siDirect version 2.0 result page. Help

2017-07-12 14:42:54, siDirect v.2.0

Query

Query name:
Query sequence: 4304 bp
Functional siRNA selection: Ui-Tei
Seed-duplex stability - Max Tm: 21.5°C
Specificity check: Homo sapiens non-redundant database

Effective siRNA candidates

target
position
target sequence
21nt target + 2nt overhang
RNA oligo sequences
21nt guide (5′→3′)
21nt passenger (5′→3′)
functional
siRNA
selection:
Ui-Tei
seed-duplex
stabilty (Tm);
specificity check:
minimum number of
mismatches against
any off-targets;
guidepassenger guidepassenger
781-803 CAGATGTGAAGTTCATTTCCAAT UGGAAAUGAACUUCACAUCUG
GAUGUGAAGUUCAUUUCCAAU
U    20.1 °C 20.5 °C 2 [detail]1 [detail]
1206-1228 AAGCTTCATTCTCCTTGTTGTTG ACAACAAGGAGAAUGAAGCUU
GCUUCAUUCUCCUUGUUGUUG
U    16.7 °C 12.0 °C 2 [detail]2 [detail]
1207-1229 AGCTTCATTCTCCTTGTTGTTGG AACAACAAGGAGAAUGAAGCU
CUUCAUUCUCCUUGUUGUUGG
U    19.3 °C 16.3 °C 2 [detail]2 [detail]
1216-1238 CTCCTTGTTGTTGGTTGTTTTTT AAAACAACCAACAACAAGGAG
CCUUGUUGUUGGUUGUUUUUU
U    13.3 °C 16.7 °C 2 [detail]2 [detail]
1217-1239 TCCTTGTTGTTGGTTGTTTTTTC AAAAACAACCAACAACAAGGA
CUUGUUGUUGGUUGUUUUUUC
U    5.6 °C 19.3 °C 2 [detail]1 [detail]
1262-1284 CTCTGACTTAAGCAAAAGAAAAA UUUCUUUUGCUUAAGUCAGAG
CUGACUUAAGCAAAAGAAAAA
U    5.5 °C 20.3 °C 2 [detail]1 [detail]
1264-1286 CTGACTTAAGCAAAAGAAAAAGA UUUUUCUUUUGCUUAAGUCAG
GACUUAAGCAAAAGAAAAAGA
U    5.5 °C 9.8 °C 2 [detail]1 [detail]
1266-1288 GACTTAAGCAAAAGAAAAAGATT UCUUUUUCUUUUGCUUAAGUC
CUUAAGCAAAAGAAAAAGAUU
U    5.5 °C 19.7 °C 2 [detail]2 [detail]
1288-1310 TACCCAAAAACTGTCTTTAAAAG UUUAAAGACAGUUUUUGGGUA
CCCAAAAACUGUCUUUAAAAG
U    7.1 °C 11.5 °C 2 [detail]2 [detail]
1289-1311 ACCCAAAAACTGTCTTTAAAAGA UUUUAAAGACAGUUUUUGGGU
CCAAAAACUGUCUUUAAAAGA
U    -3.8 °C 5.6 °C 3 [detail]2 [detail]
1314-1336 GAGAGAGAAAAAAAAAATAGTAT ACUAUUUUUUUUUUCUCUCUC
GAGAGAAAAAAAAAAUAGUAU
U    -4.3 °C 19.1 °C 1 [detail]1 [detail]
1316-1338 GAGAGAAAAAAAAAATAGTATTT AUACUAUUUUUUUUUUCUCUC
GAGAAAAAAAAAAUAGUAUUU
U    6.3 °C 5.5 °C 1 [detail]1 [detail]
1318-1340 GAGAAAAAAAAAATAGTATTTGC AAAUACUAUUUUUUUUUUCUC
GAAAAAAAAAAUAGUAUUUGC
U    6.3 °C -11.3 °C 1 [detail]1 [detail]
1374-1396 TACAGATGATAGAGGATTTTATA UAAAAUCCUCUAUCAUCUGUA
CAGAUGAUAGAGGAUUUUAUA
U    14.2 °C 20.4 °C 2 [detail]2 [detail]
1376-1398 CAGATGATAGAGGATTTTATACC UAUAAAAUCCUCUAUCAUCUG
GAUGAUAGAGGAUUUUAUACC
U    -10.3 °C 13.3 °C 2 [detail]2 [detail]
1386-1408 AGGATTTTATACCCCAATAATCA AUUAUUGGGGUAUAAAAUCCU
GAUUUUAUACCCCAAUAAUCA
U    12.8 °C -10.3 °C 3 [detail]2 [detail]
1397-1419 CCCCAATAATCAACTCGTTTTTA AAAACGAGUUGAUUAUUGGGG
CCAAUAAUCAACUCGUUUUUA
U    19.7 °C -1.8 °C 3 [detail]2 [detail]
1398-1420 CCCAATAATCAACTCGTTTTTAT AAAAACGAGUUGAUUAUUGGG
CAAUAAUCAACUCGUUUUUAU
U    15.3 °C 1.8 °C 3 [detail]2 [detail]
1408-1430 AACTCGTTTTTATATTAATGTAC ACAUUAAUAUAAAAACGAGUU
CUCGUUUUUAUAUUAAUGUAC
U    -1.8 °C 15.3 °C 2 [detail]2 [detail]
1411-1433 TCGTTTTTATATTAATGTACTTG AGUACAUUAAUAUAAAAACGA
GUUUUUAUAUUAAUGUACUUG
U    14.6 °C -9.7 °C 3 [detail]2 [detail]
1431-1453 TTGTTTCTCTGTTGTAAGAATAG AUUCUUACAACAGAGAAACAA
GUUUCUCUGUUGUAAGAAUAG
U    14.6 °C 19.1 °C 2 [detail]2 [detail]
