siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 954  
Biltr, Ernai 279   1927  
Biltr, Ernai, Sidirect 633   967  
Biltr, Ernai, Rnaxs 676   845   1231   1507   3357  
Biltr, Rnaxs, Sidirect 10   293   299   300   312   395   471   478   686   749   769   777   781   812   813   823   858   891   898   900  
901   956   1060   1063   1095   1108   1110   1139   1240   1244   1297   1877   1940   1952   1954   2090   2465   2471   2595   2682  
2730   2732   2864   2991   2992   3178   3179   3189   3191   3203   3285   3287   3289   3293   3371   3386   3474   3475   3483   3484  
3505   3519   3530   3586   3635   3645   3655   3657   3725   3728  
Biltr, Sidirect 12   283   322   405   407   410   420   422   644   696   730   733   738   778   848   892   958   1012   1019   1023  
1064   1074   1098   1115   1135   1214   1238   1255   1259   1265   1266   1388   1443   1515   1531   1813   1880   1959   2095   2116  
2157   2166   2188   2297   2466   2528   2655   2665   2668   2735   2759   2769   2770   2772   2776   2781   2852   2854   2880   2930  
2931   2932   2937   2938   2944   2947   2993   2998   3001   3070   3073   3144   3175   3230   3243   3297   3395   3401   3407   3410  
3463   3472   3497   3507   3542   3550   3573   3578   3647   3660   3695   3700   3721   3722  
Biltr, Rnaxs 8   9   291   292   298   301   306   307   308   313   314   319   340   341   342   343   344   347   348   349  
350   351   352   380   381   382   389   390   394   396   397   399   401   412   419   430   436   437   438   441  
442   443   459   470   472   473   476   477   485   496   497   500   501   502   503   508   509   514   515   535  
538   539   540   542   543   544   547   548   554   555   580   581   582   583   585   586   589   590   601   639  
640   641   642   643   675   677   683   684   685   688   691   695   719   720   723   724   726   727   728   742  
747   748   750   751   754   755   756   757   761   768   776   779   780   782   783   787   788   801   804   806  
807   808   809   810   811   814   819   820   822   832   833   834   837   844   846   856   878   885   886   899  
925   926   949   951   952   953   957   1031   1039   1040   1041   1044   1045   1048   1049   1053   1054   1055   1059   1062  
1083   1089   1091   1093   1094   1096   1097   1102   1107   1109   1113   1114   1119   1120   1133   1134   1136   1137   1138   1158  
1159   1161   1162   1167   1168   1169   1196   1203   1204   1206   1209   1210   1211   1212   1213   1216   1217   1224   1225   1230  
1233   1234   1237   1239   1243   1293   1296   1365   1366   1377   1383   1384   1387   1389   1390   1433   1439   1440   1441   1459  
1506   1509   1510   1514   1519   1527   1530   1534   1536   1563   1567   1568   1591   1592   1593   1594   1622   1623   1707   1708  
1709   1710   1718   1719   1723   1724   1798   1799   1800   1801   1803   1804   1807   1808   1845   1846   1847   1848   1851   1852  
1878   1881   1885   1886   1887   1888   1895   1896   1897   1900   1902   1903   1939   1953   1960   1961   2019   2085   2086   2087  
2088   2089   2091   2101   2149   2150   2151   2152   2176   2177   2178   2181   2182   2184   2185   2200   2264   2268   2269   2274  
2275   2277   2278   2281   2282   2292   2293   2295   2296   2303   2350   2353   2363   2364   2365   2366   2367   2368   2369   2371  
2372   2373   2374   2375   2397   2398   2399   2400   2402   2403   2464   2470   2472   2588   2589   2590   2593   2594   2644   2645  
2675   2680   2681   2723   2724   2725   2728   2729   2731   2733   2734   2745   2746   2751   2757   2762   2851   2859   2860   2872  
2873   2902   2903   2904   2916   2917   2924   2925   2970   2977   2978   2979   2997   2999   3000   3065   3066   3068   3069   3071  
3122   3123   3124   3125   3129   3163   3164   3165   3166   3167   3168   3169   3170   3171   3176   3177   3187   3188   3190   3197  
3198   3199   3202   3208   3211   3216   3217   3262   3263   3264   3268   3269   3270   3272   3273   3274   3277   3278   3284   3286  
3288   3292   3320   3324   3325   3330   3331   3332   3349   3350   3351   3352   3355   3363   3365   3375   3376   3385   3412   3413  
3414   3456   3462   3473   3482   3492   3493   3494   3495   3498   3503   3504   3517   3518   3528   3529   3531   3532   3539   3585  
3593   3594   3602   3625   3631   3632   3634   3636   3641   3642   3643   3644   3646   3648   3652   3653   3654   3656   3658   3666  
3675   3676   3679   3680   3702   3724   3727   3729   3730   3731  


Target Position: 2293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293GAAGGUAGUAGAGUCAAAG79.56481157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322311GAAGGTAGTAGAGTCAAAGCTTTGACTCTACTACCTTC0.081100.037100.534500.500001.000001.00000


Target Position: 3330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3330UCCCAUCAUCCUUUGUUCU64.82832616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133348TCCCATCATCCTTTGTTCTAGAACAAAGGATGATGGGA0.454800.332400.646600.500001.000001.00000


Target Position: 2116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116CAAUCGAGCUGUUGCAAUU89.6095333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2114-2136GCCAATCGAGCTGTTGCAATTCTAAUUGCAACAGCUCGAUUGGCCAAUCGAGCUGUUGCAAUUCUU20.021.003


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590GUUUGGGAAAGAUGGAUAA87.6558462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372608GTTTGGGAAAGATGGATAATTATCCATCTTTCCCAAAC0.720200.046300.612100.750001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430ACACAAAGAGAAGGAGAAG67.21832418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744448ACACAAAGAGAAGGAGAAGCTTCTCCTTCTCTTTGTGT0.241900.208300.569000.500001.000001.00000


Target Position: 1959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959CUGGUAUUCUGAAUAAGCA91.3237246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1957-1979TACTGGTATTCTGAATAAGCATCUGCUUAUUCAGAAUACCAGUACUGGUAUUCUGAAUAAGCAUCU13.620.002


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820CAAGAAAAAGAAGCCGAAG68.44832299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971838CAAGAAAAAGAAGCCGAAGCTTCGGCTTCTTTTTCTTG0.409400.381900.508600.500001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GGAAAUAUUUAGGAAAAAU90.5322284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011081GGAAATATTTAGGAAAAATATTTTTCCTAAATATTTCC0.089500.041700.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1061-1083AAGGAAATATTTAGGAAAAATTTAUUUUUCCUAAAUAUUUCCUUGGAAAUAUUUAGGAAAAAUUUU14.31.812


Target Position: 2735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735CUUAUUUAAAAAUAUUUCA82.3877894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2733-2755AACTTATTTAAAAATATTTCAGAUGAAAUAUUUUUAAAUAAGUUCUUAUUUAAAAAUAUUUCAGAU1.8-7.502


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306AUGAUUCUCAUAAACACAA81.0531024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996324ATGATTCTCATAAACACAATTGTGTTTATGAGAATCAT0.940100.091300.508600.500001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GCGAAGAUCCUUUCUUAUA91.3363245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042108GCGAAGATCCTTTCTTATATATAAGAAAGGATCTTCGC0.218300.032200.879301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2088-2110CAGCGAAGATCCTTTCTTATAACUAUAAGAAAGGAUCUUCGCUGGCGAAGAUCCUUUCUUAUAACU6.921.002


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960UGGUAUUCUGAAUAAGCAU79.19261203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521978TGGTATTCTGAATAAGCATATGCTTATTCAGAATACCA0.102400.017900.689700.750001.000001.00000


Target Position: 3349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3349GAGCAUUCGCUGUACCCUU84.3354710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813367GAGCATTCGCTGTACCCTTAAGGGTACAGCGAATGCTC0.727600.046500.672400.750000.918500.62500


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039GCUCGACCAUGAAUAUACU90.2376298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281057GCTCGACCATGAATATACTAGTATATTCATGGTCGAGC0.181400.089100.646600.750001.000001.00000


Target Position: 644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644GAUAUAAAGCCAUUAAAGA94.0877113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
642-664AGGATATAAAGCCATTAAAGAGAUCUUUAAUGGCUUUAUAUCCUGAUAUAAAGCCAUUAAAGAGAU-4.3-8.033


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748AGAAGAAGAGGAUGGUAAA93.8769125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433766AGAAGAAGAGGATGGTAAATTTACCATCCTCTTCTTCT0.309200.236400.724100.750001.000001.00000


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292AGAAGGUAGUAGAGUCAAA97.049354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312310AGAAGGTAGTAGAGTCAAATTTGACTCTACTACCTTCT0.081600.037700.724100.750001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206UGAGCAAGGAAGAGAAACU76.05691507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681224TGAGCAAGGAAGAGAAACTAGTTTCTCTTCCTTGCTCA0.482000.061700.517200.500001.000001.00000


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365UGCUGAAGAGACGAAUCAU81.30361005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031383TGCTGAAGAGACGAATCATATGATTCGTCTCTTCAGCA0.089000.013800.698300.750001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CUGAGCCAGAUAACAAGAA82.2182913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650825CTGAGCCAGATAACAAGAATTCTTGTTATCTGGCTCAG0.699200.302200.612100.750001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747AAGAAGAAGAGGAUGGUAA86.5914531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
722765AAGAAGAAGAGGATGGTAATTACCATCCTCTTCTTCTT0.267800.239700.603400.500001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287GUGAAUCUAAGGAUAAUGA87.4792475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303305GTGAATCTAAGGATAATGATCATTATCCTTAGATTCAC0.217400.018900.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3285-3307GAGTGAATCTAAGGATAATGAAAUCAUUAUCCUUAGAUUCACUCGUGAAUCUAAGGAUAAUGAAAU8.720.412


Target Position: 2757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757AUCAAAAUUCUAGCUGUAU72.13361921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372775ATCAAAATTCTAGCTGTATATACAGCTAGAATTTTGAT0.217400.027200.637900.500001.000001.00000


Target Position: 2668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2668CAUCUUUGCGAAAAGAUAA92.6439180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2666-2688AACATCTTTGCGAAAAGATAAACUUAUCUUUUCGCAAAGAUGUUCAUCUUUGCGAAAAGAUAAACU6.912.013


Target Position: 2655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CUUAACAAACCAACAUCUU74.61121670

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2653-2675GTCTTAACAAACCAACATCTTTGAAGAUGUUGGUUUGUUAAGACCUUAACAAACCAACAUCUUUGU19.27.202


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348ACCGGCACAAAGAACACAA78.72871245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417366ACCGGCACAAAGAACACAATTGTGTTCTTTGTGCCGGT0.823500.238200.706900.750001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465CCAAUUGAGAAGAUUUACA86.4213550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5152483CCAATTGAGAAGATTTACATGTAAATCTTCTCAATTGG0.679100.411400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2463-2485TCCCAATTGAGAAGATTTACAACUGUAAAUCUUCUCAAUUGGGACCAAUUGAGAAGAUUUACAACU10.013.802


Target Position: 3071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071AUCAAUUUUCAUUAAACUU72.55711880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8413089ATCAATTTTCATTAAACTTAAGTTTAATGAAAATTGAT0.191000.102400.543100.500000.972800.62500


Target Position: 3350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350AGCAUUCGCUGUACCCUUU75.32511584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5603368AGCATTCGCTGTACCCTTTAAAGGGTACAGCGAATGCT0.743300.061000.853400.750000.934800.62500


Target Position: 3198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198UAUUUCUUUUUAAUUAUUU71.84281958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8443216TATTTCTTTTTAATTATTTAAATAATTAAAAAGAAATA0.136800.053200.543100.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CCAGAUAACAAGAAAAAGA88.3043431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
609830CCAGATAACAAGAAAAAGATCTTTTTCTTGTTATCTGG0.890400.424600.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
810-832AGCCAGATAACAAGAAAAAGAAGUCUUUUUCUUGUUAUCUGGCUCCAGAUAACAAGAAAAAGAAGU5.513.422


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CGAAAAGAGGAAAAGGUUC68.80262268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791533CGAAAAGAGGAAAAGGTTCGAACCTTTTCCTCTTTTCG0.614100.022400.620700.750001.000001.00000


Target Position: 1388, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GAGGAUAUAAUCAUCAACU88.3177430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1386-1408CCGAGGATATAATCATCAACTGTAGUUGAUGAUUAUAUCCUCGGGAGGAUAUAAUCAUCAACUGUU20.519.932


Target Position: 1110, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110CUAAUGAAGAGAAGAAUAU83.7011762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821128CTAATGAAGAGAAGAATATATATTCTTCTCTTCATTAG0.284400.222100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1108-1130GACTAATGAAGAGAAGAATATTAAUAUUCUUCUCUUCAUUAGUCCUAAUGAAGAGAAGAAUAUUAU6.98.922


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313UCAUAAACACAAAGAUAAA88.7193394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
598331TCATAAACACAAAGATAAATTTATCTTTGTGTTTATGA0.872300.694000.724100.750001.000001.00000


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273GGGAUGAAGGGCGAGUGAA86.1589568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123291GGGATGAAGGGCGAGTGAATTCACTCGCCCTTCATCCC0.191300.107000.819001.000001.000001.00000


Target Position: 3503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3503AGGGCUUUUAUUUUUUCUU70.66252090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123521AGGGCTTTTATTTTTTCTTAAGAAAAAATAAAAGCCCT0.116000.033400.706900.750001.000001.00000


Target Position: 3123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123AGACACCUGUUCACAGAAA89.0327371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753141AGACACCTGTTCACAGAAATTTCTGTGAACAGGTGTCT0.185400.009700.724100.750000.929300.75000


Target Position: 3293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293CUAAGGAUAAUGAAAUAAU87.4871474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293311CTAAGGATAATGAAATAATATTATTTCATTATCCTTAG0.109100.084200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3291-3313ATCTAAGGATAATGAAATAATCAAUUAUUUCAUUAUCCUUAGAUCUAAGGAUAAUGAAAUAAUCAU2.119.902


Target Position: 405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GUGAACAUAAAGAUUCUGA83.8805742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
403-425CAGTGAACATAAAGATTCTGAAAUCAGAAUCUUUAUGUUCACUGGUGAACAUAAAGAUUCUGAAAU20.420.512


Target Position: 3483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483GGAAAAAUAAUCAAGAUUU88.5864408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7833501GGAAAAATAATCAAGATTTAAATCTTGATTATTTTTCC0.221100.023700.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3481-3503AAGGAAAAATAATCAAGATTTTAAAAUCUUGAUUAUUUUUCCUUGGAAAAAUAAUCAAGAUUUUAU12.00.401


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GCCGAAGAAAGAAGAGGAA85.2896649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270850GCCGAAGAAAGAAGAGGAATTCCTCTTCTTTCTTCGGC0.490000.355000.827601.000001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CCAGUAUUUCAAAGCCCAG71.23472019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841186CCAGTATTTCAAAGCCCAGCTGGGCTTTGAAATACTGG0.147700.073700.560300.750001.000001.00000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243UGAAAAAUUACUGAAAGAA81.25271011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8311261TGAAAAATTACTGAAAGAATTCTTTCAGTAATTTTTCA0.385100.343700.551700.750001.000001.00000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433CCUCCUCCAGGACAUAAGU73.06951834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831451CCTCCTCCAGGACATAAGTACTTATGTCCTGGAGGAGG0.186600.014800.637900.750000.913000.62500


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632AGAGUCCAUUUCCCACAUC64.93062607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193650AGAGTCCATTTCCCACATCGATGTGGGAAATGGACTCT0.218300.075500.543100.500001.000001.00000


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644AGGCAGCAAGUCUUAACAA89.3289348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232662AGGCAGCAAGTCTTAACAATTGTTAAGACTTGCTGCCT0.585300.040900.698300.750001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473GAAAAGCAUAAAGACAAAC69.17092229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915491GAAAAGCATAAAGACAAACGTTTGTCTTTATGCTTTTC0.941100.453600.525900.500001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682GAUAAACCUGGAGAUAUUA94.1635110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822700GATAAACCTGGAGATATTATAATATCTCCAGGTTTATC0.733000.086800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2680-2702AAGATAAACCTGGAGATATTATAUAAUAUCUCCAGGUUUAUCUUGAUAAACCUGGAGAUAUUAUAU6.613.912


Target Position: 547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
547UGCAAAAAUAAAGAAGGAG58.89543091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941565TGCAAAAATAAAGAAGGAGCTCCTTCTTTATTTTTGCA0.167500.178400.543100.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675AGGAUGAUGCUGAUUAUAA94.3999102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470693AGGATGATGCTGATTATAATTATAATCAGCATCATCCT0.321300.074300.810300.750001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640AGAGGAUAUAAAGCCAUUA87.5521469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867658AGAGGATATAAAGCCATTATAATGGCTTTATATCCTCT0.104800.016200.689700.750001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681AGAUAAACCUGGAGAUAUU91.7305230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372699AGATAAACCTGGAGATATTAATATCTCCAGGTTTATCT0.504400.028300.715500.750001.000001.00000


Target Position: 2904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2904AUUAUAUUGGUGCGUUUUU66.58652468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882922ATTATATTGGTGCGTTTTTAAAAACGCACCAATATAAT0.117200.029700.508600.500001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496AGACAGAGACAAGGAAAAA89.0115373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
262514AGACAGAGACAAGGAAAAATTTTTCCTTGTCTCTGTCT0.848400.799500.724100.750001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389AGGAUAUAAUCAUCAACUG77.63621345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141407AGGATATAATCATCAACTGCAGTTGATGATTATATCCT0.109900.083800.560300.500001.000001.00000


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494CAAGAUUUUAGGGCUUUUA83.8534749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7013512CAAGATTTTAGGGCTTTTATAAAAGCCCTAAAATCTTG0.153300.074500.612100.750001.000001.00000


Target Position: 2472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2472AGAAGAUUUACAACAAAAC71.07412041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282490AGAAGATTTACAACAAAACGTTTTGTTGTAAATCTTCT0.226600.225000.577600.500001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GAAUGAAAAAUUACUGAAA97.589147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461258GAATGAAAAATTACTGAAATTTCAGTAATTTTTCATTC0.423400.327000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1238-1260GAGAATGAAAAATTACTGAAAGAUUUCAGUAAUUUUUCAUUCUCGAAUGAAAAAUUACUGAAAGAU20.37.422


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390CCAAGCAUAGCAACAGUGA81.5968974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
633408CCAAGCATAGCAACAGTGATCACTGTTGCTATGCTTGG0.591200.363500.620700.750001.000001.00000


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268AGGUCAUGAAGGAUGCAAA93.1763159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622286AGGTCATGAAGGATGCAAATTTGCATCCTTCATGACCT0.302400.050400.844800.750001.000001.00000


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641GAGGAUAUAAAGCCAUUAA96.256362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801659GAGGATATAAAGCCATTAATTAATGGCTTTATATCCTC0.132900.021800.775900.750001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382GGAAAAGUCCAAGCAUAGC65.53052559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956400GGAAAAGTCCAAGCATAGCGCTATGCTTGGACTTTTCC0.477800.142200.517200.500000.983700.62500


