siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 783   1268   1291   1413   1433   1444   1495   1558   1569   1578   1585   1655   2065   2112   2135   2194   2295   2330   2335   2339  
2435   2436   2445   2537   2565   2637   2654   2667   2706   2855   2879   3107   3134   3135   3149   3181   3187   3198   3200   3234  
3256   3289   3526   3568   3702   3716   3755   4241   4276  
Biltr, Ernai, Rnaxs, Sidirect 1399   1911   1936   1947   3576   3579  
Biltr, Ernai 3522  
Biltr, Rnaxs 16   18   19   127   128   159   160   254   255   259   260   261   262   267   325   326   327   328   329   330  
331   332   334   335   337   403   416   478   479   480   582   583   586   587   641   643   657   658   673   674  
675   676   677   678   679   680   681   682   683   693   700   722   723   724   725   778   779   780   781   785  
786   860   863   877   878   879   889   898   905   906   908   909   910   949   1019   1021   1022   1025   1028   1031  
1078   1079   1080   1081   1156   1157   1159   1160   1161   1175   1176   1177   1180   1181   1182   1183   1206   1207   1215   1216  
1217   1220   1221   1224   1225   1228   1231   1232   1238   1239   1243   1244   1245   1251   1252   1253   1254   1257   1258   1259  
1260   1263   1265   1267   1270   1271   1273   1277   1278   1279   1300   1301   1306   1307   1308   1309   1310   1311   1312   1313  
1314   1317   1319   1332   1357   1358   1359   1364   1365   1366   1371   1372   1373   1375   1377   1397   1398   1402   1403   1405  
1406   1407   1408   1409   1411   1412   1425   1426   1428   1429   1439   1440   1441   1442   1443   1447   1448   1452   1453   1500  
1506   1508   1513   1514   1517   1518   1527   1529   1530   1531   1532   1538   1539   1543   1544   1545   1546   1549   1550   1553  
1574   1575   1576   1582   1634   1635   1636   1639   1651   1652   1670   1672   1676   1677   1678   1679   1681   1686   1688   1689  
1691   1710   1711   1723   1724   1725   1728   1729   1804   1805   1806   1808   1809   1810   1812   1813   1820   1823   1824   1827  
1828   1894   1895   1896   1898   1899   1900   1901   1904   1905   1906   1908   1909   1912   1913   1914   1917   1919   1920   1923  
1924   1925   1926   1930   1931   1933   1934   1935   1937   1941   1944   1946   1948   1950   1951   1963   1964   1965   1966   1969  
1971   1976   1980   1987   1988   2035   2036   2037   2047   2048   2049   2067   2071   2072   2074   2076   2077   2083   2087   2095  
2096   2099   2100   2107   2108   2109   2110   2169   2170   2173   2174   2180   2181   2182   2217   2220   2221   2222   2252   2253  
2254   2255   2259   2260   2280   2282   2283   2284   2285   2286   2287   2289   2291   2294   2297   2303   2304   2337   2348   2350  
2355   2360   2361   2431   2432   2433   2434   2443   2465   2466   2467   2468   2470   2471   2477   2478   2479   2480   2481   2483  
2489   2496   2497   2498   2502   2503   2504   2505   2506   2507   2526   2527   2528   2532   2533   2540   2541   2542   2544   2545  
2546   2547   2551   2567   2569   2570   2571   2572   2573   2574   2577   2578   2585   2586   2588   2589   2590   2591   2595   2596  
2597   2598   2599   2600   2601   2602   2603   2607   2608   2609   2610   2616   2621   2622   2627   2628   2632   2633   2634   2639  
2640   2642   2644   2645   2646   2647   2648   2651   2653   2663   2672   2673   2677   2681   2682   2683   2684   2687   2688   2691  
2692   2694   2695   2696   2702   2703   2704   2705   2710   2713   2714   2715   2717   2772   2773   2774   2775   2793   2794   2811  
2812   2813   2825   2826   2830   2831   2832   2833   2834   2835   2836   2838   2839   2840   2843   2848   2849   2850   2857   2858  
2880   2881   2883   2884   2886   2887   2890   2891   2892   2894   2895   2896   2897   2898   2902   2916   2921   2922   2927   2928  
2929   2932   2934   2935   2936   2942   2943   2944   2948   2949   2950   2952   2953   2971   2972   2973   2974   2975   2976   3037  
3042   3043   3055   3056   3057   3058   3060   3061   3082   3083   3087   3088   3101   3102   3103   3109   3110   3119   3120   3121  
3139   3140   3141   3142   3144   3146   3154   3155   3162   3165   3167   3173   3174   3175   3179   3185   3186   3191   3192   3193  
3209   3210   3211   3212   3215   3216   3217   3218   3219   3221   3225   3226   3227   3228   3229   3230   3232   3233   3241   3242  
3243   3244   3249   3250   3251   3252   3274   3275   3276   3277   3279   3281   3286   3287   3288   3293   3294   3295   3298   3299  
3300   3305   3306   3310   3460   3461   3462   3463   3467   3469   3477   3499   3500   3524   3525   3537   3541   3542   3545   3570  
3571   3573   3574   3575   3577   3578   3581   3582   3583   3585   3586   3600   3646   3647   3648   3651   3652   3656   3657   3658  
3671   3672   3675   3677   3678   3687   3689   3690   3695   3696   3698   3701   3708   3709   3710   3714   3715   3717   3718   3720  
3721   3722   3723   3725   3726   3728   3731   3732   3739   3743   3748   3749   3750   3753   3754   3778   3827   3828   3830   3831  
3832   3833   3835   3932   3933   3935   3938   3941   3942   3946   3947   3948   3951   3952   3953   3954   3961   3963   3966   3967  
4060   4061   4063   4064   4135   4136   4137   4222   4223   4224   4228   4230   4231   4232   4234   4235   4236   4237   4240   4242  
4253   4254   4256   4257   4263   4264   4266   4267   4277   4283   4284   4285   4286  
Biltr, Ernai, Rnaxs 670   3143  
Biltr, Ernai, Sidirect 1290  
Biltr, Rnaxs, Sidirect 1208   1209   1218   1219   1264   1266   1316   1318   1320   1376   1378   1388   1400   1410   1485   1498   1499   1504   1505   1507  
1519   1520   1528   1579   1671   1680   1690   1692   1910   1938   1939   1945   1949   2068   2069   2073   2075   2081   2101   2122  
2195   2290   2343   2349   2356   2469   2472   2473   2482   2484   2508   2509   2550   2629   2630   2641   2643   2652   2674   2675  
2844   2859   2888   2889   2893   3111   3147   3168   3177   3178   3184   3222   3223   3224   3231   3273   3280   3536   3572   3580  
3676   3688   3697   3719   3724   3727   3729   3733   3752   4243   4255   4278   4279  


Target Position: 2714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2714CCACACAAAGACAUUGAUU82.1977616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022732CCACACAAAGACATTGATTAATCAATGTCTTTGTGTGG0.406800.345700.836201.000001.000001.00000


Target Position: 3463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463CUGUGUCCCUCUUCUCUUC71.58551659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553481CTGTGTCCCTCTTCTCTTCGAAGAGAAGAGGGACACAG0.396900.103400.612100.500001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CAUCUCUGACUUAAGCAAA91.3544154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351277CATCTCTGACTTAAGCAAATTTGCTTAAGTCAGAGATG0.164600.027700.655200.750001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901UGUCCCACUCCUACGAUAC61.87162779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081919TGTCCCACTCCTACGATACGTATCGTAGGAGTGGGACA0.178900.020300.525900.500000.978300.62500


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597ACACACACACACACACACA88.4625260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592615ACACACACACACACACACATGTGTGTGTGTGTGTGTGT0.877400.877300.500000.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257UCCAUCUCUGACUUAAGCA73.36581478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491275TCCATCTCTGACTTAAGCATGCTTAAGTCAGAGATGGA0.126600.027600.517200.500001.000001.00000


Target Position: 2609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609ACACACACACAAACCUUCU72.52741572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962627ACACACACACAAACCTTCTAGAAGGTTTGTGTGTGTGT0.168800.150300.482800.500001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567AAUCUCCCCUUGAUUUAAA83.3285538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262585AATCTCCCCTTGATTTAAATTTAAATCAAGGGGAGATT0.350700.185500.508600.500001.000001.00000


Target Position: 3656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656CGGGAUGAUUGGAAUAGCU84.2735483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9153674CGGGATGATTGGAATAGCTAGCTATTCCAATCATCCCG0.126700.004100.560300.750001.000001.00000


Target Position: 3752, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3752CACCAUAAUGCUAAUUUAA94.614374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3873770CACCATAATGCTAATTTAATTAAATTAGCATTATGGTG0.284800.054800.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3750-3772TACACCATAATGCTAATTTAAAGUUAAAUUAGCAUUAUGGUGUACACCAUAAUGCUAAUUUAAAGU-7.520.023


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704AAGAAAAAAACCACACAAA86.1955367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512722AAGAAAAAAACCACACAAATTTGTGTGGTTTTTTTCTT0.583700.407600.637900.500001.000001.00000


Target Position: 1545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1545AAAAUUCAGCAAACCAUUU73.14911504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971563AAAATTCAGCAAACCATTTAAATGGTTTGCTGAATTTT0.125200.109000.500000.500001.000001.00000


Target Position: 3149, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149GUUUUUUGUUUUACAAUGU75.35181254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3147-3169CAGTTTTTTGTTTTACAATGTCAACAUUGUAAAACAAAAAACUGGUUUUUUGUUUUACAAUGUCAU13.5-2.921


Target Position: 2259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2259GGAGGUGGGGUGUUUGGGA81.9855629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652277GGAGGTGGGGTGTTTGGGATCCCAAACACCCCACCTCC0.091400.073000.500000.750001.000001.00000


Target Position: 3192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192AGUUUUCUCUUAGAACAUU79.5493827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7853210AGTTTTCTCTTAGAACATTAATGTTCTAAGAGAAAACT0.077100.022100.698300.750001.000001.00000


Target Position: 2973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2973CGGGAGGAGGUGUGAGGAG68.43362043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692991CGGGAGGAGGTGTGAGGAGCTCCTCACACCTCCTCCCG0.330100.039200.603400.750001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596CACACACACACACACACAC76.2791154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632614CACACACACACACACACACGTGTGTGTGTGTGTGTGTG0.957600.950600.500000.500001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675CUUUUAUAGGUGAGAAAAA90.1004198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732693CTTTTATAGGTGAGAAAAATTTTTCTCACCTATAAAAG0.640400.015200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2673-2695TCCTTTTATAGGTGAGAAAAAAAUUUUUCUCACCUAUAAAAGGACUUUUAUAGGUGAGAAAAAAAU14.8-7.512


Target Position: 2479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479AAACACUAAAAUAUAUAAU80.787719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772497AAACACTAAAATATATAATATTATATATTTTAGTGTTT0.229400.024500.491400.500001.000001.00000


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294AGAAGAAAAAGGUUUGCAU82.5216590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822312AGAAGAAAAAGGTTTGCATATGCAAACCTTTTTCTTCT0.028100.025400.569000.750001.000001.00000


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215UACAGAUGCCUUUUUUGUA83.7676508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173233TACAGATGCCTTTTTTGTATACAAAAAAGGCATCTGTA0.108100.013300.500000.500001.000001.00000


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532AGGAUGUUCAUAAGGCCAG61.89842776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9712550AGGATGTTCATAAGGCCAGCTGGCCTTATGAACATCCT0.048500.003700.560300.500001.000001.00000


Target Position: 3718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3718ACUAGUGUUCUGUUUGUUA88.6415255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4143736ACTAGTGTTCTGTTTGTTATAACAAACAGAACACTAGT0.210900.139900.672400.750001.000001.00000


Target Position: 3568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3568CUAUGGAAGUUGCAUAAUU87.2065311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3566-3588AGCTATGGAAGTTGCATAATTATAAUUAUGCAACUUCCAUAGCUCUAUGGAAGUUGCAUAAUUAUU15.221.223


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635GGGUUCUAGGCAUCUCUGU75.39761247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281653GGGTTCTAGGCATCTCTGTACAGAGATGCCTAGAACCC0.065100.008800.784500.750001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682ACGAUUUCAUUGAACACUU76.96661080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473700ACGATTTCATTGAACACTTAAGTGTTCAATGAAATCGT0.287800.112200.637900.750001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AAUGGAAUGGUUUGGGAAU73.78081420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752198AATGGAATGGTTTGGGAATATTCCCAAACCATTCCATT0.201500.040200.500000.500001.000001.00000


Target Position: 2898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898UCUUGUAAUUUUUAUUUAG70.66311754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922916TCTTGTAATTTTTATTTAGCTAAATAAAAATTACAAGA0.026400.004700.551700.500001.000001.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700UCCUCUCCAAAAUGCCAGA67.38112173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818718TCCTCTCCAAAATGCCAGATCTGGCATTTTGGAGAGGA0.171500.014700.646600.500001.000001.00000


Target Position: 3500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3500GGCACUUCAUCUGAUCGGG64.28682532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953518GGCACTTCATCTGATCGGGCCCGATCAGATGAAGTGCC0.035300.002600.508600.500001.000001.00000


Target Position: 2838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2838CCCCUUCCUUUAAAAAACU71.63591653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1672856CCCCTTCCTTTAAAAAACTAGTTTTTTAAAGGAAGGGG0.832600.697600.784500.750001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331CGGUGUCCUACUUCAAAUG74.12661368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982349CGGTGTCCTACTTCAAATGCATTTGAAGTAGGACACCG0.133200.002400.758600.750001.000001.00000


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173ACUGCCAUGUACUAGUUUU79.3026853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093191ACTGCCATGTACTAGTTTTAAAACTAGTACATGGCAGT0.100800.013200.706900.750001.000001.00000


Target Position: 4257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4257UGAAAGUCUAGAAAUAAAA84.7043453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3454275TGAAAGTCTAGAAATAAAATTTTATTTCTAGACTTTCA0.979100.072600.724100.750001.000001.00000


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440UGUUGUAAGAAUAGGCAUU74.88141296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301458TGTTGTAAGAATAGGCATTAATGCCTATTCTTACAACA0.119800.011700.698300.750001.000001.00000


Target Position: 3648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648CUCUCAUUCGGGAUGAUUG72.87361534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043666CTCTCATTCGGGATGATTGCAATCATCCCGAATGAGAG0.043100.004600.663800.500000.978300.75000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587CUACACCGACAACUCCAUC66.18852309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958605CTACACCGACAACTCCATCGATGGAGTTGTCGGTGTAG0.367500.028300.491400.500000.923900.75000


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350UUUAAAGAAGUUGAAGUUU61.26922848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522368TTTAAAGAAGTTGAAGTTTAAACTTCAACTTCTTTAAA0.077800.011600.500000.500001.000001.00000


Target Position: 2436, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436GUUUUUAAGGGUUAUCUUA90.4748188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2434-2456TGGTTTTTAAGGGTTATCTTAGAUAAGAUAACCCUUAAAAACCAGUUUUUAAGGGUUAUCUUAGAU6.9-9.122


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858AGUGACAAAAUAGACAAUU71.80891641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7732876AGTGACAAAATAGACAATTAATTGTCTATTTTGTCACT0.078500.040000.698300.750001.000001.00000


Target Position: 2065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065CUUGGUUUGUGUUCUUCUU79.1394875

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2063-2085TACTTGGTTTGTGTTCTTCTTCAAAGAAGAACACAAACCAAGUACUUGGUUUGUGUUCUUCUUCAU19.118.822


Target Position: 3243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243UUUUUUAUGUGAUCAAUUU72.34411592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8493261TTTTTTATGTGATCAATTTAAATTGATCACATAAAAAA0.117900.096400.500000.500001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480AACACUAAAAUAUAUAAUU81.2753677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742498AACACTAAAATATATAATTAATTATATATTTTAGTGTT0.154000.033000.637900.500001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533GGAUGUUCAUAAGGCCAGU80.4246745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492551GGATGTTCATAAGGCCAGTACTGGCCTTATGAACATCC0.048600.003400.663800.750001.000001.00000


Target Position: 3722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722GUGUUCUGUUUGUUAUUGU78.8456902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6193740GTGTTCTGTTTGTTATTGTACAATAACAAACAGAACAC0.139100.085400.586200.500001.000001.00000


Target Position: 3714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3714AUGUACUAGUGUUCUGUUU74.50481334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6383732ATGTACTAGTGTTCTGTTTAAACAGAACACTAGTACAT0.309000.081200.655200.500001.000001.00000


Target Position: 4277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4277UGGUAAAACCCCAAAAAAA84.9219438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3744295TGGTAAAACCCCAAAAAAATTTTTTTGGGGTTTTACCA0.613300.315200.844800.750000.902200.75000


Target Position: 2859, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859GUGACAAAAUAGACAAUUU91.0759165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352877GTGACAAAATAGACAATTTAAATTGTCTATTTTGTCAC0.061700.035300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2857-2879TAGTGACAAAATAGACAATTTGCAAAUUGUCUAUUUUGUCACUAGUGACAAAAUAGACAAUUUGCU14.820.522


Target Position: 3723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3723UGUUCUGUUUGUUAUUGUU80.2376763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473741TGTTCTGTTTGTTATTGTTAACAATAACAAACAGAACA0.135900.092800.560300.750001.000001.00000


Target Position: 2108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108CAAGCACUUUCAGUCCAAU86.7318335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692126CAAGCACTTTCAGTCCAATATTGGACTGAAAGTGCTTG0.810400.042500.637900.750000.945700.75000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025GGAGGAGGAAGAGGAGGAG70.45481775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6561043GGAGGAGGAAGAGGAGGAGCTCCTCCTCTTCCTCCTCC0.140600.094200.560300.750001.000001.00000


Target Position: 3729, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3729GUUUGUUAUUGUUUUGUUA93.550288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153747GTTTGTTATTGTTTTGTTATAACAAAACAATAACAAAC0.094000.068900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3727-3749CTGTTTGTTATTGTTTTGTTAATUAACAAAACAAUAACAAACAGGUUUGUUAUUGUUUUGUUAAUU5.67.212


Target Position: 1531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531UUUAAAAACAUAGAAAAAU64.85332469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481549TTTAAAAACATAGAAAAATATTTTTCTATGTTTTTAAA0.594800.394900.491400.500001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500UUUACGUGUUUAAAAAAAA76.93021089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831518TTTACGTGTTTAAAAAAAATTTTTTTTAAACACGTAAA0.174100.006900.500000.500001.000001.00000


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170GCAGUUUUCUAAUGGAAUG74.63721317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072188GCAGTTTTCTAATGGAATGCATTCCATTAGAAAACTGC0.100400.008300.698300.750001.000001.00000


Target Position: 3572, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3572GGAAGUUGCAUAAUUAUUA97.372525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883590GGAAGTTGCATAATTATTATAATAATTATGCAACTTCC0.463600.005200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3570-3592ATGGAAGTTGCATAATTATTATTUAAUAAUUAUGCAACUUCCAUGGAAGUUGCAUAAUUAUUAUUU-10.319.212


Target Position: 2894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2894UAAUUCUUGUAAUUUUUAU76.99371077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452912TAATTCTTGTAATTTTTATATAAAAATTACAAGAATTA0.109400.044700.491400.500001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514AAAAAGCAUAAAAACAUUU73.4471466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761532AAAAAGCATAAAAACATTTAAATGTTTTTATGCTTTTT0.485600.103800.500000.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778CCACAGAUGUGAAGUUCAU88.3982264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736796CCACAGATGTGAAGTTCATATGAACTTCACATCTGTGG0.236500.011400.689701.000000.907600.62500


Target Position: 2694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694AACAAUCUGGAAGAAAAAA78.3937935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552712AACAATCTGGAAGAAAAAATTTTTTCTTCCAGATTGTT0.512000.115300.646600.500001.000001.00000


Target Position: 3155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155UGUUUUACAAUGUCAUAUA87.4294301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123173TGTTTTACAATGTCATATATATATGACATTGTAAAACA0.163000.050400.663800.750001.000001.00000


Target Position: 2813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813GGUUCCGAUGAAUUCUUAU86.6676339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402831GGTTCCGATGAATTCTTATATAAGAATTCATCGGAACC0.083100.003700.810301.000001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646GACUCUCAUUCGGGAUGAU86.8003333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733664GACTCTCATTCGGGATGATATCATCCCGAATGAGAGTC0.029200.004000.637900.750000.978300.62500