1442-1464 TTGTAAGAATAGGCATTAACACA UGUUAAUGCCUAUUCUUACAA
GUAAGAAUAGGCAUUAACACA
U    6.9 °C 6.9 °C 2 [detail]3 [detail]
1483-1505 AGGATTAGGTTCCATCCTTTACG UAAAGGAUGGAACCUAAUCCU
GAUUAGGUUCCAUCCUUUACG
U    18.7 °C 18.5 °C 3 [detail]3 [detail]
1493-1515 TCCATCCTTTACGTGTTTAAAAA UUUAAACACGUAAAGGAUGGA
CAUCCUUUACGUGUUUAAAAA
U    7.2 °C 18.7 °C 3 [detail]2 [detail]
1496-1518 ATCCTTTACGTGTTTAAAAAAAA UUUUUUAAACACGUAAAGGAU
CCUUUACGUGUUUAAAAAAAA
U    -9.1 °C 12.0 °C 3 [detail]2 [detail]
1497-1519 TCCTTTACGTGTTTAAAAAAAAG UUUUUUUAAACACGUAAAGGA
CUUUACGUGUUUAAAAAAAAG
U    -9.1 °C 15.0 °C 2 [detail]1 [detail]
1502-1524 TACGTGTTTAAAAAAAAGCATAA AUGCUUUUUUUUAAACACGUA
CGUGUUUAAAAAAAAGCAUAA
U    18.6 °C 14.7 °C 2 [detail]1 [detail]
1503-1525 ACGTGTTTAAAAAAAAGCATAAA UAUGCUUUUUUUUAAACACGU
GUGUUUAAAAAAAAGCAUAAA
U    18.5 °C 7.2 °C 2 [detail]1 [detail]
1505-1527 GTGTTTAAAAAAAAGCATAAAAA UUUAUGCUUUUUUUUAAACAC
GUUUAAAAAAAAGCAUAAAAA
U    19.7 °C -9.1 °C 2 [detail]1 [detail]
1517-1539 AAGCATAAAAACATTTTAAAAAC UUUUAAAAUGUUUUUAUGCUU
GCAUAAAAACAUUUUAAAAAC
U    -9.1 °C -1.4 °C 1 [detail]0 [detail]
1518-1540 AGCATAAAAACATTTTAAAAACA UUUUUAAAAUGUUUUUAUGCU
CAUAAAAACAUUUUAAAAACA
U    -9.1 °C -9.7 °C 1 [detail]1 [detail]
1526-1548 AACATTTTAAAAACATAGAAAAA UUUCUAUGUUUUUAAAAUGUU
CAUUUUAAAAACAUAGAAAAA
U    13.4 °C -9.7 °C 2 [detail]1 [detail]
1556-1578 AACCATTTTTAAAGTAGAAGAGG UCUUCUACUUUAAAAAUGGUU
CCAUUUUUAAAGUAGAAGAGG
U    18.9 °C -3.3 °C 2 [detail]1 [detail]
1567-1589 AAGTAGAAGAGGGTTTTAGGTAG ACCUAAAACCCUCUUCUACUU
GUAGAAGAGGGUUUUAGGUAG
U    11.0 °C 20.2 °C 2 [detail]2 [detail]
1576-1598 AGGGTTTTAGGTAGAAAAACATA UGUUUUUCUACCUAAAACCCU
GGUUUUAGGUAGAAAAACAUA
U    8.7 °C 4.9 °C 3 [detail]2 [detail]
1577-1599 GGGTTTTAGGTAGAAAAACATAT AUGUUUUUCUACCUAAAACCC
GUUUUAGGUAGAAAAACAUAU
U    5.6 °C 11.0 °C 2 [detail]2 [detail]
1583-1605 TAGGTAGAAAAACATATTCTTGT AAGAAUAUGUUUUUCUACCUA
GGUAGAAAAACAUAUUCUUGU
U    6.6 °C 14.6 °C 1 [detail]2 [detail]
1653-1675 TACTTTGCTTGCTCATATGCATG UGCAUAUGAGCAAGCAAAGUA
CUUUGCUUGCUCAUAUGCAUG
U    21.1 °C 18.6 °C 2 [detail]2 [detail]
1669-1691 ATGCATGTAGTCACTTTATAAGT UUAUAAAGUGACUACAUGCAU
GCAUGUAGUCACUUUAUAAGU
U    -2.3 °C 17.9 °C 3 [detail]2 [detail]
1678-1700 GTCACTTTATAAGTCATTGTATG UACAAUGACUUAUAAAGUGAC
CACUUUAUAAGUCAUUGUAUG
U    20.5 °C 4.6 °C 3 [detail]3 [detail]
1688-1710 AAGTCATTGTATGTTATTATATT UAUAAUAACAUACAAUGACUU
GUCAUUGUAUGUUAUUAUAUU
U    -8.0 °C 20.5 °C 2 [detail]2 [detail]
1690-1712 GTCATTGTATGTTATTATATTCC AAUAUAAUAACAUACAAUGAC
CAUUGUAUGUUAUUAUAUUCC
U    -8.6 °C 6.7 °C 1 [detail]2 [detail]
1908-1930 CTCCTACGATACGCTACTATAAA UAUAGUAGCGUAUCGUAGGAG
CCUACGAUACGCUACUAUAAA
U    11.2 °C 20.9 °C 4 [detail]3 [detail]
1909-1931 TCCTACGATACGCTACTATAAAG UUAUAGUAGCGUAUCGUAGGA
CUACGAUACGCUACUAUAAAG
U    7.9 °C 17.7 °C 3 [detail]3 [detail]
1934-1956 AAGACGAAATAGTGACATAATAT AUUAUGUCACUAUUUCGUCUU
GACGAAAUAGUGACAUAAUAU
U    16.1 °C 15.2 °C 2 [detail]2 [detail]
1936-1958 GACGAAATAGTGACATAATATAT AUAUUAUGUCACUAUUUCGUC
CGAAAUAGUGACAUAAUAUAU
U    0.0 °C 6.9 °C 3 [detail]2 [detail]
1937-1959 ACGAAATAGTGACATAATATATT UAUAUUAUGUCACUAUUUCGU