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200GAUUGAUGCCAAGAAGGAA96.244763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812218GATTGATGCCAAGAAGGAATTCCTTCTTGGCATCAATC0.162700.057700.508600.750000.989100.75000


Target Position: 3188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188UGUGAAUUUUUAUUUCUUU78.15821290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133206TGTGAATTTTTATTTCTTTAAAGAAATAAAAATTCACA0.114800.047000.706900.750001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858GGAAAUGGUGGGAAGAAGA87.8486456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574876GGAAATGGTGGGAAGAAGATCTTCTTCCCACCATTTCC0.798800.047700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
856-878GTGGAAATGGTGGGAAGAAGAGCUCUUCUUCCCACCAUUUCCACGGAAAUGGUGGGAAGAAGAGCU19.120.122


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800AGUUGGAUGGUCAGGAAUA88.9351377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211818AGTTGGATGGTCAGGAATATATTCCTGACCATCCAACT0.338800.030500.663800.750001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CCCAAUUGAGAAGAUUUAC65.05252598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592482CCCAATTGAGAAGATTTACGTAAATCTTCTCAATTGGG0.689500.226200.810300.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234AGAGGAGAAUGAAAAAUUA98.014143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931252AGAGGAGAATGAAAAATTATAATTTTTCATTCTCCTCT0.587700.365500.689700.750001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691UAAACCUAAGAAAAUUAAA79.78341139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874709TAAACCTAAGAAAATTAAATTTAATTTTCTTAGGTTTA0.828400.592800.534500.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954CAGAGAAUGUCAAGUUUUA98.587932

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_595419CAGAGAATGTCAAGTTTTA1/1/0/097.21TOP1NM_003286.21NANANA20:39721201..39721219(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870972CAGAGAATGTCAAGTTTTATAAAACTTGACATTCTCTG0.169400.016000.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
952-974TCCAGAGAATGTCAAGTTTTATTUAAAACUUGACAUUCUCUGGACAGAGAAUGUCAAGUUUUAUUU3.219.122


Target Position: 2745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2745AAUAUUUCAGAUAUCAAAA88.772389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732763AATATTTCAGATATCAAAATTTTGATATCTGAAATATT0.181700.077600.508600.500001.000001.00000


Target Position: 3163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3163CCUGACUUGAGUGUUCCUU68.62762275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343181CCTGACTTGAGTGTTCCTTAAGGAACACTCAAGTCAGG0.090100.012000.706901.000001.000001.00000


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367CAGACCGAGAGGAAAAUAA89.1085366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242385CAGACCGAGAGGAAAATAATTATTTTCCTCTCGGTCTG0.146200.058900.750000.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787AGAUAAAGAUAAAAAAGUU92.1231205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742805AGATAAAGATAAAAAAGTTAACTTTTTTATCTTTATCT0.356400.332400.577600.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780AGAAUAAAGAUAAAGAUAA93.2333156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303798AGAATAAAGATAAAGATAATTATCTTTATCTTTATTCT0.892100.612900.689700.750001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514ACGAAAAGAGGAAAAGGUU74.11931716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672532ACGAAAAGAGGAAAAGGTTAACCTTTTCCTCTTTTCGT0.626300.035300.629300.750001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729GGACAACUUAUUUAAAAAU89.7697324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3292747GGACAACTTATTTAAAAATATTTTTAAATAAGTTGTCC0.422200.123100.862101.000001.000001.00000


Target Position: 3657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657CAAGUAUCUUCUAUUUUUA99.834222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6533675CAAGTATCTTCTATTTTTATAAAAATAGAAGATACTTG0.626300.425500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3655-3677CTCAAGTATCTTCTATTTTTATCUAAAAAUAGAAGAUACUUGAGCAAGUAUCUUCUAUUUUUAUCU-9.714.501


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852CAUCAGAUACUAUAACAAG86.2897560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591870CATCAGATACTATAACAAGCTTGTTATAGTATCTGATG0.146200.013200.517200.500001.000001.00000


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873GGAUUCUCUUAGCUACUGU85.8927594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732891GGATTCTCTTAGCTACTGTACAGTAGCTAAGAGAATCC0.072000.050200.663800.750001.000001.00000


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851UCACUGUUUCACUGAAAUG66.62372464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582869TCACTGTTTCACTGAAATGCATTTCAGTGAAACAGTGA0.086100.010700.569000.500000.913000.62500


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535AGCCUCUGGGGAUGCAAAA75.03671620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916553AGCCTCTGGGGATGCAAAATTTTGCATCCCCAGAGGCT0.701500.013000.853400.750000.934800.75000


Target Position: 2860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860CACUGAAAUGUUUGGAUUC73.96321734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282878CACTGAAATGTTTGGATTCGAATCCAAACATTTCAGTG0.083100.027500.620700.500001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383UGCCCGAGGAUAUAAUCAU74.68851661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501401TGCCCGAGGATATAATCATATGATTATATCCTCGGGCA0.366800.027000.698300.750001.000001.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295AGGUAGUAGAGUCAAAGAA89.8793317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642313AGGTAGTAGAGTCAAAGAATTCTTTGACTCTACTACCT0.098200.041200.672400.750001.000001.00000


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510CCAAGGUUCCAUUAAAUAC74.75961653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281528CCAAGGTTCCATTAAATACGTATTTAATGGAACCTTGG0.878100.119800.663800.750001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168CUUGAGUGUUCCUUUUUAA92.7444178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433186CTTGAGTGTTCCTTTTTAATTAAAAAGGAACACTCAAG0.301700.018100.603400.750001.000001.00000


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925AGUUAGGGUUUUGCAAUAA85.1694657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672943AGTTAGGGTTTTGCAATAATTATTGCAAAACCCTAACT0.166700.083100.672400.750001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366ACAGACCGAGAGGAAAAUA79.21151201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982384ACAGACCGAGAGGAAAATATATTTTCCTCTCGGTCTGT0.119900.055600.663800.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GAGGAUGGUAAAUUGAAAA93.5886137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366773GAGGATGGTAAATTGAAAATTTTCAATTTACCATCCTC0.754900.186900.810300.750001.000001.00000


Target Position: 3602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602UUAGAGGCAUUGUUAGUUU72.65851873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773620TTAGAGGCATTGTTAGTTTAAACTAACAATGCCTCTAA0.126600.019100.534500.500001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441AGGACAUAAGUGGAAAGAA88.3454429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581459AGGACATAAGTGGAAAGAATTCTTTCCACTTATGTCCT0.175100.037000.672400.750001.000001.00000


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278GAAGGGCGAGUGAAUCUAA98.304238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6363296GAAGGGCGAGTGAATCTAATTAGATTCACTCGCCCTTC0.178600.093300.637900.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899UGGAAAUUCCUAGAACAUA82.2212912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613917TGGAAATTCCTAGAACATATATGTTCTAGGAATTTCCA0.575200.042300.801700.750000.929300.62500


Target Position: 1443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443GACAUAAGUGGAAAGAAGU83.0716822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1441-1463AGGACATAAGTGGAAAGAAGTCCACUUCUUUCCACUUAUGUCCUGACAUAAGUGGAAAGAAGUCCU10.311.630


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AUAAAGAUAAAGAUAAAAA88.2458435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953801ATAAAGATAAAGATAAAAATTTTTATCTTTATCTTTAT0.891100.859700.543100.500001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CUCAUAAACACAAAGAUAA89.9996311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148330CTCATAAACACAAAGATAATTATCTTTGTGTTTATGAG0.872100.663700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
310-332TTCTCATAAACACAAAGATAAACUUAUCUUUGUGUUUAUGAGAACUCAUAAACACAAAGAUAAACU6.98.922


Target Position: 3456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3456GGAAAAUGAGUAUUUGGUC76.44061464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603474GGAAAATGAGTATTTGGTCGACCAAATACTCATTTTCC0.080500.010700.551700.750001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837AGAAAGAAGAGGAACAGAA90.908262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811855AGAAAGAAGAGGAACAGAATTCTGTTCCTCTTCTTTCT0.425400.363100.551700.750001.000001.00000


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296GGUAGUAGAGUCAAAGAAG85.5408627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142314GGTAGTAGAGTCAAAGAAGCTTCTTTGACTCTACTACC0.113700.053000.715500.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538CUCUGGGGAUGCAAAAAUA92.2357198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328556CTCTGGGGATGCAAAAATATATTTTTGCATCCCCAGAG0.747300.124200.767200.750001.000001.00000


Target Position: 2998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998CAGGAAUUUAAAAUUAAGU78.29051279

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2996-3018TTCAGGAATTTAAAATTAAGTAGACUUAAUUUUAAAUUCCUGAACAGGAAUUUAAAAUUAAGUAGU-4.318.702


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GGAUGGUCAGGAAUAUGUG82.7365858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261822GGATGGTCAGGAATATGTGCACATATTCCTGACCATCC0.142000.019200.577600.750001.000001.00000


Target Position: 341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341CGAGAACACCGGCACAAAG77.4421360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507359CGAGAACACCGGCACAAAGCTTTGTGCCGGTGTTCTCG0.341200.060900.655200.750001.000001.00000


Target Position: 3175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175GUUCCUUUUUAAAUGUGAA91.5402236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3173-3195GTGTTCCTTTTTAAATGTGAATTUUCACAUUUAAAAAGGAACACGUUCCUUUUUAAAUGUGAAUUU20.518.712


Target Position: 2776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2776GAUUUGUUUUGAAUUUUGU81.24991012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2774-2796ATGATTTGTTTTGAATTTTGTTTACAAAAUUCAAAACAAAUCAUGAUUUGUUUUGAAUUUUGUUUU-3.35.302


Target Position: 1534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534GCUUAACCCUAGUUCACGA92.1435203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731552GCTTAACCCTAGTTCACGATCGTGAACTAGGGTTAAGC0.199500.044100.560300.750001.000001.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343AGAACACCGGCACAAAGAA85.7195612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810361AGAACACCGGCACAAAGAATTCTTTGTGCCGGTGTTCT0.541200.099700.551700.750001.000001.00000


Target Position: 3731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731AAUGGAAAAAAAAAAAAAA84.222719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913749AATGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCATT0.991500.816800.508600.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CCCAGAUGAGCCAGUAUUU81.7484951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951176CCCAGATGAGCCAGTATTTAAATACTGGCTCATCTGGG0.496900.033300.991401.000000.983700.62500


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377GAAUCAUGCCCGAGGAUAU92.3834193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521395GAATCATGCCCGAGGATATATATCCTCGGGCATGATTC0.108000.011100.629300.750001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888AGUUUUUAAGAACCUACAA85.769605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771906AGTTTTTAAGAACCTACAATTGTAGGTTCTTAAAAACT0.271900.071300.560300.750001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GGAGAAAGGAAAUGACUAA100.08120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451113GGAGAAAGGAAATGACTAATTAGTCATTTCCTTTCTCC0.349300.053200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1093-1115CTGGAGAAAGGAAATGACTAATGUUAGUCAUUUCCUUUCUCCAGGGAGAAAGGAAAUGACUAAUGU20.319.123


Target Position: 3517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3517UUCUUUUGUAAUUGUGUAA73.98411731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153535TTCTTTTGTAATTGTGTAATTACACAATTACAAAAGAA0.273800.020300.637900.500001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181UGAUGAACUUGCAAACUAA98.996728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8052199TGATGAACTTGCAAACTAATTAGTTTGCAAGTTCATCA0.163800.021500.689700.750001.000001.00000


Target Position: 350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
350CGGCACAAAGAACACAAGA82.4026889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505368CGGCACAAAGAACACAAGATCTTGTGTTCTTTGTGCCG0.777400.313700.689700.750001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209GCAAGGAAGAGAAACUGAA93.0516167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281227GCAAGGAAGAGAAACTGAATTCAGTTTCTCTTCCTTGC0.495200.420900.681001.000001.000001.00000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GGCACAAAGAACACAAGAA97.192850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125369GGCACAAAGAACACAAGAATTCTTGTGTTCTTTGTGCC0.776600.377500.827601.000001.000001.00000


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278GGAUGCAAAGACGAAGAAG75.56971551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362296GGATGCAAAGACGAAGAAGCTTCTTCGTCTTTGCATCC0.239800.115700.732800.750001.000001.00000


Target Position: 3666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3666UCUAUUUUUAUCAUGAAUU70.07372146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5453684TCTATTTTTATCATGAATTAATTCATGATAAAAATAGA0.373800.304000.715500.750001.000001.00000


Target Position: 3504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3504GGGCUUUUAUUUUUUCUUU82.4166888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063522GGGCTTTTATTTTTTCTTTAAAGAAAAAATAAAAGCCC0.117500.032500.991401.000001.000001.00000


Target Position: 845, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GAGGAACAGAAGUGGAAAU86.358554

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_384519GAGGAACAGAAGTGGAAAT1/1/0/097.75TOP1NM_003286.21NANANA20:39713189..39713207(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684863GAGGAACAGAAGTGGAAATATTTCCACTTCTGTTCCTC0.159900.103400.801700.750001.000001.00000


Target Position: 301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
301AUUGAAUGAUUCUCAUAAA92.4302190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986319ATTGAATGATTCTCATAAATTTATGAGAATCATTCAAT0.139300.068500.508600.500001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779AAGAAUAAAGAUAAAGAUA91.3062247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812797AAGAATAAAGATAAAGATATATCTTTATCTTTATTCTT0.883400.609600.594800.500001.000001.00000


Target Position: 2746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2746AUAUUUCAGAUAUCAAAAU77.0281401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592764ATATTTCAGATATCAAAATATTTTGATATCTGAAATAT0.181300.072100.534500.500001.000001.00000


Target Position: 3179, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179CUUUUUAAAUGUGAAUUUU77.35231368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783197CTTTTTAAATGTGAATTTTAAAATTCACATTTAAAAAG0.162700.090600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3177-3199TCCTTTTTAAATGTGAATTTTTAAAAAUUCACAUUUAAAAAGGACUUUUUAAAUGUGAAUUUUUAU7.4-9.101


Target Position: 2152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152GGCACCACCAAAAACUUUU74.75581654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062170GGCACCACCAAAAACTTTTAAAAGTTTTTGGTGGTGCC0.088200.072501.000001.000001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710UGAGAGCAGGCAAUGAAAA81.6415969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561728TGAGAGCAGGCAATGAAAATTTTCATTGCCTGCTCTCA0.643500.050800.724100.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GAAAGGAAAUGACUAAUGA95.815469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118GAGAAAGGAAATGACTAATGAAGUCAUUAGUCAUUUCCUUUCUCGAAAGGAAAUGACUAAUGAAGU11.618.722


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961GGUAUUCUGAAUAAGCAUC73.11611832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361979GGTATTCTGAATAAGCATCGATGCTTATTCAGAATACC0.685100.039200.672400.750001.000001.00000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091CGAAGAUCCUUUCUUAUAA99.460626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512109CGAAGATCCTTTCTTATAATTATAAGAAAGGATCTTCG0.231800.037600.758601.000001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040CUCGACCAUGAAUAUACUA86.4781539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601058CTCGACCATGAATATACTATAGTATATTCATGGTCGAG0.223600.084500.637900.750001.000001.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217GAGAAACUGAAAAUCAAAG76.6761439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211235GAGAAACTGAAAATCAAAGCTTTGATTTTCAGTTTCTC0.448300.309600.672400.500001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101UUCUUAUAACCGUGCCAAU70.11562142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242119TTCTTATAACCGTGCCAATATTGGCACGGTTATAAGAA0.084100.031000.663800.500001.000001.00000


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088CAGCGAAGAUCCUUUCUUA102.7866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112106CAGCGAAGATCCTTTCTTATAAGAAAGGATCTTCGCTG0.186600.013100.750000.750001.000001.00000


Target Position: 3285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285GAGUGAAUCUAAGGAUAAU95.639375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143303GAGTGAATCTAAGGATAATATTATCCTTAGATTCACTC0.243500.020400.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3283-3305GCGAGTGAATCTAAGGATAATGAAUUAUCCUUAGAUUCACUCGCGAGUGAAUCUAAGGAUAAUGAU19.919.212


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369GACCGAGAGGAAAAUAAAC76.22141486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8362387GACCGAGAGGAAAATAAACGTTTATTTTCCTCTCGGTC0.466300.054000.672400.500001.000001.00000


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509UCCAAGGUUCCAUUAAAUA77.49561359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761527TCCAAGGTTCCATTAAATATATTTAATGGAACCTTGGA0.700600.097100.827600.750001.000001.00000


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709CUGAGAGCAGGCAAUGAAA90.8977264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411727CTGAGAGCAGGCAATGAAATTTCATTGCCTGCTCTCAG0.180600.038500.784500.750001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GCUGAAGAGACGAAUCAUG76.87411413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051384GCTGAAGAGACGAATCATGCATGATTCGTCTCTTCAGC0.088300.017200.698300.750001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887GAGUUUUUAAGAACCUACA88.7333392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871905GAGTTTTTAAGAACCTACATGTAGGTTCTTAAAAACTC0.224700.064900.603400.500000.989100.62500


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185GAACUUGCAAACUAAGAUU86.5902532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462203GAACTTGCAAACTAAGATTAATCTTAGTTTGCAAGTTC0.399200.027500.663800.750001.000001.00000


Target Position: 2665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665CAACAUCUUUGCGAAAAGA86.4383546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2663-2685ACCAACATCTTTGCGAAAAGATAUCUUUUCGCAAAGAUGUUGGUCAACAUCUUUGCGAAAAGAUAU12.419.213


Target Position: 1060, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060CAAGGAAAUAUUUAGGAAA94.509897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041078CAAGGAAATATTTAGGAAATTTCCTAAATATTTCCTTG0.153000.047000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1058-1080ACCAAGGAAATATTTAGGAAAAAUUUCCUAAAUAUUUCCUUGGUCAAGGAAAUAUUUAGGAAAAAU19.918.712


Target Position: 738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738GAAAACUAGAAGAAGAAGA85.4178639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
736-758AAGAAAACTAGAAGAAGAAGAGGUCUUCUUCUUCUAGUUUUCUUGAAAACUAGAAGAAGAAGAGGU19.14.912


Target Position: 3532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3532GUAAAAAAUGGAAAAAAAC71.27762012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793550GTAAAAAATGGAAAAAAACGTTTTTTTCCATTTTTTAC0.106100.039900.534500.500001.000001.00000


Target Position: 3297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3297GGAUAAUGAAAUAAUCAGU89.1171364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3295-3317AAGGATAATGAAATAATCAGTGAACUGAUUAUUUCAUUAUCCUUGGAUAAUGAAAUAAUCAGUGAU13.48.702


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437GAGAAGGAGAAGACCAAAC72.72741867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789455GAGAAGGAGAAGACCAAACGTTTGGTCTTCTCCTTCTC0.122000.095300.663800.500000.962001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239AGAAUGAAAAAUUACUGAA89.6735329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251257AGAATGAAAAATTACTGAATTCAGTAATTTTTCATTCT0.528500.408800.551700.750001.000001.00000


Target Position: 3641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641UUCCCACAUCUUUCCUCAA75.441566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293659TTCCCACATCTTTCCTCAATTGAGGAAAGATGTGGGAA0.613100.158200.525900.500001.000001.00000