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827ACCAUCCAGUGACAAACCA73.81151410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9581845ACCATCCAGTGACAAACCATGGTTTGTCACTGGATGGT0.571500.025000.508600.500001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828CCAUCCAGUGACAAACCAU86.4628350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121846CCATCCAGTGACAAACCATATGGTTTGTCACTGGATGG0.562400.020600.689701.000001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GACCCCGCACGAUUUCAUU77.28351044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452692GACCCCGCACGATTTCATTAATGAAATCGTGCGGGGTC0.192000.081400.810300.750000.994600.62500


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969UACUCUUCCUAUUUUUGUA87.2114310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771987TACTCTTCCTATTTTTGTATACAAAAATAGGAAGAGTA0.028900.019600.500000.500001.000001.00000


Target Position: 3536, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3536GUUUUUACAGCUGUGUUAU78.0101973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713554GTTTTTACAGCTGTGTTATATAACACAGCTGTAAAAAC0.079400.005900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3534-3556TAGTTTTTACAGCTGTGTTATTCAUAACACAGCUGUAAAAACUAGUUUUUACAGCUGUGUUAUUCU20.40.021


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375ACAGAUGAUAGAGGAUUUU72.39391587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181393ACAGATGATAGAGGATTTTAAAATCCTCTATCATCTGT0.067600.064300.706900.750001.000001.00000


Target Position: 1947, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947GACAUAAUAUAUUCUAUUU96.258347

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4194719GACATAATATATTCTATTT1/1/0/096.22CCND1NM_053056.21NANANA11:69466900..69466918(+)00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411965GACATAATATATTCTATTTAAATAGAATATATTATGTC0.263800.153000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1945-1967GTGACATAATATATTCTATTTTTAAAUAGAAUAUAUUAUGUCACGACAUAAUAUAUUCUAUUUUUU6.96.722


Target Position: 3211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3211GUAUUACAGAUGCCUUUUU79.6169818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7793229GTATTACAGATGCCTTTTTAAAAAGGCATCTGTAATAC0.077600.010100.681000.750001.000001.00000


Target Position: 2972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972GCGGGAGGAGGUGUGAGGA77.17011054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712990GCGGGAGGAGGTGTGAGGATCCTCACACCTCCTCCCGC0.287800.023300.551700.750001.000001.00000


Target Position: 1443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443UGUAAGAAUAGGCAUUAAC65.7072370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751461TGTAAGAATAGGCATTAACGTTAATGCCTATTCTTACA0.163000.083600.560300.500001.000001.00000


Target Position: 3696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696GGGUAUGUUUAAUCUGUUA99.98017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803714GGGTATGTTTAATCTGTTATAACAGATTAAACATACCC0.319000.035900.956901.000001.000001.00000


Target Position: 3184, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3184CUAGUUUUAGUUUUCUCUU78.2197948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273202CTAGTTTTAGTTTTCTCTTAAGAGAAAACTAAAACTAG0.091300.024100.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3182-3204TACTAGTTTTAGTTTTCTCTTAGAAGAGAAAACUAAAACUAGUACUAGUUUUAGUUUUCUCUUAGU19.14.922


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212UAUUACAGAUGCCUUUUUU75.26161261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143230TATTACAGATGCCTTTTTTAAAAAAGGCATCTGTAATA0.081700.008800.543100.500001.000001.00000


Target Position: 3460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460AGGCUGUGUCCCUCUUCUC66.93432209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723478AGGCTGTGTCCCTCTTCTCGAGAAGAGGGACACAGCCT0.405400.021900.534500.500000.918500.62500


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880ACAUCUUGGCUAUGUAAUU80.1463770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3282898ACATCTTGGCTATGTAATTAATTACATAGCCAAGATGT0.369900.233000.698300.750001.000001.00000


Target Position: 4224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4224GCAUGUUUCCAGCAGAAGA89.9332207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9144242GCATGTTTCCAGCAGAAGATCTTCTGCTGGAAACATGC0.411400.004100.629300.750000.962000.62500


Target Position: 3477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477UCUUCCCUGCGCCUGUGAU64.23682542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623495TCTTCCCTGCGCCTGTGATATCACAGGCGCAGGGAAGA0.031300.014700.543100.750001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677UUUAUAGGUGAGAAAAAAA81.4606662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122695TTTATAGGTGAGAAAAAAATTTTTTTCTCACCTATAAA0.700400.018500.500000.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673UGACCCCGCACGAUUUCAU68.56042027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
625691TGACCCCGCACGATTTCATATGAAATCGTGCGGGGTCA0.186700.073800.569000.750000.994600.75000


Target Position: 2642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642AGAUUUAAUACAGUUUAUU79.0414882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592660AGATTTAATACAGTTTATTAATAAACTGTATTAAATCT0.080900.058200.715500.750001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453GGCAUUAACACAAAGGAGG62.86772677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701471GGCATTAACACAAAGGAGGCCTCCTTTGTGTTAATGCC0.069400.011800.655200.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GCAUAAAAACAUUUUAAAA98.160620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401537GCATAAAAACATTTTAAAATTTTAAAATGTTTTTATGC0.501300.192500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1517-1539AAGCATAAAAACATTTTAAAAACUUUUAAAAUGUUUUUAUGCUUGCAUAAAAACAUUUUAAAAACU-9.1-1.410


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465ACCGGAAGGUUUUUAAACA81.274678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722483ACCGGAAGGTTTTTAAACATGTTTAAAAACCTTCCGGT0.184100.020100.646600.500000.940200.62500


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808GUGACCACCACCCCAACAA79.5507826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701826GTGACCACCACCCCAACAATTGTTGGGGTGGTGGTCAC0.468100.151700.646600.750000.994600.62500


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683CGAUUUCAUUGAACACUUC78.723913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533701CGATTTCATTGAACACTTCGAAGTGTTCAATGAAATCG0.500200.110700.620700.750001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318GAGAAAAAAAAAAUAGUAU89.1364233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321336GAGAAAAAAAAAATAGTATATACTATTTTTTTTTTCTC0.850100.826600.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1316-1338GAGAGAAAAAAAAAATAGTATTTAUACUAUUUUUUUUUUCUCUCGAGAAAAAAAAAAUAGUAUUUU6.35.511


Target Position: 4136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4136GCGCAAGUCUGAGGGUCUG67.92462101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9724154GCGCAAGTCTGAGGGTCTGCAGACCCTCAGACTTGCGC0.029500.008400.637900.750001.000001.00000


Target Position: 2478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2478UAAACACUAAAAUAUAUAA90.9279172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142496TAAACACTAAAATATATAATTATATATTTTAGTGTTTA0.219700.024500.500000.500001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433GUGGUUUUUAAGGGUUAUC58.76633116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752451GTGGTTTTTAAGGGTTATCGATAACCCTTAAAAACCAC0.078800.007200.612100.500001.000001.00000


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267GCCAACCUCCUCAACGACC56.84563286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
787285GCCAACCTCCTCAACGACCGGTCGTTGAGGAGGTTGGC0.299100.077600.646600.500001.000001.00000


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971CUCUUCCUAUUUUUGUAGU70.28021792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941989CTCTTCCTATTTTTGTAGTACTACAAAAATAGGAAGAG0.026300.013400.603400.500001.000001.00000


Target Position: 4235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4235GCAGAAGACAAAAAGACAA93.378292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3504253GCAGAAGACAAAAAGACAATTGTCTTTTTGTCTTCTGC0.272800.071000.706901.000001.000001.00000


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CAGCUCACGUCCAGGUUCA84.8789441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542053CAGCTCACGTCCAGGTTCATGAACCTGGACGTGAGCTG0.049300.003200.560300.500001.000001.00000


Target Position: 3281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3281CUCUAUUCCAAAAAGGUUG63.38362622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903299CTCTATTCCAAAAAGGTTGCAACCTTTTTGGAATAGAG0.048300.039000.663800.500000.956500.87500


Target Position: 2836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836UGCCCCUUCCUUUAAAAAA72.44781582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812854TGCCCCTTCCTTTAAAAAATTTTTTAAAGGAAGGGGCA0.857100.386900.853400.750001.000001.00000


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953GACGUGUGAGGGAGGACAG73.79971413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262971GACGTGTGAGGGAGGACAGCTGTCCTCCCTCACACGTC0.070600.008100.534500.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526UUGCAGAGGAUGUUCAUAA81.0491695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652544TTGCAGAGGATGTTCATAATTATGAACATCCTCTGCAA0.030500.016800.612100.500001.000001.00000


Target Position: 4255, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4255CAUGAAAGUCUAGAAAUAA98.479518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6634273CATGAAAGTCTAGAAATAATTATTTCTAGACTTTCATG0.800800.015800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4253-4275AACATGAAAGTCTAGAAATAAAAUUAUUUCUAGACUUUCAUGUUCAUGAAAGUCUAGAAAUAAAAU6.912.022


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578GAUUUAAACACACAGAUAC79.1692867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642596GATTTAAACACACAGATACGTATCTGTGTGTTTAAATC0.565100.437200.500000.500001.000001.00000


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884CUUGGCUAUGUAAUUCUUG66.82732216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602902CTTGGCTATGTAATTCTTGCAAGAATTACATAGCCAAG0.147300.113500.491400.500001.000001.00000


Target Position: 3232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232UAGUUUUUUUUUUUUUUAU72.46781580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693250TAGTTTTTTTTTTTTTTATATAAAAAAAAAAAAAACTA0.812700.394300.629300.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411UCGUUUUUAUAUUAAUGUA85.5681404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411429TCGTTTTTATATTAATGTATACATTAATATAAAAACGA0.261200.152100.612100.750001.000001.00000


Target Position: 2253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2253GGCAGUGGAGGUGGGGUGU64.80172476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932271GGCAGTGGAGGTGGGGTGTACACCCCACCTCCACTGCC0.427600.021900.793100.750001.000001.00000


Target Position: 2684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GUGAGAAAAAAACAAUCUG72.13451612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182702GTGAGAAAAAAACAATCTGCAGATTGTTTTTTTCTCAC0.140800.071900.508600.500001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161CCCUGACAGUCCCUCCUCU78.9423892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961179CCCTGACAGTCCCTCCTCTAGAGGAGGGACTGTCAGGG0.025700.017800.767200.750001.000001.00000


Target Position: 3275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3275UUACUGCUCUAUUCCAAAA80.8596711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163293TTACTGCTCTATTCCAAAATTTTGGAATAGAGCAGTAA0.574200.056500.534500.500001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303AGGUUUGCAUUCUCACAUU82.9606564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952321AGGTTTGCATTCTCACATTAATGTGAGAATGCAAACCT0.138100.004900.836200.750001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402AUAAUCAACUCGUUUUUAU77.45061029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791420ATAATCAACTCGTTTTTATATAAAAACGAGTTGATTAT0.437600.224400.500000.500001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022CGAGGAGGAGGAAGAGGAG75.46991234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981040CGAGGAGGAGGAAGAGGAGCTCCTCTTCCTCCTCCTCG0.163800.087700.482800.750001.000001.00000


Target Position: 1291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291CCAAAAACUGUCUUUAAAA92.7895111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1289-1311ACCCAAAAACTGTCTTTAAAAGAUUUUAAAGACAGUUUUUGGGUCCAAAAACUGUCUUUAAAAGAU-3.85.632


Target Position: 3728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3728UGUUUGUUAUUGUUUUGUU77.26151046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653746TGTTTGTTATTGTTTTGTTAACAAAACAATAACAAACA0.116100.078300.560300.750001.000001.00000


Target Position: 3056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056GCGCUGCUACCGUUGACUU80.2919758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383074GCGCTGCTACCGTTGACTTAAGTCAACGGTAGCAGCGC0.131000.003700.784501.000001.000001.00000


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632UUGAUGUUACAGAUUUAAU74.39011347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912650TTGATGTTACAGATTTAATATTAAATCTGTAACATCAA0.252400.065100.637900.500001.000001.00000


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673UCCUUUUAUAGGUGAGAAA78.3579939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932691TCCTTTTATAGGTGAGAAATTTCTCACCTATAAAAGGA0.046900.013400.870700.750000.929300.62500


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542UAAGGCCAGUAUGAUUUAU72.51671574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462560TAAGGCCAGTATGATTTATATAAATCATACTGGCCTTA0.089100.008900.491400.500001.000001.00000


Target Position: 3731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731UUGUUAUUGUUUUGUUAAU71.01271725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7383749TTGTTATTGTTTTGTTAATATTAACAAAACAATAACAA0.086300.047200.637900.500001.000001.00000


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252UGGCAGUGGAGGUGGGGUG53.66833550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242270TGGCAGTGGAGGTGGGGTGCACCCCACCTCCACTGCCA0.508400.012100.551700.500001.000001.00000


Target Position: 4243, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4243CAAAAAGACAAACAUGAAA90.6498179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3954261CAAAAAGACAAACATGAAATTTCATGTTTGTCTTTTTG0.729900.193000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4241-4263GACAAAAAGACAAACATGAAAGTUUUCAUGUUUGUCUUUUUGUCCAAAAAGACAAACAUGAAAGUU20.55.512


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887GGCUAUGUAAUUCUUGUAA92.4147120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102905GGCTATGTAATTCTTGTAATTACAAGAATTACATAGCC0.163400.087500.965501.000001.000001.00000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434UGGUUUUUAAGGGUUAUCU64.78232478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912452TGGTTTTTAAGGGTTATCTAGATAACCCTTAAAAACCA0.026600.002400.620700.500001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508UUUAAAAAAAAGCAUAAAA74.41991344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081526TTTAAAAAAAAGCATAAAATTTTATGCTTTTTTTTAAA0.249400.081900.500000.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399CCAAUAAUCAACUCGUUUU81.5317658

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2139919CCAATAATCAACTCGTTTT1/1/0/097.75CCND1NM_053056.21NANANANA00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891417CCAATAATCAACTCGTTTTAAAACGAGTTGATTATTGG0.304900.198900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1397-1419CCCCAATAATCAACTCGTTTTTAAAAACGAGUUGAUUAUUGGGGCCAAUAAUCAACUCGUUUUUAU19.7-1.832


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643UGAACAAGCUCAAGUGGAA89.1704228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894661TGAACAAGCTCAAGTGGAATTCCACTTGAGCTTGTTCA0.046900.030600.551700.750001.000001.00000


Target Position: 3198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198CUCUUAGAACAUUGUAUUA93.239194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3196-3218TTCTCTTAGAACATTGTATTACAUAAUACAAUGUUCUAAGAGAACUCUUAGAACAUUGUAUUACAU6.920.222


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287CCAGUCAAGAAGAAAAAGG61.70172804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992305CCAGTCAAGAAGAAAAAGGCCTTTTTCTTCTTGACTGG0.155300.025900.500000.500001.000001.00000


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582UUAGGUAGAAAAACAUAUU73.14961503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791600TTAGGTAGAAAAACATATTAATATGTTTTTCTACCTAA0.208500.092600.525900.500001.000001.00000


Target Position: 3721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721AGUGUUCUGUUUGUUAUUG66.12952319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7533739AGTGTTCTGTTTGTTATTGCAATAACAAACAGAACACT0.148700.090200.560300.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087AUUCUAAAACCAUUCCAUU76.79961105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582105ATTCTAAAACCATTCCATTAATGGAATGGTTTTAGAAT0.323900.185000.500000.500001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154UUGUUUUACAAUGUCAUAU66.5482266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7793172TTGTTTTACAATGTCATATATATGACATTGTAAAACAA0.203300.077200.603400.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679UCACUUUAUAAGUCAUUGU69.76231863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121697TCACTTTATAAGTCATTGTACAATGACTTATAAAGTGA0.118500.051400.517200.500001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307AAAGAGAGAGAGAGAAAAA93.570887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8941325AAAGAGAGAGAGAGAAAAATTTTTCTCTCTCTCTCTTT0.442900.119400.500000.500001.000001.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442UUGUAAGAAUAGGCAUUAA82.3858602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101460TTGTAAGAATAGGCATTAATTAATGCCTATTCTTACAA0.131600.029600.612100.500001.000001.00000


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590CAGAUACACACACACACAC75.90331198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672608CAGATACACACACACACACGTGTGTGTGTGTGTATCTG0.983000.576600.491400.500001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GGUUGUGCUACAGAUGAUA93.206395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441384GGTTGTGCTACAGATGATATATCATCTGTAGCACAACC0.366200.011000.810301.000001.000001.00000


Target Position: 3165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165UGUCAUAUACUGCCAUGUA88.9746242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043183TGTCATATACTGCCATGTATACATGGCAGTATATGACA0.071400.030900.525900.750000.951100.62500


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337UCCUUUCCUUUUCUUUAAA74.02411388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772355TCCTTTCCTTTTCTTTAAATTTAAAGAAAAGGAAAGGA0.040000.002600.870700.750001.000001.00000


Target Position: 3055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055UGCGCUGCUACCGUUGACU60.40652942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113073TGCGCTGCTACCGTTGACTAGTCAACGGTAGCAGCGCA0.139700.012400.646600.500001.000001.00000


Target Position: 3577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3577UUGCAUAAUUAUUAUUAUU76.99881074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213595TTGCATAATTATTATTATTAATAATAATAATTATGCAA0.456600.015100.637900.500001.000001.00000


Target Position: 3687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3687UCAAGUUUUGGGUAUGUUU72.01321619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863705TCAAGTTTTGGGTATGTTTAAACATACCCAAAACTTGA0.031200.002300.724100.750001.000001.00000


Target Position: 2774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2774CAUGGGUGCAAGGAAAAUU77.9037981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402792CATGGGTGCAAGGAAAATTAATTTTCCTTGCACCCATG0.167900.011200.646600.750001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572CCCCUUGAUUUAAACACAC68.33372054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3722590CCCCTTGATTTAAACACACGTGTGTTTAAATCAAGGGG0.666300.206200.698300.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287UCCAAAAAGGUUGCUGUUU57.45873232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063305TCCAAAAAGGTTGCTGTTTAAACAGCAACCTTTTTGGA0.097900.022500.870700.750000.956500.75000


Target Position: 3119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119UUCACAUUGUUUGCUGCUA70.00961824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513137TTCACATTGTTTGCTGCTATAGCAGCAAACAATGTGAA0.060200.018600.500000.500000.983700.62500


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518AGCAUAAAAACAUUUUAAA86.1539369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411536AGCATAAAAACATTTTAAATTTAAAATGTTTTTATGCT0.503100.159000.853400.750001.000001.00000


Target Position: 2112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2112CACUUUCAGUCCAAUAGGU81.1278688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2110-2132AGCACTTTCAGTCCAATAGGTGTACCUAUUGGACUGAAAGUGCUCACUUUCAGUCCAAUAGGUGUU17.419.233


Target Position: 2706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2706GAAAAAAACCACACAAAGA92.7526112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2704-2726AAGAAAAAAACCACACAAAGACAUCUUUGUGUGGUUUUUUUCUUGAAAAAAACCACACAAAGACAU16.7-11.322


Target Position: 3724, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724GUUCUGUUUGUUAUUGUUU77.19921050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003742GTTCTGTTTGTTATTGTTTAAACAATAACAAACAGAAC0.131200.087400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3722-3744GTGTTCTGTTTGTTATTGTTTTGAAACAAUAACAAACAGAACACGUUCUGUUUGUUAUUGUUUUGU6.919.211


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110AGCACUUUCAGUCCAAUAG66.70672236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602128AGCACTTTCAGTCCAATAGCTATTGGACTGAAAGTGCT0.031500.018900.681000.500000.945700.75000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397CCCCAAUAAUCAACUCGUU80.7107723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2961415CCCCAATAATCAACTCGTTAACGAGTTGATTATTGGGG0.297500.133500.844801.000000.989100.75000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825UUCUUAUCCCCUGCCCCUU53.28443580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052843TTCTTATCCCCTGCCCCTTAAGGGGCAGGGGATAAGAA0.363200.136300.534500.500001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310GAGAGAGAGAGAAAAAAAA97.994721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761328GAGAGAGAGAGAAAAAAAATTTTTTTTCTCTCTCTCTC0.928600.160000.810300.750001.000001.00000


Target Position: 2922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922GUUGAAGGGAGGUGGCAAG67.11412195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632940GTTGAAGGGAGGTGGCAAGCTTGCCACCTCCCTTCAAC0.055600.021500.508600.500001.000001.00000


