556883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7493253GAGGACTCATATATTTAAGCTTAAATATATGAGTCCTC0.127900.007900.672400.500001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093UGCACUAGCCUGUGAUUAA88.1911335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852111TGCACTAGCCTGTGATTAATTAATCACAGGCTAGTGCA0.041900.032700.819000.750000.929300.75000


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440UCUUGAUGUCAUGUACUUC67.34452483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782458TCTTGATGTCATGTACTTCGAAGTACATGACATCAAGA0.074800.013000.551700.500001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571GGUUUCUGUUCUGUUGAUC69.82282190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591589GGTTTCTGTTCTGTTGATCGATCAACAGAACAGAAACC0.124400.019700.672400.750001.000001.00000


Target Position: 3249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3249UUAAGCCUUUUGUGUAAUA76.07381460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923267TTAAGCCTTTTGTGTAATATATTACACAAAAGGCTTAA0.239600.012100.491400.500001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745GGGUAAGACAAUAUGAACA95.15864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441763GGGTAAGACAATATGAACATGTTCATATTGTCTTACCC0.255100.007800.784500.750001.000001.00000


Target Position: 3660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3660CUCUGGAAGCCUGGACUCU70.11142150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693678CTCTGGAAGCCTGGACTCTAGAGTCCAGGCTTCCAGAG0.075500.003400.586200.500000.962000.62500


Target Position: 2871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2871UGCUAAGAAAUGCUGAAAA81.3842862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022889TGCTAAGAAATGCTGAAAATTTTCAGCATTTCTTAGCA0.107800.047900.853400.750000.951100.75000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375CUGCUUACCCUUCACCUUU74.13431668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272393CTGCTTACCCTTCACCTTTAAAGGTGAAGGGTAAGCAG0.582000.020600.784500.750001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178AGGAGAGAAGAAAGUGUAG73.81641714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232196AGGAGAGAAGAAAGTGTAGCTACACTTTCTTCTCTCCT0.328100.117400.672400.500001.000001.00000


Target Position: 2937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937UCUUUCUCUAAAUAUGAUU68.84272306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632955TCTTTCTCTAAATATGATTAATCATATTTAGAGAAAGA0.189600.090500.715500.750001.000001.00000


Target Position: 3229, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229CUACAUGAGGACUCAUAUA96.428835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3227-3249TTCTACATGAGGACTCATATATTUAUAUGAGUCCUCAUGUAGAACUACAUGAGGACUCAUAUAUUU13.321.533


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698CGGUUACUUAAACAUAUGA88.8026307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453716CGGTTACTTAAACATATGATCATATGTTTAAGTAACCG0.407900.027800.689700.750001.000001.00000


Target Position: 1620, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620CGGGAACUCUCCAAAUAUU89.1466286

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9162019CGGGAACTCTCCAAATATT1/1/0/097.21MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36076280..36076298(+)00MAPK14(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851638CGGGAACTCTCCAAATATTAATATTTGGAGAGTTCCCG0.393000.037400.905201.000000.923900.75000


Target Position: 3403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3403GCAAGAAGGAAGGAGGCAG68.48822348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923421GCAAGAAGGAAGGAGGCAGCTGCCTCCTTCCTTCTTGC0.079600.067000.569000.750001.000001.00000


Target Position: 3015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3015GGCAGCUUAACAUUGACUU78.01811225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3363033GGCAGCTTAACATTGACTTAAGTCAATGTTAAGCTGCC0.232400.086600.862101.000001.000001.00000


Target Position: 3057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057UUGUUUCAGAAUUUUGUAU67.1312504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143075TTGTTTCAGAATTTTGTATATACAAAATTCTGAAACAA0.104300.003300.603400.500001.000001.00000


Target Position: 3880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3880AGUUUCUCAAGUUUAUUAU78.79381147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973898AGTTTCTCAAGTTTATTATATAATAAACTTGAGAAACT0.407600.107700.663800.750001.000001.00000


Target Position: 2752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2752CAUGCCAUCUGUUUUCAAC75.45371522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732770CATGCCATCTGTTTTCAACGTTGAAAACAGATGGCATG0.043000.010400.508600.500001.000001.00000


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889AUCAAAGUAAAAAAUUAAA79.74531034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892907ATCAAAGTAAAAAATTAAATTTAATTTTTTACTTTGAT0.664000.278800.681000.500001.000001.00000