Target Position: 293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293GAUUUCCGAUUGAAUGAUU84.9609666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842311GATTTCCGATTGAATGATTAATCATTCAATCGGAAATC0.105300.018100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
291-313CGGATTTCCGATTGAATGATTCTAAUCAUUCAAUCGGAAAUCCGGAUUUCCGAUUGAAUGAUUCUU16.220.721


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585GUCCACCACAAAUUAAAGA77.22641377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788603GTCCACCACAAATTAAAGATCTTTAATTTGTGGTGGAC0.420500.304300.594800.500001.000001.00000


Target Position: 2528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528GAUGAAGACUAUGAGUUUU88.8988379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2526-2548CTGATGAAGACTATGAGTTTTAGAAAACUCAUAGUCUUCAUCAGGAUGAAGACUAUGAGUUUUAGU19.220.412


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293AGAGGAUUGCUAACUUCAA91.6847232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531311AGAGGATTGCTAACTTCAATTGAAGTTAGCAATCCTCT0.194000.011100.577600.750001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UACUACCAAGGAAAUAUUU70.92072061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951072TACTACCAAGGAAATATTTAAATATTTCCTTGGTAGTA0.090600.028200.681000.500001.000001.00000


Target Position: 3492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492AUCAAGAUUUUAGGGCUUU63.97152690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723510ATCAAGATTTTAGGGCTTTAAAGCCCTAAAATCTTGAT0.148300.067000.681000.500001.000001.00000


Target Position: 2095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095GAUCCUUUCUUAUAACCGU81.33161003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2093-2115AAGATCCTTTCTTATAACCGTGCACGGUUAUAAGAAAGGAUCUUGAUCCUUUCUUAUAACCGUGCU20.618.703


Target Position: 2903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GAUUAUAUUGGUGCGUUUU79.62671153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572921GATTATATTGGTGCGTTTTAAAACGCACCAATATAATC0.151900.026200.681000.750001.000001.00000


Target Position: 2977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2977UCCCUUCCCUCUCUCCCAU62.30432831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2122995TCCCTTCCCTCTCTCCCATATGGGAGAGAGGGAAGGGA0.660300.640400.715500.750001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555UAAAGAAGGAGAAGGAAAA82.3766896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907573TAAAGAAGGAGAAGGAAAATTTTCCTTCTCCTTCTTTA0.087700.074500.534500.500001.000001.00000


Target Position: 3702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702AGGUUAUUUAAAAUAAAUU81.3878994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8323720AGGTTATTTAAAATAAATTAATTTATTTTAAATAACCT0.108500.047700.836200.750001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762AAUUCUAGCUGUAUGAUUU88.1504439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952780AATTCTAGCTGTATGATTTAAATCATACAGCTAGAATT0.473100.044100.508600.500001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953CCAGAGAAUGUCAAGUUUU83.9173738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876971CCAGAGAATGTCAAGTTTTAAAACTTGACATTCTCTGG0.141600.015600.844801.000001.000001.00000


Target Position: 1231, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CAAAGAGGAGAAUGAAAAA96.998156

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4123119CAAAGAGGAGAATGAAAAA1/1/0/097.75TOP1NM_003286.21NANANA20:39728701..39728719(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191249CAAAGAGGAGAATGAAAAATTTTTCATTCTCCTCTTTG0.585900.389200.646600.750001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169UUGAGUGUUCCUUUUUAAA76.87271414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393187TTGAGTGTTCCTTTTTAAATTTAAAAAGGAACACTCAA0.591500.034300.646600.500001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044ACCAUGAAUAUACUACCAA83.4705787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621062ACCATGAATATACTACCAATTGGTAGTATATTCATGGT0.233200.036500.706900.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CCACAAAUUAAAGAUGAAC69.11212234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434608CCACAAATTAAAGATGAACGTTCATCTTTAATTTGTGG0.383200.286300.698300.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UCCACCACAAAUUAAAGAU66.8982439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349604TCCACCACAAATTAAAGATATCTTTAATTTGTGGTGGA0.401200.309600.689700.750001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184UGAACUUGCAAACUAAGAU76.60781444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462202TGAACTTGCAAACTAAGATATCTTAGTTTGCAAGTTCA0.387300.031400.543100.750001.000001.00000


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277UGAAGGGCGAGUGAAUCUA75.40441572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293295TGAAGGGCGAGTGAATCTATAGATTCACTCGCCCTTCA0.165600.086200.551700.750001.000001.00000


Target Position: 3729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3729UUAAUGGAAAAAAAAAAAA70.25432129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823747TTAATGGAAAAAAAAAAAATTTTTTTTTTTTCCATTAA0.985600.809400.534500.500001.000001.00000


Target Position: 3268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268GGGGAGGGAUGAAGGGCGA76.06451505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6393286GGGGAGGGATGAAGGGCGATCGCCCTTCATCCCTCCCC0.427500.149000.698300.750001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GGUUCCAUUAAAUACAUCA92.5756185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641532GGTTCCATTAAATACATCATGATGTATTTAATGGAACC0.680900.222900.629300.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GGAAGUAGCUACGUUCUUU91.7347229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1010-1032GAGGAAGTAGCTACGTTCTTTGCAAAGAACGUAGCUACUUCCUCGGAAGUAGCUACGUUCUUUGCU19.718.933


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166GACUUGAGUGUUCCUUUUU81.41991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643184GACTTGAGTGTTCCTTTTTAAAAAGGAACACTCAAGTC0.118100.016300.819000.750001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GACAAACAUAAAGACAGAG74.26741703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983503GACAAACATAAAGACAGAGCTCTGTCTTTATGTTTGTC0.919300.891000.508600.500001.000001.00000


Target Position: 3376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3376CCAUCUUUUUCUUUUUAAC74.09331717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123394CCATCTTTTTCTTTTTAACGTTAAAAAGAAAAAGATGG0.673500.185800.698300.750001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048UGAAUAUACUACCAAGGAA91.9809215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281066TGAATATACTACCAAGGAATTCCTTGGTAGTATATTCA0.218300.034900.551700.750001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CCUGAGCCAGAUAACAAGA83.3969790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615824CCTGAGCCAGATAACAAGATCTTGTTATCTGGCTCAGG0.687600.200100.620700.750000.983700.62500


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149GAGGGCACCACCAAAAACU75.62371544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772167GAGGGCACCACCAAAAACTAGTTTTTGGTGGTGCCCTC0.174000.009500.603400.500000.962000.87500


Target Position: 3292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3292UCUAAGGAUAAUGAAAUAA77.81851322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913310TCTAAGGATAATGAAATAATTATTTCATTATCCTTAGA0.209500.098000.689700.750001.000001.00000


Target Position: 3197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197UUAUUUCUUUUUAAUUAUU70.97992055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223215TTATTTCTTTTTAATTATTAATAATTAAAAAGAAATAA0.137800.055100.525900.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519CAUUAAAUACAUCAUGCUU89.2681355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651537CATTAAATACATCATGCTTAAGCATGATGTATTTAATG0.293800.294500.517200.750001.000001.00000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803UGGAUGGUCAGGAAUAUGU69.09482237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791821TGGATGGTCAGGAATATGTACATATTCCTGACCATCCA0.126100.025400.637900.500001.000001.00000


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066UGGGGAUCAAUUUUCAUUA81.6468968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633084TGGGGATCAATTTTCATTATAATGAAAATTGATCCCCA0.331100.071700.810300.750001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582CUAGUCCACCACAAAUUAA89.7312327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519600CTAGTCCACCACAAATTAATTAATTTGTGGTGGACTAG0.614300.351800.637900.750001.000001.00000


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262GGGGUUGGGGAGGGAUGAA79.18971205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913280GGGGTTGGGGAGGGATGAATTCATCCCTCCCCAACCCC0.430200.014400.819001.000001.000001.00000


Target Position: 3700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3700GUAGGUUAUUUAAAAUAAA97.305949

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3698-3720CTGTAGGTTATTTAAAATAAATTUUUAUUUUAAAUAACCUACAGGUAGGUUAUUUAAAAUAAAUUU-9.719.802


Target Position: 2275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275GAAGGAUGCAAAGACGAAG74.34221695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782293GAAGGATGCAAAGACGAAGCTTCGTCTTTGCATCCTTC0.235100.071700.534500.500001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554AUAAAGAAGGAGAAGGAAA82.9042842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900572ATAAAGAAGGAGAAGGAAATTTCCTTCTCCTTCTTTAT0.089600.086700.543100.500001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GGAAUUUAAAAUUAAGUAG77.84151319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3453018GGAATTTAAAATTAAGTAGCTACTTAATTTTAAATTCC0.707800.260500.698300.750001.000001.00000


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634AGUCCAUUUCCCACAUCUU82.198915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523652AGTCCATTTCCCACATCTTAAGATGTGGGAAATGGACT0.249900.146400.569000.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769GCUGUAUGAUUUGUUUUGA85.6376620

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789TAGCTGTATGATTTGTTTTGAATUCAAAACAAAUCAUACAGCUAGCUGUAUGAUUUGUUUUGAAUU12.217.902


Target Position: 3073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3073CAAUUUUCAUUAAACUUGA89.051370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3071-3093ATCAATTTTCATTAAACTTGAAGUCAAGUUUAAUGAAAAUUGAUCAAUUUUCAUUAAACUUGAAGU10.30.402


Target Position: 1019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019GCUACGUUCUUUGCAAAAA85.3799640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1017-1039TAGCTACGTTCTTTGCAAAAATGUUUUUGCAAAGAACGUAGCUAGCUACGUUCUUUGCAAAAAUGU20.019.622


Target Position: 3539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3539AUGGAAAAAAACAUAAAAA84.0019731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573557ATGGAAAAAAACATAAAAATTTTTATGTTTTTTTCCAT0.083000.010900.655200.500001.000001.00000


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069GGAUCAAUUUUCAUUAAAC87.3731483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5703087GGATCAATTTTCATTAAACGTTTAATGAAAATTGATCC0.295000.209600.724100.750000.972800.62500


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851CCAUCAGAUACUAUAACAA99.72124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281869CCATCAGATACTATAACAATTGTTATAGTATCTGATGG0.245100.087200.698301.000001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CACAGACCGAGAGGAAAAU76.71811431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252383CACAGACCGAGAGGAAAATATTTTCCTCTCGGTCTGTG0.109700.054000.784500.750001.000001.00000


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217UAAAAUAUUUAAACCUUUU75.41471570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663235TAAAATATTTAAACCTTTTAAAAGGTTTAAATATTTTA0.148800.041800.534500.500001.000001.00000


Target Position: 3386, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386CUUUUUAACCCUAAUCUUU79.66551151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633404CTTTTTAACCCTAATCTTTAAAGATTAGGGTTAAAAAG0.129800.127200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3384-3406TTCTTTTTAACCCTAATCTTTCAAAAGAUUAGGGUUAAAAAGAACUUUUUAACCCUAAUCUUUCAU6.9-9.103


Target Position: 3645, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645CACAUCUUUCCUCAAGUAU79.33551191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2213663CACATCTTTCCTCAAGTATATACTTGAGGAAAGATGTG0.577800.230600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3643-3665CCCACATCTTTCCTCAAGTATCTAUACUUGAGGAAAGAUGUGGGCACAUCUUUCCUCAAGUAUCUU20.319.202


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548GCAAAAAUAAAGAAGGAGA86.1832567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710566GCAAAAATAAAGAAGGAGATCTCCTTCTTTATTTTTGC0.151800.164800.629300.750001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509GAAAAACGAAAAGAGGAAA85.6372621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588527GAAAAACGAAAAGAGGAAATTTCCTCTTTTCGTTTTTC0.210500.142400.672400.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845AGGACUCCAUCAGAUACUA88.7909388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541863AGGACTCCATCAGATACTATAGTATCTGATGGAGTCCT0.230500.017400.672400.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373GAGAGGAAAAUAAACAGAU88.7118396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962391GAGAGGAAAATAAACAGATATCTGTTTATTTTCCTCTC0.412500.069100.629300.750001.000001.00000


Target Position: 3167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167ACUUGAGUGUUCCUUUUUA88.9482376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753185ACTTGAGTGTTCCTTTTTATAAAAAGGAACACTCAAGT0.187500.015700.672400.750001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725CUAUGGACAACUUAUUUAA94.176109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502743CTATGGACAACTTATTTAATTAAATAAGTTGTCCATAG0.293500.111400.637900.750001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CUGGGGAUGCAAAAAUAAA88.3432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490558CTGGGGATGCAAAAATAAATTTATTTTTGCATCCCCAG0.909100.480200.784500.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583UAGUCCACCACAAAUUAAA79.82041134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835601TAGTCCACCACAAATTAAATTTAATTTGTGGTGGACTA0.573400.321400.672400.500001.000001.00000


Target Position: 3320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3320GAAACCAUUUUCCCAUCAU83.5619774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643338GAAACCATTTTCCCATCATATGATGGGAAAATGGTTTC0.191100.106300.517200.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819ACAAGAAAAAGAAGCCGAA82.9074841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897837ACAAGAAAAAGAAGCCGAATTCGGCTTCTTTTTCTTGT0.416100.388600.534500.750001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441AGGAGAAGACCAAACACAA94.328104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579459AGGAGAAGACCAAACACAATTGTGTTTGGTCTTCTCCT0.368300.085600.698300.750000.962000.75000


Target Position: 696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696CUAAGAAAAUUAAAACAGA90.9931257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
694-716ACCTAAGAAAATTAAAACAGAAGUCUGUUUUAAUUUUCUUAGGUCUAAGAAAAUUAAAACAGAAGU10.37.122


Target Position: 3495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495AAGAUUUUAGGGCUUUUAU75.25581591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9213513AAGATTTTAGGGCTTTTATATAAAAGCCCTAAAATCTT0.084400.038000.594800.500001.000001.00000


Target Position: 3202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3202UCUUUUUAAUUAUUUUAAA82.1767917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863220TCTTTTTAATTATTTTAAATTTAAAATAATTAAAAAGA0.159000.076700.724100.750001.000001.00000


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097AGAAAGGAAAUGACUAAUG68.98892250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471115AGAAAGGAAATGACTAATGCATTAGTCATTTCCTTTCT0.318700.060100.569000.500001.000001.00000


Target Position: 3124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3124GACACCUGUUCACAGAAAA92.1852201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553142GACACCTGTTCACAGAAAATTTTCTGTGAACAGGTGTC0.210300.011000.819000.750000.929300.87500


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719GCAAUGAAAAGGAGGAAGG61.60412888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901737GCAATGAAAAGGAGGAAGGCCTTCCTCCTTTTCATTGC0.272000.176700.508600.500001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196CGGAAACAGAUGAGCAAGG64.16382668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961214CGGAAACAGATGAGCAAGGCCTTGCTCATCTGTTTCCG0.066800.010700.569000.500001.000001.00000


Target Position: 3410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3410GAAAGAUUUUAUUGUAUAA104.2064

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3408-3430TTGAAAGATTTTATTGTATAAAAUUAUACAAUAAAAUCUUUCAAGAAAGAUUUUAUUGUAUAAAAU8.55.301


Target Position: 3199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3199AUUUCUUUUUAAUUAUUUU77.76681331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763217ATTTCTTTTTAATTATTTTAAAATAATTAAAAAGAAAT0.137600.043700.508600.500001.000001.00000


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440CAGGACAUAAGUGGAAAGA76.66241440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661458CAGGACATAAGTGGAAAGATCTTTCCACTTATGTCCTG0.162900.027500.560300.500001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GGAUUGCUAACUUCAAGAU87.9973446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481314GGATTGCTAACTTCAAGATATCTTGAAGTTAGCAATCC0.208700.037800.689701.000001.000001.00000


Target Position: 542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
542GGGGAUGCAAAAAUAAAGA83.9988732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440560GGGGATGCAAAAATAAAGATCTTTATTTTTGCATCCCC0.795400.500300.767200.750001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939UCUUUUUGAUAGACUCAAU80.50581067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171957TCTTTTTGATAGACTCAATATTGAGTCTATCAAAAAGA0.113100.021000.715500.750000.934800.62500


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568GACUGGCAGAAAUACGAGA87.6157466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831586GACTGGCAGAAATACGAGATCTCGTATTTCTGCCAGTC0.384800.009300.594800.500001.000001.00000


Target Position: 2732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732CAACUUAUUUAAAAAUAUU91.1056254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522750CAACTTATTTAAAAATATTAATATTTTTAAATAAGTTG0.510500.156600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2730-2752GACAACTTATTTAAAAATATTTCAAUAUUUUUAAAUAAGUUGUCCAACUUAUUUAAAAAUAUUUCU-10.34.601


Target Position: 3475, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3475CAAAAAAAGGAAAAAUAAU85.5834623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933493CAAAAAAAGGAAAAATAATATTATTTTTCCTTTTTTTG0.090900.032400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3473-3495TCCAAAAAAAGGAAAAATAATCAAUUAUUUUUCCUUUUUUUGGACAAAAAAAGGAAAAAUAAUCAU-9.7-11.311


Target Position: 3695, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3695CAACUGUAGGUUAUUUAAA93.1302162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3693-3715ATCAACTGTAGGTTATTTAAAATUUUAAAUAACCUACAGUUGAUCAACUGUAGGUUAUUUAAAAUU-7.519.002


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594CAUUAGUUUUAGAGGCAUU87.9264449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593612CATTAGTTTTAGAGGCATTAATGCCTCTAAAACTAATG0.073900.070100.646600.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GGAUGAUGCUGAUUAUAAA111.71

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_167619GGATGATGCTGATTATAAA1/1/0/0100.00TOP1NM_003286.21NANANA20:39708815,39709805..39708820,39709817(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436694GGATGATGCTGATTATAAATTTATAATCAGCATCATCC0.357400.077400.870701.000001.000001.00000


Target Position: 1880, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GAGAAACGAGUUUUUAAGA88.4893415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1878-1900TTGAGAAACGAGTTTTTAAGAACUCUUAAAAACUCGUUUCUCAAGAGAAACGAGUUUUUAAGAACU-3.819.722


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237GGAGAAUGAAAAAUUACUG80.03551109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001255GGAGAATGAAAAATTACTGCAGTAATTTTTCATTCTCC0.529300.379800.586200.750001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436AGAGAAGGAGAAGACCAAA88.4123424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761454AGAGAAGGAGAAGACCAAATTTGGTCTTCTCCTTCTCT0.131000.101400.724100.750000.962000.87500


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292GGAUUUCCGAUUGAAUGAU79.8061135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727310GGATTTCCGATTGAATGATATCATTCAATCGGAAATCC0.145600.033600.689701.000001.000001.00000


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804UUCCUGAGCCAGAUAACAA81.7248955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921822TTCCTGAGCCAGATAACAATTGTTATCTGGCTCAGGAA0.460400.150500.525900.500000.983700.87500