Target Position: 3305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305UCACAAUACCUCAUGCUUC66.67452242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443323TCACAATACCTCATGCTTCGAAGCATGAGGTATTGTGA0.135900.012500.551700.500000.923900.62500


Target Position: 2472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2472GGUUUUUAAACACUAAAAU83.9525495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542490GGTTTTTAAACACTAAAATATTTTAGTGTTTAAAAACC0.057400.030400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2470-2492AAGGTTTTTAAACACTAAAATATAUUUUAGUGUUUAAAAACCUUGGUUUUUAAACACUAAAAUAUU4.90.022


Target Position: 2891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891AUGUAAUUCUUGUAAUUUU83.008559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482909ATGTAATTCTTGTAATTTTAAAATTACAAGAATTACAT0.083500.063300.655200.500001.000001.00000


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141GAGGAUCAGUUUUUUGUUU84.2575485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923159GAGGATCAGTTTTTTGTTTAAACAAAAAACTGATCCTC0.303800.014000.810300.750001.000001.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GGGGAGGAGGGUUGUGCUA83.1826548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961375GGGGAGGAGGGTTGTGCTATAGCACAACCCTCCTCCCC0.028600.002100.819001.000001.000001.00000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181CGGAGCAUUUUGAUACCAG77.13131060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011199CGGAGCATTTTGATACCAGCTGGTATCAAAATGCTCCG0.116700.013600.629300.750000.929300.62500


Target Position: 3223, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223CCUUUUUUGUAGUUUUUUU81.2921675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2553241CCTTTTTTGTAGTTTTTTTAAAAAAACTACAAAAAAGG0.340900.117900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3221-3243TGCCTTTTTTGTAGTTTTTTTTTAAAAAAACUACAAAAAAGGCACCUUUUUUGUAGUUUUUUUUUU-1.8-5.911


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966UUAUACUCUUCCUAUUUUU73.1841496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081984TTATACTCTTCCTATTTTTAAAAATAGGAAGAGTATAA0.164500.105700.534500.500001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031GGAAGAGGAGGAGGAGGAG71.33931689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401049GGAAGAGGAGGAGGAGGAGCTCCTCCTCCTCCTCTTCC0.100000.007000.560300.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899CCUGUCCCACUCCUACGAU75.71131214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831917CCTGTCCCACTCCTACGATATCGTAGGAGTGGGACAGG0.143600.014400.663801.000000.978300.75000


Target Position: 3541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3541UACAGCUGUGUUAUUCUUU70.42391779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933559TACAGCTGTGTTATTCTTTAAAGAATAACACAGCTGTA0.377400.014000.681000.500001.000001.00000


Target Position: 2291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2291UCAAGAAGAAAAAGGUUUG60.44192933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952309TCAAGAAGAAAAAGGTTTGCAAACCTTTTTCTTCTTGA0.078200.023000.577600.500001.000001.00000


Target Position: 3147, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147CAGUUUUUUGUUUUACAAU83.7158511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293165CAGTTTTTTGTTTTACAATATTGTAAAACAAAAAACTG0.211200.054300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3145-3167ATCAGTTTTTTGTTTTACAATGTAUUGUAAAACAAAAAACUGAUCAGUUUUUUGUUUUACAAUGUU7.23.222


Target Position: 1911, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1911CUACGAUACGCUACUAUAA96.615141

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9191119CTACGATACGCTACTATAA1/1/0/094.96CCND1NM_053056.21NANANA11:69466864..69466882(+)00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281929CTACGATACGCTACTATAATTATAGTAGCGTATCGTAG0.246100.106100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1909-1931TCCTACGATACGCTACTATAAAGUUAUAGUAGCGUAUCGUAGGACUACGAUACGCUACUAUAAAGU7.917.733


Target Position: 3935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3935ACCCCGCCCCACCCCUCCA57.48743229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8223953ACCCCGCCCCACCCCTCCATGGAGGGGTGGGGCGGGGT0.781100.243600.508600.500001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485GAUUAGGUUCCAUCCUUUA94.766971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631503GATTAGGTTCCATCCTTTATAAAGGATGGAACCTAATC0.083800.002900.646600.750000.913000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1483-1505AGGATTAGGTTCCATCCTTTACGUAAAGGAUGGAACCUAAUCCUGAUUAGGUUCCAUCCUUUACGU18.718.533


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965UUUAUACUCUUCCUAUUUU73.28611487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131983TTTATACTCTTCCTATTTTAAAATAGGAAGAGTATAAA0.166500.112200.500000.500001.000001.00000


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952UGACGUGUGAGGGAGGACA74.50611333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452970TGACGTGTGAGGGAGGACATGTCCTCCCTCACACGTCA0.060200.003600.517200.500001.000001.00000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672CAUGUAGUCACUUUAUAAG80.6597730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541690CATGTAGTCACTTTATAAGCTTATAAAGTGACTACATG0.130400.006500.517200.500001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805CCUGUGACCACCACCCCAA82.437597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811823CCTGTGACCACCACCCCAATTGGGGTGGTGGTCACAGG0.308100.057600.698301.000000.918500.87500


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772GGCAUGGGUGCAAGGAAAA83.9119496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482790GGCATGGGTGCAAGGAAAATTTTCCTTGCACCCATGCC0.200200.026201.000001.000000.956500.62500


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082CGGUUUGGAAAUAUUCACA87.5729294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573100CGGTTTGGAAATATTCACATGTGAATATTTCCAAACCG0.311500.006300.706900.750001.000001.00000


Target Position: 3279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3279UGCUCUAUUCCAAAAAGGU70.29661791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853297TGCTCTATTCCAAAAAGGTACCTTTTTGGAATAGAGCA0.128100.128300.500000.500000.956500.75000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636GGUUCUAGGCAUCUCUGUA99.92018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171654GGTTCTAGGCATCTCTGTATACAGAGATGCCTAGAACC0.274300.007900.672401.000001.000001.00000


Target Position: 3651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651UCAUUCGGGAUGAUUGGAA72.86921536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873669TCATTCGGGATGATTGGAATTCCAATCATCCCGAATGA0.134800.002300.551700.750001.000001.00000


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672AUCCUUUUAUAGGUGAGAA81.3453672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312690ATCCTTTTATAGGTGAGAATTCTCACCTATAAAAGGAT0.037000.011400.508600.500000.929300.75000


Target Position: 3273, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273GAUUACUGCUCUAUUCCAA97.851124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413291GATTACTGCTCTATTCCAATTGGAATAGAGCAGTAATC0.502600.034200.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3271-3293GTGATTACTGCTCTATTCCAAAAUUGGAAUAGAGCAGUAAUCACGAUUACUGCUCUAUUCCAAAAU21.211.623


Target Position: 18, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18AGUUUUGUUGAAGUUGCAA80.741720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88736AGTTTTGTTGAAGTTGCAATTGCAACTTCAACAAAACT0.160100.005300.560300.750001.000001.00000


Target Position: 3209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209UUGUAUUACAGAUGCCUUU68.03532090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813227TTGTATTACAGATGCCTTTAAAGGCATCTGTAATACAA0.080300.008800.646600.500001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271AAGCAAAAGAAAAAGAUUA85.4222415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631289AAGCAAAAGAAAAAGATTATAATCTTTTTCTTTTGCTT0.574000.159500.603400.500001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919CGCUACUAUAAAGAGAAGA79.7718802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461937CGCTACTATAAAGAGAAGATCTTCTCTTTATAGTAGCG0.257600.080100.698300.750001.000001.00000


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037GCAGCUCCAUUUUCUUAUU83.5431521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8623055GCAGCTCCATTTTCTTATTAATAAGAAAATGGAGCTGC0.306700.006100.844801.000001.000001.00000


Target Position: 2637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637GUUACAGAUUUAAUACAGU84.8182445

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2635-2657ATGTTACAGATTTAATACAGTTTACUGUAUUAAAUCUGUAACAUGUUACAGAUUUAAUACAGUUUU11.620.322


Target Position: 3710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3710UGUUAUGUACUAGUGUUCU72.15491610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9903728TGTTATGTACTAGTGTTCTAGAACACTAGTACATAACA0.363300.100400.482800.500001.000001.00000


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286UUCCAAAAAGGUUGCUGUU63.33352629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293304TTCCAAAAAGGTTGCTGTTAACAGCAACCTTTTTGGAA0.059800.023900.525900.500000.956500.75000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916GGAAGUGUUGAAGGGAGGU71.46671671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002934GGAAGTGTTGAAGGGAGGTACCTCCCTTCAACACTTCC0.076900.020200.517200.750001.000001.00000


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217CAGAUGCCUUUUUUGUAGU75.97831190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753235CAGATGCCTTTTTTGTAGTACTACAAAAAAGGCATCTG0.131800.035200.577600.500001.000001.00000


Target Position: 3242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242UUUUUUUAUGUGAUCAAUU68.76022003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633260TTTTTTTATGTGATCAATTAATTGATCACATAAAAAAA0.120500.109000.491400.500001.000001.00000


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622CCUUCUGCCUUUGAUGUUA85.3982420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782640CCTTCTGCCTTTGATGTTATAACATCAAAGGCAGAAGG0.244200.023500.810301.000001.000001.00000


Target Position: 2260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2260GAGGUGGGGUGUUUGGGAG70.10561809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112278GAGGTGGGGTGTTTGGGAGCTCCCAAACACCCCACCTC0.067900.053900.500000.500001.000001.00000


Target Position: 2540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540CAUAAGGCCAGUAUGAUUU80.6405733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082558CATAAGGCCAGTATGATTTAAATCATACTGGCCTTATG0.093600.008300.655200.750001.000001.00000


Target Position: 2717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717CACAAAGACAUUGAUUCAG69.37481919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382735CACAAAGACATTGATTCAGCTGAATCAATGTCTTTGTG0.061100.038200.508600.500001.000001.00000


Target Position: 3580, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580CAUAAUUAUUAUUAUUAUU93.581486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4043598CATAATTATTATTATTATTAATAATAATAATAATTATG0.426800.327500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3578-3600TGCATAATTATTATTATTATTATAAUAAUAAUAAUAAUUAUGCACAUAAUUAUUAUUAUUAUUAUU-8.0-8.010


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048GGUUCAACCCACAGCUACU88.7439254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492066GGTTCAACCCACAGCTACTAGTAGCTGTGGGTTGAACC0.144900.038900.646600.750000.967400.75000


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CCGGAAGGUUUUUAAACAC70.47091773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162484CCGGAAGGTTTTTAAACACGTGTTTAAAAACCTTCCGG0.177200.020100.620700.750001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GAGAGAGAAAAAAAAAAUA96.286545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211332GAGAGAGAAAAAAAAAATATATTTTTTTTTTCTCTCTC0.911600.405400.767200.750001.000001.00000


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658GGAACCUGGCCGCAAUGAC68.22452068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805676GGAACCTGGCCGCAATGACGTCATTGCGGCCAGGTTCC0.071400.010300.551700.750000.967400.62500


Target Position: 3701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3701UGUUUAAUCUGUUAUGUAC75.29011257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7563719TGTTTAATCTGTTATGTACGTACATAACAGATTAAACA0.254300.073500.525900.500001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483ACUAAAAUAUAUAAUUUAU89.9735205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282501ACTAAAATATATAATTTATATAAATTATATATTTTAGT0.089300.045600.663800.750001.000001.00000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924CUAUAAAGAGAAGACGAAA91.8741136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271942CTATAAAGAGAAGACGAAATTTCGTCTTCTCTTTATAG0.065100.048600.672400.750001.000001.00000


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219GAUGCCUUUUUUGUAGUUU76.25731159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313237GATGCCTTTTTTGTAGTTTAAACTACAAAAAAGGCATC0.153000.060500.681000.750001.000001.00000


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251GUGAUCAAUUUUGACUUAA84.8331444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4743269GTGATCAATTTTGACTTAATTAAGTCAAAATTGATCAC0.181600.048800.758600.750000.945700.87500


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277AAGAAAAAGAUUACCCAAA82.609584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461295AAGAAAAAGATTACCCAAATTTGGGTAATCTTTTTCTT0.947200.482000.637900.500001.000001.00000


Target Position: 2848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2848UAAAAAACUUAGUGACAAA91.2597156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7092866TAAAAAACTTAGTGACAAATTTGTCACTAAGTTTTTTA0.145200.148000.534500.500001.000001.00000


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332GGUGUCCUACUUCAAAUGU76.07641185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
733350GGTGTCCTACTTCAAATGTACATTTGAAGTAGGACACC0.100600.011600.646600.750001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603ACACACACACACACACAAA91.2069160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2102621ACACACACACACACACAAATTTGTGTGTGTGTGTGTGT0.800700.799100.706900.750001.000001.00000


Target Position: 3942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3942CCCACCCCUCCAGAACACG50.51353772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7953960CCCACCCCTCCAGAACACGCGTGTTCTGGAGGGGTGGG0.074700.059900.715500.500001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176CUCUCCGGAGCAUUUUGAU74.34341349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701194CTCTCCGGAGCATTTTGATATCAAAATGCTCCGGAGAG0.152500.005900.629300.750000.994600.62500


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309AGAGAGAGAGAGAAAAAAA97.155730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831327AGAGAGAGAGAGAAAAAAATTTTTTTCTCTCTCTCTCT0.762400.147000.724100.750001.000001.00000


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095ACCAUUCCAUUUCCAAGCA71.98071623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442113ACCATTCCATTTCCAAGCATGCTTGGAAATGGAATGGT0.205600.174400.500000.500001.000001.00000


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277ACUGCUCUAUUCCAAAAAG70.06621814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9513295ACTGCTCTATTCCAAAAAGCTTTTTGGAATAGAGCAGT0.192300.084300.569000.500001.000001.00000


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591AGAUACACACACACACACA93.0402100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402609AGATACACACACACACACATGTGTGTGTGTGTGTATCT0.980000.907400.517200.500001.000001.00000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19GUUUUGUUGAAGUUGCAAA87.2406308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77637GTTTTGTTGAAGTTGCAAATTTGCAACTTCAACAAAAC0.180000.009800.646600.750001.000001.00000


Target Position: 1495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495CAUCCUUUACGUGUUUAAA89.4419219

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1493-1515TCCATCCTTTACGTGTTTAAAAAUUUAAACACGUAAAGGAUGGACAUCCUUUACGUGUUUAAAAAU7.218.732


Target Position: 3961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3961GCUCACGCUUACCUCAACC64.65062488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503979GCTCACGCTTACCTCAACCGGTTGAGGTAAGCGTGAGC0.448500.162800.500000.500000.956500.62500


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416GGAACAGAAGUGCGAGGAG76.2941152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958434GGAACAGAAGTGCGAGGAGCTCCTCGCACTTCTGTTCC0.032500.021600.560300.750001.000001.00000


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193GUUUUCUCUUAGAACAUUG73.70861432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783211GTTTTCTCTTAGAACATTGCAATGTTCTAAGAGAAAAC0.078200.024400.500000.500001.000001.00000


Target Position: 3954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3954GAACACGGCUCACGCUUAC70.5581764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623972GAACACGGCTCACGCTTACGTAAGCGTGAGCCGTGTTC0.252800.019300.491400.500000.940201.00000


Target Position: 3227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227UUUUGUAGUUUUUUUUUUU69.28751930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813245TTTTGTAGTTTTTTTTTTTAAAAAAAAAAACTACAAAA0.890300.170000.500000.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686AUAAGUCAUUGUAUGUUAU84.1504489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901704ATAAGTCATTGTATGTTATATAACATACAATGACTTAT0.026800.008700.500000.500001.000001.00000


Target Position: 1820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820CCAACAAACCAUCCAGUGA85.2205428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601838CCAACAAACCATCCAGTGATCACTGGATGGTTTGTTGG0.056200.059400.620700.750001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373CUACAGAUGAUAGAGGAUU76.96521081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051391CTACAGATGATAGAGGATTAATCCTCTATCATCTGTAG0.098400.095100.663800.750001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682AGGUGAGAAAAAAACAAUC70.12971805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952700AGGTGAGAAAAAAACAATCGATTGTTTTTTTCTCACCT0.270300.078600.663800.500001.000001.00000


Target Position: 2639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2639UACAGAUUUAAUACAGUUU74.97821285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7182657TACAGATTTAATACAGTTTAAACTGTATTAAATCTGTA0.117600.040900.681000.500001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529AUUUUAAAAACAUAGAAAA83.3803533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981547ATTTTAAAAACATAGAAAATTTTCTATGTTTTTAAAAT0.551800.373400.508600.500001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259ACCCCGAUGCCAACCUCCU60.96382874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946277ACCCCGATGCCAACCTCCTAGGAGGTTGGCATCGGGGT0.496300.069200.508600.500001.000001.00000


Target Position: 3234, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234GUUUUUUUUUUUUUUAUGU71.55221661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3232-3254TAGTTTTTTTTTTTTTTATGTGAACAUAAAAAAAAAAAAAACUAGUUUUUUUUUUUUUUAUGUGAU-1.4-11.310


Target Position: 3461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3461GGCUGUGUCCCUCUUCUCU82.0861622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4313479GGCTGTGTCCCTCTTCTCTAGAGAAGAGGGACACAGCC0.422100.107600.775900.750001.000001.00000


Target Position: 2049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2049GUUCAACCCACAGCUACUU72.69571555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452067GTTCAACCCACAGCTACTTAAGTAGCTGTGGGTTGAAC0.035000.009900.508600.750000.967400.75000


Target Position: 4253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4253AACAUGAAAGUCUAGAAAU81.3249674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7984271AACATGAAAGTCTAGAAATATTTCTAGACTTTCATGTT0.074300.015400.637900.500001.000001.00000


Target Position: 2222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2222GGACUUUGAGGCAAGUGUG78.1207958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272240GGACTTTGAGGCAAGTGTGCACACTTGCCTCAAAGTCC0.037400.009600.577600.750000.923900.62500


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100UCCAUUUCCAAGCACUUUC51.12113737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972118TCCATTTCCAAGCACTTTCGAAAGTGCTTGGAAATGGA0.137500.145100.698300.500001.000001.00000


Target Position: 2135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135GAAAUAGCGCUGUUUUUGU79.7862800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2133-2155AGGAAATAGCGCTGTTTTTGTTGACAAAAACAGCGCUAUUUCCUGAAAUAGCGCUGUUUUUGUUGU5.613.633


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681CACGAUUUCAUUGAACACU73.25181491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985699CACGATTTCATTGAACACTAGTGTTCAATGAAATCGTG0.215200.120300.586200.500001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CUGUCCCACUCCUACGAUA89.2938225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761918CTGTCCCACTCCTACGATATATCGTAGGAGTGGGACAG0.218700.023600.741400.750000.978300.62500


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157GCUCCCCUGACAGUCCCUC54.43333490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741175GCTCCCCTGACAGTCCCTCGAGGGACTGTCAGGGGAGC0.101100.002600.543100.750001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206AAGCUUCAUUCUCCUUGUU74.63051318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651224AAGCTTCATTCTCCTTGTTAACAAGGAGAATGAAGCTT0.341700.007100.491400.500001.000001.00000


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142AGGAUCAGUUUUUUGUUUU74.65251316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5863160AGGATCAGTTTTTTGTTTTAAAACAAAAAACTGATCCT0.192500.022600.844800.750001.000001.00000


Target Position: 1578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578GGUUUUAGGUAGAAAAACA98.709916

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1576-1598AGGGTTTTAGGTAGAAAAACATAUGUUUUUCUACCUAAAACCCUGGUUUUAGGUAGAAAAACAUAU8.74.932


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607ACACACACACACAAACCUU79.3559844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282625ACACACACACACAAACCTTAAGGTTTGTGTGTGTGTGT0.264900.238500.569000.750001.000001.00000


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215UCUCCUUGUUGUUGGUUGU66.37042287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801233TCTCCTTGTTGTTGGTTGTACAACCAACAACAAGGAGA0.118200.033500.517200.500000.978300.87500


Target Position: 2036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036AGCUCACGUCCAGGUUCAA83.8477500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192054AGCTCACGTCCAGGTTCAATTGAACCTGGACGTGAGCT0.041100.014000.706900.750001.000001.00000


Target Position: 3087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3087UGGAAAUAUUCACAUCGCU73.83541407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563105TGGAAATATTCACATCGCTAGCGATGTGAATATTTCCA0.132600.013600.491400.500001.000001.00000