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269CUCAGAUGCCGAAGAUGAA91.3123168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901287CTCAGATGCCGAAGATGAATTCATCTTCGGCATCTGAG0.029200.002600.637900.750000.945700.62500


Target Position: 2860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860CCAAUAACUAAUGCUAAGA81.0496896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632878CCAATAACTAATGCTAAGATCTTAGCATTAGTTATTGG0.281700.122200.620700.750000.967400.87500


Target Position: 4069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4069UGUGGAUGGGUAAAGCAAA83.3238699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8454087TGTGGATGGGTAAAGCAAATTTGCTTTACCCATCCACA0.047000.013800.706900.750001.000001.00000


Target Position: 4289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289CAUGUGAUGUAAGUAAUGU82.7891737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4287-4309AGCATGTGATGTAAGTAATGTAAACAUUACUUACAUCACAUGCUCAUGUGAUGUAAGUAAUGUAAU11.620.533


Target Position: 2863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2863AUAACUAAUGCUAAGAAAU79.17991104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272881ATAACTAATGCTAAGAAATATTTCTTAGCATTAGTTAT0.570800.057400.534500.500000.967400.62500


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751UCAUGCCAUCUGUUUUCAA81.8886820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872769TCATGCCATCTGTTTTCAATTGAAAACAGATGGCATGA0.041500.011900.577600.750001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374UCUGCUUACCCUUCACCUU68.84132307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232392TCTGCTTACCCTTCACCTTAAGGTGAAGGGTAAGCAGA0.650400.057400.586200.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414CCACGAUCCUGAUGAUGAA99.41711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461432CCACGATCCTGATGATGAATTCATCATCAGGATCGTGG0.226300.018500.672401.000001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184GAAGAAAGUGUAGAUAGUU89.6008254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292202GAAGAAAGTGTAGATAGTTAACTATCTACACTTTCTTC0.290500.211500.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2182-2204GAGAAGAAAGTGTAGATAGTTAAAACUAUCUACACUUUCUUCUCGAAGAAAGUGUAGAUAGUUAAU18.910.323


Target Position: 3014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3014UGGCAGCUUAACAUUGACU70.03182163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373032TGGCAGCTTAACATTGACTAGTCAATGTTAAGCTGCCA0.262000.098300.637900.500001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915CAAUCCCGGUCAUGCUUUU78.21321198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111933CAATCCCGGTCATGCTTTTAAAAGCATGACCGGGATTG0.167900.037700.646600.750001.000001.00000


Target Position: 4246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4246AAAUGGUUGGGAAAGAAAA84.3669605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9364264AAATGGTTGGGAAAGAAAATTTTCTTTCCCAACCATTT0.512300.033100.500000.500001.000001.00000


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210UGCAGCUGCUGAAGUUCUG61.76183123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862228TGCAGCTGCTGAAGTTCTGCAGAACTTCAGCAGCTGCA0.259700.002200.569000.500000.956500.75000


Target Position: 2674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674GAACACAAUUGAUACUUCA97.146327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694TTGAACACAATTGATACTTCAGGUGAAGUAUCAAUUGUGUUCAAGAACACAAUUGAUACUUCAGGU14.519.313


Target Position: 3199, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3199CAUAACUUGCUGAAUUUCA86.1439478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3197-3219TTCATAACTTGCTGAATTTCAGGUGAAAUUCAGCAAGUUAUGAACAUAACUUGCUGAAUUUCAGGU10.44.622


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33CCAUAUUGGGUAAAAUCUC70.94522042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80951CCATATTGGGTAAAATCTCGAGATTTTACCCAATATGG0.088400.008800.534500.750001.000001.00000


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724UCCCAUCUCCUGAUUUCUC58.29143453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9463742TCCCATCTCCTGATTTCTCGAGAAATCAGGAGATGGGA0.034300.018800.560300.500001.000001.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493UGUUUUGCACGUCUUGCUA78.73881153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482511TGTTTTGCACGTCTTGCTATAGCAAGACGTGCAAAACA0.072600.002700.534500.750000.913000.75000


Target Position: 2454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454ACUUCCUGUGUACUCUUUA82.2202788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162472ACTTCCTGTGTACTCTTTATAAAGAGTACACAGGAAGT0.071500.005200.672400.750001.000001.00000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207CCCCGCUUAUCUCAUUAAC64.75682769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921225CCCCGCTTATCTCATTAACGTTAATGAGATAAGCGGGG0.111700.034200.844800.750001.000001.00000