GAAAUAGUGACAUAAUAUAUU
U    -8.6 °C 4.6 °C 2 [detail]1 [detail]
1943-1965 TAGTGACATAATATATTCTATTT AUAGAAUAUAUUAUGUCACUA
GUGACAUAAUAUAUUCUAUUU
U    8.4 °C 21.5 °C 2 [detail]2 [detail]
1945-1967 GTGACATAATATATTCTATTTTT AAAUAGAAUAUAUUAUGUCAC
GACAUAAUAUAUUCUAUUUUU
U    6.9 °C 6.7 °C 2 [detail]2 [detail]
1947-1969 GACATAATATATTCTATTTTTAT AAAAAUAGAAUAUAUUAUGUC
CAUAAUAUAUUCUAUUUUUAU
U    -4.3 °C -8.6 °C 2 [detail]2 [detail]
2063-2085 TACTTGGTTTGTGTTCTTCTTCA AAGAAGAACACAAACCAAGUA
CUUGGUUUGUGUUCUUCUUCA
U    19.1 °C 18.8 °C 2 [detail]2 [detail]
2066-2088 TTGGTTTGTGTTCTTCTTCATAT AUGAAGAAGAACACAAACCAA
GGUUUGUGUUCUUCUUCAUAU
U    20.4 °C 19.3 °C 2 [detail]2 [detail]
2067-2089 TGGTTTGTGTTCTTCTTCATATT UAUGAAGAAGAACACAAACCA
GUUUGUGUUCUUCUUCAUAUU
U    20.4 °C 19.3 °C 2 [detail]2 [detail]
2071-2093 TTGTGTTCTTCTTCATATTCTAA AGAAUAUGAAGAAGAACACAA
GUGUUCUUCUUCAUAUUCUAA
U    8.7 °C 19.2 °C 2 [detail]1 [detail]
2073-2095 GTGTTCTTCTTCATATTCTAAAA UUAGAAUAUGAAGAAGAACAC
GUUCUUCUUCAUAUUCUAAAA
U    8.4 °C 19.1 °C 1 [detail]1 [detail]
2079-2101 TTCTTCATATTCTAAAACCATTC AUGGUUUUAGAAUAUGAAGAA
CUUCAUAUUCUAAAACCAUUC
U    18.8 °C 8.7 °C 2 [detail]1 [detail]
2099-2121 TTCCATTTCCAAGCACTTTCAGT UGAAAGUGCUUGGAAAUGGAA
CCAUUUCCAAGCACUUUCAGU
U    19.2 °C 20.1 °C 2 [detail]1 [detail]
2110-2132 AGCACTTTCAGTCCAATAGGTGT ACCUAUUGGACUGAAAGUGCU
CACUUUCAGUCCAAUAGGUGU
U    17.4 °C 19.2 °C 3 [detail]3 [detail]
2120-2142 GTCCAATAGGTGTAGGAAATAGC UAUUUCCUACACCUAUUGGAC
CCAAUAGGUGUAGGAAAUAGC
U    18.7 °C 17.4 °C 2 [detail]3 [detail]
2133-2155 AGGAAATAGCGCTGTTTTTGTTG ACAAAAACAGCGCUAUUUCCU
GAAAUAGCGCUGUUUUUGUUG
U    5.6 °C 13.6 °C 3 [detail]3 [detail]
2192-2214 TGGGAATATCCATGTACTTGTTT ACAAGUACAUGGAUAUUCCCA
GGAAUAUCCAUGUACUUGUUU
U    19.0 °C 11.6 °C 3 [detail]2 [detail]
2193-2215 GGGAATATCCATGTACTTGTTTG AACAAGUACAUGGAUAUUCCC
GAAUAUCCAUGUACUUGUUUG
U    19.0 °C 15.4 °C 3 [detail]2 [detail]
2288-2310 CAGTCAAGAAGAAAAAGGTTTGC AAACCUUUUUCUUCUUGACUG
GUCAAGAAGAAAAAGGUUUGC
U    17.3 °C 20.4 °C 2 [detail]2 [detail]
2293-2315 AAGAAGAAAAAGGTTTGCATTCT AAUGCAAACCUUUUUCUUCUU
GAAGAAAAAGGUUUGCAUUCU
U    20.0 °C 5.5 °C 2 [detail]2 [detail]
2328-2350 ATGATAAGTTCCTTTCCTTTTCT AAAAGGAAAGGAACUUAUCAU
GAUAAGUUCCUUUCCUUUUCU
U    18.7 °C 4.6 °C 2 [detail]2 [detail]
2333-2355 AAGTTCCTTTCCTTTTCTTTAAA UAAAGAAAAGGAAAGGAACUU
GUUCCUUUCCUUUUCUUUAAA
U    5.5 °C 18.7 °C 1 [detail]1 [detail]
2337-2359 TCCTTTCCTTTTCTTTAAAGAAG UCUUUAAAGAAAAGGAAAGGA
CUUUCCUUUUCUUUAAAGAAG
U    -3.8 °C 18.7 °C 2 [detail]1 [detail]
2341-2363 TTCCTTTTCTTTAAAGAAGTTGA AACUUCUUUAAAGAAAAGGAA
CCUUUUCUUUAAAGAAGUUGA
U    17.7 °C 10.3 °C 1 [detail]1 [detail]
2347-2369 TTCTTTAAAGAAGTTGAAGTTTA AACUUCAACUUCUUUAAAGAA
CUUUAAAGAAGUUGAAGUUUA
U    19.2 °C -3.8 °C 2 [detail]2 [detail]
2354-2376 AAGAAGTTGAAGTTTAGGAATCC AUUCCUAAACUUCAACUUCUU
GAAGUUGAAGUUUAGGAAUCC
U    19.9 °C 19.2 °C 2 [detail]3 [detail]
2433-2455 GTGGTTTTTAAGGGTTATCTTAG AAGAUAACCCUUAAAAACCAC
GGUUUUUAAGGGUUAUCUUAG
U    14.5 °C 0.0 °C 3 [detail]2 [detail]
2434-2456 TGGTTTTTAAGGGTTATCTTAGA UAAGAUAACCCUUAAAAACCA
GUUUUUAAGGGUUAUCUUAGA
U    6.9 °C -9.1 °C 2 [detail]2 [detail]