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844AGAGGAACAGAAGUGGAAA87.5994467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534862AGAGGAACAGAAGTGGAAATTTCCACTTCTGTTCCTCT0.240300.135100.724100.750001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055ACUACCAAGGAAAUAUUUA83.0931820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811073ACTACCAAGGAAATATTTATAAATATTTCCTTGGTAGT0.094400.024800.672400.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798AGAGUUGGAUGGUCAGGAA93.1247163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121816AGAGTTGGATGGTCAGGAATTCCTGACCATCCAACTCT0.247600.021500.551700.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508GGAAAAACGAAAAGAGGAA90.0356309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563526GGAAAAACGAAAAGAGGAATTCCTCTTTTCGTTTTTCC0.222500.154000.698301.000001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956GAGAAUGUCAAGUUUUAUU87.1741495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912974GAGAATGTCAAGTTTTATTAATAAAACTTGACATTCTC0.085800.032400.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
954-976CAGAGAATGTCAAGTTTTATTATAAUAAAACUUGACAUUCUCUGGAGAAUGUCAAGUUUUAUUAUU-0.319.222


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390GGAUAUAAUCAUCAACUGU91.1831252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511408GGATATAATCATCAACTGTACAGTTGATGATTATATCC0.103100.079300.663800.750001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344GAACACCGGCACAAAGAAC72.71841869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958362GAACACCGGCACAAAGAACGTTCTTTGTGCCGGTGTTC0.505500.160000.525900.500001.000001.00000


Target Position: 3656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656UCAAGUAUCUUCUAUUUUU81.19341016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6323674TCAAGTATCTTCTATTTTTAAAAATAGAAGATACTTGA0.539800.428300.724100.750001.000001.00000


Target Position: 1531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531CAUGCUUAACCCUAGUUCA92.0451208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1529-1551ATCATGCTTAACCCTAGTTCACGUGAACUAGGGUUAAGCAUGAUCAUGCUUAACCCUAGUUCACGU18.919.723


Target Position: 1259, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259GAAUAUGGAUUCUGUAUUA104.9723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1257-1279AAGAATATGGATTCTGTATTATGUAAUACAGAAUCCAUAUUCUUGAAUAUGGAUUCUGUAUUAUGU11.612.622


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497GACAGAGACAAGGAAAAAC74.08031720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808515GACAGAGACAAGGAAAAACGTTTTTCCTTGTCTCTGTC0.655600.628400.672400.500001.000001.00000


Target Position: 3191, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191GAAUUUUUAUUUCUUUUUA93.0276170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943209GAATTTTTATTTCTTTTTATAAAAAGAAATAAAAATTC0.090600.039900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3189-3211GTGAATTTTTATTTCTTTTTAATUAAAAAGAAAUAAAAAUUCACGAAUUUUUAUUUCUUUUUAAUU5.5-12.001


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087CCAGCGAAGAUCCUUUCUU76.31475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472105CCAGCGAAGATCCTTTCTTAAGAAAGGATCTTCGCTGG0.141900.011600.706901.000001.000001.00000


Target Position: 3528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528UUGUGUAAAAAAUGGAAAA75.53561555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013546TTGTGTAAAAAATGGAAAATTTTCCATTTTTTACACAA0.304100.028000.646600.500001.000001.00000


Target Position: 2645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645GGCAGCAAGUCUUAACAAA95.070586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1912663GGCAGCAAGTCTTAACAAATTTGTTAAGACTTGCTGCC0.593700.278301.000001.000001.000001.00000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727GGAGAAGAAAAGAAAACUA98.984229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277745GGAGAAGAAAAGAAAACTATAGTTTTCTTTTCTTCTCC0.631900.621000.698301.000001.000001.00000


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GCCAGUAUUUCAAAGCCCA85.7734604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541185GCCAGTATTTCAAAGCCCATGGGCTTTGAAATACTGGC0.171700.080400.655200.750001.000001.00000


Target Position: 3164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3164CUGACUUGAGUGUUCCUUU81.6999960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163182CTGACTTGAGTGTTCCTTTAAAGGAACACTCAAGTCAG0.085200.014700.784500.750001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395CAUAGCAACAGUGAACAUA89.1901360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635413CATAGCAACAGTGAACATATATGTTCACTGTTGCTATG0.634900.402300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
393-415AGCATAGCAACAGTGAACATAAAUAUGUUCACUGUUGCUAUGCUCAUAGCAACAGUGAACAUAAAU20.519.722


Target Position: 3178, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178CCUUUUUAAAUGUGAAUUU77.64181344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513196CCTTTTTAAATGTGAATTTAAATTCACATTTAAAAAGG0.136500.099600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3176-3198TTCCTTTTTAAATGTGAATTTTTAAAUUCACAUUUAAAAAGGAACCUUUUUAAAUGUGAAUUUUUU14.8-3.801


Target Position: 1115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115GAAGAGAAGAAUAUUAUCA96.402860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1113-1135ATGAAGAGAAGAATATTATCACCUGAUAAUAUUCUUCUCUUCAUGAAGAGAAGAAUAUUAUCACCU3.519.122


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213GGAAGAGAAACUGAAAAUC72.91241850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851231GGAAGAGAAACTGAAAATCGATTTTCAGTTTCTCTTCC0.341300.315300.689700.750001.000001.00000


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091GACUGGAGAAAGGAAAUGA88.4552419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941109GACTGGAGAAAGGAAATGATCATTTCCTTTCTCCAGTC0.409900.049500.594800.500001.000001.00000


Target Position: 2470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470UGAGAAGAUUUACAACAAA90.5082286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1782488TGAGAAGATTTACAACAAATTTGTTGTAAATCTTCTCA0.690200.523400.724100.750001.000001.00000


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212AGGAAGAGAAACUGAAAAU82.0141933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861230AGGAAGAGAAACTGAAAATATTTTCAGTTTCTCTTCCT0.359500.333600.836200.750001.000001.00000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170UGAGUGUUCCUUUUUAAAU75.8271527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6493188TGAGTGTTCCTTTTTAAATATTTAAAAAGGAACACTCA0.652200.037700.715500.750001.000001.00000


Target Position: 3550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550CAUAAAAAGCAGAAUUUUA97.070252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3548-3570AACATAAAAAGCAGAATTTTAATUAAAAUUCUGCUUUUUAUGUUCAUAAAAAGCAGAAUUUUAAUU0.4-9.711


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182GAUGAACUUGCAAACUAAG79.66871148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452200GATGAACTTGCAAACTAAGCTTAGTTTGCAAGTTCATC0.239800.030800.543100.500001.000001.00000


Target Position: 1023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CGUUCUUUGCAAAAAUGCU80.39071081

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1021-1043TACGTTCTTTGCAAAAATGCTCGAGCAUUUUUGCAAAGAACGUACGUUCUUUGCAAAAAUGCUCGU14.013.322


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136AACCUAAGCAAAUGUGAUU76.33231471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531154AACCTAAGCAAATGTGATTAATCACATTTGCTTAGGTT0.075700.022000.637900.500001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742ACUAGAAGAAGAAGAGGAU81.4849984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918760ACTAGAAGAAGAAGAGGATATCCTCTTCTTCTTCTAGT0.526600.470800.525900.750001.000001.00000


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GCAAAGACGAAGAAGGUAG72.95971846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6462300GCAAAGACGAAGAAGGTAGCTACCTTCTTCGTCTTTGC0.541700.146300.681000.750001.000001.00000


Target Position: 3243, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243CUUAAAGAUCGUGUAGAUU78.6571252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3241-3263ATCTTAAAGATCGTGTAGATTGGAAUCUACACGAUCUUUAAGAUCUUAAAGAUCGUGUAGAUUGGU20.37.113


Target Position: 3070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070GAUCAAUUUUCAUUAAACU90.0368308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090GGGATCAATTTTCATTAAACTTGAGUUUAAUGAAAAUUGAUCCCGAUCAAUUUUCAUUAAACUUGU-0.37.202


Target Position: 3230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230CCUUUUUCUUGAUCUUAAA91.9626216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250AACCTTTTTCTTGATCTTAAAGAUUUAAGAUCAAGAAAAAGGUUCCUUUUUCUUGAUCUUAAAGAU6.95.502


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476AAGCAUAAAGACAAACAUA93.2259157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979494AAGCATAAAGACAAACATATATGTTTGTCTTTATGCTT0.947400.469900.594800.500001.000001.00000


Target Position: 3473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473UCCAAAAAAAGGAAAAAUA76.84921418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203491TCCAAAAAAAGGAAAAATATATTTTTCCTTTTTTTGGA0.084400.050600.827600.750000.918500.62500


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211AAGGAAGAGAAACUGAAAA83.6085770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961229AAGGAAGAGAAACTGAAAATTTTCAGTTTCTCTTCCTT0.494600.411000.637900.500001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472AGAAAAGCAUAAAGACAAA93.0859164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423490AGAAAAGCATAAAGACAAATTTGTCTTTATGCTTTTCT0.957000.455200.724100.750001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374AGAGGAAAAUAAACAGAUU88.4329422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4412392AGAGGAAAATAAACAGATTAATCTGTTTATTTTCCTCT0.400900.076900.715500.750001.000001.00000


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594GGGAAAGAUGGAUAAACUG78.75441244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412612GGGAAAGATGGATAAACTGCAGTTTATCCATCTTTCCC0.176800.087600.706900.750001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CCACAGACCGAGAGGAAAA89.5863335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602382CCACAGACCGAGAGGAAAATTTTCCTCTCGGTCTGTGG0.099200.053200.844801.000001.000001.00000


Target Position: 3497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497GAUUUUAGGGCUUUUAUUU84.0468727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3495-3517AAGATTTTAGGGCTTTTATTTTTAAAUAAAAGCCCUAAAAUCUUGAUUUUAGGGCUUUUAUUUUUU-9.7-4.302


Target Position: 2978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2978CCCUUCCCUCUCUCCCAUU69.03582244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2472996CCCTTCCCTCTCTCCCATTAATGGGAGAGAGGGAAGGG0.519500.480700.982801.000001.000001.00000


Target Position: 892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CAUCAAGUGGAAAUUCCUA93.7039130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
890-912GGCATCAAGTGGAAATTCCTAGAUAGGAAUUUCCACUUGAUGCCCAUCAAGUGGAAAUUCCUAGAU18.719.223


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401AACAGUGAACAUAAAGAUU80.69151054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769419AACAGTGAACATAAAGATTAATCTTTATGTTCACTGTT0.129000.067200.637900.500001.000001.00000


Target Position: 2970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2970CCUAAACUCCCUUCCCUCU73.78861760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132988CCTAAACTCCCTTCCCTCTAGAGGGAAGGGAGTTTAGG0.900700.593800.620700.750001.000001.00000


Target Position: 3530, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3530GUGUAAAAAAUGGAAAAAA86.7867517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503548GTGTAAAAAATGGAAAAAATTTTTTCCATTTTTTACAC0.327500.052900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3528-3550TTGTGTAAAAAATGGAAAAAAACUUUUUUCCAUUUUUUACACAAGUGUAAAAAAUGGAAAAAAACU14.37.201


Target Position: 3593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593UCAUUAGUUUUAGAGGCAU71.75781967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333611TCATTAGTTTTAGAGGCATATGCCTCTAAAACTAATGA0.080800.079900.569000.750001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216AGAGAAACUGAAAAUCAAA94.4161101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331234AGAGAAACTGAAAATCAAATTTGATTTTCAGTTTCTCT0.450100.309800.724100.750001.000001.00000


Target Position: 12, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12GAACUUAGGCUGUUACACA98.329237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10-32GCGAACTTAGGCTGTTACACAACUGUGUAACAGCCUAAGUUCGCGAACUUAGGCUGUUACACAACU21.59.843


Target Position: 322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CAAAGAUAAACACAAAGAU87.925450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342CACAAAGATAAACACAAAGATCGAUCUUUGUGUUUAUCUUUGUGCAAAGAUAAACACAAAGAUCGU19.26.922


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563AGAAGGACUGGCAGAAAUA90.9813259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911581AGAAGGACTGGCAGAAATATATTTCTGCCAGTCCTTCT0.175600.008700.681000.750001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731ACAACUUAUUUAAAAAUAU83.4953782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272749ACAACTTATTTAAAAATATATATTTTTAAATAAGTTGT0.477800.156100.663800.750001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885ACGAGUUUUUAAGAACCUA82.5159880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581903ACGAGTTTTTAAGAACCTATAGGTTCTTAAAAACTCGT0.204200.057500.603400.750000.989100.62500


Target Position: 478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478GCAUAAAGACAAACAUAAA102.1429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32496GCATAAAGACAAACATAAATTTATGTTTGTCTTTATGC0.965000.908700.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
476-498AAGCATAAAGACAAACATAAAGAUUUAUGUUUGUCUUUAUGCUUGCAUAAAGACAAACAUAAAGAU6.93.512


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477AGCAUAAAGACAAACAUAA89.3215349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
239495AGCATAAAGACAAACATAATTATGTTTGTCTTTATGCT0.962800.908100.819000.750001.000001.00000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319ACACAAAGAUAAACACAAA95.785670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
602337ACACAAAGATAAACACAAATTTGTGTTTATCTTTGTGT0.962700.851500.706900.750001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031GCAAAAAUGCUCGACCAUG70.93422058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181049GCAAAAATGCTCGACCATGCATGGTCGAGCATTTTTGC0.148700.128700.698300.750000.929300.62500


Target Position: 3472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472GUCCAAAAAAAGGAAAAAU75.64421541

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3470-3492TGGTCCAAAAAAAGGAAAAATAAAUUUUUCCUUUUUUUGGACCAGUCCAAAAAAAGGAAAAAUAAU14.320.111


Target Position: 3211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3211UUAUUUUAAAAUAUUUAAA81.00451027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733229TTATTTTAAAATATTTAAATTTAAATATTTTAAAATAA0.232200.060300.534500.500001.000001.00000


Target Position: 3325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3325CAUUUUCCCAUCAUCCUUU79.86381129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5163343CATTTTCCCATCATCCTTTAAAGGATGATGGGAAAATG0.522400.145000.655200.750001.000001.00000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129CUGUUCACAGAAAAAGCAU77.32021372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063147CTGTTCACAGAAAAAGCATATGCTTTTTCTGTGAACAG0.290800.031900.629300.750001.000001.00000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724CCUAUGGACAACUUAUUUA91.652235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402742CCTATGGACAACTTATTTATAAATAAGTTGTCCATAGG0.236100.105800.810301.000001.000001.00000


Target Position: 749, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GAAGAAGAGGAUGGUAAAU83.7645757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613767GAAGAAGAGGATGGTAAATATTTACCATCCTCTTCTTC0.268900.202800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
747-769AAGAAGAAGAGGATGGTAAATTGAUUUACCAUCCUCUUCUUCUUGAAGAAGAGGAUGGUAAAUUGU20.019.112


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397UAGCAACAGUGAACAUAAA89.746325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
714415TAGCAACAGTGAACATAAATTTATGTTCACTGTTGCTA0.897000.411100.672400.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GGAUUCUGUAUUAUGGAUA93.1338161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1263-1285ATGGATTCTGTATTATGGATAACUAUCCAUAAUACAGAAUCCAUGGAUUCUGUAUUAUGGAUAACU21.220.422


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384GCCCGAGGAUAUAAUCAUC78.28631281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231402GCCCGAGGATATAATCATCGATGATTATATCCTCGGGC0.366900.029800.819000.750000.972800.62500


Target Position: 3586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3586GCUAUAAUCAUUAGUUUUA92.489188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843604GCTATAATCATTAGTTTTATAAAACTAATGATTATAGC0.366400.287000.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3584-3606TTGCTATAATCATTAGTTTTAGAUAAAACUAAUGAUUAUAGCAAGCUAUAAUCAUUAGUUUUAGAU4.9-2.702


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GGAUGCAAAAAUAAAGAAG76.4771458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536562GGATGCAAAAATAAAGAAGCTTCTTTATTTTTGCATCC0.277500.238100.732800.750001.000001.00000


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680AAGAUAAACCUGGAGAUAU81.5116981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352698AAGATAAACCTGGAGATATATATCTCCAGGTTTATCTT0.489400.018700.594800.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GCGGCUGAAAAAAUGUGUG67.29482409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811612GCGGCTGAAAAAATGTGTGCACACATTTTTTCAGCCGC0.070300.014700.629300.750001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCAGAAAAGCAUAAAGACA82.0937923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973488TCAGAAAAGCATAAAGACATGTCTTTATGCTTTTCTGA0.930500.441100.517200.500001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGAAAAAACCCAAGAAUAA85.2791651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300786TGAAAAAACCCAAGAATAATTATTCTTGGGTTTTTTCA0.532800.250000.689700.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166CUUUUGAGAAGUCUAUGAU83.2787807

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2164-2186AACTTTTGAGAAGTCTATGATGAAUCAUAGACUUCUCAAAAGUUCUUUUGAGAAGUCUAUGAUGAU21.412.203


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094UGGAGAAAGGAAAUGACUA85.8073602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521112TGGAGAAAGGAAATGACTATAGTCATTTCCTTTCTCCA0.346100.051500.672400.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053AUACUACCAAGGAAAUAUU78.86951232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701071ATACTACCAAGGAAATATTAATATTTCCTTGGTAGTAT0.143200.064000.534500.500001.000001.00000


Target Position: 967, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967GUUUUAUUAUGAUGGUAAA95.649574

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_896719GTTTTATTATGATGGTAAA1/1/0/096.22TOP1NM_003286.21NANANA4:76724846..76724864(+)00TOP1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
965-987AAGTTTTATTATGATGGTAAAGTUUUACCAUCAUAAUAAAACUUGUUUUAUUAUGAUGGUAAAGUU20.0-9.722


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397UGGGAACCUCCAAACUCAA81.3791996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932415TGGGAACCTCCAAACTCAATTGAGTTTGGAGGTTCCCA0.343300.008600.698300.750000.934800.62500


Target Position: 3176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3176UUCCUUUUUAAAUGUGAAU61.72982877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903194TTCCTTTTTAAATGTGAATATTCACATTTAAAAAGGAA0.151700.115300.663800.500001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708UCUGAGAGCAGGCAAUGAA82.0582929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271726TCTGAGAGCAGGCAATGAATTCATTGCCTGCTCTCAGA0.150000.026100.551700.750000.967400.62500


Target Position: 3288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288UGAAUCUAAGGAUAAUGAA84.6695685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513306TGAATCTAAGGATAATGAATTCATTATCCTTAGATTCA0.208100.017600.551700.750001.000001.00000


Target Position: 8, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8AUGCGAACUUAGGCUGUUA83.0272832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76826ATGCGAACTTAGGCTGTTATAACAGCCTAAGTTCGCAT0.221300.045300.620700.500000.972800.75000


Target Position: 2588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2588UGGUUUGGGAAAGAUGGAU64.79482619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622606TGGTTTGGGAAAGATGGATATCCATCTTTCCCAAACCA0.722200.025600.663800.750001.000001.00000


Target Position: 2269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269GGUCAUGAAGGAUGCAAAG77.15611391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052287GGTCATGAAGGATGCAAAGCTTTGCATCCTTCATGACC0.199900.058200.715500.750001.000001.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GUUGAGAAACGAGUUUUUA85.9437588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491895GTTGAGAAACGAGTTTTTATAAAAACTCGTTTCTCAAC0.129800.011500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1875-1897CTGTTGAGAAACGAGTTTTTAAGUAAAAACUCGUUUCUCAACAGGUUGAGAAACGAGUUUUUAAGU3.220.423