Target Position: 3848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3848GUUAAAAUAAAGCCUAUUU79.79081025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513866GTTAAAATAAAGCCTATTTAAATAGGCTTTATTTTAAC0.151600.065900.646600.750001.000001.00000


Target Position: 4136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4136CGAGUGUAAGAGUGGCCGA85.1367554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154154CGAGTGTAAGAGTGGCCGATCGGCCACTCTTACACTCG0.105600.036100.500000.750001.000001.00000


Target Position: 3929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3929UAUGGCAUUAUAUCAAUAU77.20791312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9513947TATGGCATTATATCAATATATATTGATATAATGCCATA0.489200.062000.500000.500001.000001.00000


Target Position: 3122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3122GGGCAAAUUAUUUUAAUAU89.7399249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6093140GGGCAAATTATTTTAATATATATTAAAATAATTTGCCC0.106300.024900.948301.000001.000001.00000


Target Position: 4323, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4323GUAUCCAUAAAUAAAGUUU81.6546839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3834341GTATCCATAAATAAAGTTTAAACTTTATTTATGGATAC0.203300.170300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4321-4343CAGTATCCATAAATAAAGTTTTAAAACUUUAUUUAUGGAUACUGGUAUCCAUAAAUAAAGUUUUAU4.921.211


Target Position: 3854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3854AUAAAGCCUAUUUUUCAAA77.66731263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243872ATAAAGCCTATTTTTCAAATTTGAAAAATAGGCTTTAT0.236800.051900.543100.500001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GCUCUCCAGACCAUUUCAG67.70732434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677661GCTCTCCAGACCATTTCAGCTGAAATGGTCTGGAGAGC0.233700.044900.569000.750001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392CACAUGCCUACUUUGCUCA83.0259721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721410CACATGCCTACTTTGCTCATGAGCAAAGTAGGCATGTG0.204700.049300.569000.500000.983700.87500


Target Position: 3143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143UGUAUUUUCAACUUUAUAA85.6239524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3523161TGTATTTTCAACTTTATAATTATAAAGTTGAAAATACA0.399000.068000.672400.750001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882UUCAAUGCAAAGUAAAAAA73.91051705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421900TTCAATGCAAAGTAAAAAATTTTTTACTTTGCATTGAA0.694200.201300.672400.500001.000001.00000


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653CCCCUAGUGCUAUUCUGUG70.80112074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482671CCCCTAGTGCTATTCTGTGCACAGAATAGCACTAGGGG0.033900.005500.698300.750001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124GAGCUGUUGACUGGAAGAA85.8465496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051142GAGCTGTTGACTGGAAGAATTCTTCCAGTCAACAGCTC0.067900.005500.637900.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GCUGUGAAUGAAGACUGUG72.45981871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711968GCTGTGAATGAAGACTGTGCACAGTCTTCATTCACAGC0.238200.009300.560300.750001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988UGGACUGGCUCGGCACACA76.57271387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951006TGGACTGGCTCGGCACACATGTGTGCCGAGCCAGTCCA0.031100.002100.637900.500001.000001.00000


Target Position: 2168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168GUGCCUUAAAAGGAGAGAA84.1501620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562186GTGCCTTAAAAGGAGAGAATTCTCTCCTTTTAAGGCAC0.138700.020300.620700.750000.972800.87500


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996CUCGGCACACAGAUGAUGA83.316700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891014CTCGGCACACAGATGATGATCATCATCTGTGTGCCGAG0.455800.024600.586200.500001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867CCUUUUAGGAAUAUGUUCA86.0167485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521885CCTTTTAGGAATATGTTCATGAACATATTCCTAAAAGG0.134900.007600.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1865-1887GTCCTTTTAGGAATATGTTCAATUGAACAUAUUCCUAAAAGGACCCUUUUAGGAAUAUGUUCAAUU16.11.322


Target Position: 4254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4254GGGAAAGAAAAAAAAAGAA91.1383175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1064272GGGAAAGAAAAAAAAAGAATTCTTTTTTTTTCTTTCCC0.788400.340400.819001.000001.000001.00000


Target Position: 3053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3053AAUUUUGUUUCAGAAUUUU73.69721729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673071AATTTTGTTTCAGAATTTTAAAATTCTGAAACAAAATT0.152600.004900.508600.500001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GGUUACUUAAACAUAUGAA97.031129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342717GGTTACTTAAACATATGAATTCATATGTTTAAGTAACC0.406600.044300.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
697-719GCGGTTACTTAAACATATGAAACUUCAUAUGUUUAAGUAACCGCGGUUACUUAAACAUAUGAAACU14.912.932