2443-2465 AGGGTTATCTTAGATGTTTCACA UGAAACAUCUAAGAUAACCCU
GGUUAUCUUAGAUGUUUCACA
U    14.8 °C 14.5 °C 3 [detail]3 [detail]
2467-2489 CGGAAGGTTTTTAAACACTAAAA UUAGUGUUUAAAAACCUUCCG
GAAGGUUUUUAAACACUAAAA
U    19.0 °C 17.3 °C 2 [detail]2 [detail]
2470-2492 AAGGTTTTTAAACACTAAAATAT AUUUUAGUGUUUAAAAACCUU
GGUUUUUAAACACUAAAAUAU
U    4.9 °C 0.0 °C 2 [detail]2 [detail]
2471-2493 AGGTTTTTAAACACTAAAATATA UAUUUUAGUGUUUAAAAACCU
GUUUUUAAACACUAAAAUAUA
U    -4.3 °C -9.1 °C 2 [detail]2 [detail]
2480-2502 AACACTAAAATATATAATTTATA UAAAUUAUAUAUUUUAGUGUU
CACUAAAAUAUAUAAUUUAUA
U    -10.3 °C 4.9 °C 2 [detail]2 [detail]
2482-2504 CACTAAAATATATAATTTATAGT UAUAAAUUAUAUAUUUUAGUG
CUAAAAUAUAUAAUUUAUAGU
U    -10.3 °C -7.5 °C 1 [detail]2 [detail]
2506-2528 AAGGCTAAAAAGTATATTTATTG AUAAAUAUACUUUUUAGCCUU
GGCUAAAAAGUAUAUUUAUUG
U    -8.0 °C 13.7 °C 2 [detail]2 [detail]
2507-2529 AGGCTAAAAAGTATATTTATTGC AAUAAAUAUACUUUUUAGCCU
GCUAAAAAGUAUAUUUAUUGC
U    -8.0 °C -3.8 °C 2 [detail]2 [detail]
2535-2557 ATGTTCATAAGGCCAGTATGATT UCAUACUGGCCUUAUGAACAU
GUUCAUAAGGCCAGUAUGAUU
U    17.9 °C 8.9 °C 3 [detail]2 [detail]
2548-2570 CAGTATGATTTATAAATGCAATC UUGCAUUUAUAAAUCAUACUG
GUAUGAUUUAUAAAUGCAAUC
U    20.0 °C 8.7 °C 2 [detail]2 [detail]
2563-2585 ATGCAATCTCCCCTTGATTTAAA UAAAUCAAGGGGAGAUUGCAU
GCAAUCUCCCCUUGAUUUAAA
U    7.4 °C 20.4 °C 3 [detail]3 [detail]
2627-2649 TGCCTTTGATGTTACAGATTTAA AAAUCUGUAACAUCAAAGGCA
CCUUUGAUGUUACAGAUUUAA
U    19.2 °C 12.0 °C 3 [detail]2 [detail]
2628-2650 GCCTTTGATGTTACAGATTTAAT UAAAUCUGUAACAUCAAAGGC
CUUUGAUGUUACAGAUUUAAU
U    12.0 °C 13.8 °C 2 [detail]2 [detail]
2635-2657 ATGTTACAGATTTAATACAGTTT ACUGUAUUAAAUCUGUAACAU
GUUACAGAUUUAAUACAGUUU
U    11.6 °C 20.3 °C 2 [detail]2 [detail]
2639-2661 TACAGATTTAATACAGTTTATTT AUAAACUGUAUUAAAUCUGUA
CAGAUUUAAUACAGUUUAUUU
U    11.8 °C 6.9 °C 2 [detail]0 [detail]
2641-2663 CAGATTTAATACAGTTTATTTTT AAAUAAACUGUAUUAAAUCUG
GAUUUAAUACAGUUUAUUUUU
U    -0.3 °C -10.3 °C 2 [detail]2 [detail]
2650-2672 TACAGTTTATTTTTAAAGATAGA UAUCUUUAAAAAUAAACUGUA
CAGUUUAUUUUUAAAGAUAGA
U    6.9 °C 4.6 °C 2 [detail]2 [detail]
2652-2674 CAGTTTATTTTTAAAGATAGATC UCUAUCUUUAAAAAUAAACUG
GUUUAUUUUUAAAGAUAGAUC
U    11.6 °C -9.7 °C 1 [detail]2 [detail]
2665-2687 AAGATAGATCCTTTTATAGGTGA ACCUAUAAAAGGAUCUAUCUU
GAUAGAUCCUUUUAUAGGUGA
U    12.3 °C 15.9 °C 2 [detail]3 [detail]
2672-2694 ATCCTTTTATAGGTGAGAAAAAA UUUUCUCACCUAUAAAAGGAU
CCUUUUAUAGGUGAGAAAAAA
U    20.4 °C -4.3 °C 1 [detail]2 [detail]
2673-2695 TCCTTTTATAGGTGAGAAAAAAA UUUUUCUCACCUAUAAAAGGA
CUUUUAUAGGUGAGAAAAAAA
U    14.8 °C -7.5 °C 1 [detail]2 [detail]
2704-2726 AAGAAAAAAACCACACAAAGACA UCUUUGUGUGGUUUUUUUCUU
GAAAAAAACCACACAAAGACA
U    16.7 °C -11.3 °C 2 [detail]2 [detail]
2842-2864 TTCCTTTAAAAAACTTAGTGACA UCACUAAGUUUUUUAAAGGAA
CCUUUAAAAAACUUAGUGACA
U    16.4 °C -3.8 °C 2 [detail]2 [detail]
2853-2875 AACTTAGTGACAAAATAGACAAT UGUCUAUUUUGUCACUAAGUU
CUUAGUGACAAAAUAGACAAU
U    14.5 °C 20.3 °C 2 [detail]2 [detail]
2857-2879 TAGTGACAAAATAGACAATTTGC AAAUUGUCUAUUUUGUCACUA
GUGACAAAAUAGACAAUUUGC
U    14.8 °C 20.5 °C 2 [detail]2 [detail]
2877-2899 TGCACATCTTGGCTATGTAATTC AUUACAUAGCCAAGAUGUGCA
CACAUCUUGGCUAUGUAAUUC