Target Position: 751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751AGAAGAGGAUGGUAAAUUG81.9297940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926769AGAAGAGGATGGTAAATTGCAATTTACCATCCTCTTCT0.276800.192800.577600.500001.000001.00000


Target Position: 3357, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3357GCUGUACCCUUUAAGAUAU88.5093412

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7335719GCTGTACCCTTTAAGATAT1/1/0/097.21TOP1NM_003286.21NANANA20:39752746..39752764(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453375GCTGTACCCTTTAAGATATATATCTTAAAGGGTACAGC0.104500.086900.810301.000000.945700.62500


Target Position: 2999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2999AGGAAUUUAAAAUUAAGUA87.0747502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4233017AGGAATTTAAAATTAAGTATACTTAATTTTAAATTCCT0.715000.167900.663800.750001.000001.00000


Target Position: 3655, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655CUCAAGUAUCUUCUAUUUU79.00421218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073673CTCAAGTATCTTCTATTTTAAAATAGAAGATACTTGAG0.567200.420200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3653-3675TCCTCAAGTATCTTCTATTTTTAAAAAUAGAAGAUACUUGAGGACUCAAGUAUCUUCUAUUUUUAU6.920.302


Target Position: 3272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272AGGGAUGAAGGGCGAGUGA74.08751719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573290AGGGATGAAGGGCGAGTGATCACTCGCCCTTCATCCCT0.389100.146400.620700.500001.000001.00000


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372CGAGAGGAAAAUAAACAGA87.7245458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572390CGAGAGGAAAATAAACAGATCTGTTTATTTTCCTCTCG0.469100.067700.569000.750001.000001.00000


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114UGAAGAGAAGAAUAUUAUC72.93251849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721132TGAAGAGAAGAATATTATCGATAATATTCTTCTCTTCA0.168100.116200.543100.500001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822AGAAAAAGAAGCCGAAGAA86.4832538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814840AGAAAAAGAAGCCGAAGAATTCTTCGGCTTCTTTTTCT0.400600.379400.551700.750001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CAGAUAACAAGAAAAAGAA95.564977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654831CAGATAACAAGAAAAAGAATTCTTTTTCTTGTTATCTG0.903800.638600.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
811-833GCCAGATAACAAGAAAAAGAAGCUUCUUUUUCUUGUUAUCUGGCCAGAUAACAAGAAAAAGAAGCU5.514.512


Target Position: 1255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255GAAAGAAUAUGGAUUCUGU93.6137134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1253-1275CTGAAAGAATATGGATTCTGTATACAGAAUCCAUAUUCUUUCAGGAAAGAAUAUGGAUUCUGUAUU20.45.322


Target Position: 3727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3727ACUUAAUGGAAAAAAAAAA83.8685745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3303745ACTTAATGGAAAAAAAAAATTTTTTTTTTCCATTAAGT0.978500.795700.706900.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952UCCAGAGAAUGUCAAGUUU74.29671697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881970TCCAGAGAATGTCAAGTTTAAACTTGACATTCTCTGGA0.183500.015300.870700.750001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CCAACCUAAGCAAAUGUGA78.08611296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781152CCAACCTAAGCAAATGTGATCACATTTGCTTAGGTTGG0.071000.027200.620700.750001.000001.00000


Target Position: 2402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402ACCUCCAAACUCAAUUAUC64.52282642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362420ACCTCCAAACTCAATTATCGATAATTGAGTTTGGAGGT0.550500.208000.672400.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723UGAAAAGGAGGAAGGAGAA81.5337979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031741TGAAAAGGAGGAAGGAGAATTCTCCTTCCTCCTTTTCA0.319700.168600.551700.750001.000001.00000


Target Position: 3413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413AGAUUUUAUUGUAUAAAAA96.598457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6993431AGATTTTATTGTATAAAAATTTTTATACAATAAAATCT0.430000.032500.724100.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846GGACUCCAUCAGAUACUAU94.918188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181864GGACTCCATCAGATACTATATAGTATCTGATGGAGTCC0.311500.020000.827601.000001.000001.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593UGGGAAAGAUGGAUAAACU80.85441040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492611TGGGAAAGATGGATAAACTAGTTTATCCATCTTTCCCA0.173900.084700.637900.500001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953UCAAUACUGGUAUUCUGAA83.4931783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211971TCAATACTGGTATTCTGAATTCAGAATACCAGTATTGA0.189200.012800.551700.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102GGAAAUGACUAAUGAAGAG84.3374709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861120GGAAATGACTAATGAAGAGCTCTTCATTAGTCATTTCC0.415700.211400.560300.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224UGAAAAUCAAAGAGGAGAA83.3442798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351242TGAAAATCAAAGAGGAGAATTCTCCTCTTTGATTTTCA0.485300.242700.551700.750001.000001.00000


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340UCGAGAACACCGGCACAAA78.10691294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572358TCGAGAACACCGGCACAAATTTGTGCCGGTGTTCTCGA0.329900.064200.793100.750001.000001.00000


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350GCUGGAAGUUCAAGCCACA92.7988176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942368GCTGGAAGTTCAAGCCACATGTGGCTTGAACTTCCAGC0.271500.070900.646600.750000.956500.62500


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801GUUGGAUGGUCAGGAAUAU83.514778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731819GTTGGATGGTCAGGAATATATATTCCTGACCATCCAAC0.221400.015800.603400.750001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878UUGAGAAACGAGUUUUUAA82.8818843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701896TTGAGAAACGAGTTTTTAATTAAAAACTCGTTTCTCAA0.121800.029600.612100.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895AAGAACCUACAACUAUUUA84.1166723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521913AAGAACCTACAACTATTTATAAATAGTTGTAGGTTCTT0.541200.176700.603400.500001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625UGUGUGCAGAGUCCAUUUC58.36193124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723643TGTGTGCAGAGTCCATTTCGAAATGGACTCTGCACACA0.205300.010100.534500.500001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371CCGAGAGGAAAAUAAACAG74.17731712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842389CCGAGAGGAAAATAAACAGCTGTTTATTTTCCTCTCGG0.459100.060200.629300.750001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CGGCGGCUGAAAAAAUGUG66.98662435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5991610CGGCGGCTGAAAAAATGTGCACATTTTTTCAGCCGCCG0.348300.058300.620700.750001.000001.00000


Target Position: 3208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3208UAAUUAUUUUAAAAUAUUU85.8453599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173226TAATTATTTTAAAATATTTAAATATTTTAAAATAATTA0.234800.124900.534500.500001.000001.00000


Target Position: 3414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3414GAUUUUAUUGUAUAAAAAG81.6823965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433432GATTTTATTGTATAAAAAGCTTTTTATACAATAAAATC0.470500.084200.543100.500001.000001.00000


Target Position: 3531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3531UGUAAAAAAUGGAAAAAAA88.6666400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5613549TGTAAAAAATGGAAAAAAATTTTTTTCCATTTTTTACA0.382300.050400.706900.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898GUGGAAAUUCCUAGAACAU85.0262664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753916GTGGAAATTCCTAGAACATATGTTCTAGGAATTTCCAC0.249800.026400.637900.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
896-918AAGTGGAAATTCCTAGAACATAAAUGUUCUAGGAAUUUCCACUUGUGGAAAUUCCUAGAACAUAAU20.320.122


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653UCCUCAAGUAUCUUCUAUU79.19251204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2583671TCCTCAAGTATCTTCTATTAATAGAAGATACTTGAGGA0.568600.411700.862100.750001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CGGAUUUCCGAUUGAAUGA81.6383971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798309CGGATTTCCGATTGAATGATCATTCAATCGGAAATCCG0.245900.022000.689700.750000.907600.62500


Target Position: 778, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778CAAGAAUAAAGAUAAAGAU92.2318199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
776-798CCCAAGAATAAAGATAAAGATAAAUCUUUAUCUUUAUUCUUGGGCAAGAAUAAAGAUAAAGAUAAU6.96.921


Target Position: 2188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188CUUGCAAACUAAGAUUGAU84.5006699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2186-2208AACTTGCAAACTAAGATTGATGCAUCAAUCUUAGUUUGCAAGUUCUUGCAAACUAAGAUUGAUGCU20.420.003


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CCUAAGCAAAUGUGAUUUU77.20291382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151156CCTAAGCAAATGTGATTTTAAAATCACATTTGCTTAGG0.085300.034000.844801.000001.000001.00000


Target Position: 633, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633CUCCUAAAGAGGAUAUAAA93.6017136

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1063319CTCCTAAAGAGGATATAAA1/1/0/094.96TOP1NM_003286.21NANANA20:39708772..39708790(+)00TOP1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
631-653TCCTCCTAAAGAGGATATAAAGCUUUAUAUCCUCUUUAGGAGGACUCCUAAAGAGGAUAUAAAGCU3.519.922


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCUUCCAGAGAAUGUCAAG63.98712689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861967TCTTCCAGAGAATGTCAAGCTTGACATTCTCTGGAAGA0.153200.016400.586200.500001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GGAUAUAAAGCCAUUAAAG84.6176688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637661GGATATAAAGCCATTAAAGCTTTAATGGCTTTATATCC0.178300.074100.732800.750001.000001.00000


Target Position: 2466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CAAUUGAGAAGAUUUACAA97.872946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2464-2486CCCAATTGAGAAGATTTACAACAUUGUAAAUCUUCUCAAUUGGGCAAUUGAGAAGAUUUACAACAU6.912.002


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GAUGAGCAAGGAAGAGAAA93.294154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351222GATGAGCAAGGAAGAGAAATTTCTCTTCCTTGCTCATC0.884800.054900.681000.750001.000001.00000


Target Position: 3355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355UCGCUGUACCCUUUAAGAU72.26441903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093373TCGCTGTACCCTTTAAGATATCTTAAAGGGTACAGCGA0.113300.013200.612100.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801AAGUUCCUGAGCCAGAUAA80.39521079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
820819AAGTTCCTGAGCCAGATAATTATCTGGCTCAGGAACTT0.410600.111500.603400.500000.983701.00000


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CAUAAACACAAAGAUAAAC71.08722038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992332CATAAACACAAAGATAAACGTTTATCTTTGTGTTTATG0.869900.836200.508600.500001.000001.00000


Target Position: 3519, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519CUUUUGUAAUUGUGUAAAA91.1533253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5833537CTTTTGTAATTGTGTAAAATTTTACACAATTACAAAAG0.215300.116000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3517-3539TTCTTTTGTAATTGTGTAAAAAAUUUUACACAAUUACAAAAGAACUUUUGUAAUUGUGUAAAAAAU14.77.202


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589ACCACAAAUUAAAGAUGAA89.8267319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362607ACCACAAATTAAAGATGAATTCATCTTTAATTTGTGGT0.387300.283700.681000.750001.000001.00000


Target Position: 1530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530UCAUGCUUAACCCUAGUUC56.22943250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471548TCATGCTTAACCCTAGTTCGAACTAGGGTTAAGCATGA0.077100.077000.551700.500001.000001.00000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916CGUUUUUACAGUUAGGGUU79.14541209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942934CGTTTTTACAGTTAGGGTTAACCCTAACTGTAAAAACG0.067100.016500.629301.000001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363GCCACAGACCGAGAGGAAA85.1104660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022381GCCACAGACCGAGAGGAAATTTCCTCTCGGTCTGTGGC0.089200.050301.000001.000001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233AAGAGGAGAAUGAAAAAUU80.34481086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581251AAGAGGAGAATGAAAAATTAATTTTTCATTCTCCTCTT0.583800.368600.629300.500001.000001.00000


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807UGGUCAGGAAUAUGUGGUA83.986734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401825TGGTCAGGAATATGTGGTATACCACATATTCCTGACCA0.140900.036400.663800.750001.000001.00000


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AGAGGAUGGUAAAUUGAAA96.148365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358772AGAGGATGGTAAATTGAAATTTCAATTTACCATCCTCT0.758600.185800.724100.750001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203AGAUGAGCAAGGAAGAGAA94.898689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091221AGATGAGCAAGGAAGAGAATTCTCTTCCTTGCTCATCT0.832800.043400.551700.750001.000001.00000


Target Position: 3636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3636UCCAUUUCCCACAUCUUUC56.71993225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7283654TCCATTTCCCACATCTTTCGAAAGATGTGGGAAATGGA0.272600.176300.698300.500001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675GCGAAAAGAUAAACCUGGA87.6793461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892693GCGAAAAGATAAACCTGGATCCAGGTTTATCTTTTCGC0.106300.008900.551700.750001.000001.00000


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068GGGAUCAAUUUUCAUUAAA90.8889266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4363086GGGATCAATTTTCATTAAATTTAATGAAAATTGATCCC0.307800.118700.991401.000000.972800.62500


Target Position: 3264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3264GGUUGGGGAGGGAUGAAGG66.16042498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933282GGTTGGGGAGGGATGAAGGCCTTCATCCCTCCCCAACC0.521300.043400.508600.500001.000001.00000


Target Position: 3122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3122CAGACACCUGUUCACAGAA94.2404106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983140CAGACACCTGTTCACAGAATTCTGTGAACAGGTGTCTG0.112900.008400.612100.750000.929300.62500


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089AGCGAAGAUCCUUUCUUAU81.8114946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472107AGCGAAGATCCTTTCTTATATAAGAAAGGATCTTCGCT0.206600.027300.810300.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GAACAGAAGUGGAAAUGGU84.7755680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
846-868AGGAACAGAAGTGGAAATGGTGGACCAUUUCCACUUCUGUUCCUGAACAGAAGUGGAAAUGGUGGU20.119.212


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119AGAAGAAUAUUAUCACCAA99.734323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181137AGAAGAATATTATCACCAATTGGTGATAATATTCTTCT0.208600.117500.577600.750001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CAGAAAAGCAUAAAGACAA93.684131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566489CAGAAAAGCATAAAGACAATTGTCTTTATGCTTTTCTG0.955500.450200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
469-491CTCAGAAAAGCATAAAGACAAACUUGUCUUUAUGCUUUUCUGAGCAGAAAAGCAUAAAGACAAACU19.210.312


Target Position: 3654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654CCUCAAGUAUCUUCUAUUU88.5021414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2113672CCTCAAGTATCTTCTATTTAAATAGAAGATACTTGAGG0.567600.409900.844801.000001.000001.00000


Target Position: 1515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GUUCCAUUAAAUACAUCAU85.3382643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1513-1535AGGTTCCATTAAATACATCATGCAUGAUGUAUUUAAUGGAACCUGUUCCAUUAAAUACAUCAUGCU21.520.122


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GAAUAUACUACCAAGGAAA98.884930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491067GAATATACTACCAAGGAAATTTCCTTGGTAGTATATTC0.103500.041800.672400.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951UUCCAGAGAAUGUCAAGUU69.21562224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917969TTCCAGAGAATGTCAAGTTAACTTGACATTCTCTGGAA0.142700.015600.525900.500001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GGAAAUUCCUAGAACAUAA103.3125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526918GGAAATTCCTAGAACATAATTATGTTCTAGGAATTTCC0.559700.057500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
898-920GTGGAAATTCCTAGAACATAAAGUUAUGUUCUAGGAAUUUCCACGGAAAUUCCUAGAACAUAAAGU16.110.412


Target Position: 3635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635GUCCAUUUCCCACAUCUUU76.84181420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6013653GTCCATTTCCCACATCTTTAAAGATGTGGGAAATGGAC0.260800.162100.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3633-3655GAGTCCATTTCCCACATCTTTCCAAAGAUGUGGGAAAUGGACUCGUCCAUUUCCCACAUCUUUCCU19.220.102


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CCUCCAAACUCAAUUAUCU86.7054520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122421CCTCCAAACTCAATTATCTAGATAATTGAGTTTGGAGG0.242000.201800.620700.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GAAAAAACCCAAGAAUAAA92.7932177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352787GAAAAAACCCAAGAATAAATTTATTCTTGGGTTTTTTC0.639000.253200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
767-789TTGAAAAAACCCAAGAATAAAGAUUUAUUCUUGGGUUUUUUCAAGAAAAAACCCAAGAAUAAAGAU6.9-1.822


Target Position: 2852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852CACUGUUUCACUGAAAUGU75.1381606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2850-2872TTCACTGTTTCACTGAAATGTTTACAUUUCAGUGAAACAGUGAACACUGUUUCACUGAAAUGUUUU13.817.802


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728GAGAAGAAAAGAAAACUAG79.45381178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
652746GAGAAGAAAAGAAAACTAGCTAGTTTTCTTTTCTTCTC0.628900.623900.637900.500001.000001.00000


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385UCUUUUUAACCCUAAUCUU73.00321839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303403TCTTTTTAACCCTAATCTTAAGATTAGGGTTAAAAAGA0.144800.130300.586200.750001.000001.00000


Target Position: 3728, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3728CUUAAUGGAAAAAAAAAAA82.4845882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5203746CTTAATGGAAAAAAAAAAATTTTTTTTTTTCCATTAAG0.982900.804400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3726-3748AACTTAATGGAAAAAAAAAAAAAUUUUUUUUUUUCCAUUAAGUUCUUAAUGGAAAAAAAAAAAAAU-11.312.81


Target Position: 3125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125ACACCUGUUCACAGAAAAA89.5546336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653143ACACCTGTTCACAGAAAAATTTTTCTGTGAACAGGTGT0.208900.010600.706900.750000.929300.87500


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788GAUAAAGAUAAAAAAGUUC75.14611605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980806GATAAAGATAAAAAAGTTCGAACTTTTTTATCTTTATC0.346200.324800.508600.500001.000001.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GAUUGCUAACUUCAAGAUA93.6058135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071315GATTGCTAACTTCAAGATATATCTTGAAGTTAGCAATC0.199300.051100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317AGGATTGCTAACTTCAAGATAGAUAUCUUGAAGUUAGCAAUCCUGAUUGCUAACUUCAAGAUAGAU20.419.732


Target Position: 3721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721CCUACAACUUAAUGGAAAA94.92587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3719-3741TTCCTACAACTTAATGGAAAAAAUUUUCCAUUAAGUUGUAGGAACCUACAACUUAAUGGAAAAAAU20.119.0


Target Position: 3371, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371GAUAUCCAUCUUUUUCUUU81.7015959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3883389GATATCCATCTTTTTCTTTAAAGAAAAAGATGGATATC0.382100.149800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3369-3391AAGATATCCATCTTTTTCTTTTTAAAGAAAAAGAUGGAUAUCUUGAUAUCCAUCUUUUUCUUUUUU5.521.202


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277AGGAUGCAAAGACGAAGAA81.11471020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372295AGGATGCAAAGACGAAGAATTCTTCGTCTTTGCATCCT0.239800.117900.672400.750001.000001.00000


Target Position: 2297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2297GUAGUAGAGUCAAAGAAGA91.4607240

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2295-2317AGGTAGTAGAGTCAAAGAAGAAGUCUUCUUUGACUCUACUACCUGUAGUAGAGUCAAAGAAGAAGU10.320.102


Target Position: 1718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718GGCAAUGAAAAGGAGGAAG65.36072574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841736GGCAATGAAAAGGAGGAAGCTTCCTCCTTTTCATTGCC0.268700.198500.862100.750001.000001.00000