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329CUCGGUGUCCUACUUCAAA86.1195371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
844347CTCGGTGTCCTACTTCAAATTTGAAGTAGGACACCGAG0.136100.006800.810300.750001.000001.00000


Target Position: 3537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3537UUUUUACAGCUGUGUUAUU70.39591780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473555TTTTTACAGCTGTGTTATTAATAACACAGCTGTAAAAA0.093300.006700.491400.500001.000001.00000


Target Position: 2843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843UCCUUUAAAAAACUUAGUG56.85813285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942861TCCTTTAAAAAACTTAGTGCACTAAGTTTTTTAAAGGA0.203800.215500.577600.500001.000001.00000


Target Position: 2550, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2550GUAUGAUUUAUAAAUGCAA94.860867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182568GTATGATTTATAAATGCAATTGCATTTATAAATCATAC0.041200.020100.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2548-2570CAGTATGATTTATAAATGCAATCUUGCAUUUAUAAAUCAUACUGGUAUGAUUUAUAAAUGCAAUCU20.08.722


Target Position: 2849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2849AAAAAACUUAGUGACAAAA81.6575650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952867AAAAAACTTAGTGACAAAATTTTGTCACTAAGTTTTTT0.140100.130600.500000.500001.000001.00000


Target Position: 2927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927AGGGAGGUGGCAAGAGUGU65.50062402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272945AGGGAGGTGGCAAGAGTGTACACTCTTGCCACCTCCCT0.149600.020700.637900.500001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376CAGAUGAUAGAGGAUUUUA93.506989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401394CAGATGATAGAGGATTTTATAAAATCCTCTATCATCTG0.060900.053100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1374-1396TACAGATGATAGAGGATTTTATAUAAAAUCCUCUAUCAUCUGUACAGAUGAUAGAGGAUUUUAUAU14.220.422


Target Position: 4232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4232CCAGCAGAAGACAAAAAGA89.6863213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5214250CCAGCAGAAGACAAAAAGATCTTTTTGTCTTCTGCTGG0.271800.195000.620700.750001.000001.00000


Target Position: 3732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732UGUUAUUGUUUUGUUAAUU73.15861502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443750TGTTATTGTTTTGTTAATTAATTAACAAAACAATAACA0.083900.041500.698300.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647ACUCUCAUUCGGGAUGAUU69.77351860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493665ACTCTCATTCGGGATGATTAATCATCCCGAATGAGAGT0.034300.003800.698300.750000.978300.75000


Target Position: 2343, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2343CCUUUUCUUUAAAGAAGUU80.9646702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662361CCTTTTCTTTAAAGAAGTTAACTTCTTTAAAGAAAAGG0.030500.004800.698301.000000.972800.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2341-2363TTCCTTTTCTTTAAAGAAGTTGAAACUUCUUUAAAGAAAAGGAACCUUUUCUUUAAAGAAGUUGAU17.710.311


Target Position: 3134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3134GCUAUUGGAGGAUCAGUUU81.5581654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3132-3154CTGCTATTGGAGGATCAGTTTTTAAACUGAUCCUCCAAUAGCAGGCUAUUGGAGGAUCAGUUUUUU19.217.432


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452AGGCAUUAACACAAAGGAG72.88751530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931470AGGCATTAACACAAAGGAGCTCCTTTGTGTTAATGCCT0.115900.025700.534500.500001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371UGCUACAGAUGAUAGAGGA83.0845553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881389TGCTACAGATGATAGAGGATCCTCTATCATCTGTAGCA0.116600.119900.482800.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677CCCGCACGAUUUCAUUGAA87.6577292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411695CCCGCACGATTTCATTGAATTCAATGAAATCGTGCGGG0.212300.105000.819001.000001.000001.00000


Target Position: 3244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3244UUUUUAUGUGAUCAAUUUU69.94521831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013262TTTTTATGTGATCAATTTTAAAATTGATCACATAAAAA0.121200.083200.500000.500001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570CUCCCCUUGAUUUAAACAC58.41913157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582588CTCCCCTTGATTTAAACACGTGTTTAAATCAAGGGGAG0.625100.244000.517200.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CAGAUGUGAAGUUCAUUUC72.27181601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764799CAGATGTGAAGTTCATTTCGAAATGAACTTCACATCTG0.142500.010300.612100.500000.994600.62500


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081GGGACGUGGACAUCUGAGG64.83132471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341099GGGACGTGGACATCTGAGGCCTCAGATGTCCACGTCCC0.208000.011500.646600.500000.907600.75000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CCCUUCCAUCUCUGACUUA86.0589378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881271CCCTTCCATCTCTGACTTATAAGTCAGAGATGGAAGGG0.430900.447400.956901.000001.000001.00000


Target Position: 4228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4228GUUUCCAGCAGAAGACAAA87.4495300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4074246GTTTCCAGCAGAAGACAAATTTGTCTTCTGCTGGAAAC0.576700.285200.646600.750000.983700.87500


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725GUAACCUCUUCACCUUAUU77.56911019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221743GTAACCTCTTCACCTTATTAATAAGGTGAAGAGGTTAC0.040500.010900.672400.750001.000001.00000


Target Position: 4137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4137CGCAAGUCUGAGGGUCUGG58.63483128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674155CGCAAGTCTGAGGGTCTGGCCAGACCCTCAGACTTGCG0.030400.009700.577600.500001.000001.00000


Target Position: 3083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3083GGUUUGGAAAUAUUCACAU85.9576383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7473101GGTTTGGAAATATTCACATATGTGAATATTTCCAAACC0.295100.010900.698301.000001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711CCGUAGGUAGAUGUGUAAC68.35792053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011729CCGTAGGTAGATGTGTAACGTTACACATCTACCTACGG0.084400.004700.767200.750001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810GACCACCACCCCAACAAAC67.91692103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461828GACCACCACCCCAACAAACGTTTGTTGGGGTGGTGGTC0.414500.201200.672400.500001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909UCCUACGAUACGCUACUAU70.04671818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641927TCCTACGATACGCTACTATATAGTAGCGTATCGTAGGA0.260400.092300.827600.750001.000001.00000


Target Position: 783, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783GAUGUGAAGUUCAUUUCCA92.3287123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
781-803CAGATGTGAAGTTCATTTCCAATUGGAAAUGAACUUCACAUCUGGAUGUGAAGUUCAUUUCCAAUU20.120.521


Target Position: 3300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3300CUGUUUCACAAUACCUCAU79.16868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453318CTGTTTCACAATACCTCATATGAGGTATTGTGAAACAG0.083800.023200.629300.750001.000001.00000


Target Position: 2932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932GGUGGCAAGAGUGUGGAGG57.03153270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272950GGTGGCAAGAGTGTGGAGGCCTCCACACTCTTGCCACC0.244700.043700.508600.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895GCCACCUGUCCCACUCCUA83.3198539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411913GCCACCTGTCCCACTCCTATAGGAGTGGGACAGGTGGC0.078900.007000.827601.000001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546GCCAGUAUGAUUUAUAAAU85.3198423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712564GCCAGTATGATTTATAAATATTTATAAATCATACTGGC0.138800.029600.991401.000001.000001.00000


Target Position: 3690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3690AGUUUUGGGUAUGUUUAAU78.4483932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673708AGTTTTGGGTATGTTTAATATTAAACATACCCAAAACT0.088900.002800.698300.750001.000001.00000


Target Position: 1941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941AAUAGUGACAUAAUAUAUU84.3117480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621959AATAGTGACATAATATATTAATATATTATGTCACTATT0.658900.038500.500000.500001.000001.00000


Target Position: 3573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3573GAAGUUGCAUAAUUAUUAU95.170662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8593591GAAGTTGCATAATTATTATATAATAATTATGCAACTTC0.485700.006200.629300.750001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267ACUUAAGCAAAAGAAAAAG62.19682747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6941285ACTTAAGCAAAAGAAAAAGCTTTTTCTTTTGCTTAAGT0.344100.099900.569000.500001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258CCAUCUCUGACUUAAGCAA91.3617153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921276CCATCTCTGACTTAAGCAATTGCTTAAGTCAGAGATGG0.132700.026300.698301.000001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021CCGAGGAGGAGGAAGAGGA78.7368911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011039CCGAGGAGGAGGAAGAGGATCCTCTTCCTCCTCCTCGG0.179900.093600.543100.750001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096CCAUUCCAUUUCCAAGCAC65.64292384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752114CCATTCCATTTCCAAGCACGTGCTTGGAAATGGAATGG0.190100.200200.551700.750001.000001.00000


Target Position: 3289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289CAAAAAGGUUGCUGUUUCA92.1896129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3287-3309TCCAAAAAGGTTGCTGTTTCACAUGAAACAGCAACCUUUUUGGACAAAAAGGUUGCUGUUUCACAU19.29.512


Target Position: 2929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929GGAGGUGGCAAGAGUGUGG68.52462032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552947GGAGGTGGCAAGAGTGTGGCCACACTCTTGCCACCTCC0.324500.023800.525900.500001.000001.00000


Target Position: 3103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103GCUUCUGUGUAUCUCUUUC76.50661131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163121GCTTCTGTGTATCTCTTTCGAAAGAGATACACAGAAGC0.115000.007900.681000.750001.000001.00000


Target Position: 3585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585UUAUUAUUAUUAUUAUUAU88.7597252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663603TTATTATTATTATTATTATATAATAATAATAATAATAA0.370300.277900.491400.500001.000001.00000


Target Position: 2435, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435GGUUUUUAAGGGUUAUCUU86.9324325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2433-2455GTGGTTTTTAAGGGTTATCTTAGAAGAUAACCCUUAAAAACCACGGUUUUUAAGGGUUAUCUUAGU14.50.032


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506UGUUUAAAAAAAAGCAUAA82.2341611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941524TGTTTAAAAAAAAGCATAATTATGCTTTTTTTTAAACA0.251900.053400.672400.750001.000001.00000


Target Position: 3755, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3755CAUAAUGCUAAUUUAAAGA86.6494340

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3753-3775ACCATAATGCTAATTTAAAGAGAUCUUUAAAUUAGCAUUAUGGUCAUAAUGCUAAUUUAAAGAGAU-3.815.222


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326GCCCUCGGUGUCCUACUUC61.75952793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849344GCCCTCGGTGTCCTACTTCGAAGTAGGACACCGAGGGC0.129800.006600.827600.750001.000001.00000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553GCAAACCAUUUUUAAAGUA87.9559281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591571GCAAACCATTTTTAAAGTATACTTTAAAAATGGTTTGC0.032200.026800.672401.000001.000001.00000


Target Position: 1410, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410CUCGUUUUUAUAUUAAUGU70.9211737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861428CTCGTTTTTATATTAATGTACATTAATATAAAAACGAG0.265400.148300.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1408-1430AACTCGTTTTTATATTAATGTACACAUUAAUAUAAAAACGAGUUCUCGUUUUUAUAUUAAUGUACU-1.815.322


Target Position: 2895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895AAUUCUUGUAAUUUUUAUU79.3246850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602913AATTCTTGTAATTTTTATTAATAAAAATTACAAGAATT0.097300.033400.500000.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574CCUUGAUUUAAACACACAG74.67121314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622592CCTTGATTTAAACACACAGCTGTGTGTTTAAATCAAGG0.584400.193500.560300.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571UCCCCUUGAUUUAAACACA76.68581117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012589TCCCCTTGATTTAAACACATGTGTTTAAATCAAGGGGA0.796200.258200.663800.500001.000001.00000


Target Position: 1358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GGGAGGAGGGUUGUGCUAC67.38562172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391376GGGAGGAGGGTTGTGCTACGTAGCACAACCCTCCTCCC0.049100.003700.810300.750001.000001.00000


Target Position: 1268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268CUUAAGCAAAAGAAAAAGA78.9967887

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1266-1288GACTTAAGCAAAAGAAAAAGATTUCUUUUUCUUUUGCUUAAGUCCUUAAGCAAAAGAAAAAGAUUU5.519.722


Target Position: 1579, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1579GUUUUAGGUAGAAAAACAU84.5075464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741597GTTTTAGGTAGAAAAACATATGTTTTTCTACCTAAAAC0.187400.042900.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1577-1599GGGTTTTAGGTAGAAAAACATATAUGUUUUUCUACCUAAAACCCGUUUUAGGUAGAAAAACAUAUU5.611.022


Target Position: 2897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2897UUCUUGUAAUUUUUAUUUA78.599920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462915TTCTTGTAATTTTTATTTATAAATAAAAATTACAAGAA0.034900.014000.637900.500001.000001.00000


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688GAAAAAAACAAUCUGGAAG73.51741459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972706GAAAAAAACAATCTGGAAGCTTCCAGATTGTTTTTTTC0.117000.094200.534500.500001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830AUCCCCUGCCCCUUCCUUU59.9422986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422848ATCCCCTGCCCCTTCCTTTAAAGGAAGGGGCAGGGGAT0.779700.335900.681000.500001.000001.00000


Target Position: 2528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528GCAGAGGAUGUUCAUAAGG66.23682304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682546GCAGAGGATGTTCATAAGGCCTTATGAACATCCTCTGC0.030100.010500.508600.500001.000001.00000


Target Position: 2976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976GAGGAGGUGUGAGGAGGAG70.30171789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732994GAGGAGGTGTGAGGAGGAGCTCCTCCTCACACCTCCTC0.306400.259200.500000.500001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949GCCAGGAGCAGAUCGAAGC60.82932886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829967GCCAGGAGCAGATCGAAGCGCTTCGATCTGCTCCTGGC0.264800.007200.646600.500000.934800.75000


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462GCUGUGUCCCUCUUCUCUU82.7981579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2543480GCTGTGTCCCTCTTCTCTTAAGAGAAGAGGGACACAGC0.425400.104900.715501.000001.000001.00000


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107CCAAGCACUUUCAGUCCAA89.0062240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972125CCAAGCACTTTCAGTCCAATTGGACTGAAAGTGCTTGG0.817000.053200.698301.000000.945700.87500


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216ACAGAUGCCUUUUUUGUAG68.07542085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103234ACAGATGCCTTTTTTGTAGCTACAAAAAAGGCATCTGT0.118800.023500.534500.500001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216CUCCUUGUUGUUGGUUGUU65.40212410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681234CTCCTTGTTGTTGGTTGTTAACAACCAACAACAAGGAG0.139900.042800.663800.750000.978300.75000


Target Position: 3143, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143GGAUCAGUUUUUUGUUUUA98.729315

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5314319GGATCAGTTTTTTGTTTTA1/1/0/096.22CCND1NM_053056.21NANANA11:69468096..69468114(+)00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5243161GGATCAGTTTTTTGTTTTATAAAACAAAAAACTGATCC0.156900.068300.836201.000001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988GUGACCUGUUUAUGAGAUG71.4811668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842006GTGACCTGTTTATGAGATGCATCTCATAAACAGGTCAC0.034000.002400.637900.500001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UUCAGCAAACCAUUUUUAA72.54551570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601567TTCAGCAAACCATTTTTAATTAAAAATGGTTTGCTGAA0.116000.083600.637900.500001.000001.00000


Target Position: 3579, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3579GCAUAAUUAUUAUUAUUAU98.879413

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7357919GCATAATTATTATTATTAT1/1/0/096.22CCND1NM_053056.21NANANANA00CCND1(0.002)&TAF5L(0.029)&HOXB5(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3603597GCATAATTATTATTATTATATAATAATAATAATTATGC0.434400.065300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3577-3599TTGCATAATTATTATTATTATTAAUAAUAAUAAUAAUUAUGCAAGCAUAAUUAUUAUUAUUAUUAU-8.0-1.811


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691UCAUUGUAUGUUAUUAUAU79.7918798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771709TCATTGTATGTTATTATATATATAATAACATACAATGA0.212500.009800.681000.750001.000001.00000


Target Position: 2888, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888GCUAUGUAAUUCUUGUAAU90.3773191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302906GCTATGTAATTCTTGTAATATTACAAGAATTACATAGC0.153600.079500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2886-2908TGGCTATGTAATTCTTGTAATTTAUUACAAGAAUUACAUAGCCAGCUAUGUAAUUCUUGUAAUUUU11.813.132


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653AGUUUAUUUUUAAAGAUAG77.33181040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882671AGTTTATTTTTAAAGATAGCTATCTTTAAAAATAAACT0.059800.014000.534500.500001.000001.00000


Target Position: 1499, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499CUUUACGUGUUUAAAAAAA83.421530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681517CTTTACGTGTTTAAAAAAATTTTTTTAAACACGTAAAG0.210100.006000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1497-1519TCCTTTACGTGTTTAAAAAAAAGUUUUUUUAAACACGUAAAGGACUUUACGUGUUUAAAAAAAAGU-9.115.021


Target Position: 3162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3162CAAUGUCAUAUACUGCCAU87.3125306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703180CAATGTCATATACTGCCATATGGCAGTATATGACATTG0.136000.040100.491400.750001.000001.00000


Target Position: 3526, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3526CAUCAUAGUAGUUUUUACA94.446875

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3524-3546AGCATCATAGTAGTTTTTACAGCUGUAAAAACUACUAUGAUGCUCAUCAUAGUAGUUUUUACAGCU0.013.333


Target Position: 4223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4223GGCAUGUUUCCAGCAGAAG67.31492179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9194241GGCATGTTTCCAGCAGAAGCTTCTGCTGGAAACATGCC0.406500.004000.862100.750000.918500.75000


Target Position: 2221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2221AGGACUUUGAGGCAAGUGU69.30081929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692239AGGACTTTGAGGCAAGTGTACACTTGCCTCAAAGTCCT0.029900.007200.637900.500000.923900.62500


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251CCCCCUUCCAUCUCUGACU69.50351897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451269CCCCCTTCCATCTCTGACTAGTCAGAGATGGAAGGGGG0.457400.491000.784500.750001.000001.00000


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270UAAGCAAAAGAAAAAGAUU76.65251121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541288TAAGCAAAAGAAAAAGATTAATCTTTTTCTTTTGCTTA0.567100.140700.525900.500001.000001.00000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692AAAACAAUCUGGAAGAAAA94.802970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052710AAAACAATCTGGAAGAAAATTTTCTTCCAGATTGTTTT0.275700.110300.500000.500001.000001.00000


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019CGCCGAGGAGGAGGAAGAG66.40572285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421037CGCCGAGGAGGAGGAAGAGCTCTTCCTCCTCCTCGGCG0.167800.011000.612100.750001.000001.00000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254GCAGUGGAGGUGGGGUGUU69.24931933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222272GCAGTGGAGGTGGGGTGTTAACACCCCACCTCCACTGC0.381700.029500.706901.000001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356GAAGUUGAAGUUUAGGAAU84.8959440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352374GAAGTTGAAGTTTAGGAATATTCCTAAACTTCAACTTC0.151200.036500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2354-2376AAGAAGTTGAAGTTTAGGAATCCAUUCCUAAACUUCAACUUCUUGAAGUUGAAGUUUAGGAAUCCU19.919.223


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812CCACCACCCCAACAAACCA82.4265600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801830CCACCACCCCAACAAACCATGGTTTGTTGGGGTGGTGG0.375700.184700.500000.750001.000001.00000


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334UGUCCUACUUCAAAUGUGU74.93531292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890352TGTCCTACTTCAAATGTGTACACATTTGAAGTAGGACA0.341400.038100.500000.500001.000001.00000


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575GAGGGUUUUAGGUAGAAAA94.808869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431593GAGGGTTTTAGGTAGAAAATTTTCTACCTAAAACCCTC0.216200.011000.810300.750001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508GGCUAAAAAGUAUAUUUAU94.221879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582526GGCTAAAAAGTATATTTATATAAATATACTTTTTAGCC0.193300.040000.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2506-2528AAGGCTAAAAAGTATATTTATTGAUAAAUAUACUUUUUAGCCUUGGCUAAAAAGUAUAUUUAUUGU-8.013.722


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265UGACUUAAGCAAAAGAAAA85.181432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301283TGACTTAAGCAAAAGAAAATTTTCTTTTGCTTAAGTCA0.203500.084700.724100.750001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077UCUUCUUCAUAUUCUAAAA87.3825302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512095TCTTCTTCATATTCTAAAATTTTAGAATATGAAGAAGA0.493500.355600.724100.750001.000001.00000