U    8.5 °C 19.2 °C 3 [detail]2 [detail]
2886-2908 TGGCTATGTAATTCTTGTAATTT AUUACAAGAAUUACAUAGCCA
GCUAUGUAAUUCUUGUAAUUU
U    11.8 °C 13.1 °C 3 [detail]2 [detail]
2887-2909 GGCTATGTAATTCTTGTAATTTT AAUUACAAGAAUUACAUAGCC
CUAUGUAAUUCUUGUAAUUUU
U    6.9 °C 8.5 °C 2 [detail]2 [detail]
2891-2913 ATGTAATTCTTGTAATTTTTATT UAAAAAUUACAAGAAUUACAU
GUAAUUCUUGUAAUUUUUAUU
U    -12.0 °C 6.9 °C 1 [detail]0 [detail]
3105-3127 TTCTGTGTATCTCTTTCACATTG AUGUGAAAGAGAUACACAGAA
CUGUGUAUCUCUUUCACAUUG
U    20.5 °C 20.4 °C 2 [detail]0 [detail]
3109-3131 GTGTATCTCTTTCACATTGTTTG AACAAUGUGAAAGAGAUACAC
GUAUCUCUUUCACAUUGUUUG
U    19.3 °C 20.2 °C 2 [detail]0 [detail]
3132-3154 CTGCTATTGGAGGATCAGTTTTT AAACUGAUCCUCCAAUAGCAG
GCUAUUGGAGGAUCAGUUUUU
U    19.2 °C 17.4 °C 3 [detail]2 [detail]
3133-3155 TGCTATTGGAGGATCAGTTTTTT AAAACUGAUCCUCCAAUAGCA
CUAUUGGAGGAUCAGUUUUUU
U    19.2 °C 21.2 °C 2 [detail]3 [detail]
3145-3167 ATCAGTTTTTTGTTTTACAATGT AUUGUAAAACAAAAAACUGAU
CAGUUUUUUGUUUUACAAUGU
U    7.2 °C 3.2 °C 2 [detail]2 [detail]
3147-3169 CAGTTTTTTGTTTTACAATGTCA ACAUUGUAAAACAAAAAACUG
GUUUUUUGUUUUACAAUGUCA
U    13.5 °C -2.9 °C 2 [detail]1 [detail]
3166-3188 GTCATATACTGCCATGTACTAGT UAGUACAUGGCAGUAUAUGAC
CAUAUACUGCCAUGUACUAGU
U    19.0 °C 6.1 °C 2 [detail]2 [detail]
3175-3197 TGCCATGTACTAGTTTTAGTTTT AACUAAAACUAGUACAUGGCA
CCAUGUACUAGUUUUAGUUUU
U    4.9 °C 20.4 °C 3 [detail]2 [detail]
3176-3198 GCCATGTACTAGTTTTAGTTTTC AAACUAAAACUAGUACAUGGC
CAUGUACUAGUUUUAGUUUUC
U    4.9 °C 19.0 °C 3 [detail]3 [detail]
3179-3201 ATGTACTAGTTTTAGTTTTCTCT AGAAAACUAAAACUAGUACAU
GUACUAGUUUUAGUUUUCUCU
U    13.3 °C 18.8 °C 3 [detail]2 [detail]
3182-3204 TACTAGTTTTAGTTTTCTCTTAG AAGAGAAAACUAAAACUAGUA
CUAGUUUUAGUUUUCUCUUAG
U    19.1 °C 4.9 °C 2 [detail]2 [detail]
3185-3207 TAGTTTTAGTTTTCTCTTAGAAC UCUAAGAGAAAACUAAAACUA
GUUUUAGUUUUCUCUUAGAAC
U    16.3 °C 4.9 °C 2 [detail]2 [detail]
3196-3218 TTCTCTTAGAACATTGTATTACA UAAUACAAUGUUCUAAGAGAA
CUCUUAGAACAUUGUAUUACA
U    6.9 °C 20.2 °C 2 [detail]2 [detail]
3198-3220 CTCTTAGAACATTGTATTACAGA UGUAAUACAAUGUUCUAAGAG
CUUAGAACAUUGUAUUACAGA
U    9.5 °C 14.6 °C 2 [detail]2 [detail]
3220-3242 ATGCCTTTTTTGTAGTTTTTTTT AAAAAACUACAAAAAAGGCAU
GCCUUUUUUGUAGUUUUUUUU
U    3.2 °C 9.5 °C 1 [detail]1 [detail]
3221-3243 TGCCTTTTTTGTAGTTTTTTTTT AAAAAAACUACAAAAAAGGCA
CCUUUUUUGUAGUUUUUUUUU
U    -1.8 °C -5.9 °C 1 [detail]1 [detail]
3222-3244 GCCTTTTTTGTAGTTTTTTTTTT AAAAAAAACUACAAAAAAGGC
CUUUUUUGUAGUUUUUUUUUU
U    -11.3 °C -2.9 °C 1 [detail]0 [detail]
3229-3251 TTGTAGTTTTTTTTTTTTTTATG UAAAAAAAAAAAAAACUACAA
GUAGUUUUUUUUUUUUUUAUG
U    -11.3 °C 4.9 °C 0 [detail]0 [detail]
3232-3254 TAGTTTTTTTTTTTTTTATGTGA ACAUAAAAAAAAAAAAAACUA
GUUUUUUUUUUUUUUAUGUGA
U    -1.4 °C -11.3 °C 1 [detail]0 [detail]
3254-3276 ATCAATTTTGACTTAATGTGATT UCACAUUAAGUCAAAAUUGAU
CAAUUUUGACUUAAUGUGAUU
U    13.5 °C -3.3 °C 2 [detail]3 [detail]
3271-3293 GTGATTACTGCTCTATTCCAAAA UUGGAAUAGAGCAGUAAUCAC
GAUUACUGCUCUAUUCCAAAA
U    21.2 °C 11.6 °C 2 [detail]3 [detail]
3278-3300 CTGCTCTATTCCAAAAAGGTTGC AACCUUUUUGGAAUAGAGCAG
GCUCUAUUCCAAAAAGGUUGC
U    17.3 °C 11.6 °C 1 [detail]2 [detail]
3287-3309 TCCAAAAAGGTTGCTGTTTCACA UGAAACAGCAACCUUUUUGGA