Target Position: 3484, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484GAAAAAUAAUCAAGAUUUU89.3319347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593502GAAAAATAATCAAGATTTTAAAATCTTGATTATTTTTC0.269500.026000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3482-3504AGGAAAAATAATCAAGATTTTAGAAAAUCUUGAUUAUUUUUCCUGAAAAAUAAUCAAGAUUUUAGU5.3-9.701


Target Position: 2930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2930GGGUUUUGCAAUAACUUCU80.50511068

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2928-2950TAGGGTTTTGCAATAACTTCTATAGAAGUUAUUGCAAAACCCUAGGGUUUUGCAAUAACUUCUAUU14.618.802


Target Position: 420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420CUGAAAAGAAACACAAAGA84.6061689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
418-440TTCTGAAAAGAAACACAAAGAGAUCUUUGUGUUUCUUUUCAGAACUGAAAAGAAACACAAAGAGAU16.712.212


Target Position: 901, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GAAAUUCCUAGAACAUAAA93.7444128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
669919GAAATTCCTAGAACATAAATTTATGTTCTAGGAATTTC0.165700.037900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
899-921TGGAAATTCCTAGAACATAAAGGUUUAUGUUCUAGGAAUUUCCAGAAAUUCCUAGAACAUAAAGGU6.914.223


Target Position: 3573, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3573GAAGACAUUUUUUGCUAUA93.4789144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3571-3593GTGAAGACATTTTTTGCTATAATUAUAGCAAAAAAUGUCUUCACGAAGACAUUUUUUGCUAUAAUU19.719.202


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161AGAUGAGCCAGUAUUUCAA93.5242142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171179AGATGAGCCAGTATTTCAATTGAAATACTGGCTCATCT0.519400.043600.577600.750001.000001.00000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387CGAGGAUAUAAUCAUCAAC80.42661077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401405CGAGGATATAATCATCAACGTTGATGATTATATCCTCG0.105400.047000.646600.750000.983700.62500


Target Position: 2944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944CUUCUAUAUUUUAAUAGAA97.428148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2942-2964AACTTCTATATTTTAATAGAAATUUCUAUUAAAAUAUAGAAGUUCUUCUAUAUUUUAAUAGAAAUU8.48.402


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159CCAGAUGAGCCAGUAUUUC67.28952410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681177CCAGATGAGCCAGTATTTCGAAATACTGGCTCATCTGG0.491700.035900.672400.750001.000001.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419UCUGAAAAGAAACACAAAG62.0732844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691437TCTGAAAAGAAACACAAAGCTTTGTGTTTCTTTTCAGA0.589900.119100.586200.500001.000001.00000


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363CCCUUUAAGAUAUCCAUCU75.81171530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183381CCCTTTAAGATATCCATCTAGATGGATATCTTAAAGGG0.250100.064200.767200.750001.000001.00000


Target Position: 3270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270GGAGGGAUGAAGGGCGAGU69.11142235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263288GGAGGGATGAAGGGCGAGTACTCGCCCTTCATCCCTCC0.387300.137500.663800.750001.000001.00000


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808UGAGCCAGAUAACAAGAAA86.6297528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182826TGAGCCAGATAACAAGAAATTTCTTGTTATCTGGCTCA0.706600.311000.724100.750001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886UGAAGGCAUCAAGUGGAAA78.93931227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986904TGAAGGCATCAAGTGGAAATTTCCACTTGATGCCTTCA0.069000.030900.724100.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398GGGAACCUCCAAACUCAAU80.10821103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702416GGGAACCTCCAAACTCAATATTGAGTTTGGAGGTTCCC0.660300.035800.982801.000000.967400.62500


Target Position: 2917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2917GUUUUUACAGUUAGGGUUU74.45261685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572935GTTTTTACAGTTAGGGTTTAAACCCTAACTGTAAAAAC0.187600.016700.646600.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733AACUUAUUUAAAAAUAUUU78.3241275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572751AACTTATTTAAAAATATTTAAATATTTTTAAATAAGTT0.470800.185300.646600.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881AGAAACGAGUUUUUAAGAA85.4726633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021899AGAAACGAGTTTTTAAGAATTCTTAAAAACTCGTTTCT0.156900.077700.551700.750001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567GGACUGGCAGAAAUACGAG78.94491225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461585GGACTGGCAGAAATACGAGCTCGTATTTCTGCCAGTCC0.394100.011600.560300.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459AAGAUGGAAGCUCAGAAAA81.6865962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899477AAGATGGAAGCTCAGAAAATTTTCTGAGCTTCCATCTT0.097700.013800.637900.500001.000001.00000


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171GAGUGUUCCUUUUUAAAUG80.44291073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933189GAGTGTTCCTTTTTAAATGCATTTAAAAAGGAACACTC0.284400.039500.655200.500001.000001.00000


Target Position: 3505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3505GGCUUUUAUUUUUUCUUUU82.2473911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803523GGCTTTTATTTTTTCTTTTAAAAGAAAAAATAAAAGCC0.125700.034401.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3503-3525AGGGCTTTTATTTTTTCTTTTGTAAAAGAAAAAAUAAAAGCCCUGGCUUUUAUUUUUUCUUUUGUU5.513.702


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150AGGGCACCACCAAAAACUU75.79111532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782168AGGGCACCACCAAAAACTTAAGTTTTTGGTGGTGCCCT0.160700.009500.706900.750000.962000.75000


Target Position: 2993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2993CAUUUCAGGAAUUUAAAAU81.736954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2991-3013CCCATTTCAGGAATTTAAAATTAAUUUUAAAUUCCUGAAAUGGGCAUUUCAGGAAUUUAAAAUUAU-9.112.002


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897GAACCUACAACUAUUUAUG79.94711118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571915GAACCTACAACTATTTATGCATAAATAGTTGTAGGTTC0.293700.137500.517200.500001.000001.00000


Target Position: 3680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3680GAAUUCCCUUUUAAUCAAC72.55541881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783698GAATTCCCTTTTAATCAACGTTGATTAAAAGGGAATTC0.567000.363400.525900.500001.000001.00000


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652UUCCUCAAGUAUCUUCUAU70.03892148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393670TTCCTCAAGTATCTTCTATATAGAAGATACTTGAGGAA0.574100.420800.629300.500001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GAGUUGGAUGGUCAGGAAU83.3281801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761817GAGTTGGATGGTCAGGAATATTCCTGACCATCCAACTC0.300600.024700.801700.750001.000001.00000


Target Position: 3407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3407CUUGAAAGAUUUUAUUGUA94.853990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3405-3427CACTTGAAAGATTTTATTGTATAUACAAUAAAAUCUUUCAAGUGCUUGAAAGAUUUUAUUGUAUAU6.912.202


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502AGACAAGGAAAAACGAAAA85.9817587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479520AGACAAGGAAAAACGAAAATTTTCGTTTTTCCTTGTCT0.278700.282700.724100.750001.000001.00000


Target Position: 3263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3263GGGUUGGGGAGGGAUGAAG63.67882716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313281GGGTTGGGGAGGGATGAAGCTTCATCCCTCCCCAACCC0.518200.018900.853400.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539UCUGGGGAUGCAAAAAUAA78.85361236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482557TCTGGGGATGCAAAAATAATTATTTTTGCATCCCCAGA0.892500.494800.689700.750001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349CCGGCACAAAGAACACAAG70.52282105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328367CCGGCACAAAGAACACAAGCTTGTGTTCTTTGTGCCGG0.776600.258200.775900.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439CCAGGACAUAAGUGGAAAG75.0091623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201457CCAGGACATAAGTGGAAAGCTTTCCACTTATGTCCTGG0.154700.020000.706900.750001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CGCUAUCCUGAAGGCAUCA81.12671019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979896CGCTATCCTGAAGGCATCATGATGCCTTCAGGATAGCG0.292500.009500.698300.750000.983700.62500


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCAUGAAUAUACUACCAAG90.7721272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781063CCATGAATATACTACCAAGCTTGGTAGTATATTCATGG0.216500.024600.706900.750001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726AGGAGAAGAAAAGAAAACU75.14851604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782744AGGAGAAGAAAAGAAAACTAGTTTTCTTTTCTTCTCCT0.635400.617500.637900.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GACAAGGAAAAACGAAAAG66.75072455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754521GACAAGGAAAAACGAAAAGCTTTTCGTTTTTCCTTGTC0.219300.233600.681000.500001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GAAAAAGAAGCCGAAGAAA88.5833410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412841GAAAAAGAAGCCGAAGAAATTTCTTCGGCTTCTTTTTC0.425200.382600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
821-843AAGAAAAAGAAGCCGAAGAAAGAUUUCUUCGGCUUCUUUUUCUUGAAAAAGAAGCCGAAGAAAGAU21.05.511


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684CUGAUUAUAAACCUAAGAA90.5363283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631702CTGATTATAAACCTAAGAATTCTTAGGTTTATAATCAG0.716400.316500.612100.750001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957AGAAUGUCAAGUUUUAUUA87.8813452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984975AGAATGTCAAGTTTTATTATAATAAAACTTGACATTCT0.069200.024000.689700.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601AGAUGAACCUGAAGAUGAU93.4297147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974619AGATGAACCTGAAGATGATATCATCTTCAGGTTCATCT0.071900.025000.543100.750001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695CCUAAGAAAAUUAAAACAG70.35962116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797713CCTAAGAAAATTAAAACAGCTGTTTTAATTTTCTTAGG0.797100.747900.560300.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GAGAAUGAAAAAUUACUGA89.7324326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1236-1258AGGAGAATGAAAAATTACTGAAAUCAGUAAUUUUUCAUUCUCCUGAGAAUGAAAAAUUACUGAAAU11.620.411


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085UCCCAGCGAAGAUCCUUUC51.53593444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522103TCCCAGCGAAGATCCTTTCGAAAGGATCTTCGCTGGGA0.076400.011800.698300.500000.994600.62500


Target Position: 1952, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952CUCAAUACUGGUAUUCUGA84.4056705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341970CTCAATACTGGTATTCTGATCAGAATACCAGTATTGAG0.080700.013100.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1950-1972GACTCAATACTGGTATTCTGAATUCAGAAUACCAGUAUUGAGUCCUCAAUACUGGUAUUCUGAAUU13.416.103


Target Position: 3493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493UCAAGAUUUUAGGGCUUUU68.93522256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7293511TCAAGATTTTAGGGCTTTTAAAAGCCCTAAAATCTTGA0.145000.070500.724100.750001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438AGAAGGAGAAGACCAAACA84.2756716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961456AGAAGGAGAAGACCAAACATGTTTGGTCTTCTCCTTCT0.123700.093000.517200.500000.962001.00000


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274GGAUGAAGGGCGAGUGAAU90.9801260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7023292GGATGAAGGGCGAGTGAATATTCACTCGCCCTTCATCC0.153300.086200.862101.000001.000001.00000


Target Position: 283, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283GAUCGAAGCGGAUUUCCGA86.7953516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
281-303CAGATCGAAGCGGATTTCCGATTUCGGAAAUCCGCUUCGAUCUGGAUCGAAGCGGAUUUCCGAUUU20.721.033


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761GGUAAAUUGAAAAAACCCA86.5556534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994779GGTAAATTGAAAAAACCCATGGGTTTTTTCAATTTACC0.290900.227000.508600.750001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885CUGAAGGCAUCAAGUGGAA85.0622662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998903CTGAAGGCATCAAGTGGAATTCCACTTGATGCCTTCAG0.066600.036200.612100.750000.972800.62500


Target Position: 422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GAAAAGAAACACAAAGAGA93.2593155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
420-442CTGAAAAGAAACACAAAGAGAAGUCUCUUUGUGUUUCUUUUCAGGAAAAGAAACACAAAGAGAAGU16.65.511


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834CGAAGAAAGAAGAGGAACA91.4663238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692852CGAAGAAAGAAGAGGAACATGTTCCTCTTCTTTCTTCG0.415500.350600.586200.750001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368AGACCGAGAGGAAAAUAAA92.9601171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5122386AGACCGAGAGGAAAATAAATTTATTTTCCTCTCGGTCT0.596700.059600.724100.750001.000001.00000


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924CAGUUAGGGUUUUGCAAUA93.2947153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702942CAGTTAGGGTTTTGCAATATATTGCAAAACCCTAACTG0.175200.025000.741400.750001.000001.00000


Target Position: 3482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3482AGGAAAAAUAAUCAAGAUU78.60291256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893500AGGAAAAATAATCAAGATTAATCTTGATTATTTTTCCT0.226700.022500.836200.750001.000001.00000


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352GCACAAAGAACACAAGAAG77.12171394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283370GCACAAAGAACACAAGAAGCTTCTTGTGTTCTTTGTGC0.739100.320100.715500.750001.000001.00000


Target Position: 3289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289GAAUCUAAGGAUAAUGAAA101.31716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653307GAATCTAAGGATAATGAAATTTCATTATCCTTAGATTC0.202900.016200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3287-3309GTGAATCTAAGGATAATGAAATAUUUCAUUAUCCUUAGAUUCACGAAUCUAAGGAUAAUGAAAUAU8.96.911


Target Position: 279, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279CCCAGAUCGAAGCGGAUUU70.83572071

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_927919CCCAGATCGAAGCGGATTT1/1/0/094.96TOP1NM_003286.21NANANANA00TOP1(0.002)


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925AGUAUUUGCCCCACCAUAU79.4751175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512943AGTATTTGCCCCACCATATATATGGTGGGGCAAATACT0.259000.117300.663800.750001.000001.00000


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903ACAACUAUUUAUGGAGAAC66.40182481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211921ACAACTATTTATGGAGAACGTTCTCCATAAATAGTTGT0.214800.153400.560300.500001.000001.00000


Target Position: 10, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10GCGAACUUAGGCUGUUACA82.3454899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
49628GCGAACTTAGGCTGTTACATGTAACAGCCTAAGTTCGC0.287400.062400.715500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8-30ATGCGAACTTAGGCTGTTACACAUGUAACAGCCUAAGUUCGCAUGCGAACUUAGGCUGUUACACAU19.019.723


Target Position: 3324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3324CCAUUUUCCCAUCAUCCUU77.54531353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3083342CCATTTTCCCATCATCCTTAAGGATGATGGGAAAATGG0.600200.138000.706901.000001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GAUGAGCCAGUAUUUCAAA95.191884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511180GATGAGCCAGTATTTCAAATTTGAAATACTGGCTCATC0.549900.051900.681000.750001.000001.00000


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GUGGAAAUGGUGGGAAGAA83.3925792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888874GTGGAAATGGTGGGAAGAATTCTTCCCACCATTTCCAC0.092600.059500.620700.750001.000001.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347CACCGGCACAAAGAACACA81.683963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870365CACCGGCACAAAGAACACATGTGTTCTTTGTGCCGGTG0.823000.180400.586200.500001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225GAAAAUCAAAGAGGAGAAU78.89871230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121243GAAAATCAAAGAGGAGAATATTCTCCTCTTTGATTTTC0.461900.239200.663800.750001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902UACAACUAUUUAUGGAGAA79.89271123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751920TACAACTATTTATGGAGAATTCTCCATAAATAGTTGTA0.216800.153000.508600.500001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AGGAUAUAAAGCCAUUAAA88.6412402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694660AGGATATAAAGCCATTAAATTTAATGGCTTTATATCCT0.156100.046100.844800.750001.000001.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307UGAUUCUCAUAAACACAAA87.1083499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529325TGATTCTCATAAACACAAATTTGTGTTTATGAGAATCA0.927800.089100.724100.750001.000001.00000


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059CCAAGGAAAUAUUUAGGAA95.767971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321077CCAAGGAAATATTTAGGAATTCCTAAATATTTCCTTGG0.143700.039200.672401.000001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GACUCCAUCAGAUACUAUA98.488235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421865GACTCCATCAGATACTATATATAGTATCTGATGGAGTC0.320600.028000.775900.750001.000001.00000


Target Position: 733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733GAAAAGAAAACUAGAAGAA93.6622132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
731-753AAGAAAAGAAAACTAGAAGAAGAUUCUUCUAGUUUUCUUUUCUUGAAAAGAAAACUAGAAGAAGAU20.25.512


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543GGGAUGCAAAAAUAAAGAA91.6878231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92561GGGATGCAAAAATAAAGAATTCTTTATTTTTGCATCCC0.789700.576100.819001.000001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891GCAUCAAGUGGAAAUUCCU85.7363609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
977909GCATCAAGTGGAAATTCCTAGGAATTTCCACTTGATGC0.092100.014100.508600.750000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
889-911AGGCATCAAGTGGAAATTCCTAGAGGAAUUUCCACUUGAUGCCUGCAUCAAGUGGAAAUUCCUAGU14.218.132


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527ACAUCAUGCUUAACCCUAG76.12351500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831545ACATCATGCTTAACCCTAGCTAGGGTTAAGCATGATGT0.103400.107400.534500.500001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459AGUCCGGCAUGAUAACAAG75.73571533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771477AGTCCGGCATGATAACAAGCTTGTTATCATGCCGGACT0.071300.023400.569000.500001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954CAAUACUGGUAUUCUGAAU88.6469401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851972CAATACTGGTATTCTGAATATTCAGAATACCAGTATTG0.152500.009200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1952-1974CTCAATACTGGTATTCTGAATAAAUUCAGAAUACCAGUAUUGAGCAAUACUGGUAUUCUGAAUAAU20.411.602


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACCAACCUAAGCAAAUGUG58.05083140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671151ACCAACCTAAGCAAATGTGCACATTTGCTTAGGTTGGT0.072400.032700.560300.500001.000001.00000


Target Position: 3585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585UGCUAUAAUCAUUAGUUUU80.04041108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5173603TGCTATAATCATTAGTTTTAAAACTAATGATTATAGCA0.389900.058800.853400.750001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442GGAGAAGACCAAACACAAA100.47319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
397460GGAGAAGACCAAACACAAATTTGTGTTTGGTCTTCTCC0.829200.086400.870701.000001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CGGGAAAAGUCCAAGCAUA95.343781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544398CGGGAAAAGTCCAAGCATATATGCTTGGACTTTTCCCG0.233600.134200.870701.000000.940200.75000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109ACUAAUGAAGAGAAGAAUA89.0229372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371127ACTAATGAAGAGAAGAATATATTCTTCTCTTCATTAGT0.391500.178300.663800.750001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300GAUUGAAUGAUUCUCAUAA100.4918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828318GATTGAATGATTCTCATAATTATGAGAATCATTCAATC0.109200.053900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
298-320CCGATTGAATGATTCTCATAAACUUAUGAGAAUCAUUCAAUCGGGAUUGAAUGAUUCUCAUAAACU21.47.232


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113AUGAAGAGAAGAAUAUUAU81.04931025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311131ATGAAGAGAAGAATATTATATAATATTCTTCTCTTCAT0.180300.132600.612100.500001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724GAAGGAGAAGAAAAGAAAA98.132139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361742GAAGGAGAAGAAAAGAAAATTTTCTTTTCTTCTCCTTC0.759100.330900.672400.750001.000001.00000


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041UCGACCAUGAAUAUACUAC61.30722909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021059TCGACCATGAATATACTACGTAGTATATTCATGGTCGA0.202500.075100.612100.500001.000001.00000