Target Position: 1413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413GUUUUUAUAUUAAUGUACU84.3584478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1411-1433TCGTTTTTATATTAATGTACTTGAGUACAUUAAUAUAAAAACGAGUUUUUAUAUUAAUGUACUUGU14.6-9.732


Target Position: 2482, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482CACUAAAAUAUAUAAUUUA100.4464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052500CACTAAAATATATAATTTATAAATTATATATTTTAGTG0.130500.051900.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2480-2502AACACTAAAATATATAATTTATAUAAAUUAUAUAUUUUAGUGUUCACUAAAAUAUAUAAUUUAUAU-10.34.922


Target Position: 2630, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2630CUUUGAUGUUACAGAUUUA99.73559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602648CTTTGATGTTACAGATTTATAAATCTGTAACATCAAAG0.234700.051300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2628-2650GCCTTTGATGTTACAGATTTAATUAAAUCUGUAACAUCAAAGGCCUUUGAUGUUACAGAUUUAAUU12.013.822


Target Position: 3951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3951CCAGAACACGGCUCACGCU79.0837879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643969CCAGAACACGGCTCACGCTAGCGTGAGCCGTGTTCTGG0.079700.015500.491400.750000.929300.87500


Target Position: 3276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276UACUGCUCUAUUCCAAAAA74.54881327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163294TACTGCTCTATTCCAAAAATTTTTGGAATAGAGCAGTA0.290700.128600.681000.500001.000001.00000


Target Position: 3102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3102CGCUUCUGUGUAUCUCUUU80.7931717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033120CGCTTCTGTGTATCTCTTTAAAGAGATACACAGAAGCG0.305300.008500.922401.000001.000001.00000


Target Position: 3952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3952CAGAACACGGCUCACGCUU71.38311681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923970CAGAACACGGCTCACGCTTAAGCGTGAGCCGTGTTCTG0.238800.022000.646600.750000.929300.75000


Target Position: 2850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850AAAAACUUAGUGACAAAAU75.29871256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752868AAAAACTTAGTGACAAAATATTTTGTCACTAAGTTTTT0.149400.119100.491400.500001.000001.00000


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944GUGGAGGCUGACGUGUGAG67.29422183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922962GTGGAGGCTGACGTGTGAGCTCACACGTCAGCCTCCAC0.036000.005400.482800.500001.000001.00000


Target Position: 3178, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178CAUGUACUAGUUUUAGUUU86.8683329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7133196CATGTACTAGTTTTAGTTTAAACTAAAACTAGTACATG0.201800.013000.655200.750000.945700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3176-3198GCCATGTACTAGTTTTAGTTTTCAAACUAAAACUAGUACAUGGCCAUGUACUAGUUUUAGUUUUCU4.919.033


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948AGGCUGACGUGUGAGGGAG64.04512551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662966AGGCTGACGTGTGAGGGAGCTCCCTCACACGTCAGCCT0.080800.003200.534500.500001.000001.00000


Target Position: 4284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4284ACCCCAAAAAAAAAAAAAA77.60581014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3794302ACCCCAAAAAAAAAAAAAATTTTTTTTTTTTTTGGGGT0.998500.582400.853400.750001.000001.00000


Target Position: 2651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651ACAGUUUAUUUUUAAAGAU81.1554683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952669ACAGTTTATTTTTAAAGATATCTTTAAAAATAAACTGT0.046300.014300.525900.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898CACGCUUCCUCUCCAGAGU73.9271399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997916CACGCTTCCTCTCCAGAGTACTCTGGAGAGGAAGCGTG0.081800.002100.586200.500000.918500.62500


Target Position: 4230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4230UUCCAGCAGAAGACAAAAA73.60721444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484248TTCCAGCAGAAGACAAAAATTTTTGTCTTCTGCTGGAA0.354000.239500.672400.500000.983700.62500


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935GGCAAGAGUGUGGAGGCUG67.2642187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262953GGCAAGAGTGTGGAGGCTGCAGCCTCCACACTCTTGCC0.065500.007500.715500.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431AGGUGGUUUUUAAGGGUUA83.7277509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662449AGGTGGTTTTTAAGGGTTATAACCCTTAAAAACCACCT0.055500.002800.810300.750001.000001.00000


Target Position: 4266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4266AGAAAUAAAACUGGUAAAA80.8208713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5164284AGAAATAAAACTGGTAAAATTTTACCAGTTTTATTTCT0.162200.159800.724100.750001.000001.00000


Target Position: 3310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3310AUACCUCAUGCUUCACUUA85.6788399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303328ATACCTCATGCTTCACTTATAAGTGAAGCATGAGGTAT0.066300.007200.508600.500001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239CCUUUGCUCUUUCCCCCUU69.47391908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221257CCTTTGCTCTTTCCCCCTTAAGGGGGAAAGAGCAAAGG0.729700.270700.706901.000001.000001.00000


Target Position: 4064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4064GGAUGUUGUGUGUAUCGAG87.998279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6934082GGATGTTGTGTGTATCGAGCTCGATACACACAACATCC0.102000.024500.560300.750001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692CAUUGUAUGUUAUUAUAUU96.701438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411710CATTGTATGTTATTATATTAATATAATAACATACAATG0.218800.011100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1690-1712GTCATTGTATGTTATTATATTCCAAUAUAAUAACAUACAAUGACCAUUGUAUGUUAUUAUAUUCCU-8.66.712


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812CGGUUCCGAUGAAUUCUUA91.482145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9712830CGGTTCCGATGAATTCTTATAAGAATTCATCGGAACCG0.075600.002700.879301.000001.000001.00000


Target Position: 1316, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316GAGAGAAAAAAAAAAUAGU83.4304529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521334GAGAGAAAAAAAAAATAGTACTATTTTTTTTTTCTCTC0.869000.676500.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1314-1336GAGAGAGAAAAAAAAAATAGTATACUAUUUUUUUUUUCUCUCUCGAGAGAAAAAAAAAAUAGUAUU-4.319.111


Target Position: 2484, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484CUAAAAUAUAUAAUUUAUA94.749672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702502CTAAAATATATAATTTATATATAAATTATATATTTTAG0.078800.046200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2482-2504CACTAAAATATATAATTTATAGTUAUAAAUUAUAUAUUUUAGUGCUAAAAUAUAUAAUUUAUAGUU-10.3-7.512


Target Position: 2601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2601ACACACACACACACACACA88.4625262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672619ACACACACACACACACACATGTGTGTGTGTGTGTGTGT0.831300.830500.500000.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678CCGCACGAUUUCAUUGAAC66.7992222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396696CCGCACGATTTCATTGAACGTTCAATGAAATCGTGCGG0.224300.115400.767200.750001.000001.00000


Target Position: 4263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4263UCUAGAAAUAAAACUGGUA82.0302628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7044281TCTAGAAATAAAACTGGTATACCAGTTTTATTTCTAGA0.232400.229400.543100.750001.000001.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261CCCGAUGCCAACCUCCUCA75.24181263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271279CCCGATGCCAACCTCCTCATGAGGAGGTTGGCATCGGG0.394600.097800.767200.750001.000001.00000


Target Position: 3294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3294AGGUUGCUGUUUCACAAUA87.0234319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5033312AGGTTGCTGTTTCACAATATATTGTGAAACAGCAACCT0.164800.037200.801700.750000.940200.62500


Target Position: 4240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4240AGACAAAAAGACAAACAUG78.6178919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6984258AGACAAAAAGACAAACATGCATGTTTGTCTTTTTGTCT0.187800.045300.569000.500001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478CGCUGGAGCCCGUGAAAAA91.7152140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964496CGCTGGAGCCCGTGAAAAATTTTTCACGGGCTCCAGCG0.179600.002800.922401.000000.978300.75000


Target Position: 1926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926AUAAAGAGAAGACGAAAUA81.7247645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251944ATAAAGAGAAGACGAAATATATTTCGTCTTCTCTTTAT0.038300.015600.500000.500001.000001.00000


Target Position: 3060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060UGCUACCGUUGACUUCCAG62.21612743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773078TGCTACCGTTGACTTCCAGCTGGAAGTCAACGGTAGCA0.042500.023800.569000.500000.940200.62500


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317AGAGAAAAAAAAAAUAGUA91.3079155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6971335AGAGAAAAAAAAAATAGTATACTATTTTTTTTTTCTCT0.876800.688400.543100.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527ACAUUUUAAAAACAUAGAA84.1074490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7381545ACATTTTAAAAACATAGAATTCTATGTTTTTAAAATGT0.486600.363600.534500.750001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840CCUUCCUUUAAAAAACUUA84.065492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
952858CCTTCCTTTAAAAAACTTATAAGTTTTTTAAAGGAAGG0.784200.704100.810301.000001.000001.00000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067UGGUUUGUGUUCUUCUUCA82.9547565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232085TGGTTTGTGTTCTTCTTCATGAAGAAGAACACAAACCA0.551700.007500.620700.500001.000001.00000


Target Position: 3187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187GUUUUAGUUUUCUCUUAGA89.5157217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3185-3207TAGTTTTAGTTTTCTCTTAGAACUCUAAGAGAAAACUAAAACUAGUUUUAGUUUUCUCUUAGAACU16.34.922


Target Position: 1945, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945GUGACAUAAUAUAUUCUAU96.641940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121963GTGACATAATATATTCTATATAGAATATATTATGTCAC0.343500.179400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1943-1965TAGTGACATAATATATTCTATTTAUAGAAUAUAUUAUGUCACUAGUGACAUAAUAUAUUCUAUUUU8.421.522


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GAGAAGACGAAAUAGUGAC75.95111194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521949GAGAAGACGAAATAGTGACGTCACTATTTCGTCTTCTC0.055200.015500.491400.500001.000001.00000


Target Position: 3222, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222GCCUUUUUUGUAGUUUUUU70.47091774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4023240GCCTTTTTTGTAGTTTTTTAAAAAACTACAAAAAAGGC0.218800.103001.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3220-3242ATGCCTTTTTTGTAGTTTTTTTTAAAAAACUACAAAAAAGGCAUGCCUUUUUUGUAGUUUUUUUUU3.29.511


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245CUCUUUCCCCCUUCCAUCU67.5062165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611263CTCTTTCCCCCTTCCATCTAGATGGAAGGGGGAAAGAG0.756200.581200.586200.500001.000001.00000


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185UAGUUUUAGUUUUCUCUUA84.5195461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053203TAGTTTTAGTTTTCTCTTATAAGAGAAAACTAAAACTA0.077000.018800.637900.500001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319AGAAAAAAAAAAUAGUAUU81.0904692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1901337AGAAAAAAAAAATAGTATTAATACTATTTTTTTTTTCT0.817600.803300.715500.750001.000001.00000


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229UUGUAGUUUUUUUUUUUUU65.18762427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5423247TTGTAGTTTTTTTTTTTTTAAAAAAAAAAAAACTACAA0.858500.199300.646600.500001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080CGGGACGUGGACAUCUGAG70.91971738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841098CGGGACGTGGACATCTGAGCTCAGATGTCCACGTCCCG0.300200.009600.603400.750000.907600.87500


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146UCAGUUUUUUGUUUUACAA81.4157667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973164TCAGTTTTTTGTTTTACAATTGTAAAACAAAAAACTGA0.195200.053000.577600.750001.000001.00000


Target Position: 2599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2599ACACACACACACACACACA88.4625261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912617ACACACACACACACACACATGTGTGTGTGTGTGTGTGT0.857200.856700.500000.500001.000001.00000


Target Position: 3522, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522GUAGCAUCAUAGUAGUUUU93.683984

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1352219GTAGCATCATAGTAGTTTT1/1/0/0100.00CCND1NM_053056.21NANANA11:69468475..69468493(+)00CCND1(0.002)


Target Position: 3695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3695UGGGUAUGUUUAAUCUGUU79.3102852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6483713TGGGTATGTTTAATCTGTTAACAGATTAAACATACCCA0.807200.017200.698300.750001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074UGUUCUUCUUCAUAUUCUA91.0565167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172092TGTTCTTCTTCATATTCTATAGAATATGAAGAAGAACA0.481900.392100.534500.750001.000001.00000


Target Position: 3107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107CUGUGUAUCUCUUUCACAU91.4528149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3105-3127TTCTGTGTATCTCTTTCACATTGAUGUGAAAGAGAUACACAGAACUGUGUAUCUCUUUCACAUUGU20.520.420


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912UACGAUACGCUACUAUAAA84.4771470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381930TACGATACGCTACTATAAATTTATAGTAGCGTATCGTA0.250200.113500.681000.500001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877UCCUGUCCUACUACCGCCU58.78273113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
748895TCCTGTCCTACTACCGCCTAGGCGGTAGTAGGACAGGA0.102800.047600.525900.500001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902GUAAUUUUUAUUUAGGAAG67.65432149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632920GTAATTTTTATTTAGGAAGCTTCCTAAATAAAAATTAC0.031300.003100.543100.500001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306AAAAGAGAGAGAGAGAAAA85.4403413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071324AAAAGAGAGAGAGAGAAAATTTTCTCTCTCTCTCTTTT0.421900.106000.500000.500001.000001.00000


Target Position: 3748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3748AUUACACCAUAAUGCUAAU81.1529685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703766ATTACACCATAATGCTAATATTAGCATTATGGTGTAAT0.078900.048100.500000.500000.940200.87500


Target Position: 1689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689AGUCAUUGUAUGUUAUUAU88.2237269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001707AGTCATTGTATGTTATTATATAATAACATACAATGACT0.045000.008400.663800.750001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405AUCAACUCGUUUUUAUAUU68.91983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731423ATCAACTCGTTTTTATATTAATATAAAAACGAGTTGAT0.450600.114400.672400.500001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722GGAGGAGAACAAACAGAUC80.9848699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
624740GGAGGAGAACAAACAGATCGATCTGTTTGTTCTCCTCC0.391200.019100.689700.750001.000001.00000


Target Position: 2335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335GUUCCUUUCCUUUUCUUUA86.8369331

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2333-2355AAGTTCCTTTCCTTTTCTTTAAAUAAAGAAAAGGAAAGGAACUUGUUCCUUUCCUUUUCUUUAAAU5.518.711


Target Position: 2695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2695ACAAUCUGGAAGAAAAAAA79.9392788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3222713ACAATCTGGAAGAAAAAAATTTTTTTCTTCCAGATTGT0.469400.094200.706900.750001.000001.00000


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646UUAAUACAGUUUAUUUUUA80.675728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832664TTAATACAGTTTATTTTTATAAAAATAAACTGTATTAA0.061600.034400.500000.500001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159UCCCCUGACAGUCCCUCCU54.40433491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931177TCCCCTGACAGTCCCTCCTAGGAGGGACTGTCAGGGGA0.050800.016900.525900.500001.000001.00000


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186AGUUUUAGUUUUCUCUUAG75.02231281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333204AGTTTTAGTTTTCTCTTAGCTAAGAGAAAACTAAAACT0.061800.015500.534500.500001.000001.00000


Target Position: 1538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538ACAUAGAAAAAUUCAGCAA85.9118386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661556ACATAGAAAAATTCAGCAATTGCTGAATTTTTCTATGT0.347300.248600.560300.750001.000001.00000


Target Position: 2715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715CACACAAAGACAUUGAUUC74.16431366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392733CACACAAAGACATTGATTCGAATCAATGTCTTTGTGTG0.413500.331700.620700.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075GUUCUUCUUCAUAUUCUAA94.924765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562093GTTCTTCTTCATATTCTAATTAGAATATGAAGAAGAAC0.444100.369000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2073-2095GTGTTCTTCTTCATATTCTAAAAUUAGAAUAUGAAGAAGAACACGUUCUUCUUCAUAUUCUAAAAU8.419.111


Target Position: 1569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569GUAGAAGAGGGUUUUAGGU73.99131391

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1567-1589AAGTAGAAGAGGGTTTTAGGTAGACCUAAAACCCUCUUCUACUUGUAGAAGAGGGUUUUAGGUAGU11.020.222


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925UAUAAAGAGAAGACGAAAU75.81891208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031943TATAAAGAGAAGACGAAATATTTCGTCTTCTCTTTATA0.043200.020700.534500.500001.000001.00000


Target Position: 2348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2348UCUUUAAAGAAGUUGAAGU68.93411980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472366TCTTTAAAGAAGTTGAAGTACTTCAACTTCTTTAAAGA0.048500.009700.517200.500001.000001.00000


Target Position: 2834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834CCUGCCCCUUCCUUUAAAA82.535589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502852CCTGCCCCTTCCTTTAAAATTTTAAAGGAAGGGGCAGG0.869500.389800.844801.000001.000001.00000


Target Position: 3120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120UCACAUUGUUUGCUGCUAU77.44231030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683138TCACATTGTTTGCTGCTATATAGCAGCAAACAATGTGA0.054600.034000.681000.750000.983700.62500


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505UAAGGCUAAAAAGUAUAUU68.12052078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922523TAAGGCTAAAAAGTATATTAATATACTTTTTAGCCTTA0.120600.012600.525900.500001.000001.00000


Target Position: 16, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
16GGAGUUUUGUUGAAGUUGC69.71161868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97234GGAGTTTTGTTGAAGTTGCGCAACTTCAACAAAACTCC0.101300.002700.517200.500001.000001.00000


Target Position: 2468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468GGAAGGUUUUUAAACACUA96.924936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5662486GGAAGGTTTTTAAACACTATAGTGTTTAAAAACCTTCC0.180900.024100.698301.000001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GUUGUAAGAAUAGGCAUUA85.4203416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351459GTTGTAAGAATAGGCATTATAATGCCTATTCTTACAAC0.127700.018000.612100.750001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905CCUCUCCAGAGUGAUCAAG62.89472676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843923CCTCTCCAGAGTGATCAAGCTTGATCACTCTGGAGAGG0.060600.006900.706900.750000.918500.62500


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785UGUGAAGUUCAUUUCCAAU80.2736760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644803TGTGAAGTTCATTTCCAATATTGGAAATGAACTTCACA0.163700.017300.698300.750001.000001.00000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913ACGAUACGCUACUAUAAAG77.7469998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921931ACGATACGCTACTATAAAGCTTTATAGTAGCGTATCGT0.209800.141300.637900.500001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208GCUUCAUUCUCCUUGUUGU85.1836430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561226GCTTCATTCTCCTTGTTGTACAACAAGGAGAATGAAGC0.154900.025000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1206-1228AAGCTTCATTCTCCTTGTTGTTGACAACAAGGAGAAUGAAGCUUGCUUCAUUCUCCUUGUUGUUGU16.712.022


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GCCUGUGACCACCACCCCA83.8667498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841822GCCTGTGACCACCACCCCATGGGGTGGTGGTCACAGGC0.400800.089000.655200.750000.918501.00000


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335GUCCUACUUCAAAUGUGUG73.40491469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807353GTCCTACTTCAAATGTGTGCACACATTTGAAGTAGGAC0.280200.017900.525900.500001.000001.00000


Target Position: 3542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542ACAGCUGUGUUAUUCUUUG70.6141759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6743560ACAGCTGTGTTATTCTTTGCAAAGAATAACACAGCTGT0.211600.015100.560300.500001.000001.00000


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948ACAUAAUAUAUUCUAUUUU82.2042615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991966ACATAATATATTCTATTTTAAAATAGAATATATTATGT0.233900.141000.706900.750001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139UGGAGGAUCAGUUUUUUGU67.99862092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573157TGGAGGATCAGTTTTTTGTACAAAAAACTGATCCTCCA0.224300.003100.637900.500001.000001.00000


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621ACCUUCUGCCUUUGAUGUU67.84992113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692639ACCTTCTGCCTTTGATGTTAACATCAAAGGCAGAAGGT0.250100.023800.706900.750001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545GGCCAGUAUGAUUUAUAAA97.914123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392563GGCCAGTATGATTTATAAATTTATAAATCATACTGGCC0.365800.011301.000001.000001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043CCAUUUUCUUAUUGCGCUG68.22032069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7123061CCATTTTCTTATTGCGCTGCAGCGCAATAAGAAAATGG0.095900.053200.560300.750001.000001.00000


Target Position: 3726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3726UCUGUUUGUUAUUGUUUUG62.2342742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913744TCTGTTTGTTATTGTTTTGCAAAACAATAACAAACAGA0.127500.081000.577600.500001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480CUGGAGCCCGUGAAAAAGA76.12771174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925498CTGGAGCCCGTGAAAAAGATCTTTTTCACGGGCTCCAG0.367900.003900.560300.500001.000001.00000