CAAAAAGGUUGCUGUUUCACA
U    19.2 °C 9.5 °C 1 [detail]2 [detail]
3524-3546 AGCATCATAGTAGTTTTTACAGC UGUAAAAACUACUAUGAUGCU
CAUCAUAGUAGUUUUUACAGC
U    0.0 °C 13.3 °C 3 [detail]3 [detail]
3534-3556 TAGTTTTTACAGCTGTGTTATTC AUAACACAGCUGUAAAAACUA
GUUUUUACAGCUGUGUUAUUC
U    20.4 °C 0.0 °C 2 [detail]1 [detail]
3566-3588 AGCTATGGAAGTTGCATAATTAT AAUUAUGCAACUUCCAUAGCU
CUAUGGAAGUUGCAUAAUUAU
U    15.2 °C 21.2 °C 2 [detail]3 [detail]
3570-3592 ATGGAAGTTGCATAATTATTATT UAAUAAUUAUGCAACUUCCAU
GGAAGUUGCAUAAUUAUUAUU
U    -10.3 °C 19.2 °C 1 [detail]2 [detail]
3574-3596 AAGTTGCATAATTATTATTATTA AUAAUAAUAAUUAUGCAACUU
GUUGCAUAAUUAUUAUUAUUA
U    -8.0 °C 21.1 °C 2 [detail]1 [detail]
3577-3599 TTGCATAATTATTATTATTATTA AUAAUAAUAAUAAUUAUGCAA
GCAUAAUUAUUAUUAUUAUUA
U    -8.0 °C -1.8 °C 1 [detail]1 [detail]
3578-3600 TGCATAATTATTATTATTATTAT AAUAAUAAUAAUAAUUAUGCA
CAUAAUUAUUAUUAUUAUUAU
U    -8.0 °C -8.0 °C 1 [detail]0 [detail]
3674-3696 TTCTGGAATTTGTTCAAGTTTTG AAACUUGAACAAAUUCCAGAA
CUGGAAUUUGUUCAAGUUUUG
U    19.2 °C 20.1 °C 2 [detail]2 [detail]
3686-3708 TTCAAGTTTTGGGTATGTTTAAT UAAACAUACCCAAAACUUGAA
CAAGUUUUGGGUAUGUUUAAU
U    6.9 °C 3.2 °C 2 [detail]2 [detail]
3695-3717 TGGGTATGTTTAATCTGTTATGT AUAACAGAUUAAACAUACCCA
GGUAUGUUUAAUCUGUUAUGU
U    20.3 °C 14.6 °C 2 [detail]2 [detail]
3700-3722 ATGTTTAATCTGTTATGTACTAG AGUACAUAACAGAUUAAACAU
GUUUAAUCUGUUAUGUACUAG
U    15.8 °C 2.1 °C 2 [detail]2 [detail]
3714-3736 ATGTACTAGTGTTCTGTTTGTTA ACAAACAGAACACUAGUACAU
GUACUAGUGUUCUGUUUGUUA
U    16.7 °C 18.8 °C 1 [detail]2 [detail]
3717-3739 TACTAGTGTTCTGTTTGTTATTG AUAACAAACAGAACACUAGUA
CUAGUGUUCUGUUUGUUAUUG
U    7.2 °C 19.0 °C 3 [detail]2 [detail]
3722-3744 GTGTTCTGTTTGTTATTGTTTTG AAACAAUAACAAACAGAACAC
GUUCUGUUUGUUAUUGUUUUG
U    6.9 °C 19.2 °C 1 [detail]1 [detail]
3725-3747 TTCTGTTTGTTATTGTTTTGTTA ACAAAACAAUAACAAACAGAA
CUGUUUGUUAUUGUUUUGUUA
U    12.2 °C 19.3 °C 1 [detail]1 [detail]
3727-3749 CTGTTTGTTATTGTTTTGTTAAT UAACAAAACAAUAACAAACAG
GUUUGUUAUUGUUUUGUUAAU
U    5.6 °C 7.2 °C 1 [detail]2 [detail]
3731-3753 TTGTTATTGTTTTGTTAATTACA UAAUUAACAAAACAAUAACAA
GUUAUUGUUUUGUUAAUUACA
U    -0.3 °C 6.9 °C 2 [detail]2 [detail]
3750-3772 TACACCATAATGCTAATTTAAAG UUAAAUUAGCAUUAUGGUGUA
CACCAUAAUGCUAAUUUAAAG
U    -7.5 °C 20.0 °C 2 [detail]3 [detail]
3753-3775 ACCATAATGCTAATTTAAAGAGA UCUUUAAAUUAGCAUUAUGGU
CAUAAUGCUAAUUUAAAGAGA
U    -3.8 °C 15.2 °C 2 [detail]2 [detail]
4239-4261 AAGACAAAAAGACAAACATGAAA UCAUGUUUGUCUUUUUGUCUU
GACAAAAAGACAAACAUGAAA
U    12.1 °C 5.6 °C 2 [detail]2 [detail]
4241-4263 GACAAAAAGACAAACATGAAAGT UUUCAUGUUUGUCUUUUUGUC
CAAAAAGACAAACAUGAAAGU
U    20.5 °C 5.5 °C 1 [detail]2 [detail]
4253-4275 AACATGAAAGTCTAGAAATAAAA UUAUUUCUAGACUUUCAUGUU
CAUGAAAGUCUAGAAAUAAAA
U    6.9 °C 12.0 °C 2 [detail]2 [detail]
4274-4296 AACTGGTAAAACCCCAAAAAAAA UUUUUUGGGGUUUUACCAGUU
CUGGUAAAACCCCAAAAAAAA
U    11.5 °C 20.0 °C 2 [detail]1 [detail]
4276-4298 CTGGTAAAACCCCAAAAAAAAAA UUUUUUUUGGGGUUUUACCAG
GGUAAAACCCCAAAAAAAAAA
U    -11.3 °C 8.2 °C 2 [detail]1 [detail]
4277-4299 TGGTAAAACCCCAAAAAAAAAAA UUUUUUUUUGGGGUUUUACCA
GUAAAACCCCAAAAAAAAAAA
U    -11.3 °C 14.0 °C 2 [detail]0 [detail]