Target Position: 3725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CCCAUCUCCUGAUUUCUCU74.35551647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993743CCCATCTCCTGATTTCTCTAGAGAAATCAGGAGATGGG0.040000.018100.767200.750001.000001.00000


Target Position: 3732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732CCUGAUUUCUCUGAACAGA84.0944630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293750CCTGATTTCTCTGAACAGATCTGTTCAGAGAAATCAGG0.047500.003000.620700.750000.951100.62500


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204ACCCCCCGCUUAUCUCAUU66.08952611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081222ACCCCCCGCTTATCTCATTAATGAGATAAGCGGGGGGT0.106300.026200.844800.750001.000001.00000


Target Position: 2928, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2928CUUUUGCUGUCUUUCUCUA88.6872313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2926-2948TCCTTTTGCTGTCTTTCTCTAAAUAGAGAAAGACAGCAAAAGGACUUUUGCUGUCUUUCUCUAAAU19.118.623


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CUGGUUUCUGUUCUGUUGA75.91011481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001587CTGGTTTCTGTTCTGTTGATCAACAGAACAGAAACCAG0.077100.009700.560300.500001.000001.00000


Target Position: 2055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055AGUGAUACGUACAGCCAAA93.844590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752073AGTGATACGTACAGCCAAATTTGGCTGTACGTATCACT0.059300.031400.706900.750001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145UAUUUGAAACUGUAAAUAU83.919645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162163TATTTGAAACTGTAAATATATATTTACAGTTTCAAATA0.111400.021800.500000.500001.000001.00000


Target Position: 3978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3978GACAGAUCUUAAUACUACU94.371174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943996GACAGATCTTAATACTACTAGTAGTATTAAGATCTGTC0.807800.208300.612100.500001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004AGGGUCUUCUUGGCAGCUU65.53922682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583022AGGGTCTTCTTGGCAGCTTAAGCTGCCAAGAAGACCCT0.065400.002600.706900.750001.000001.00000


Target Position: 4269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4269AGAAGUAGUAGAUUUUGUA95.307558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7764287AGAAGTAGTAGATTTTGTATACAAAATCTACTACTTCT0.303800.270400.543100.750001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889AGGUCUAAAGUAUAUACAU90.5193205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473907AGGTCTAAAGTATATACATATGTATATACTTTAGACCT0.682200.100700.689700.750001.000001.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357CUCAGAUAAGAGAAUUACA92.7061115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041375CTCAGATAAGAGAATTACATGTAATTCTCTTATCTGAG0.064800.014500.603400.500000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1355-1377GACTCAGATAAGAGAATTACAGCUGUAAUUCUCUUAUCUGAGUCCUCAGAUAAGAGAAUUACAGCU10.021.421


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335CGUCUCUCUUUCUCCCUCA87.5681372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382353CGTCTCTCTTTCTCCCTCATGAGGGAGAAAGAGAGACG0.286300.176900.551700.750001.000001.00000


Target Position: 4245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4245UAAAUGGUUGGGAAAGAAA79.70641037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8854263TAAATGGTTGGGAAAGAAATTTCTTTCCCAACCATTTA0.502800.032300.534500.500001.000001.00000


Target Position: 3977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3977UGACAGAUCUUAAUACUAC77.11981322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063995TGACAGATCTTAATACTACGTAGTATTAAGATCTGTCA0.778700.193500.543100.500001.000001.00000


Target Position: 3744, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3744GAACAGAAAACAAAAGAGA88.8254305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3742-3764CTGAACAGAAAACAAAAGAGAGAUCUCUUUUGUUUUCUGUUCAGGAACAGAAAACAAAAGAGAGAU10.319.221


Target Position: 3019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3019GCUUAACAUUGACUUCUUG79.63161044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003037GCTTAACATTGACTTCTTGCAAGAAGTCAATGTTAAGC0.054200.043900.706900.750001.000001.00000


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947AAUAUGAUUACUUUAAAAU81.3198867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042965AATATGATTACTTTAAAATATTTTAAAGTAATCATATT0.106800.071800.500000.500001.000001.00000


Target Position: 3826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3826AGGAUGUCAGACAAUACCA86.6098440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433844AGGATGTCAGACAATACCATGGTATTGTCTGACATCCT0.167400.056200.500000.500001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815UCCACCUUGCUCUUCUUUC52.68783835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441833TCCACCTTGCTCTTCTTTCGAAAGAAGAGCAAGGTGGA0.048000.051500.698300.500001.000001.00000