Target Position: 4236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4236CAGAAGACAAAAAGACAAA91.3996152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3794254CAGAAGACAAAAAGACAAATTTGTCTTTTTGTCTTCTG0.247800.058100.784500.750001.000001.00000


Target Position: 1290, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290CCCAAAAACUGUCUUUAAA89.9889204

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3129019CCCAAAAACTGTCTTTAAA1/1/0/097.21CCND1NM_053056.21NANANA11:69466243..69466261(+)00CCND1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1288-1310TACCCAAAAACTGTCTTTAAAAGUUUAAAGACAGUUUUUGGGUACCCAAAAACUGUCUUUAAAAGU7.111.522


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906CUCUCCAGAGUGAUCAAGU75.98711189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936924CTCTCCAGAGTGATCAAGTACTTGATCACTCTGGAGAG0.066000.009600.603400.500000.978300.62500


Target Position: 2477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2477UUAAACACUAAAAUAUAUA78.0666966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592495TTAAACACTAAAATATATATATATATTTTAGTGTTTAA0.204000.023700.491400.500001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377AGAUGAUAGAGGAUUUUAU91.6387141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111395AGATGATAGAGGATTTTATATAAAATCCTCTATCATCT0.070000.043300.681000.750001.000001.00000


Target Position: 2936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2936GCAAGAGUGUGGAGGCUGA90.5842182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762954GCAAGAGTGTGGAGGCTGATCAGCCTCCACACTCTTGC0.051400.012900.629300.750001.000001.00000


Target Position: 1447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447AGAAUAGGCAUUAACACAA89.3886221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071465AGAATAGGCATTAACACAATTGTGTTAATGCCTATTCT0.177100.047400.577600.750001.000001.00000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728ACCUCUUCACCUUAUUCAU78.6806915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461746ACCTCTTCACCTTATTCATATGAATAAGGTGAAGAGGT0.689100.017300.698300.750001.000001.00000


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325CGCCCUCGGUGUCCUACUU77.34441038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856343CGCCCTCGGTGTCCTACTTAAGTAGGACACCGAGGGCG0.069100.006500.784501.000001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182UGGAAUGGUUUGGGAAUAU71.06811720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4462200TGGAATGGTTTGGGAATATATATTCCCAAACCATTCCA0.193600.066700.801700.750001.000001.00000


Target Position: 3830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3830AGCUGCCGAACCAAAAGAA81.0418696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623848AGCTGCCGAACCAAAAGAATTCTTTTGGTTCGGCAGCT0.553800.064500.681000.750001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076UUCUUCUUCAUAUUCUAAA73.10751506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562094TTCTTCTTCATATTCTAAATTTAGAATATGAAGAAGAA0.446000.354900.672400.500001.000001.00000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574AGAGGGUUUUAGGUAGAAA89.9642206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281592AGAGGGTTTTAGGTAGAAATTTCTACCTAAAACCCTCT0.208100.007300.724100.750001.000001.00000


Target Position: 2588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2588CACAGAUACACACACACAC76.99691075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882606CACAGATACACACACACACGTGTGTGTGTGTATCTGTG0.984000.547700.500000.500001.000001.00000


Target Position: 3181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181GUACUAGUUUUAGUUUUCU79.9533787

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3179-3201ATGTACTAGTTTTAGTTTTCTCTAGAAAACUAAAACUAGUACAUGUACUAGUUUUAGUUUUCUCUU13.318.832


Target Position: 2537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537GUUCAUAAGGCCAGUAUGA84.9618435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2535-2557ATGTTCATAAGGCCAGTATGATTUCAUACUGGCCUUAUGAACAUGUUCAUAAGGCCAGUAUGAUUU17.98.932


Target Position: 1729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1729CCUCUUCACCUUAUUCAUG72.25131603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321747CCTCTTCACCTTATTCATGCATGAATAAGGTGAAGAGG0.151500.018400.689700.750001.000001.00000


Target Position: 3715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3715UGUACUAGUGUUCUGUUUG66.41532284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163733TGTACTAGTGTTCTGTTTGCAAACAGAACACTAGTACA0.271400.069900.560300.500001.000001.00000


Target Position: 2469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2469GAAGGUUUUUAAACACUAA100.2396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652487GAAGGTTTTTAAACACTAATTAGTGTTTAAAAACCTTC0.079500.015300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2467-2489CGGAAGGTTTTTAAACACTAAAAUUAGUGUUUAAAAACCUUCCGGAAGGUUUUUAAACACUAAAAU19.017.322


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183GAGCAUUUUGAUACCAGAA94.840668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231201GAGCATTTTGATACCAGAATTCTGGTATCAAAATGCTC0.065900.016400.637900.750000.929300.62500


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693GAACACUUCCUCUCCAAAA92.6616115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671711GAACACTTCCTCTCCAAAATTTTGGAGAGGAAGTGTTC0.111200.095800.672400.750001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177UCUCCGGAGCAUUUUGAUA78.0226971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551195TCTCCGGAGCATTTTGATATATCAAAATGCTCCGGAGA0.112900.006500.681000.750001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069GUUUGUGUUCUUCUUCAUA91.6227142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962087GTTTGTGTTCTTCTTCATATATGAAGAAGAACACAAAC0.549600.014000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2067-2089TGGTTTGTGTTCTTCTTCATATTUAUGAAGAAGAACACAAACCAGUUUGUGUUCUUCUUCAUAUUU20.419.322


Target Position: 3524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3524AGCAUCAUAGUAGUUUUUA79.4473838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163542AGCATCATAGTAGTTTTTATAAAAACTACTATGATGCT0.121700.004100.819000.750001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939GAAAUAGUGACAUAAUAUA101.0743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121957GAAATAGTGACATAATATATATATTATGTCACTATTTC0.703500.047200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1937-1959ACGAAATAGTGACATAATATATTUAUAUUAUGUCACUAUUUCGUGAAAUAGUGACAUAAUAUAUUU-8.64.621


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950AUAAUAUAUUCUAUUUUUA92.0545130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101968ATAATATATTCTATTTTTATAAAAATAGAATATATTAT0.146900.128900.508600.500001.000001.00000


Target Position: 1444, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444GUAAGAAUAGGCAUUAACA95.366259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1442-1464TTGTAAGAATAGGCATTAACACAUGUUAAUGCCUAUUCUUACAAGUAAGAAUAGGCAUUAACACAU6.96.923


Target Position: 2195, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195GAAUAUCCAUGUACUUGUU92.2543126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792213GAATATCCATGTACTTGTTAACAAGTACATGGATATTC0.028300.003800.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2193-2215GGGAATATCCATGTACTTGTTTGAACAAGUACAUGGAUAUUCCCGAAUAUCCAUGUACUUGUUUGU19.015.432


Target Position: 1934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1934AAGACGAAAUAGUGACAUA96.287444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431952AAGACGAAATAGTGACATATATGTCACTATTTCGTCTT0.084300.029600.594800.500001.000001.00000


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663UAAAGAUAGAUCCUUUUAU79.0288883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542681TAAAGATAGATCCTTTTATATAAAAGGATCTATCTTTA0.059900.004800.491400.500000.945700.62500


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327CCCUCGGUGUCCUACUUCA87.5304296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847345CCCTCGGTGTCCTACTTCATGAAGTAGGACACCGAGGG0.123800.006700.767200.750001.000001.00000


Target Position: 2892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892UGUAAUUCUUGUAAUUUUU76.47751133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612910TGTAATTCTTGTAATTTTTAAAAATTACAAGAATTACA0.115000.061800.706900.750001.000001.00000


Target Position: 2339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339CUUUCCUUUUCUUUAAAGA80.0188782

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2337-2359TCCTTTCCTTTTCTTTAAAGAAGUCUUUAAAGAAAAGGAAAGGACUUUCCUUUUCUUUAAAGAAGU-3.818.721


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639UCUAGGCAUCUCUGUACUU74.74621309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9231657TCTAGGCATCTCTGTACTTAAGTACAGAGATGCCTAGA0.258400.004000.586200.750001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068GGUUUGUGUUCUUCUUCAU90.5833183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672086GGTTTGTGTTCTTCTTCATATGAAGAAGAACACAAACC0.550700.010300.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2066-2088TTGGTTTGTGTTCTTCTTCATATAUGAAGAAGAACACAAACCAAGGUUUGUGUUCUUCUUCAUAUU20.419.322


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550UCAGCAAACCAUUUUUAAA84.4902468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591568TCAGCAAACCATTTTTAAATTTAAAAATGGTTTGCTGA0.056300.049800.724100.750001.000001.00000


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832CCCCUGCCCCUUCCUUUAA72.24371604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692850CCCCTGCCCCTTCCTTTAATTAAAGGAAGGGGCAGGGG0.814500.362600.956901.000001.000001.00000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898ACCUGUCCCACUCCUACGA69.70441869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201916ACCTGTCCCACTCCTACGATCGTAGGAGTGGGACAGGT0.130300.010200.560300.500000.983700.62500


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083UCAUAUUCUAAAACCAUUC60.6852904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682101TCATATTCTAAAACCATTCGAATGGTTTTAGAATATGA0.708200.387700.551700.500001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CCCCUGACAGUCCCUCCUC58.86823107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401178CCCCTGACAGTCCCTCCTCGAGGAGGGACTGTCAGGGG0.035500.016900.681000.750001.000001.00000


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658GGAUGAUUGGAAUAGCUUC81.5431657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9743676GGATGATTGGAATAGCTTCGAAGCTATTCCAATCATCC0.029100.009500.698300.750001.000001.00000


Target Position: 3061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3061GCUACCGUUGACUUCCAGG62.5842708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873079GCTACCGTTGACTTCCAGGCCTGGAAGTCAACGGTAGC0.027300.011800.508600.500000.918500.62500


Target Position: 3832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3832CUGCCGAACCAAAAGAAUU77.06991068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5143850CTGCCGAACCAAAAGAATTAATTCTTTTGGTTCGGCAG0.497200.237500.775900.750001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938CGAAAUAGUGACAUAAUAU97.329926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381956CGAAATAGTGACATAATATATATTATGTCACTATTTCG0.652100.044900.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1936-1958GACGAAATAGTGACATAATATATAUAUUAUGUCACUAUUUCGUCCGAAAUAGUGACAUAAUAUAUU0.06.932


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541AUAAGGCCAGUAUGAUUUA82.2575608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062559ATAAGGCCAGTATGATTTATAAATCATACTGGCCTTAT0.098700.008800.508600.500001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628GCCUUUGAUGUUACAGAUU79.5915824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072646GCCTTTGATGTTACAGATTAATCTGTAACATCAAAGGC0.217200.051300.991401.000001.000001.00000


Target Position: 1935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1935AGACGAAAUAGUGACAUAA93.178796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061953AGACGAAATAGTGACATAATTATGTCACTATTTCGTCT0.448400.031100.689700.750001.000001.00000


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109GUGUAUCUCUUUCACAUUG75.88941200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013127GTGTATCTCTTTCACATTGCAATGTGAAAGAGATACAC0.072800.028300.646600.500001.000001.00000


Target Position: 4060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4060UCCUGGAUGUUGUGUGUAU78.156953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9284078TCCTGGATGTTGTGTGTATATACACACAACATCCAGGA0.071100.003800.827600.750001.000001.00000


Target Position: 3778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3778CCAAAUCUCAAUGAAGCCA76.81071104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073796CCAAATCTCAATGAAGCCATGGCTTCATTGAGATTTGG0.043000.012200.500000.750001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GAAGACGAAAUAGUGACAU78.1071960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341951GAAGACGAAATAGTGACATATGTCACTATTTCGTCTTC0.061700.028400.517200.750001.000001.00000


Target Position: 328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328CCUCGGUGUCCUACUUCAA90.0901199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848346CCTCGGTGTCCTACTTCAATTGAAGTAGGACACCGAGG0.123300.006700.698301.000001.000001.00000


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306CACAAUACCUCAUGCUUCA91.0713166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363324CACAATACCTCATGCTTCATGAAGCATGAGGTATTGTG0.078000.007100.569000.500000.983700.62500


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304GGUUUGCAUUCUCACAUUG78.1503955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512322GGTTTGCATTCTCACATTGCAATGTGAGAATGCAAACC0.147400.006600.706900.750001.000001.00000


Target Position: 4256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256AUGAAAGUCUAGAAAUAAA92.8156108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5714274ATGAAAGTCTAGAAATAAATTTATTTCTAGACTTTCAT0.795200.070800.655200.500001.000001.00000


Target Position: 4241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4241GACAAAAAGACAAACAUGA88.0343277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4239-4261AAGACAAAAAGACAAACATGAAAUCAUGUUUGUCUUUUUGUCUUGACAAAAAGACAAACAUGAAAU12.15.622


Target Position: 2616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616CACAAACCUUCUGCCUUUG65.62062386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432634CACAAACCTTCTGCCTTTGCAAAGGCAGAAGGTTTGTG0.049800.042700.646600.500000.951100.62500


Target Position: 2595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595ACACACACACACACACACA88.4625259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542613ACACACACACACACACACATGTGTGTGTGTGTGTGTGT0.961400.951600.500000.500001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109AAGCACUUUCAGUCCAAUA85.3983419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122127AAGCACTTTCAGTCCAATATATTGGACTGAAAGTGCTT0.107800.032100.594800.500000.945700.87500


Target Position: 3672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3672GCUUCUGGAAUUUGUUCAA88.268266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9423690GCTTCTGGAATTTGTTCAATTGAACAAATTCCAGAAGC0.160500.003700.706901.000001.000001.00000


Target Position: 3233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3233AGUUUUUUUUUUUUUUAUG66.00852332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923251AGTTTTTTTTTTTTTTATGCATAAAAAAAAAAAAAACT0.302500.294200.551700.500001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CCCCUUCCAUCUCUGACUU74.33311350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741270CCCCTTCCATCTCTGACTTAAGTCAGAGATGGAAGGGG0.449900.479600.853401.000001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517AAGCAUAAAAACAUUUUAA87.953282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081535AAGCATAAAAACATTTTAATTAAAATGTTTTTATGCTT0.509000.124200.603400.500001.000001.00000


Target Position: 1576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1576AGGGUUUUAGGUAGAAAAA83.6048515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471594AGGGTTTTAGGTAGAAAAATTTTTCTACCTAAAACCCT0.207200.017300.844800.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CACUCCUACGAUACGCUAC70.65371756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941924CACTCCTACGATACGCTACGTAGCGTATCGTAGGAGTG0.296600.026900.612100.500001.000001.00000


Target Position: 3733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3733GUUAUUGUUUUGUUAAUUA93.0249101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563751GTTATTGTTTTGTTAATTATAATTAACAAAACAATAAC0.057200.019600.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3731-3753TTGTTATTGTTTTGTTAATTACAUAAUUAACAAAACAAUAACAAGUUAUUGUUUUGUUAAUUACAU-0.36.922


Target Position: 3675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675UCUGGAAUUUGUUCAAGUU77.7965995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903693TCTGGAATTTGTTCAAGTTAACTTGAACAAATTCCAGA0.130500.009100.577600.750001.000001.00000


Target Position: 3719, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3719CUAGUGUUCUGUUUGUUAU86.3758355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023737CTAGTGTTCTGTTTGTTATATAACAAACAGAACACTAG0.227000.131800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3717-3739TACTAGTGTTCTGTTTGTTATTGAUAACAAACAGAACACUAGUACUAGUGUUCUGUUUGUUAUUGU7.219.032


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273GCAAAAGAAAAAGAUUACC61.63132811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981291GCAAAAGAAAAAGATTACCGGTAATCTTTTTCTTTTGC0.576300.200900.500000.500001.000001.00000


Target Position: 2641, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2641CAGAUUUAAUACAGUUUAU91.4569147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172659CAGATTTAATACAGTTTATATAAACTGTATTAAATCTG0.093400.037400.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2639-2661TACAGATTTAATACAGTTTATTTAUAAACUGUAUUAAAUCUGUACAGAUUUAAUACAGUUUAUUUU11.86.920


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481ACACUAAAAUAUAUAAUUU89.1541230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732499ACACTAAAATATATAATTTAAATTATATATTTTAGTGT0.138700.049700.706900.750001.000001.00000


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110UGUAUCUCUUUCACAUUGU69.64341877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473128TGTATCTCTTTCACATTGTACAATGTGAAAGAGATACA0.076800.030700.500000.500001.000001.00000


Target Position: 3717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3717UACUAGUGUUCUGUUUGUU73.58351449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8353735TACTAGTGTTCTGTTTGTTAACAAACAGAACACTAGTA0.237400.099100.534500.500001.000001.00000


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GGUUGUUUUUUCCUUUGCU81.691649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271246GGTTGTTTTTTCCTTTGCTAGCAAAGGAAAAAACAACC0.109000.086300.500000.750001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507GUUUAAAAAAAAGCAUAAA84.4694471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981525GTTTAAAAAAAAGCATAAATTTATGCTTTTTTTTAAAC0.234900.068100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1505-1527GTGTTTAAAAAAAAGCATAAAAAUUUAUGCUUUUUUUUAAACACGUUUAAAAAAAAGCAUAAAAAU19.7-9.121


Target Position: 1180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180CCGGAGCAUUUUGAUACCA78.5639925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521198CCGGAGCATTTTGATACCATGGTATCAAAATGCTCCGG0.160000.010700.569000.750000.929300.62500


Target Position: 3688, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3688CAAGUUUUGGGUAUGUUUA88.9023245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853706CAAGTTTTGGGTATGTTTATAAACATACCCAAAACTTG0.065800.002300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3686-3708TTCAAGTTTTGGGTATGTTTAATUAAACAUACCCAAAACUUGAACAAGUUUUGGGUAUGUUUAAUU6.93.222


Target Position: 3947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3947CCCUCCAGAACACGGCUCA73.26981489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123965CCCTCCAGAACACGGCTCATGAGCCGTGTTCTGGAGGG0.042300.023600.767200.750000.929300.62500


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332AGUAUUUGCAUAACCCUGA77.8249992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951350AGTATTTGCATAACCCTGATCAGGGTTATGCAAATACT0.045000.027000.482800.500001.000001.00000


Target Position: 1946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1946UGACAUAAUAUAUUCUAUU83.0257556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311964TGACATAATATATTCTATTAATAGAATATATTATGTCA0.226400.143700.715500.750001.000001.00000


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432GGUGGUUUUUAAGGGUUAU81.4215666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992450GGTGGTTTTTAAGGGTTATATAACCCTTAAAAACCACC0.065900.004700.810301.000001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908CUCCAGAGUGAUCAAGUGU75.35581253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863926CTCCAGAGTGATCAAGTGTACACTTGATCACTCTGGAG0.101100.014300.603400.500001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220CAGGACUUUGAGGCAAGUG64.45692508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862238CAGGACTTTGAGGCAAGTGCACTTGCCTCAAAGTCCTG0.027600.005900.491400.500000.923900.62500


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681ACUUUAUAAGUCAUUGUAU84.2932482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381699ACTTTATAAGTCATTGTATATACAATGACTTATAAAGT0.150100.055200.663800.750001.000001.00000


Target Position: 4254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4254ACAUGAAAGUCUAGAAAUA96.242348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6704272ACATGAAAGTCTAGAAATATATTTCTAGACTTTCATGT0.128400.015400.663800.750001.000001.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217UCCUUGUUGUUGGUUGUUU63.63132596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151235TCCTTGTTGTTGGTTGTTTAAACAACCAACAACAAGGA0.162700.053200.870700.750000.978300.75000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243UGCUCUUUCCCCCUUCCAU69.00581963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271261TGCTCTTTCCCCCTTCCATATGGAAGGGGGAAAGAGCA0.791600.243300.698300.750001.000001.00000


Target Position: 3467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467GUCCCUCUUCUCUUCCCUG68.69662009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973485GTCCCTCTTCTCTTCCCTGCAGGGAAGAGAAGAGGGAC0.229800.155500.534500.500001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806CUGUGACCACCACCCCAAC66.70422237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451824CTGTGACCACCACCCCAACGTTGGGGTGGTGGTCACAG0.282300.146100.637900.500000.918500.75000