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658AAGUAUCUUCUAUUUUUAU85.5472626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9743676AAGTATCTTCTATTTTTATATAAAAATAGAAGATACTT0.684400.459900.594800.500001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178CUAUGAUGAACUUGCAAAC73.55431786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922196CTATGATGAACTTGCAAACGTTTGCAAGTTCATCATAG0.067800.029500.525900.500001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581UCUAGUCCACCACAAAUUA80.76671049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299599TCTAGTCCACCACAAATTATAATTTGTGGTGGACTAGA0.595100.363300.689700.750001.000001.00000


Target Position: 3203, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3203CUUUUUAAUUAUUUUAAAA92.0295212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423221CTTTTTAATTATTTTAAAATTTTAAAATAATTAAAAAG0.176700.075000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3201-3223TTCTTTTTAATTATTTTAAAATAUUUUAAAAUAAUUAAAAAGAACUUUUUAAUUAUUUUAAAAUAU-9.1-9.102


Target Position: 3165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165UGACUUGAGUGUUCCUUUU76.30831473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083183TGACTTGAGTGTTCCTTTTAAAAGGAACACTCAAGTCA0.087600.014700.724100.750001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299CGAUUGAAUGAUUCUCAUA99.558525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835317CGATTGAATGATTCTCATATATGAGAATCATTCAATCG0.107000.053200.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
297-319TCCGATTGAATGATTCTCATAAAUAUGAGAAUCAUUCAAUCGGACGAUUGAAUGAUUCUCAUAAAU20.416.333


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264GCCAAGGUCAUGAAGGAUG66.08032506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152282GCCAAGGTCATGAAGGATGCATCCTTCATGACCTTGGC0.331500.046500.844800.750001.000001.00000


Target Position: 3412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3412AAGAUUUUAUUGUAUAAAA92.516187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553430AAGATTTTATTGTATAAAATTTTATACAATAAAATCTT0.297100.017300.637900.500001.000001.00000


Target Position: 3578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578CAUUUUUUGCUAUAAUCAU87.0812501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3576-3598GACATTTTTTGCTATAATCATTAAUGAUUAUAGCAAAAAAUGUCCAUUUUUUGCUAUAAUCAUUAU8.7-12.012


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286AGUGAAUCUAAGGAUAAUG71.10212034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243304AGTGAATCTAAGGATAATGCATTATCCTTAGATTCACT0.222300.019400.551700.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GAAGAAAAGAAAACUAGAA97.034855

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
728-750GAGAAGAAAAGAAAACTAGAAGAUUCUAGUUUUCUUUUCUUCUCGAAGAAAAGAAAACUAGAAGAU18.95.522


Target Position: 2854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854CUGUUUCACUGAAAUGUUU82.0728927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2852-2874CACTGTTTCACTGAAATGTTTGGAAACAUUUCAGUGAAACAGUGCUGUUUCACUGAAAUGUUUGGU5.320.501


Target Position: 3401, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401CUUUCACUUGAAAGAUUUU80.58161061

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3399-3421ATCTTTCACTTGAAAGATTTTATAAAAUCUUUCAAGUGAAAGAUCUUUCACUUGAAAGAUUUUAUU5.319.202


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAUGAUGCUGAUUAUAAAC79.8851125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881695GATGATGCTGATTATAAACGTTTATAATCAGCATCATC0.345800.077400.534500.500001.000001.00000


Target Position: 1214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GAAGAGAAACUGAAAAUCA98.005745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1212-1234AGGAAGAGAAACTGAAAATCAAAUGAUUUUCAGUUUCUCUUCCUGAAGAGAAACUGAAAAUCAAAU10.419.121


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216UUAAAAUAUUUAAACCUUU71.73041970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693234TTAAAATATTTAAACCTTTAAAGGTTTAAATATTTTAA0.154700.044000.534500.500001.000001.00000


Target Position: 3351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351GCAUUCGCUGUACCCUUUA81.17551018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173369GCATTCGCTGTACCCTTTATAAAGGGTACAGCGAATGC0.310800.030700.819001.000001.000001.00000


Target Position: 2991, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991CCCAUUUCAGGAAUUUAAA83.6785768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403009CCCATTTCAGGAATTTAAATTTAAATTCCTGAAATGGG0.167900.028100.991401.000000.918500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2989-3011CTCCCATTTCAGGAATTTAAAATUUUAAAUUCCUGAAAUGGGAGCCCAUUUCAGGAAUUUAAAAUU-9.720.112


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GCCAGAUAACAAGAAAAAG73.45971794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271829GCCAGATAACAAGAAAAAGCTTTTTCTTGTTATCTGGC0.889100.414300.862100.750001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137ACCUAAGCAAAUGUGAUUU69.05642241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391155ACCTAAGCAAATGTGATTTAAATCACATTTGCTTAGGT0.079900.022700.853400.750001.000001.00000


Target Position: 3660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3660GUAUCUUCUAUUUUUAUCA90.6101281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3658-3680AAGTATCTTCTATTTTTATCATGUGAUAAAAAUAGAAGAUACUUGUAUCUUCUAUUUUUAUCAUGU2.116.002


Target Position: 1927, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927GCCCGAGGAUGAUCUUUUU84.0175729

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2192719GCCCGAGGATGATCTTTTT1/1/0/0100.00TOP1NM_003286.21NANANA20:39744049..39744067(+)00TOP1(0.002)


Target Position: 958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958GAAUGUCAAGUUUUAUUAU93.4353146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978GAGAATGTCAAGTTTTATTATGAAUAAUAAAACUUGACAUUCUCGAAUGUCAAGUUUUAUUAUGAU-7.520.522


Target Position: 9, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9UGCGAACUUAGGCUGUUAC60.93242940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73827TGCGAACTTAGGCTGTTACGTAACAGCCTAAGTTCGCA0.255800.051200.672400.500000.972800.75000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375GAGGAAAAUAAACAGAUUG76.55291450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232393GAGGAAAATAAACAGATTGCAATCTGTTTATTTTCCTC0.390000.092300.663800.500001.000001.00000


Target Position: 2931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931GGUUUUGCAAUAACUUCUA89.4542342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2929-2951AGGGTTTTGCAATAACTTCTATAUAGAAGUUAUUGCAAAACCCUGGUUUUGCAAUAACUUCUAUAU17.721.102


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CCGAAGAAAGAAGAGGAAC62.48982822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462851CCGAAGAAAGAAGAGGAACGTTCCTCTTCTTTCTTCGG0.411100.343300.767200.750001.000001.00000


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394GCAUAGCAACAGUGAACAU91.9383217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282412GCATAGCAACAGTGAACATATGTTCACTGTTGCTATGC0.594700.395400.698301.000001.000001.00000


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723UCCUAUGGACAACUUAUUU72.57291878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122741TCCTATGGACAACTTATTTAAATAAGTTGTCCATAGGA0.223400.031300.870700.750001.000001.00000


Target Position: 3643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643CCCACAUCUUUCCUCAAGU75.96171512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3673661CCCACATCTTTCCTCAAGTACTTGAGGAAAGATGTGGG0.586000.164900.784500.750001.000001.00000


Target Position: 3631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3631CAGAGUCCAUUUCCCACAU82.5968870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793649CAGAGTCCATTTCCCACATATGTGGGAAATGGACTCTG0.222000.058600.629300.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813GGAAUAUGUGGUAGAGUUU89.3916344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1811-1833CAGGAATATGTGGTAGAGTTTGAAAACUCUACCACAUAUUCCUGGGAAUAUGUGGUAGAGUUUGAU18.98.722


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177UCUAUGAUGAACUUGCAAA81.7769950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792195TCTATGATGAACTTGCAAATTTGCAAGTTCATCATAGA0.070900.032200.724100.750001.000001.00000


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808GGUCAGGAAUAUGUGGUAG77.15461392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431826GGTCAGGAATATGTGGTAGCTACCACATATTCCTGACC0.104900.019900.681000.750001.000001.00000


Target Position: 2274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274UGAAGGAUGCAAAGACGAA85.8192601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372292TGAAGGATGCAAAGACGAATTCGTCTTTGCATCCTTCA0.248700.082400.551700.750001.000001.00000


Target Position: 3642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642UCCCACAUCUUUCCUCAAG55.72923276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003660TCCCACATCTTTCCTCAAGCTTGAGGAAAGATGTGGGA0.586800.157400.732800.500001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707CUCUGAGAGCAGGCAAUGA83.114818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221725CTCTGAGAGCAGGCAATGATCATTGCCTGCTCTCAGAG0.117600.012700.586200.500000.967400.75000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720CCAAGAAGGAGAAGAAAAG74.02431728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561738CCAAGAAGGAGAAGAAAAGCTTTTCTTCTCCTTCTTGG0.941700.377000.706900.750001.000001.00000


Target Position: 1135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1135CAACCUAAGCAAAUGUGAU89.2955354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1133-1155ACCAACCTAAGCAAATGTGATTTAUCACAUUUGCUUAGGUUGGUCAACCUAAGCAAAUGUGAUUUU20.518.622


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107UGACUAAUGAAGAGAAGAA90.4071292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181125TGACTAATGAAGAGAAGAATTCTTCTCTTCATTAGTCA0.653400.210500.551700.750001.000001.00000


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332CCAUCAUCCUUUGUUCUGA86.423549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273350CCATCATCCTTTGTTCTGATCAGAACAAAGGATGATGG0.083700.077200.620700.750001.000001.00000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751UCAGAUAUCAAAAUUCUAG69.00932246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062769TCAGATATCAAAATTCTAGCTAGAATTTTGATATCTGA0.135700.050700.551700.500001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589GGUUUGGGAAAGAUGGAUA91.7543227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802607GGTTTGGGAAAGATGGATATATCCATCTTTCCCAAACC0.718400.034600.810301.000001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230UCAAAGAGGAGAAUGAAAA79.94041119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141248TCAAAGAGGAGAATGAAAATTTTCATTCTCCTCTTTGA0.566800.403400.724100.750001.000001.00000


Target Position: 3644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3644CCACAUCUUUCCUCAAGUA95.704973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4223662CCACATCTTTCCTCAAGTATACTTGAGGAAAGATGTGG0.586100.171900.663801.000001.000001.00000


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CUUUUAUUUUUUCUUUUGU71.54011990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527GGCTTTTATTTTTTCTTTTGTAAACAAAAGAAAAAAUAAAAGCCCUUUUAUUUUUUCUUUUGUAAU12.2-9.701


Target Position: 3725, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CAACUUAAUGGAAAAAAAA93.4385145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923743CAACTTAATGGAAAAAAAATTTTTTTTCCATTAAGTTG0.936300.789400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3723-3745TACAACTTAATGGAAAAAAAAAAUUUUUUUUCCAUUAAGUUGUACAACUUAAUGGAAAAAAAAAAU-11.34.9


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342GAGAACACCGGCACAAAGA83.4891785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850360GAGAACACCGGCACAAAGATCTTTGTGCCGGTGTTCTC0.409600.067000.586200.500001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GAAAAAUUACUGAAAGAAU91.7439228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111262GAAAAATTACTGAAAGAATATTCTTTCAGTAATTTTTC0.459200.336300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1242-1264ATGAAAAATTACTGAAAGAATATAUUCUUUCAGUAAUUUUUCAUGAAAAAUUACUGAAAGAAUAUU14.8-12.011


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724GAAAAGGAGGAAGGAGAAA84.1479722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221742GAAAAGGAGGAAGGAGAAATTTCTCCTTCCTCCTTTTC0.248500.157000.672400.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GACUAAUGAAGAGAAGAAU87.7088459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311126GACTAATGAAGAGAAGAATATTCTTCTCTTCATTAGTC0.367300.168700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1106-1128ATGACTAATGAAGAGAAGAATATAUUCUUCUCUUCAUUAGUCAUGACUAAUGAAGAGAAGAAUAUU19.111.622


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281UGCAAAGACGAAGAAGGUA76.44181463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692299TGCAAAGACGAAGAAGGTATACCTTCTTCGTCTTTGCA0.580200.169100.672400.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GGAACCAGUAUCGAGAAGA83.063823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091641GGAACCAGTATCGAGAAGATCTTCTCGATACTGGTTCC0.086600.018000.646600.750001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536UUAACCCUAGUUCACGAAU61.00412928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761554TTAACCCTAGTTCACGAATATTCGTGAACTAGGGTTAA0.438000.031800.525900.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UGAUUAUAAACCUAAGAAA90.1823301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276703TGATTATAAACCTAAGAAATTTCTTAGGTTTATAATCA0.704100.324900.724100.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776CCCAAGAAUAAAGAUAAAG66.61072466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420794CCCAAGAATAAAGATAAAGCTTTATCTTTATTCTTGGG0.878100.471300.853400.750001.000001.00000


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065AUGGGGAUCAAUUUUCAUU72.27111901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703083ATGGGGATCAATTTTCATTAATGAAAATTGATCCCCAT0.322600.010200.646600.500001.000001.00000


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750AAGAAGAGGAUGGUAAAUU73.67691773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815768AAGAAGAGGATGGTAAATTAATTTACCATCCTCTTCTT0.272300.198500.629300.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730GACAACUUAUUUAAAAAUA91.6741233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3642748GACAACTTATTTAAAAATATATTTTTAAATAAGTTGTC0.432900.138400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2728-2750TGGACAACTTATTTAAAAATATTUAUUUUUAAAUAAGUUGUCCAGACAACUUAUUUAAAAAUAUUU-9.717.801


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353GGAAGUUCAAGCCACAGAC75.55651553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962371GGAAGTTCAAGCCACAGACGTCTGTGGCTTGAACTTCC0.090500.046300.551700.750001.000001.00000


Target Position: 3518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3518UCUUUUGUAAUUGUGUAAA72.02441934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463536TCTTTTGTAATTGTGTAAATTTACACAATTACAAAAGA0.232400.069000.724100.750001.000001.00000


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GCUGAUUAUAAACCUAAGA83.8626746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
590701GCTGATTATAAACCTAAGATCTTAGGTTTATAATCAGC0.718000.285300.629300.750001.000001.00000


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872UGGAUUCUCUUAGCUACUG60.97932933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512890TGGATTCTCTTAGCTACTGCAGTAGCTAAGAGAATCCA0.076800.053800.560300.500001.000001.00000


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859UCACUGAAAUGUUUGGAUU74.67711662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852877TCACTGAAATGTTTGGATTAATCCAAACATTTCAGTGA0.069100.026200.715500.750001.000001.00000


Target Position: 3542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542GAAAAAAACAUAAAAAGCA86.6899523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3540-3562TGGAAAAAAACATAAAAAGCAGAUGCUUUUUAUGUUUUUUUCCAGAAAAAAACAUAAAAAGCAGAU12.3-11.301


Target Position: 2399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399GGAACCUCCAAACUCAAUU77.56311350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612417GGAACCTCCAAACTCAATTAATTGAGTTTGGAGGTTCC0.659600.036700.862101.000001.000001.00000


Target Position: 1266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266GAUUCUGUAUUAUGGAUAA102.6567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1264-1286TGGATTCTGTATTATGGATAACCUUAUCCAUAAUACAGAAUCCAGAUUCUGUAUUAUGGAUAACCU21.219.222


Target Position: 2932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932GUUUUGCAAUAACUUCUAU85.4721634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2930-2952GGGTTTTGCAATAACTTCTATATAUAGAAGUUAUUGCAAAACCCGUUUUGCAAUAACUUCUAUAUU18.920.002


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303GAGUCAAAGAAGAAGGCUG78.45161263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422321GAGTCAAAGAAGAAGGCTGCAGCCTTCTTCTTTGACTC0.129500.016300.525900.500001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443GAGAAGACCAAACACAAAG74.91881631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922461GAGAAGACCAAACACAAAGCTTTGTGTTTGGTCTTCTC0.823700.087400.672400.500001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396AUAGCAACAGUGAACAUAA92.3268195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979414ATAGCAACAGTGAACATAATTATGTTCACTGTTGCTAT0.701400.406200.508600.500001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814AGAUAACAAGAAAAAGAAG76.68621436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694832AGATAACAAGAAAAAGAAGCTTCTTTTTCTTGTTATCT0.828100.577400.586200.500001.000001.00000


Target Position: 2880, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880CUUAGCUACUGUAUGCAAA90.3759294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2878-2900CTCTTAGCTACTGTATGCAAAGTUUUGCAUACAGUAGCUAAGAGCUUAGCUACUGUAUGCAAAGUU21.119.502


Target Position: 3648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648AUCUUUCCUCAAGUAUCUU70.12842141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673666ATCTTTCCTCAAGTATCTTAAGATACTTGAGGAAAGAT0.538300.450600.543100.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500AGAGACAAGGAAAAACGAA86.0618577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832518AGAGACAAGGAAAAACGAATTCGTTTTTCCTTGTCTCT0.657700.613000.551700.750001.000001.00000


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679UGAAUUCCCUUUUAAUCAA83.2844805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373697TGAATTCCCTTTTAATCAATTGATTAAAAGGGAATTCA0.542500.316000.577600.750001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GAAGAAUAUUAUCACCAAC83.7651756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161138GAAGAATATTATCACCAACGTTGGTGATAATATTCTTC0.214900.120400.525900.500001.000001.00000


Target Position: 2772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772GUAUGAUUUGUUUUGAAUU85.3442642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2770-2792CTGTATGATTTGTTTTGAATTTTAAUUCAAAACAAAUCAUACAGGUAUGAUUUGUUUUGAAUUUUU7.48.702


Target Position: 2770, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770CUGUAUGAUUUGUUUUGAA94.823992

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2768-2790AGCTGTATGATTTGTTTTGAATTUUCAAAACAAAUCAUACAGCUCUGUAUGAUUUGUUUUGAAUUU14.921.502


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622CGGAACCAGUAUCGAGAAG68.50082291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621640CGGAACCAGTATCGAGAAGCTTCTCGATACTGGTTCCG0.487300.016300.775900.750001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506ACAUCCAAGGUUCCAUUAA79.88171127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221524ACATCCAAGGTTCCATTAATTAATGGAACCTTGGATGT0.352000.058200.672400.750001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902CGAUUAUAUUGGUGCGUUU89.5132338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902920CGATTATATTGGTGCGTTTAAACGCACCAATATAATCG0.068200.022200.793101.000001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CUGGAGAAAGGAAAUGACU75.70411534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611111CTGGAGAAAGGAAATGACTAGTCATTTCCTTTCTCCAG0.345000.043600.577600.500001.000001.00000


Target Position: 2938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938CAAUAACUUCUAUAUUUUA102.01410

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2936-2958TGCAATAACTTCTATATTTTAATUAAAAUAUAGAAGUUAUUGCACAAUAACUUCUAUAUUUUAAUU-10.34.602


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724ACAACUUAAUGGAAAAAAA89.9723313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5213742ACAACTTAATGGAAAAAAATTTTTTTCCATTAAGTTGT0.860700.788600.706900.750001.000001.00000


Target Position: 1064, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064GAAAUAUUUAGGAAAAAUU87.9347448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1062-1084AGGAAATATTTAGGAAAAATTTCAAUUUUUCCUAAAUAUUUCCUGAAAUAUUUAGGAAAAAUUUCU0.4-10.311