Graphical view of effective siRNA candidates

start-end Functional, off-target reduced siRNA (seed duplex Tm < 10 °C)
start-end Functional, off-target reduced siRNA (seed duplex Tm < 15 °C)
start-end Functional, off-target reduced siRNA (seed duplex Tm < 21.5 °C)
start-end Functional siRNA
10 20 30 40 50 60 70 80 90 100  
CACACGGACTACAGGGGAGTTTTGTTGAAGTTGCAAAGTCCTGGAGCCTCCAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCG   1-100
 
110 120 130 140 150 160 170 180 190 200  
GCGAGGGGCAGAAGAGCGCGAGGGAGCGCGGGGCAGCAGAAGCGAGAGCCGAGCGCGGACCCAGCCAGGACCCACAGCCCTCCCCAGCTGCCCAGGAAGA   101-200
 
210 220 230 240 250 260 270 280 290 300  
GCCCCAGCCATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCA   201-300
 
310 320 330 340 350 360 370 380 390 400  
TGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGAT   301-400
 
410 420 430 440 450 460 470 480 490 500  
GCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGC   401-500
 
510 520 530 540 550 560 570 580 590 600  
CGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACT   501-600
 
610 620 630 640 650 660 670 680 690 700  
CCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTT   601-700
 
710 720 730 740 750 760 770 780 790 800  
CCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCC   701-800
781-803 U
 
810 820 830 840 850 860 870 880 890 900  
AATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACAC   801-900
 
 
910 920 930 940 950 960 970 980 990 1000  
GCTTCCTCTCCAGAGTGATCAAGTGTGACCCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCA   901-1000
 
1010 1020 1030 1040 1050 1060 1070 1080 1090 1100  
GAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGAGGG   1001-1100
 
1110 1120 1130 1140 1150 1160 1170 1180 1190 1200  
CGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCCCAGGTGCTCCCCTGACAGTCCCTCCTCTCCGGAGCATTTTGATACCAGA   1101-1200
 
1210 1220 1230 1240 1250 1260 1270 1280 1290 1300  
AGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCCCCTTCCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTG   1201-1300
1206-1228 U
1207-1229 U
1216-1238 U
1217-1239 U
1262-1284 U
1264-1286 U
1266-1288 U
1288-1310 U
1289-1311 U
 
1310 1320 1330 1340 1350 1360 1370 1380 1390 1400  
TCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATTTGCATAACCCTGAGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCC   1301-1400
 
 
1314-1336 U
1316-1338 U
1318-1340 U
1374-1396 U
1376-1398 U
1386-1408 U
1397-1419 U
1398-1420 U
 
1410 1420 1430 1440 1450 1460 1470 1480 1490 1500  
AATAATCAACTCGTTTTTATATTAATGTACTTGTTTCTCTGTTGTAAGAATAGGCATTAACACAAAGGAGGCGTCTCGGGAGAGGATTAGGTTCCATCCT   1401-1500
 
 
 
1408-1430 U
1411-1433 U
1431-1453 U
1442-1464 U
1483-1505 U
1493-1515 U
1496-1518 U
1497-1519 U
 
1510 1520 1530 1540 1550 1560 1570 1580 1590 1600  
TTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAAATTCAGCAAACCATTTTTAAAGTAGAAGAGGGTTTTAGGTAGAAAAACATATT   1501-1600
 
 
 
 
1502-1524 U
1503-1525 U
1505-1527 U
1517-1539 U
1518-1540 U
1526-1548 U
1556-1578 U
1567-1589 U
1576-1598 U
1577-1599 U
1583-1605 U
 
1610 1620 1630 1640 1650 1660 1670 1680 1690 1700  
CTTGTGCTTTTCCTGATAAAGCACAGCTGTAGTGGGGTTCTAGGCATCTCTGTACTTTGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATG   1601-1700
 
1653-1675 U
1669-1691 U
1678-1700 U
1688-1710 U
1690-1712 U
 
1710 1720 1730 1740 1750 1760 1770 1780 1790 1800  
TTATTATATTCCGTAGGTAGATGTGTAACCTCTTCACCTTATTCATGGCTGAAGTCACCTCTTGGTTACAGTAGCGTAGCGTGCCCGTGTGCATGTCCTT   1701-1800
 
 
 
1810 1820 1830 1840 1850 1860 1870 1880 1890 1900  
TGCGCCTGTGACCACCACCCCAACAAACCATCCAGTGACAAACCATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCCACC   1801-1900
 
1910 1920 1930 1940 1950 1960 1970 1980 1990 2000  
TGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAAATAGTGACATAATATATTCTATTTTTATACTCTTCCTATTTTTGTAGTGACCTGTTTAT   1901-2000
1908-1930 U
1909-1931 U
1934-1956 U
1936-1958 U
1937-1959 U
1943-1965 U
1945-1967 U
1947-1969 U
 
2010 2020 2030 2040 2050 2060 2070 2080 2090 2100  
GAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCACGTCCAGGTTCAACCCACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATT   2001-2100
2063-2085 U
2066-2088 U
2067-2089 U
2071-2093 U
2073-2095 U
2079-2101 U
2099-2121 U
 
2110 2120 2130 2140 2150 2160 2170 2180 2190 2200  
CCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAAATAGCGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATAT   2101-2200
 
2110-2132 U
2120-2142 U
2133-2155 U
2192-2214 U
2193-2215 U
 
2210 2220 2230 2240 2250 2260 2270 2280 2290 2300  
CCATGTACTTGTTTGCAAGCAGGACTTTGAGGCAAGTGTGGGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAAGAA   2201-2300
 
 
2288-2310 U
2293-2315 U
 
2310 2320 2330 2340 2350 2360 2370 2380 2390 2400  
AAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCCTTTCCTTTTCTTTAAAGAAGTTGAAGTTTAGGAATCCTTTGGTGCCAACTGGTGTTTGAAA   2301-2400
 
 
2328-2350 U
2333-2355 U
2337-2359 U
2341-2363 U
2347-2369 U
2354-2376 U
 
2410 2420 2430 2440 2450 2460 2470 2480 2490 2500  
GTAGGGACCTCAGAGGTTTACCTAGAGAACAGGTGGTTTTTAAGGGTTATCTTAGATGTTTCACACCGGAAGGTTTTTAAACACTAAAATATATAATTTA   2401-2500
2433-2455 U
2434-2456 U
2443-2465 U
2467-2489 U
2470-2492 U
2471-2493 U
2480-2502 U
2482-2504 U
 
2510 2520 2530 2540 2550 2560 2570 2580 2590 2600  
TAGTTAAGGCTAAAAAGTATATTTATTGCAGAGGATGTTCATAAGGCCAGTATGATTTATAAATGCAATCTCCCCTTGATTTAAACACACAGATACACAC   2501-2600
 