Target Position: 1530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530UUUUAAAAACAUAGAAAAA80.5116740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921548TTTTAAAAACATAGAAAAATTTTTCTATGTTTTTAAAA0.556600.379100.500000.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573CCCUUGAUUUAAACACACA89.0998235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742591CCCTTGATTTAAACACACATGTGTGTTTAAATCAAGGG0.605800.186700.784500.750001.000001.00000


Target Position: 2600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2600CACACACACACACACACAC76.2791156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092618CACACACACACACACACACGTGTGTGTGTGTGTGTGTG0.841700.841900.500000.500001.000001.00000


Target Position: 2683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683GGUGAGAAAAAAACAAUCU82.4627595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5012701GGTGAGAAAAAAACAATCTAGATTGTTTTTTTCTCACC0.180000.077200.629300.750001.000001.00000


Target Position: 3299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3299GCUGUUUCACAAUACCUCA91.0085170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7353317GCTGTTTCACAATACCTCATGAGGTATTGTGAAACAGC0.087600.023100.629300.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583GCAUCUACACCGACAACUC79.2076864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774601GCATCTACACCGACAACTCGAGTTGTCGGTGTAGATGC0.078300.027800.543100.750000.945700.75000


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226UUUUUGUAGUUUUUUUUUU63.7772581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503244TTTTTGTAGTTTTTTTTTTAAAAAAAAAACTACAAAAA0.870100.159000.500000.500001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910CCAGAGUGAUCAAGUGUGA89.0025241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687928CCAGAGTGATCAAGTGTGATCACACTTGATCACTCTGG0.105300.014800.620700.750001.000001.00000


Target Position: 2544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544AGGCCAGUAUGAUUUAUAA98.485917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452562AGGCCAGTATGATTTATAATTATAAATCATACTGGCCT0.273700.011000.810300.750001.000001.00000


Target Position: 3938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3938CCGCCCCACCCCUCCAGAA73.52931456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1633956CCGCCCCACCCCTCCAGAATTCTGGAGGGGTGGGGCGG0.690400.215400.741401.000001.000001.00000


Target Position: 3941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3941CCCCACCCCUCCAGAACAC58.44893155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2813959CCCCACCCCTCCAGAACACGTGTTCTGGAGGGGTGGGG0.619400.556200.698300.750001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260AUCUCUGACUUAAGCAAAA84.7926448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6761278ATCTCTGACTTAAGCAAAATTTTGCTTAAGTCAGAGAT0.133200.031500.681000.500001.000001.00000


Target Position: 3657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657GGGAUGAUUGGAAUAGCUU84.4896469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503675GGGATGATTGGAATAGCTTAAGCTATTCCAATCATCCC0.058500.010400.853401.000001.000001.00000


Target Position: 3833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3833UGCCGAACCAAAAGAAUUU69.48741901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1683851TGCCGAACCAAAAGAATTTAAATTCTTTTGGTTCGGCA0.463400.245800.853400.750001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577UGAUUUAAACACACAGAUA91.4323150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852595TGATTTAAACACACAGATATATCTGTGTGTTTAAATCA0.572600.370200.681000.750001.000001.00000


Target Position: 2629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629CCUUUGAUGUUACAGAUUU83.0068560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102647CCTTTGATGTTACAGATTTAAATCTGTAACATCAAAGG0.251700.050500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2627-2649TGCCTTTGATGTTACAGATTTAAAAAUCUGUAACAUCAAAGGCACCUUUGAUGUUACAGAUUUAAU19.212.032


Target Position: 1504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504CGUGUUUAAAAAAAAGCAU78.8381904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231522CGTGTTTAAAAAAAAGCATATGCTTTTTTTTAAACACG0.209600.019300.620701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1502-1524TACGTGTTTAAAAAAAAGCATAAAUGCUUUUUUUUAAACACGUACGUGUUUAAAAAAAAGCAUAAU18.614.721


Target Position: 3967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3967GCUUACCUCAACCAUCCUG66.7522229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243985GCTTACCTCAACCATCCTGCAGGATGGTTGAGGTAAGC0.039100.029000.569000.750001.000001.00000


Target Position: 3288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288CCAAAAAGGUUGCUGUUUC69.58761881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6893306CCAAAAAGGTTGCTGTTTCGAAACAGCAACCTTTTTGG0.104100.021700.672400.750000.989100.75000


Target Position: 3581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3581AUAAUUAUUAUUAUUAUUA91.2192159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033599ATAATTATTATTATTATTATAATAATAATAATAATTAT0.453900.353900.508600.500001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951UAAUAUAUUCUAUUUUUAU86.231365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531969TAATATATTCTATTTTTATATAAAAATAGAATATATTA0.142900.123300.491400.500001.000001.00000


Target Position: 3671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3671AGCUUCUGGAAUUUGUUCA75.86851206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9133689AGCTTCTGGAATTTGTTCATGAACAAATTCCAGAAGCT0.083700.004100.629300.500001.000001.00000


Target Position: 1498, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498CCUUUACGUGUUUAAAAAA90.2665193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791516CCTTTACGTGTTTAAAAAATTTTTTAAACACGTAAAGG0.131000.005500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1496-1518ATCCTTTACGTGTTTAAAAAAAAUUUUUUAAACACGUAAAGGAUCCUUUACGUGUUUAAAAAAAAU-9.112.032


Target Position: 1266, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266GACUUAAGCAAAAGAAAAA94.361577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771284GACTTAAGCAAAAGAAAAATTTTTCTTTTGCTTAAGTC0.237000.088800.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1264-1286CTGACTTAAGCAAAAGAAAAAGAUUUUUCUUUUGCUUAAGUCAGGACUUAAGCAAAAGAAAAAGAU5.59.821


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934UGGCAAGAGUGUGGAGGCU65.10522438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692952TGGCAAGAGTGTGGAGGCTAGCCTCCACACTCTTGCCA0.044100.005500.491400.500001.000001.00000


Target Position: 2289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289AGUCAAGAAGAAAAAGGUU79.963786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632307AGTCAAGAAGAAAAAGGTTAACCTTTTTCTTCTTGACT0.113500.021400.560300.750001.000001.00000


Target Position: 3280, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280GCUCUAUUCCAAAAAGGUU83.2703542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6323298GCTCTATTCCAAAAAGGTTAACCTTTTTGGAATAGAGC0.122300.121700.706901.000000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3278-3300CTGCTCTATTCCAAAAAGGTTGCAACCUUUUUGGAAUAGAGCAGGCUCUAUUCCAAAAAGGUUGCU17.311.612


Target Position: 2349, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349CUUUAAAGAAGUUGAAGUU81.3728670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782367CTTTAAAGAAGTTGAAGTTAACTTCAACTTCTTTAAAG0.068100.011500.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2347-2369TTCTTTAAAGAAGTTGAAGTTTAAACUUCAACUUCUUUAAAGAACUUUAAAGAAGUUGAAGUUUAU19.2-3.822


Target Position: 2775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2775AUGGGUGCAAGGAAAAUUA79.5935823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722793ATGGGTGCAAGGAAAATTATAATTTTCCTTGCACCCAT0.158300.005800.620700.500001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426UGUACUUGUUUCUCUGUUG69.93921832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251444TGTACTTGTTTCTCTGTTGCAACAGAGAAACAAGTACA0.065800.031300.560300.500001.000001.00000


Target Position: 2893, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2893GUAAUUCUUGUAAUUUUUA88.1012272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402911GTAATTCTTGTAATTTTTATAAAAATTACAAGAATTAC0.119900.052400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2891-2913ATGTAATTCTTGTAATTTTTATTUAAAAAUUACAAGAAUUACAUGUAAUUCUUGUAAUUUUUAUUU-12.06.910


Target Position: 1532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1532UUAAAAACAUAGAAAAAUU76.70241114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521550TTAAAAACATAGAAAAATTAATTTTTCTATGTTTTTAA0.560200.375500.525900.500001.000001.00000


Target Position: 3293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293AAGGUUGCUGUUUCACAAU75.3651251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003311AAGGTTGCTGTTTCACAATATTGTGAAACAGCAACCTT0.202900.021500.629300.500000.940200.62500


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813CACCACCCCAACAAACCAU74.66331315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761831CACCACCCCAACAAACCATATGGTTTGTTGGGGTGGTG0.338800.190800.637900.750001.000001.00000


Target Position: 2889, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889CUAUGUAAUUCUUGUAAUU89.5161216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522907CTATGTAATTCTTGTAATTAATTACAAGAATTACATAG0.143800.075300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2887-2909GGCTATGTAATTCTTGTAATTTTAAUUACAAGAAUUACAUAGCCCUAUGUAAUUCUUGUAAUUUUU6.98.522


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GGAGGAAGAGGAGGAGGAG73.77281422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011046GGAGGAAGAGGAGGAGGAGCTCCTCCTCCTCTTCCTCC0.100300.072900.560300.750001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169GGCAGUUUUCUAAUGGAAU84.2267488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182187GGCAGTTTTCTAATGGAATATTCCATTAGAAAACTGCC0.096900.004100.991401.000001.000001.00000


Target Position: 2648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648AAUACAGUUUAUUUUUAAA93.419590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912666AATACAGTTTATTTTTAAATTTAAAAATAAACTGTATT0.047400.025600.508600.500001.000001.00000


Target Position: 4231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4231UCCAGCAGAAGACAAAAAG56.59093319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9444249TCCAGCAGAAGACAAAAAGCTTTTTGTCTTCTGCTGGA0.273400.203500.732800.500001.000001.00000


Target Position: 3677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3677UGGAAUUUGUUCAAGUUUU72.85591538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913695TGGAATTTGTTCAAGTTTTAAAACTTGAACAAATTCCA0.133000.023700.844800.750001.000001.00000


Target Position: 2833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833CCCUGCCCCUUCCUUUAAA78.2821945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572851CCCTGCCCCTTCCTTTAAATTTAAAGGAAGGGGCAGGG0.866600.377400.991401.000001.000001.00000


Target Position: 2942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942GUGUGGAGGCUGACGUGUG74.86741298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062960GTGTGGAGGCTGACGTGTGCACACGTCAGCCTCCACAC0.056000.006600.500000.500001.000001.00000


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479GCUGGAGCCCGUGAAAAAG68.08992082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
880497GCTGGAGCCCGTGAAAAAGCTTTTTCACGGGCTCCAGC0.153900.005500.715500.750001.000001.00000


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058GCUGCUACCGUUGACUUCC61.19922854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913076GCTGCTACCGTTGACTTCCGGAAGTCAACGGTAGCAGC0.072300.003700.482800.500001.000001.00000


Target Position: 2565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565GCAAUCUCCCCUUGAUUUA83.5529520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2563-2585ATGCAATCTCCCCTTGATTTAAAUAAAUCAAGGGGAGAUUGCAUGCAAUCUCCCCUUGAUUUAAAU7.420.433


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285UGCCAGUCAAGAAGAAAAA78.0972962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992303TGCCAGTCAAGAAGAAAAATTTTTCTTCTTGACTGGCA0.390500.013700.853400.750001.000001.00000


Target Position: 3725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725UUCUGUUUGUUAUUGUUUU69.01471961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223743TTCTGTTTGTTATTGTTTTAAAACAATAACAAACAGAA0.118400.081400.672400.500001.000001.00000


Target Position: 3175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175UGCCAUGUACUAGUUUUAG62.65762700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033193TGCCATGTACTAGTTTTAGCTAAAACTAGTACATGGCA0.072200.016300.681000.500001.000001.00000


Target Position: 2949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2949GGCUGACGUGUGAGGGAGG67.70522136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222967GGCTGACGTGTGAGGGAGGCCTCCCTCACACGTCAGCC0.425700.004000.655200.500001.000001.00000


Target Position: 1823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823ACAAACCAUCCAGUGACAA76.23881161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211841ACAAACCATCCAGTGACAATTGTCACTGGATGGTTTGT0.040500.044800.560300.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UCUACACCGACAACUCCAU70.10921808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627604TCTACACCGACAACTCCATATGGAGTTGTCGGTGTAGA0.344600.030300.569000.750000.951100.62500


Target Position: 2602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2602CACACACACACACACACAA95.385958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272620CACACACACACACACACAATTGTGTGTGTGTGTGTGTG0.806300.806800.646600.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181AUGGAAUGGUUUGGGAAUA74.24321359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272199ATGGAATGGTTTGGGAATATATTCCCAAACCATTCCAT0.208900.051300.612100.500001.000001.00000


Target Position: 2173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173GUUUUCUAAUGGAAUGGUU79.489834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562191GTTTTCTAATGGAATGGTTAACCATTCCATTAGAAAAC0.101900.021300.500000.750001.000001.00000


Target Position: 1359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359GGAGGAGGGUUGUGCUACA96.219649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681377GGAGGAGGGTTGTGCTACATGTAGCACAACCCTCCTCC0.049900.002700.663800.750001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255GCGUACCCCGAUGCCAACC49.11993868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884273GCGTACCCCGATGCCAACCGGTTGGCATCGGGGTACGC0.311000.032100.569000.500001.000001.00000


Target Position: 3828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828CAAGCUGCCGAACCAAAAG68.29912060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253846CAAGCTGCCGAACCAAAAGCTTTTGGTTCGGCAGCTTG0.545700.030700.508600.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675ACCCCGCACGAUUUCAUUG59.57383026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
837693ACCCCGCACGATTTCATTGCAATGAAATCGTGCGGGGT0.189200.085800.706900.500001.000001.00000


Target Position: 4222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4222CGGCAUGUUUCCAGCAGAA92.8519105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244240CGGCATGTTTCCAGCAGAATTCTGCTGGAAACATGCCG0.421400.004000.741401.000000.918500.75000


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286GCCAGUCAAGAAGAAAAAG68.66122013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602304GCCAGTCAAGAAGAAAAAGCTTTTTCTTCTTGACTGGC0.159000.016300.862100.750001.000001.00000


Target Position: 3256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256CAAUUUUGACUUAAUGUGA88.9503244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3254-3276ATCAATTTTGACTTAATGTGATTUCACAUUAAGUCAAAAUUGAUCAAUUUUGACUUAAUGUGAUUU13.5-3.323


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GGAGGAUCAGUUUUUUGUU87.6598291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273158GGAGGATCAGTTTTTTGTTAACAAAAAACTGATCCTCC0.306700.003900.724101.000001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228UUUGUAGUUUUUUUUUUUU65.1682430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723246TTTGTAGTTTTTTTTTTTTAAAAAAAAAAAACTACAAA0.893900.181800.500000.500001.000001.00000


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610CACACACACAAACCUUCUG70.82591743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022628CACACACACAAACCTTCTGCAGAAGGTTTGTGTGTGTG0.173000.137100.508600.500001.000001.00000


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904CCCACUCCUACGAUACGCU73.75121426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611922CCCACTCCTACGATACGCTAGCGTATCGTAGGAGTGGG0.141800.027000.637900.750001.000001.00000


Target Position: 4279, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279GUAAAACCCCAAAAAAAAA87.0122321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2894297GTAAAACCCCAAAAAAAAATTTTTTTTTGGGGTTTTAC0.995900.365400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4277-4299TGGTAAAACCCCAAAAAAAAAAAUUUUUUUUUGGGGUUUUACCAGUAAAACCCCAAAAAAAAAAAU-11.314.020


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330UCGGUGUCCUACUUCAAAU76.14371170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839348TCGGTGTCCTACTTCAAATATTTGAAGTAGGACACCGA0.131800.007000.784500.750001.000001.00000


Target Position: 4267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4267GAAAUAAAACUGGUAAAAC76.10431180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924285GAAATAAAACTGGTAAAACGTTTTACCAGTTTTATTTC0.142500.131900.525900.500001.000001.00000


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527UGCAGAGGAUGUUCAUAAG73.81651409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932545TGCAGAGGATGTTCATAAGCTTATGAACATCCTCTGCA0.026300.015100.715500.500001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168CAUAUACUGCCAUGUACUA96.496143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9943186CATATACTGCCATGTACTATAGTACATGGCAGTATATG0.115500.054200.482800.750000.918500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3166-3188GTCATATACTGCCATGTACTAGTUAGUACAUGGCAGUAUAUGACCAUAUACUGCCAUGUACUAGUU19.06.122


Target Position: 1218, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218CCUUGUUGUUGGUUGUUUU85.6721400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841236CCTTGTTGTTGGTTGTTTTAAAACAACCAACAACAAGG0.178900.063500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1216-1238CTCCTTGTTGTTGGTTGTTTTTTAAAACAACCAACAACAAGGAGCCUUGUUGUUGGUUGUUUUUUU13.316.722


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337CCUACUUCAAAUGUGUGCA78.7313912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984355CCTACTTCAAATGTGTGCATGCACACATTTGAAGTAGG0.268500.010600.491400.750001.000001.00000


Target Position: 2839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2839CCCUUCCUUUAAAAAACUU73.78891416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482857CCCTTCCTTTAAAAAACTTAAGTTTTTTAAAGGAAGGG0.822700.691400.853401.000001.000001.00000


Target Position: 3525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3525GCAUCAUAGUAGUUUUUAC87.0806317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173543GCATCATAGTAGTTTTTACGTAAAAACTACTATGATGC0.106700.004100.672400.750001.000001.00000


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156UGCUCCCCUGACAGUCCCU60.86482880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301174TGCTCCCCTGACAGTCCCTAGGGACTGTCAGGGGAGCA0.105900.003800.508600.500001.000001.00000


Target Position: 2691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2691AAAAACAAUCUGGAAGAAA80.1436771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662709AAAAACAATCTGGAAGAAATTTCTTCCAGATTGTTTTT0.177200.105300.500000.500001.000001.00000


Target Position: 2857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2857UAGUGACAAAAUAGACAAU80.884709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5882875TAGTGACAAAATAGACAATATTGTCTATTTTGTCACTA0.133200.045300.663800.500001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724AGGAGAACAAACAGAUCAU85.3995418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518742AGGAGAACAAACAGATCATATGATCTGTTTGTTCTCCT0.363100.029700.689700.750001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679CGCACGAUUUCAUUGAACA91.2365158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373697CGCACGATTTCATTGAACATGTTCAATGAAATCGTGCG0.241700.147500.715500.750001.000001.00000


Target Position: 4276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4276CUGGUAAAACCCCAAAAAA85.884388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4274-4296AACTGGTAAAACCCCAAAAAAAAUUUUUUGGGGUUUUACCAGUUCUGGUAAAACCCCAAAAAAAAU11.520.021


Target Position: 3578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578UGCAUAAUUAUUAUUAUUA85.73397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973596TGCATAATTATTATTATTATAATAATAATAATTATGCA0.437900.032400.819000.750001.000001.00000


Target Position: 3575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3575AGUUGCAUAAUUAUUAUUA88.8151250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713593AGTTGCATAATTATTATTATAATAATAATTATGCAACT0.499200.010100.672400.750001.000001.00000


Target Position: 2794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2794GGGUACUCAACCUAAGUUC71.86131638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372812GGGTACTCAACCTAAGTTCGAACTTAGGTTGAGTACCC0.086500.012400.819000.750000.907600.62500


Target Position: 3583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3583AAUUAUUAUUAUUAUUAUU92.9923103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693601AATTATTATTATTATTATTAATAATAATAATAATAATT0.414700.298000.500000.500001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209CUUCAUUCUCCUUGUUGUU76.82041102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721227CTTCATTCTCCTTGTTGTTAACAACAAGGAGAATGAAG0.274600.028300.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1207-1229AGCTTCATTCTCCTTGTTGTTGGAACAACAAGGAGAAUGAAGCUCUUCAUUCUCCUUGUUGUUGGU19.316.322


Target Position: 3709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3709CUGUUAUGUACUAGUGUUC70.35921784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6803727CTGTTATGTACTAGTGTTCGAACACTAGTACATAACAG0.203800.102000.612100.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CUUGUUGUUGGUUGUUUUU72.3121598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591237CTTGTTGTTGGTTGTTTTTAAAAACAACCAACAACAAG0.350300.075300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1217-1239TCCTTGTTGTTGGTTGTTTTTTCAAAAACAACCAACAACAAGGACUUGUUGUUGGUUGUUUUUUCU5.619.321


Target Position: 3676, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676CUGGAAUUUGUUCAAGUUU75.20611267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6803694CTGGAATTTGTTCAAGTTTAAACTTGAACAAATTCCAG0.133500.014800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3674-3696TTCTGGAATTTGTTCAAGTTTTGAAACUUGAACAAAUUCCAGAACUGGAAUUUGUUCAAGUUUUGU19.220.122