Target Position: 3495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495UCUCCUUUAUUGCAGUUCA78.10771216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183513TCTCCTTTATTGCAGTTCATGAACTGCAATAAAGGAGA0.410600.056100.500000.500000.962000.75000


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924ACUCCUUUUGCUGUCUUUC57.23973543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082942ACTCCTTTTGCTGTCTTTCGAAAGACAGCAAAAGGAGT0.271300.099600.534500.500001.000001.00000


Target Position: 2187, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187GAAAGUGUAGAUAGUUAAA98.762713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3302205GAAAGTGTAGATAGTTAAATTTAACTATCTACACTTTC0.397900.242700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2185-2207AAGAAAGTGTAGATAGTTAAAAGUUUAACUAUCUACACUUUCUUGAAAGUGUAGAUAGUUAAAAGU6.617.822


Target Position: 2702, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702GAUGUGAAAAUCAUGAAAA95.700751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982720GATGTGAAAATCATGAAAATTTTCATGATTTTCACATC0.115500.014200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2700-2722TTGATGTGAAAATCATGAAAAGAUUUUCAUGAUUUUCACAUCAAGAUGUGAAAAUCAUGAAAAGAU13.820.512


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840ACAAGUUAUUCUCUUCACU77.8991234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012858ACAAGTTATTCTCTTCACTAGTGAAGAGAATAACTTGT0.715700.021300.500000.500001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154CUUUAUAAAGAUAAAAUAU89.1469285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093172CTTTATAAAGATAAAATATATATTTTATCTTTATAAAG0.076000.055900.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3152-3174AACTTTATAAAGATAAAATATCCAUAUUUUAUCUUUAUAAAGUUCUUUAUAAAGAUAAAAUAUCCU-7.5-7.521


Target Position: 4248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4248AUGGUUGGGAAAGAAAAAA70.66932088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6434266ATGGTTGGGAAAGAAAAAATTTTTTCTTTCCCAACCAT0.535400.037400.655200.500001.000001.00000


Target Position: 2872, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872GCUAAGAAAUGCUGAAAAU89.3862267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552890GCTAAGAAATGCTGAAAATATTTTCAGCATTTCTTAGC0.089600.057800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2870-2892ATGCTAAGAAATGCTGAAAATCAAUUUUCAGCAUUUCUUAGCAUGCUAAGAAAUGCUGAAAAUCAU12.211.722


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653CCAUUUCAGUCCAUCAUUC75.65031502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487671CCATTTCAGTCCATCATTCGAATGATGGACTGAAATGG0.289300.093000.672400.750001.000001.00000


Target Position: 4293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4293UGAUGUAAGUAAUGUAAAA94.902567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8674311TGATGTAAGTAATGTAAAATTTTACATTACTTACATCA0.043700.019700.724100.750001.000001.00000


Target Position: 973, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973GAAGAUUCUGGAUUUUGGA85.4309540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
971-993CTGAAGATTCTGGATTTTGGACTUCCAAAAUCCAGAAUCUUCAGGAAGAUUCUGGAUUUUGGACUU11.314.802


Target Position: 3875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3875UAGUGAGUUUCUCAAGUUU80.0945989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8483893TAGTGAGTTTCTCAAGTTTAAACTTGAGAAACTCACTA0.150400.008700.672400.500000.923900.87500


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367CCAUUUCUCUGCUUACCCU82.7404743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372385CCATTTCTCTGCTTACCCTAGGGTAAGCAGAGAAATGG0.202100.164400.500000.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327UAUAUGUGCGUCUCUCUUU75.62011508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9502345TATATGTGCGTCTCTCTTTAAAGAGAGACGCACATATA0.836000.028400.543100.500001.000001.00000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913CCCAAUCCCGGUCAUGCUU66.03732618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6001931CCCAATCCCGGTCATGCTTAAGCATGACCGGGATTGGG0.108200.033200.853401.000000.934800.62500


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851UCUUCACUCCCAAUAACUA85.8056499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322869TCTTCACTCCCAATAACTATAGTTATTGGGAGTGAAGA0.408400.207100.551700.750001.000001.00000


Target Position: 1322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1322GCUGUCGACUUGCUGGAGA80.252975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871340GCTGTCGACTTGCTGGAGATCTCCAGCAAGTCGACAGC0.057000.006300.629300.750001.000001.00000