Target Position: 3730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3730UAAUGGAAAAAAAAAAAAA81.4862983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893748TAATGGAAAAAAAAAAAAATTTTTTTTTTTTTCCATTA0.990000.809500.534500.500001.000001.00000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284CGAGUGAAUCUAAGGAUAA97.058553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903302CGAGTGAATCTAAGGATAATTATCCTTAGATTCACTCG0.193900.022400.758601.000001.000001.00000


Target Position: 3675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675AUCAUGAAUUCCCUUUUAA82.6319868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723693ATCATGAATTCCCTTTTAATTAAAAGGGAATTCATGAT0.445200.267100.646600.500001.000001.00000


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462UGAGUAUUUGGUCCAAAAA82.4742883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943480TGAGTATTTGGTCCAAAAATTTTTGGACCAAATACTCA0.127700.022200.724100.750001.000001.00000


Target Position: 2728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728UGGACAACUUAUUUAAAAA90.9984256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602746TGGACAACTTATTTAAAAATTTTTAAATAAGTTGTCCA0.426200.111000.844800.750001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756AGGAUGGUAAAUUGAAAAA82.8153851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
614774AGGATGGTAAATTGAAAAATTTTTCAATTTACCATCCT0.745000.231800.844800.750001.000001.00000


Target Position: 399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399GCAACAGUGAACAUAAAGA91.2285250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571417GCAACAGTGAACATAAAGATCTTTATGTTCACTGTTGC0.623200.374100.629300.750001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580CUCUAGUCCACCACAAAUU77.86431316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577598CTCTAGTCCACCACAAATTAATTTGTGGTGGACTAGAG0.550000.074800.801700.750001.000001.00000


Target Position: 3187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187AUGUGAAUUUUUAUUUCUU79.90321121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583205ATGTGAATTTTTATTTCTTAAGAAATAAAAATTCACAT0.174300.073700.517200.500001.000001.00000


Target Position: 1940, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940CUUUUUGAUAGACUCAAUA87.5247472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631958CTTTTTGATAGACTCAATATATTGAGTCTATCAAAAAG0.136500.025500.594800.750000.934800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1938-1960ATCTTTTTGATAGACTCAATACTUAUUGAGUCUAUCAAAAAGAUCUUUUUGAUAGACUCAAUACUU19.27.702


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400GAACCUCCAAACUCAAUUA95.636876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372418GAACCTCCAAACTCAATTATAATTGAGTTTGGAGGTTC0.703200.039000.637900.750001.000001.00000


Target Position: 3529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3529UGUGUAAAAAAUGGAAAAA76.43641465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653547TGTGTAAAAAATGGAAAAATTTTTCCATTTTTTACACA0.313300.036400.706900.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723AGAAGGAGAAGAAAAGAAA90.6776277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
274741AGAAGGAGAAGAAAAGAAATTTCTTTTCTTCTCCTTCT0.950000.404100.724100.750001.000001.00000


Target Position: 3001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3001GAAUUUAAAAUUAAGUAGA89.2226358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2999-3021AGGAATTTAAAATTAAGTAGAACUCUACUUAAUUUUAAAUUCCUGAAUUUAAAAUUAAGUAGAACU11.3-9.701


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096GAGAAAGGAAAUGACUAAU84.4437703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891114GAGAAAGGAAATGACTAATATTAGTCATTTCCTTTCTC0.299900.045400.801700.750001.000001.00000


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151GGGCACCACCAAAAACUUU78.69691246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922169GGGCACCACCAAAAACTTTAAAGTTTTTGGTGGTGCCC0.123100.008600.991401.000000.962000.62500


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GGAUGGUAAAUUGAAAAAA90.852268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251775GGATGGTAAATTGAAAAAATTTTTTCAATTTACCATCC0.514200.229200.870701.000001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593GGCGGCUGAAAAAAUGUGU69.90662155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111611GGCGGCTGAAAAAATGTGTACACATTTTTTCAGCCGCC0.300200.066000.793100.750001.000001.00000


Target Position: 1886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886CGAGUUUUUAAGAACCUAC75.15611602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521904CGAGTTTTTAAGAACCTACGTAGGTTCTTAAAAACTCG0.224400.054900.612100.750000.989100.62500


Target Position: 1139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139CUAAGCAAAUGUGAUUUUA85.49631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731157CTAAGCAAATGTGATTTTATAAAATCACATTTGCTTAG0.095900.031500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1137-1159ACCTAAGCAAATGTGATTTTACCUAAAAUCACAUUUGCUUAGGUCUAAGCAAAUGUGAUUUUACCU7.419.723


Target Position: 2471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471GAGAAGAUUUACAACAAAA102.2738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342489GAGAAGATTTACAACAAAATTTTGTTGTAAATCTTCTC0.665100.550300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2469-2491TTGAGAAGATTTACAACAAAACCUUUUGUUGUAAAUCUUCUCAAGAGAAGAUUUACAACAAAACCU12.219.102


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365CUUUAAGAUAUCCAUCUUU82.3882893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513383CTTTAAGATATCCATCTTTAAAGATGGATATCTTAAAG0.272200.061400.637900.750000.907600.62500


Target Position: 1169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1169CAGUAUUUCAAAGCCCAGA78.62981254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721187CAGTATTTCAAAGCCCAGATCTGGGCTTTGAAATACTG0.131700.076500.560300.500001.000001.00000


Target Position: 1074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GGAAAAAUUUCUUUAAAGA93.9749118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1072-1094TAGGAAAAATTTCTTTAAAGACTUCUUUAAAGAAAUUUUUCCUAGGAAAAAUUUCUUUAAAGACUU-3.80.421


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896AGAACCUACAACUAUUUAU82.9972835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471914AGAACCTACAACTATTTATATAAATAGTTGTAGGTTCT0.403700.152800.681000.750001.000001.00000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GAGCCAGAUAACAAGAAAA98.514234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336827GAGCCAGATAACAAGAAAATTTTCTTGTTATCTGGCTC0.710000.346300.810300.750001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177UCCUUUUUAAAUGUGAAUU60.28392984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6573195TCCTTTTTAAATGTGAATTAATTCACATTTAAAAAGGA0.170600.110200.862100.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GAAUAAAGAUAAAGAUAAA108.322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379799GAATAAAGATAAAGATAAATTTATCTTTATCTTTATTC0.891800.622900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801AAGAATAAAGATAAAGATAAAAAUUUAUCUUUAUCUUUAUUCUUGAAUAAAGAUAAAGAUAAAAAU6.9-4.311


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190UGAAUUUUUAUUUCUUUUU66.722459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653208TGAATTTTTATTTCTTTTTAAAAAGAAATAAAAATTCA0.098100.037800.724100.750001.000001.00000


Target Position: 2979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2979CCUUCCCUCUCUCCCAUUU72.09661924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822997CCTTCCCTCTCTCCCATTTAAATGGGAGAGAGGGAAGG0.473100.438200.844801.000001.000001.00000


Target Position: 3189, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189GUGAAUUUUUAUUUCUUUU81.02161026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6813207GTGAATTTTTATTTCTTTTAAAAGAAATAAAAATTCAC0.161200.037900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3187-3209ATGTGAATTTTTATTTCTTTTTAAAAAGAAAUAAAAAUUCACAUGUGAAUUUUUAUUUCUUUUUAU5.57.401


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926GUAUUUGCCCCACCAUAUG67.86562354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926944GTATTTGCCCCACCATATGCATATGGTGGGGCAAATAC0.212400.104000.525900.500001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688UUAUAAACCUAAGAAAAUU74.06711721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919706TTATAAACCTAAGAAAATTAATTTTCTTAGGTTTATAA0.820300.400900.525900.500001.000001.00000


Target Position: 2595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GGAAAGAUGGAUAAACUGA92.4712189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6302613GGAAAGATGGATAAACTGATCAGTTTATCCATCTTTCC0.181100.092700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2593-2615TGGGAAAGATGGATAAACTGAGCUCAGUUUAUCCAUCUUUCCCAGGAAAGAUGGAUAAACUGAGCU11.814.801


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639AAGAGGAUAUAAAGCCAUU82.4212887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901657AAGAGGATATAAAGCCATTAATGGCTTTATATCCTCTT0.093300.013700.629300.500001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381GGGAAAAGUCCAAGCAUAG78.86111233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476399GGGAAAAGTCCAAGCATAGCTATGCTTGGACTTTTCCC0.511800.149600.819000.750000.940200.62500


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848ACUCCAUCAGAUACUAUAA93.5319141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841866ACTCCATCAGATACTATAATTATAGTATCTGATGGAGT0.436700.092600.672400.750001.000001.00000


Target Position: 2734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734ACUUAUUUAAAAAUAUUUC65.28472578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812752ACTTATTTAAAAATATTTCGAAATATTTTTAAATAAGT0.446800.316200.534500.500001.000001.00000


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298CCGAUUGAAUGAUUCUCAU85.5587624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831316CCGATTGAATGATTCTCATATGAGAATCATTCAATCGG0.108700.054100.758601.000001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501GAGACAAGGAAAAACGAAA94.0677114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500519GAGACAAGGAAAAACGAAATTTCGTTTTTCCTTGTCTC0.654400.621500.810300.750001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591UCGGCGGCUGAAAAAAUGU58.68673103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991609TCGGCGGCTGAAAAAATGTACATTTTTTCAGCCGCCGA0.386400.038900.586200.500001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062AGGAAAUAUUUAGGAAAAA85.1833656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201080AGGAAATATTTAGGAAAAATTTTTCCTAAATATTTCCT0.147900.065800.844800.750001.000001.00000


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019GUACAUACAAUGCCUCCAU82.3615897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402037GTACATACAATGCCTCCATATGGAGGCATTGTATGTAC0.187000.113500.525900.750000.978300.75000


Target Position: 686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GAUUAUAAACCUAAGAAAA99.866721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644704GATTATAAACCTAAGAAAATTTTCTTAGGTTTATAATC0.712400.338800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
684-706CTGATTATAAACCTAAGAAAATTUUUUCUUAGGUUUAUAAUCAGGAUUAUAAACCUAAGAAAAUUU7.1-8.022


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176GUCUAUGAUGAACUUGCAA89.6941328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632194GTCTATGATGAACTTGCAATTGCAAGTTCATCATAGAC0.073400.020200.672400.750001.000001.00000


Target Position: 2937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937GCAAUAACUUCUAUAUUUU91.5221237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2935-2957TTGCAATAACTTCTATATTTTAAAAAAUAUAGAAGUUAUUGCAAGCAAUAACUUCUAUAUUUUAAU-8.06.902


Target Position: 2157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157CACCAAAAACUUUUGAGAA92.8155175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2155-2177ACCACCAAAAACTTTTGAGAAGTUUCUCAAAAGUUUUUGGUGGUCACCAAAAACUUUUGAGAAGUU20.418.802


Target Position: 777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CCAAGAAUAAAGAUAAAGA92.2691196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
607795CCAAGAATAAAGATAAAGATCTTTATCTTTATTCTTGG0.877800.562200.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
775-797ACCCAAGAATAAAGATAAAGATAUCUUUAUCUUUAUUCUUGGGUCCAAGAAUAAAGAUAAAGAUAU6.912.012


Target Position: 2781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781GUUUUGAAUUUUGUUUUUA83.7294760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2779-2801TTGTTTTGAATTTTGTTTTTATTUAAAAACAAAAUUCAAAACAAGUUUUGAAUUUUGUUUUUAUUU5.67.700


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086CCCAGCGAAGAUCCUUUCU64.84682615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442104CCCAGCGAAGATCCTTTCTAGAAAGGATCTTCGCTGGG0.091900.011700.767200.750001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810AGCCAGAUAACAAGAAAAA84.9596667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519828AGCCAGATAACAAGAAAAATTTTTCTTGTTATCTGGCT0.906200.403700.853400.750001.000001.00000


Target Position: 2759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2759CAAAAUUCUAGCUGUAUGA87.8759454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2757-2779ATCAAAATTCTAGCTGTATGATTUCAUACAGCUAGAAUUUUGAUCAAAAUUCUAGCUGUAUGAUUU17.90.402


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719ACCAAGAAGGAGAAGAAAA83.0352828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232737ACCAAGAAGGAGAAGAAAATTTTCTTCTCCTTCTTGGT0.930500.370400.853400.750000.978300.75000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CAAGGAAGAGAAACUGAAA98.041742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811228CAAGGAAGAGAAACTGAAATTTCAGTTTCTCTTCCTTG0.501000.416200.646600.750001.000001.00000


Target Position: 3474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474CCAAAAAAAGGAAAAAUAA90.7082276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763492CCAAAAAAAGGAAAAATAATTATTTTTCCTTTTTTTGG0.095300.041200.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3472-3494GTCCAAAAAAAGGAAAAATAATCUUAUUUUUCCUUUUUUUGGACCCAAAAAAAGGAAAAAUAAUCU-9.7-2.911


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782AAUAAAGAUAAAGAUAAAA85.758606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985800AATAAAGATAAAGATAAAATTTTATCTTTATCTTTATT0.891100.857600.508600.500001.000001.00000


Target Position: 3352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3352CAUUCGCUGUACCCUUUAA93.911122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8983370CATTCGCTGTACCCTTTAATTAAAGGGTACAGCGAATG0.159800.014000.620700.750001.000001.00000


Target Position: 3375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3375UCCAUCUUUUUCUUUUUAA74.80771650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3253393TCCATCTTTTTCTTTTTAATTAAAAAGAAAAAGATGGA0.670400.177700.836200.750001.000001.00000


Target Position: 3144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GCAUGAUGGGAAAAUAUUU88.8426383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164AAGCATGATGGGAAAATATTTCCAAAUAUUUUCCCAUCAUGCUUGCAUGAUGGGAAAAUAUUUCCU-10.319.402


Target Position: 407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GAACAUAAAGAUUCUGAAA98.477936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
405-427GTGAACATAAAGATTCTGAAAAGUUUCAGAAUCUUUAUGUUCACGAACAUAAAGAUUCUGAAAAGU20.46.922


Target Position: 2864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864GAAAUGUUUGGAUUCUCUU84.5694691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082882GAAATGTTTGGATTCTCTTAAGAGAATCCAAACATTTC0.338300.032700.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884CTGAAATGTTTGGATTCTCTTAGAAGAGAAUCCAAACAUUUCAGGAAAUGUUUGGAUUCUCUUAGU19.15.302


Target Position: 3395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395CCUAAUCUUUCACUUGAAA89.5319337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3393-3415ACCCTAATCTTTCACTTGAAAGAUUUCAAGUGAAAGAUUAGGGUCCUAAUCUUUCACUUGAAAGAU19.211.602


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083UCUUUAAAGACUGGAGAAA74.06551722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041101TCTTTAAAGACTGGAGAAATTTCTCCAGTCTTTAAAGA0.088700.015500.724100.750001.000001.00000


Target Position: 3498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498AUUUUAGGGCUUUUAUUUU71.9351943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873516ATTTTAGGGCTTTTATTTTAAAATAAAAGCCCTAAAAT0.069900.034500.508600.500001.000001.00000


Target Position: 3647, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647CAUCUUUCCUCAAGUAUCU83.5819773

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3645-3667CACATCTTTCCTCAAGTATCTTCAGAUACUUGAGGAAAGAUGUGCAUCUUUCCUCAAGUAUCUUCU14.514.802


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CCUACAACUAUUUAUGGAG75.31651586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891918CCTACAACTATTTATGGAGCTCCATAAATAGTTGTAGG0.215900.149000.534500.750001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646ACAUCUUUCCUCAAGUAUC70.88662066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333664ACATCTTTCCTCAAGTATCGATACTTGAGGAAAGATGT0.584800.272900.525900.500001.000001.00000


Target Position: 3331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3331CCCAUCAUCCUUUGUUCUG61.81682869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3183349CCCATCATCCTTTGTTCTGCAGAACAAAGGATGATGGG0.426500.323400.706900.750001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UAAAGAUUCUGAAAAGAAA90.3048296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865430TAAAGATTCTGAAAAGAAATTTCTTTTCAGAATCTTTA0.179900.029200.534500.500000.989100.62500


Target Position: 410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CAUAAAGAUUCUGAAAAGA88.0711444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
408-430AACATAAAGATTCTGAAAAGAAAUCUUUUCAGAAUCUUUAUGUUCAUAAAGAUUCUGAAAAGAAAU12.26.921


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308GAUUCUCAUAAACACAAAG78.99521222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
950326GATTCTCATAAACACAAAGCTTTGTGTTTATGAGAATC0.848500.084500.543100.500001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389UCCAAGCAUAGCAACAGUG59.31833060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841407TCCAAGCATAGCAACAGTGCACTGTTGCTATGCTTGGA0.427600.364200.577600.500001.000001.00000


Target Position: 2992, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2992CCAUUUCAGGAAUUUAAAA89.6166332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6733010CCATTTCAGGAATTTAAAATTTTAAATTCCTGAAATGG0.267000.035200.844801.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2990-3012TCCCATTTCAGGAATTTAAAATTUUUUAAAUUCCUGAAAUGGGACCAUUUCAGGAAUUUAAAAUUU-9.713.802


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997UCAGGAAUUUAAAAUUAAG71.81611962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933015TCAGGAATTTAAAATTAAGCTTAATTTTAAATTCCTGA0.745100.070400.586200.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507CAUCCAAGGUUCCAUUAAA98.114540

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6150719CATCCAAGGTTCCATTAAA1/1/0/097.21TOP1NM_003286.21NANANA20:39729942..39729960(+)00TOP1(0.002)&KIAA0368(0.007)&DDX18(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791525CATCCAAGGTTCCATTAAATTTAATGGAACCTTGGATG0.367700.068000.655200.750001.000001.00000


Target Position: 2947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947CUAUAUUUUAAUAGAAAUA93.0309169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2945-2967TTCTATATTTTAATAGAAATAAAUAUUUCUAUUAAAAUAUAGAACUAUAUUUUAAUAGAAAUAAAU6.9-8.002


Target Position: 3722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722CUACAACUUAAUGGAAAAA83.8017755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3720-3742TCCTACAACTTAATGGAAAAAAAUUUUUCCAUUAAGUUGUAGGACUACAACUUAAUGGAAAAAAAU20.119.0


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676UCAUGAAUUCCCUUUUAAU81.7105957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4983694TCATGAATTCCCTTTTAATATTAAAAGGGAATTCATGA0.417900.264300.715500.750001.000001.00000


Target Position: 3463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463GAGUAUUUGGUCCAAAAAA93.0774166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3461-3483ATGAGTATTTGGTCCAAAAAAAGUUUUUUGGACCAAAUACUCAUGAGUAUUUGGUCCAAAAAAAGU11.54.602


Target Position: 3269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GGGAGGGAUGAAGGGCGAG61.65442884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3753287GGGAGGGATGAAGGGCGAGCTCGCCCTTCATCCCTCCC0.413400.142900.681000.750001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089AAGACUGGAGAAAGGAAAU76.721430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771107AAGACTGGAGAAAGGAAATATTTCCTTTCTCCAGTCTT0.112000.047800.629300.500001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846AGGAACAGAAGUGGAAAUG58.61373109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802864AGGAACAGAAGTGGAAATGCATTTCCACTTCTGTTCCT0.119300.123000.689700.500001.000001.00000