 
2506-2528 U
2507-2529 U
2535-2557 U
2548-2570 U
2563-2585 U
 
2610 2620 2630 2640 2650 2660 2670 2680 2690 2700  
ACACACACACACACACACAAACCTTCTGCCTTTGATGTTACAGATTTAATACAGTTTATTTTTAAAGATAGATCCTTTTATAGGTGAGAAAAAAACAATC   2601-2700
2627-2649 U
2628-2650 U
2635-2657 U
2639-2661 U
2641-2663 U
2650-2672 U
2652-2674 U
2665-2687 U
2672-2694 U
2673-2695 U
 
2710 2720 2730 2740 2750 2760 2770 2780 2790 2800  
TGGAAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGGCGTTTCCCAGAGTCATCTGATTGGACAGGCATGGGTGCAAGGAAAATTAGGGTACT   2701-2800
2704-2726 U
 
2810 2820 2830 2840 2850 2860 2870 2880 2890 2900  
CAACCTAAGTTCGGTTCCGATGAATTCTTATCCCCTGCCCCTTCCTTTAAAAAACTTAGTGACAAAATAGACAATTTGCACATCTTGGCTATGTAATTCT   2801-2900
2842-2864 U
2853-2875 U
2857-2879 U
2877-2899 U
2886-2908 U
2887-2909 U
2891-2913 U
 
2910 2920 2930 2940 2950 2960 2970 2980 2990 3000  
TGTAATTTTTATTTAGGAAGTGTTGAAGGGAGGTGGCAAGAGTGTGGAGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAGGAGGAGGCTCCC   2901-3000
 
 
 
 
3010 3020 3030 3040 3050 3060 3070 3080 3090 3100  
GAGGGGAAGGGGCGGTGCCCACACCGGGGACAGGCCGCAGCTCCATTTTCTTATTGCGCTGCTACCGTTGACTTCCAGGCACGGTTTGGAAATATTCACA   3001-3100
 
3110 3120 3130 3140 3150 3160 3170 3180 3190 3200  
TCGCTTCTGTGTATCTCTTTCACATTGTTTGCTGCTATTGGAGGATCAGTTTTTTGTTTTACAATGTCATATACTGCCATGTACTAGTTTTAGTTTTCTC   3101-3200
3105-3127 U
3109-3131 U
3132-3154 U
3133-3155 U
3145-3167 U
3147-3169 U
3166-3188 U
3175-3197 U
3176-3198 U
3179-3201 U
3182-3204 U
3185-3207 U
3196-3218 U
3198-3220 U
 
3210 3220 3230 3240 3250 3260 3270 3280 3290 3300  
TTAGAACATTGTATTACAGATGCCTTTTTTGTAGTTTTTTTTTTTTTTATGTGATCAATTTTGACTTAATGTGATTACTGCTCTATTCCAAAAAGGTTGC   3201-3300
 
 
 
 
3220-3242 U
3221-3243 U
3222-3244 U
3229-3251 U
3232-3254 U
3254-3276 U
3271-3293 U
3278-3300 U
3287-3309 U
 
3310 3320 3330 3340 3350 3360 3370 3380 3390 3400  
TGTTTCACAATACCTCATGCTTCACTTAGCCATGGTGGACCCAGCGGGCAGGTTCTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACACAGGC   3301-3400
 
 
3410 3420 3430 3440 3450 3460 3470 3480 3490 3500  
TGGCGGGGGCCGGCCCCGAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCTCTTCCCTGCGCCTGTGATGCTGG   3401-3500
 
3510 3520 3530 3540 3550 3560 3570 3580 3590 3600  
GCACTTCATCTGATCGGGGGCGTAGCATCATAGTAGTTTTTACAGCTGTGTTATTCTTTGCGTGTAGCTATGGAAGTTGCATAATTATTATTATTATTAT   3501-3600
3524-3546 U
3534-3556 U
3566-3588 U
3570-3592 U
3574-3596 U
3577-3599 U
3578-3600 U
 
3610 3620 3630 3640 3650 3660 3670 3680 3690 3700  
TATAACAAGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCGGGATGATTGGAATAGCTTCTGGAATTTGTTCAAGTTTTGGGTA   3601-3700
3674-3696 U
3686-3708 U
3695-3717 U
3700-3722 U
 
3710 3720 3730 3740 3750 3760 3770 3780 3790 3800  
TGTTTAATCTGTTATGTACTAGTGTTCTGTTTGTTATTGTTTTGTTAATTACACCATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCCAGCTC   3701-3800
 
 
 
3714-3736 U
3717-3739 U
3722-3744 U
3725-3747 U
3727-3749 U
3731-3753 U
3750-3772 U
3753-3775 U
 
3810 3820 3830 3840 3850 3860 3870 3880 3890 3900  
ACAGTGCTGTGTGCCCCGGTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCGCTGCGGGCCCACGTGGTTGGGGCCCTGCCCTGGCAGGGTCA   3801-3900
 
3910 3920 3930 3940 3950 3960 3970 3980 3990 4000  
TCCTGTGCTCGGAGGCCATCTCGGGCACAGGCCCACCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCAACCATCCTGGCTGCGGCGTCTGTC   3901-4000
 
4010 4020 4030 4040 4050 4060 4070 4080 4090 4100  
TGAACCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGGGGCAAGGGCACAAGTCCTGGATGTTGTGTGTATCGAGAGGCCAAAGGCTGGTGGC   4001-4100
 
4110 4120 4130 4140 4150 4160 4170 4180 4190 4200  
AAGTGCACGGGGCACAGCGGAGTCTGTCCTGTGACGCGCAAGTCTGAGGGTCTGGGCGGCGGGCGGCTGGGTCTGTGCATTTCTGGTTGCACCGCGGCGC   4101-4200
 
4210 4220 4230 4240 4250 4260 4270 4280 4290 4300  
TTCCCAGCACCAACATGTAACCGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAAAAAAAAAAAA   4201-4300
4239-4261 U
4241-4263 U
4253-4275 U
4274-4296 U
4276-4298 U
4277-4299 U
 
 
AAAA   4301-4304
 

Tab-delimited list (for data export)