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181GUGGAGAAGUGUCGUUUUC68.35842360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273199GTGGAGAAGTGTCGTTTTCGAAAACGACACTTCTCCAC0.056000.003200.620700.500001.000001.00000


Target Position: 2848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2848UUCUCUUCACUCCCAAUAA78.02931223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7342866TTCTCTTCACTCCCAATAATTATTGGGAGTGAAGAGAA0.332400.135700.637900.500001.000001.00000


Target Position: 942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942GUAAUCUAGCUGUGAAUGA84.0949629

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
940-962TAGTAATCTAGCTGTGAATGAAGUCAUUCACAGCUAGAUUACUAGUAAUCUAGCUGUGAAUGAAGU20.58.422


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326GUAUAUGUGCGUCUCUCUU84.103627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522344GTATATGTGCGTCTCTCTTAAGAGAGACGCACATATAC0.627900.022800.543100.750001.000001.00000


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129UCAGAUCUUGACAGUAUAU80.0806992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212147TCAGATCTTGACAGTATATATATACTGTCAAGATCTGA0.037700.013900.681000.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769ACCAACUAUUUUUGAGGAA76.93521346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5762787ACCAACTATTTTTGAGGAATTCCTCAAAAATAGTTGGT0.118000.069000.681000.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282GAUGAACUUUGCGAAUGUA97.046328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661300GATGAACTTTGCGAATGTATACATTCGCAAAGTTCATC0.090500.013500.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1280-1302AAGATGAACTTTGCGAATGTATTUACAUUCGCAAAGUUCAUCUUGAUGAACUUUGCGAAUGUAUUU21.119.233


Target Position: 1881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881GUUCAAUGCAAAGUAAAAA86.5636446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831899GTTCAATGCAAAGTAAAAATTTTTACTTTGCATTGAAC0.694500.076100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1879-1901ATGTTCAATGCAAAGTAAAAAAAUUUUUACUUUGCAUUGAACAUGUUCAAUGCAAAGUAAAAAAAU4.913.822


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901UAUACAUUCAGCUGACAUA89.5583257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
935919TATACATTCAGCTGACATATATGTCAGCTGAATGTATA0.363400.255300.500000.500001.000001.00000


Target Position: 3261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261UGUAAUAAGAAAGUAUAAA82.8616732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2673279TGTAATAAGAAAGTATAAATTTATACTTTCTTATTACA0.526200.266000.706900.750001.000001.00000


Target Position: 2211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211GCAGCUGCUGAAGUUCUGA83.4152687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432229GCAGCTGCTGAAGTTCTGATCAGAACTTCAGCAGCTGC0.108200.002700.629300.750001.000001.00000


Target Position: 3180, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3180GGUGGAGAAGUGUCGUUUU87.4459384

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5318019GGTGGAGAAGTGTCGTTTT1/1/0/097.75MAPK14NM_139014.2+NM_001315.2+NM_139012.2+NM_139013.21+1+1+0NANANA6:36077840..36077858(+)00MAPK14(0.002)


Target Position: 4089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4089AGCAAAUGAACGAAGUAUU78.41641179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2754107AGCAAATGAACGAAGTATTAATACTTCGTTCATTTGCT0.355900.270200.844800.750001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577UGUUCUGUUGAUCCCACUU72.40451876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241595TGTTCTGTTGATCCCACTTAAGTGGGATCAACAGAACA0.087700.008700.569000.750001.000001.00000


Target Position: 3081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081AGGAAUCCUUUGAGAAUGU74.64871618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763099AGGAATCCTTTGAGAATGTACATTCTCAAAGGATTCCT0.156900.007900.637900.500000.989100.75000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471GGACCUCCUUAUAGAUGAG84.1041626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261489GGACCTCCTTATAGATGAGCTCATCTATAAGGAGGTCC0.357700.004900.560300.750000.956500.62500


Target Position: 3410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3410GGAAGGAGGCAGACUGAUG80.3128971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923428GGAAGGAGGCAGACTGATGCATCAGTCTGCCTCCTTCC0.040900.012500.715500.750001.000001.00000


Target Position: 3118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3118GAAAGGGCAAAUUAUUUUA90.3696211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6603136GAAAGGGCAAATTATTTTATAAAATAATTTGCCCTTTC0.140600.011000.637900.750001.000001.00000


Target Position: 4292, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4292GUGAUGUAAGUAAUGUAAA91.095178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4934310GTGATGTAAGTAATGTAAATTTACATTACTTACATCAC0.887000.023300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4290-4312ATGTGATGTAAGTAATGTAAAACUUUACAUUACUUACAUCACAUGUGAUGUAAGUAAUGUAAAACU6.921.523


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286AACUUUGCGAAUGUAUUUA76.8881352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391304AACTTTGCGAATGTATTTATAAATACATTCGCAAAGTT0.116400.044100.612100.500001.000001.00000


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327CGACUUGCUGGAGAAGAUG70.32262128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331345CGACTTGCTGGAGAAGATGCATCTTCTCCAGCAAGTCG0.091100.002900.637900.750001.000001.00000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624UACGUGUGGCAGUGAAGAA84.0479635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999642TACGTGTGGCAGTGAAGAATTCTTCACTGCCACACGTA0.026900.006400.508600.500001.000001.00000


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377GCUUACCCUUCACCUUUGG57.82223496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492395GCTTACCCTTCACCTTTGGCCAAAGGTGAAGGGTAAGC0.033800.037700.508600.500001.000001.00000


Target Position: 4140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4140UGUAAGAGUGGCCGAAAUG62.96672985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8334158TGTAAGAGTGGCCGAAATGCATTTCGGCCACTCTTACA0.256400.077000.551700.500001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278CGAAGAUGAACUUUGCGAA94.369775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691296CGAAGATGAACTTTGCGAATTCGCAAAGTTCATCTTCG0.181700.002400.620701.000001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864AGUUCCUUAUCUACCAAAU81.253876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475882AGTTCCTTATCTACCAAATATTTGGTAGATAAGGAACT0.486300.241900.698300.750001.000001.00000


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123CGAGCUGUUGACUGGAAGA88.8152306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021141CGAGCTGTTGACTGGAAGATCTTCCAGTCAACAGCTCG0.077400.003400.569000.750001.000001.00000


Target Position: 715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715GAAACAUGAAAAUGUGAUU87.0708406

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
713-735ATGAAACATGAAAATGTGATTGGAAUCACAUUUUCAUGUUUCAUGAAACAUGAAAAUGUGAUUGGU20.512.122


Target Position: 3489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3489GCCUCAUCUCCUUUAUUGC68.30052366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7033507GCCTCATCTCCTTTATTGCGCAATAAAGGAGATGAGGC0.078500.036700.646600.500001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100GCCUGUGAUUAACUUGCUU83.1904712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072118GCCTGTGATTAACTTGCTTAAGCAAGTTAATCACAGGC0.075500.005500.862101.000001.000001.00000


Target Position: 2140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140CAGUAUAUUUGAAACUGUA102.3322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2138-2160GACAGTATATTTGAAACTGTAAAUACAGUUUCAAAUAUACUGUCCAGUAUAUUUGAAACUGUAAAU17.86.112


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457UCCUGUGUACUCUUUAUUU76.83831361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652475TCCTGTGTACTCTTTATTTAAATAAAGAGTACACAGGA0.223700.007200.870700.750001.000001.00000


Target Position: 4022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4022AGCUUCUUAGUUGUACAUU71.22312010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8354040AGCTTCTTAGTTGTACATTAATGTACAACTAAGAAGCT0.048400.008500.844800.750001.000001.00000


Target Position: 3820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3820CCGUAUAGGAUGUCAGACA89.8154244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803838CCGTATAGGATGTCAGACATGTCTGACATCCTATACGG0.388500.024900.706900.750001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670CCAUGGUGGAAGGGGGUGU61.73843126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771688CCATGGTGGAAGGGGGTGTACACCCCCTTCCACCATGG0.157500.040200.637900.750001.000001.00000


Target Position: 3868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3868UCAAAUUUAGUGAGUUUCU67.55532456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703886TCAAATTTAGTGAGTTTCTAGAAACTCACTAAATTTGA0.030700.013000.500000.500001.000001.00000


Target Position: 3933, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3933GCAUUAUAUCAAUAUCCUU93.528799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2173951GCATTATATCAATATCCTTAAGGATATTGATATAATGC0.551900.113100.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3931-3953TGGCATTATATCAATATCCTTTAAAGGAUAUUGAUAUAAUGCCAGCAUUAUAUCAAUAUCCUUUAU19.90.022


Target Position: 2671, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2671GUUGAACACAAUUGAUACU79.8251022

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2669-2691GTGTTGAACACAATTGATACTTCAGUAUCAAUUGUGUUCAACACGUUGAACACAAUUGAUACUUCU16.120.512


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068UUUUGUAUAUUGUAGGAAU78.97751131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983086TTTTGTATATTGTAGGAATATTCCTACAATATACAAAA0.061100.037300.491400.500001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746GGUAAGACAAUAUGAACAA95.778948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071764GGTAAGACAATATGAACAATTGTTCATATTGTCTTACC0.254600.034700.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1744-1766AGGGTAAGACAATATGAACAAACUUGUUCAUAUUGUCUUACCCUGGUAAGACAAUAUGAACAAACU20.521.432


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273GAUGCCGAAGAUGAACUUU77.28981301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401291GATGCCGAAGATGAACTTTAAAGTTCATCTTCGGCATC0.110300.004600.681000.750001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884CAAUGCAAAGUAAAAAAAU84.0493634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591902CAATGCAAAGTAAAAAAATATTTTTTTACTTTGCATTG0.568500.343200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1882-1904TTCAATGCAAAGTAAAAAAATATAUUUUUUUACUUUGCAUUGAACAAUGCAAAGUAAAAAAAUAUU-11.320.021


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186AGAAAGUGUAGAUAGUUAA93.508100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712204AGAAAGTGTAGATAGTTAATTAACTATCTACACTTTCT0.400200.244600.689700.750001.000001.00000


Target Position: 2936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2936GUCUUUCUCUAAAUAUGAU89.7263250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902954GTCTTTCTCTAAATATGATATCATATTTAGAGAAAGAC0.290200.118300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2934-2956CTGTCTTTCTCTAAATATGATTAAUCAUAUUUAGAGAAAGACAGGUCUUUCUCUAAAUAUGAUUAU8.719.122


Target Position: 2882, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882GCUGAAAAUCAAAGUAAAA95.158563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1242900GCTGAAAATCAAAGTAAAATTTTACTTTGATTTTCAGC0.434300.274900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2880-2902ATGCTGAAAATCAAAGTAAAAAAUUUUACUUUGAUUUUCAGCAUGCUGAAAAUCAAAGUAAAAAAU4.912.222


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608GUCACCUCAGCUGAUAUUA81.4357857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552626GTCACCTCAGCTGATATTATAATATCAGCTGAGGTGAC0.032900.004700.784500.750000.967400.62500


Target Position: 3462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462CAAGGAAAGUGAACCUUUA98.002319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3460-3482TTCAAGGAAAGTGAACCTTTAAAUAAAGGUUCACUUUCCUUGAACAAGGAAAGUGAACCUUUAAAU17.318.721


Target Position: 4316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4316AAUUCCAGUAUCCAUAAAU79.25141091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9114334AATTCCAGTATCCATAAATATTTATGGATACTGGAATT0.434700.035800.500000.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368CAUUUCUCUGCUUACCCUU77.32941297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602386CATTTCTCTGCTTACCCTTAAGGGTAAGCAGAGAAATG0.293300.156400.517200.750001.000001.00000


Target Position: 3901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3901UUUUCUCUUGUUUUUAUUU66.48962562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593919TTTTCTCTTGTTTTTATTTAAATAAAAACAAGAGAAAA0.210800.155200.500000.500001.000001.00000


Target Position: 4314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4314UAAAUUCCAGUAUCCAUAA82.6477752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9284332TAAATTCCAGTATCCATAATTATGGATACTGGAATTTA0.467500.035200.500000.500001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281AGAUGAACUUUGCGAAUGU81.6311842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321299AGATGAACTTTGCGAATGTACATTCGCAAAGTTCATCT0.088900.007900.517200.500001.000001.00000


Target Position: 3248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248UUUAAGCCUUUUGUGUAAU61.73323127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913266TTTAAGCCTTTTGTGTAATATTACACAAAAGGCTTAAA0.076600.011000.491400.500001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919AAUUCACAGGGACCUAAAA85.8046501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991937AATTCACAGGGACCTAAAATTTTAGGTCCCTGTGAATT0.597400.011200.508600.500001.000001.00000


Target Position: 3928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3928AUAUGGCAUUAUAUCAAUA94.176778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003946ATATGGCATTATATCAATATATTGATATAATGCCATAT0.481500.052700.500000.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469AGGGACCUCCUUAUAGAUG64.67872780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741487AGGGACCTCCTTATAGATGCATCTATAAGGAGGTCCCT0.374700.002300.689700.500000.945700.62500