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274AUUACUGCUCUAUUCCAAA84.5616457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133292ATTACTGCTCTATTCCAAATTTGGAATAGAGCAGTAAT0.589600.045100.508600.500001.000001.00000


Target Position: 3831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3831GCUGCCGAACCAAAAGAAU76.18531166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3773849GCTGCCGAACCAAAAGAATATTCTTTTGGTTCGGCAGC0.501000.058900.844801.000001.000001.00000


Target Position: 2355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355AGAAGUUGAAGUUUAGGAA89.8203210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772373AGAAGTTGAAGTTTAGGAATTCCTAAACTTCAACTTCT0.142900.023300.551700.750001.000001.00000


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950GCUGACGUGUGAGGGAGGA73.9431397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932968GCTGACGTGTGAGGGAGGATCCTCCCTCACACGTCAGC0.485500.010700.482800.750001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262CCGAUGCCAACCUCCUCAA80.3852749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
219280CCGATGCCAACCTCCTCAATTGAGGAGGTTGGCATCGG0.381600.241600.767201.000001.000001.00000


Target Position: 670, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670CAAUGACCCCGCACGAUUU84.3162479

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_867019CAATGACCCCGCACGATTT1/1/0/094.96CCND1NM_053056.21NANANA11:69458646..69458664(+)00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500688CAATGACCCCGCACGATTTAAATCGTGCGGGGTCATTG0.167000.045400.646600.750000.994600.75000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037GCUCACGUCCAGGUUCAAC66.46762274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482055GCTCACGTCCAGGTTCAACGTTGAACCTGGACGTGAGC0.034400.014300.706900.750000.983700.62500


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GAAAAAGAUUACCCAAAAA96.866737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621297GAAAAAGATTACCCAAAAATTTTTGGGTAATCTTTTTC0.961900.528200.672400.750001.000001.00000


Target Position: 2896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896AUUCUUGUAAUUUUUAUUU69.49881899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982914ATTCTTGTAATTTTTATTTAAATAAAAATTACAAGAAT0.045700.023000.508600.500001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633UGAUGUUACAGAUUUAAUA91.0268169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3282651TGATGTTACAGATTTAATATATTAAATCTGTAACATCA0.301200.079000.681000.750001.000001.00000


Target Position: 3057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057CGCUGCUACCGUUGACUUC69.48481902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693075CGCTGCTACCGTTGACTTCGAAGTCAACGGTAGCAGCG0.112200.002700.750000.750001.000001.00000


Target Position: 4237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4237AGAAGACAAAAAGACAAAC67.00822203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7334255AGAAGACAAAAAGACAAACGTTTGTCTTTTTGTCTTCT0.232600.048000.577600.500001.000001.00000


Target Position: 3225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225UUUUUUGUAGUUUUUUUUU60.98132873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773243TTTTTTGTAGTTTTTTTTTAAAAAAAAACTACAAAAAA0.856700.146800.500000.500001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831UCCCCUGCCCCUUCCUUUA65.56692394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1392849TCCCCTGCCCCTTCCTTTATAAAGGAAGGGGCAGGGGA0.787500.349000.836200.750001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890UAUGUAAUUCUUGUAAUUU75.14151272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932908TATGTAATTCTTGTAATTTAAATTACAAGAATTACATA0.134900.069100.543100.500001.000001.00000


Target Position: 3720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3720UAGUGUUCUGUUUGUUAUU74.62381320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963738TAGTGTTCTGTTTGTTATTAATAACAAACAGAACACTA0.217300.133000.663800.500001.000001.00000


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652GUACUUUGCUUGCUCAUAU88.24268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431670GTACTTTGCTTGCTCATATATATGAGCAAGCAAAGTAC0.041500.003600.637900.750001.000001.00000


Target Position: 2507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507AGGCUAAAAAGUAUAUUUA91.8728137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302525AGGCTAAAAAGTATATTTATAAATATACTTTTTAGCCT0.154900.028300.810300.750001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403UAAUCAACUCGUUUUUAUA90.8327173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801421TAATCAACTCGTTTTTATATATAAAAACGAGTTGATTA0.448400.236600.491400.500001.000001.00000


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283CGUGCCAGUCAAGAAGAAA88.861247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362301CGTGCCAGTCAAGAAGAAATTTCTTCTTGACTGGCACG0.386100.027600.775901.000001.000001.00000


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174CUGCCAUGUACUAGUUUUA88.9631243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7213192CTGCCATGTACTAGTTTTATAAAACTAGTACATGGCAG0.091800.021300.750000.750001.000001.00000


Target Position: 3088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3088GGAAAUAUUCACAUCGCUU89.5171215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513106GGAAATATTCACATCGCTTAAGCGATGTGAATATTTCC0.143900.032300.732801.000001.000001.00000


Target Position: 3750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3750UACACCAUAAUGCUAAUUU69.36661921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613768TACACCATAATGCTAATTTAAATTAGCATTATGGTGTA0.077400.039200.681000.500000.940200.62500


Target Position: 2297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2297AGAAAAAGGUUUGCAUUCU73.38961471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852315AGAAAAAGGTTTGCATTCTAGAATGCAAACCTTTTTCT0.027700.004400.500000.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634GGGGUUCUAGGCAUCUCUG74.04191382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971652GGGGTTCTAGGCATCTCTGCAGAGATGCCTAGAACCCC0.025600.003600.706900.750001.000001.00000


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651UGUACUUUGCUUGCUCAUA77.69021003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561669TGTACTTTGCTTGCTCATATATGAGCAAGCAAAGTACA0.033000.003400.663800.750001.000001.00000


Target Position: 2640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640ACAGAUUUAAUACAGUUUA83.0103558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662658ACAGATTTAATACAGTTTATAAACTGTATTAAATCTGT0.112600.038800.672400.750001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582UGCAUCUACACCGACAACU60.73252898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915600TGCATCTACACCGACAACTAGTTGTCGGTGTAGATGCA0.081000.026300.646600.500000.945700.87500


Target Position: 2551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2551UAUGAUUUAUAAAUGCAAU80.6998724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132569TATGATTTATAAATGCAATATTGCATTTATAAATCATA0.042000.020800.534500.500001.000001.00000


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930AGAGAAGACGAAAUAGUGA88.0416276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021948AGAGAAGACGAAATAGTGATCACTATTTCGTCTTCTCT0.053000.013700.500000.500001.000001.00000


Target Position: 3948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3948CCUCCAGAACACGGCUCAC66.95232208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843966CCTCCAGAACACGGCTCACGTGAGCCGTGTTCTGGAGG0.027900.017300.551700.750000.929300.75000


Target Position: 2811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2811UCGGUUCCGAUGAAUUCUU62.95342670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912829TCGGTTCCGATGAATTCTTAAGAATTCATCGGAACCGA0.080200.002200.655200.750000.972800.62500


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905CCACUCCUACGAUACGCUA86.5098348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441923CCACTCCTACGATACGCTATAGCGTATCGTAGGAGTGG0.320400.026700.672401.000001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224UGUUGGUUGUUUUUUCCUU73.20311493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421242TGTTGGTTGTTTTTTCCTTAAGGAAAAAACAACCAACA0.140900.017500.569000.750001.000001.00000


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365GGGUUGUGCUACAGAUGAU95.144363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911383GGGTTGTGCTACAGATGATATCATCTGTAGCACAACCC0.330100.005100.810301.000001.000001.00000


Target Position: 3697, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697GGUAUGUUUAAUCUGUUAU85.9179385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4283715GGTATGTTTAATCTGTTATATAACAGATTAAACATACC0.304900.046800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3695-3717TGGGTATGTTTAATCTGTTATGTAUAACAGAUUAAACAUACCCAGGUAUGUUUAAUCUGUUAUGUU20.314.622


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260CCCCGAUGCCAACCUCCUC61.05052867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293278CCCCGATGCCAACCTCCTCGAGGAGGTTGGCATCGGGG0.402800.104500.681000.750001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312GAGAGAGAGAAAAAAAAAA96.158651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261330GAGAGAGAGAAAAAAAAAATTTTTTTTTTCTCTCTCTC0.917400.221100.810300.750001.000001.00000


Target Position: 4061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061CCUGGAUGUUGUGUGUAUC73.84331406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8584079CCTGGATGTTGTGTGTATCGATACACACAACATCCAGG0.056400.021300.663800.750001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671GCAUGUAGUCACUUUAUAA107.8851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531689GCATGTAGTCACTTTATAATTATAAAGTGACTACATGC0.129600.006600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1669-1691ATGCATGTAGTCACTTTATAAGTUUAUAAAGUGACUACAUGCAUGCAUGUAGUCACUUUAUAAGUU-2.317.932


Target Position: 4278, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4278GGUAAAACCCCAAAAAAAA92.4936118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914296GGTAAAACCCCAAAAAAAATTTTTTTTGGGGTTTTACC0.679600.347300.853401.000000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4276-4298CTGGTAAAACCCCAAAAAAAAAAUUUUUUUUGGGGUUUUACCAGGGUAAAACCCCAAAAAAAAAAU-11.38.221


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644AUUUAAUACAGUUUAUUUU77.39211034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122662ATTTAATACAGTTTATTTTAAAATAAACTGTATTAAAT0.080000.038700.508600.500001.000001.00000


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191UAGUUUUCUCUUAGAACAU76.0191186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123209TAGTTTTCTCTTAGAACATATGTTCTAAGAGAAAACTA0.069700.015300.517200.500001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657UGGAACCUGGCCGCAAUGA59.34663058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802675TGGAACCTGGCCGCAATGATCATTGCGGCCAGGTTCCA0.075500.010200.620700.500001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071UUGUGUUCUUCUUCAUAUU74.70011313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232089TTGTGTTCTTCTTCATATTAATATGAAGAAGAACACAA0.551400.082700.637900.500001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177CCAUGUACUAGUUUUAGUU87.8002287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6893195CCATGTACTAGTTTTAGTTAACTAAAACTAGTACATGG0.201300.014300.698301.000000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3175-3197TGCCATGTACTAGTTTTAGTTTTAACUAAAACUAGUACAUGGCACCAUGUACUAGUUUUAGUUUUU4.920.432


Target Position: 2073, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073GUGUUCUUCUUCAUAUUCU81.6959647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232091GTGTTCTTCTTCATATTCTAGAATATGAAGAAGAACAC0.487300.379300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2071-2093TTGTGTTCTTCTTCATATTCTAAAGAAUAUGAAGAAGAACACAAGUGUUCUUCUUCAUAUUCUAAU8.719.221


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780ACAGAUGUGAAGUUCAUUU79.1382877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793798ACAGATGTGAAGTTCATTTAAATGAACTTCACATCTGT0.193100.009000.706900.750001.000001.00000


Target Position: 3210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3210UGUAUUACAGAUGCCUUUU68.60612022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8103228TGTATTACAGATGCCTTTTAAAAGGCATCTGTAATACA0.088000.008200.706900.750001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681UAGGUGAGAAAAAAACAAU75.43641242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782699TAGGTGAGAAAAAAACAATATTGTTTTTTTCTCACCTA0.297500.034600.663800.500001.000001.00000


Target Position: 2645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645UUUAAUACAGUUUAUUUUU67.46652168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872663TTTAATACAGTTTATTTTTAAAAATAAACTGTATTAAA0.070200.034000.500000.500001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923ACUAUAAAGAGAAGACGAA86.9569324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7331941ACTATAAAGAGAAGACGAATTCGTCTTCTCTTTATAGT0.158800.044700.534500.750001.000001.00000


Target Position: 2713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2713ACCACACAAAGACAUUGAU76.13171172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3832731ACCACACAAAGACATTGATATCAATGTCTTTGTGTGGT0.401900.309700.672400.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723GAGGAGAACAAACAGAUCA90.9908171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832741GAGGAGAACAAACAGATCATGATCTGTTTGTTCTCCTC0.402900.029400.586200.500001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513AAAAAAGCAUAAAAACAUU80.9139704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611531AAAAAAGCATAAAAACATTAATGTTTTTATGCTTTTTT0.495500.101300.491400.500001.000001.00000


Target Position: 2826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826UCUUAUCCCCUGCCCCUUC50.33183792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822844TCTTATCCCCTGCCCCTTCGAAGGGGCAGGGGATAAGA0.375400.149800.551700.500001.000001.00000


Target Position: 3678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3678GGAAUUUGUUCAAGUUUUG75.60111219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5113696GGAATTTGTTCAAGTTTTGCAAAACTTGAACAAATTCC0.163200.037700.724100.750001.000001.00000


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412CGUUUUUAUAUUAAUGUAC73.59131447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801430CGTTTTTATATTAATGTACGTACATTAATATAAAAACG0.230900.147100.594800.750001.000001.00000


Target Position: 3111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111GUAUCUCUUUCACAUUGUU87.1178314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183129GTATCTCTTTCACATTGTTAACAATGTGAAAGAGATAC0.097000.032300.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3109-3131GTGTATCTCTTTCACATTGTTTGAACAAUGUGAAAGAGAUACACGUAUCUCUUUCACAUUGUUUGU19.320.220


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725GGAGAACAAACAGAUCAUC74.47381337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381743GGAGAACAAACAGATCATCGATGATCTGTTTGTTCTCC0.361400.059100.689700.750001.000001.00000


Target Position: 2674, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674CCUUUUAUAGGUGAGAAAA86.6757338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902692CCTTTTATAGGTGAGAAAATTTTCTCACCTATAAAAGG0.137900.014100.844801.000000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694ATCCTTTTATAGGTGAGAAAAAAUUUUCUCACCUAUAAAAGGAUCCUUUUAUAGGUGAGAAAAAAU20.4-4.312


Target Position: 1690, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690GUCAUUGUAUGUUAUUAUA95.60756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891708GTCATTGTATGTTATTATATATAATAACATACAATGAC0.082000.009100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1688-1710AAGTCATTGTATGTTATTATATTUAUAAUAACAUACAAUGACUUGUCAUUGUAUGUUAUUAUAUUU-8.020.522


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886UGGCUAUGUAAUUCUUGUA85.1833431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722904TGGCTATGTAATTCTTGTATACAAGAATTACATAGCCA0.182400.101900.663800.750001.000001.00000


Target Position: 4234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4234AGCAGAAGACAAAAAGACA90.2338194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8444252AGCAGAAGACAAAAAGACATGTCTTTTTGTCTTCTGCT0.318400.103100.646600.500001.000001.00000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174UUUUCUAAUGGAAUGGUUU67.56622160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712192TTTTCTAATGGAATGGTTTAAACCATTCCATTAGAAAA0.088900.014900.500000.500001.000001.00000


Target Position: 2667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2667GAUAGAUCCUUUUAUAGGU86.0616377

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2665-2687AAGATAGATCCTTTTATAGGTGAACCUAUAAAAGGAUCUAUCUUGAUAGAUCCUUUUAUAGGUGAU12.315.923


Target Position: 1320, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320GAAAAAAAAAAUAGUAUUU84.5168462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171338GAAAAAAAAAATAGTATTTAAATACTATTTTTTTTTTC0.792200.776800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1318-1340GAGAAAAAAAAAATAGTATTTGCAAAUACUAUUUUUUUUUUCUCGAAAAAAAAAAUAGUAUUUGCU6.3-11.311


Target Position: 3135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3135CUAUUGGAGGAUCAGUUUU77.02771071

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3133-3155TGCTATTGGAGGATCAGTTTTTTAAAACUGAUCCUCCAAUAGCACUAUUGGAGGAUCAGUUUUUUU19.221.223


Target Position: 1221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1221UGUUGUUGGUUGUUUUUUC66.68792239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7121239TGTTGTTGGTTGTTTTTTCGAAAAAACAACCAACAACA0.328400.077900.534500.500001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547CCAGUAUGAUUUAUAAAUG81.74639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222565CCAGTATGATTTATAAATGCATTTATAAATCATACTGG0.125800.026300.689700.750001.000001.00000


Target Position: 1433, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433GUUUCUCUGUUGUAAGAAU89.4064220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1431-1453TTGTTTCTCTGTTGTAAGAATAGAUUCUUACAACAGAGAAACAAGUUUCUCUGUUGUAAGAAUAGU14.619.122


Target Position: 2710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2710AAAACCACACAAAGACAUU75.99841188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732728AAAACCACACAAAGACATTAATGTCTTTGTGTGGTTTT0.511800.404000.491400.500001.000001.00000


Target Position: 2627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627UGCCUUUGAUGUUACAGAU79.9262790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952645TGCCTTTGATGTTACAGATATCTGTAACATCAAAGGCA0.131900.051400.672400.750001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308AAGAGAGAGAGAGAAAAAA86.0692376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661326AAGAGAGAGAGAGAAAAAATTTTTTCTCTCTCTCTCTT0.758000.133400.637900.500001.000001.00000


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128GCGGGGCAGCAGAAGCGAG68.4042049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975146GCGGGGCAGCAGAAGCGAGCTCGCTTCTGCTGCCCCGC0.130800.002600.612100.750000.929300.87500


Target Position: 3298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298UGCUGUUUCACAAUACCUC63.43782612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343316TGCTGTTTCACAATACCTCGAGGTATTGTGAAACAGCA0.043100.022400.543100.500001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300GUCUUUAAAAGAGAGAGAG68.53342031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641318GTCTTTAAAAGAGAGAGAGCTCTCTCTCTTTTAAAGAC0.124200.016500.508600.500001.000001.00000


Target Position: 2696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696CAAUCUGGAAGAAAAAAAC74.96991287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862714CAATCTGGAAGAAAAAAACGTTTTTTTCTTCCAGATTG0.550200.094300.500000.500001.000001.00000


Target Position: 1400, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400CAAUAAUCAACUCGUUUUU80.1293773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961418CAATAATCAACTCGTTTTTAAAAACGAGTTGATTATTG0.313900.205700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1398-1420CCCAATAATCAACTCGTTTTTATAAAAACGAGUUGAUUAUUGGGCAAUAAUCAACUCGUUUUUAUU15.31.832


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670UGCAUGUAGUCACUUUAUA84.493467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901688TGCATGTAGTCACTTTATATATAAAGTGACTACATGCA0.130300.002300.810300.750001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505GUGUUUAAAAAAAAGCAUA86.9195326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421523GTGTTTAAAAAAAAGCATATATGCTTTTTTTTAAACAC0.226600.026900.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1503-1525ACGTGTTTAAAAAAAAGCATAAAUAUGCUUUUUUUUAAACACGUGUGUUUAAAAAAAAGCAUAAAU18.57.221


Target Position: 3241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3241UUUUUUUUAUGUGAUCAAU67.91972102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763259TTTTTTTTATGTGATCAATATTGATCACATAAAAAAAA0.117000.120600.491400.500001.000001.00000


Target Position: 3499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3499GGGCACUUCAUCUGAUCGG62.1812751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093517GGGCACTTCATCTGATCGGCCGATCAGATGAAGTGCCC0.075600.004200.577600.500001.000001.00000


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448GAAUAGGCAUUAACACAAA99.618312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271466GAATAGGCATTAACACAAATTTGTGTTAATGCCTATTC0.200800.052300.672400.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439CUGUUGUAAGAAUAGGCAU81.0597694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251457CTGTTGTAAGAATAGGCATATGCCTATTCTTACAACAG0.138200.007500.629300.750001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949CAUAAUAUAUUCUAUUUUU94.429776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331967CATAATATATTCTATTTTTAAAAATAGAATATATTATG0.151900.131400.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1947-1969GACATAATATATTCTATTTTTATAAAAAUAGAAUAUAUUAUGUCCAUAAUAUAUUCUAUUUUUAUU-4.3-8.622


Target Position: 2280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280CUGCGUGCCAGUCAAGAAG65.9832338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642298CTGCGTGCCAGTCAAGAAGCTTCTTGACTGGCACGCAG0.296400.006000.646600.500000.934800.62500


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CCUAUUUUUGUAGUGACCU69.47931905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431994CCTATTTTTGTAGTGACCTAGGTCACTACAAAAATAGG0.035100.007800.500000.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676CCCCGCACGAUUUCAUUGA70.86521741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439694CCCCGCACGATTTCATTGATCAATGAAATCGTGCGGGG0.200400.095000.767200.750001.000001.00000


Target Position: 1963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1963UUUUUAUACUCUUCCUAUU74.45181340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681981TTTTTATACTCTTCCTATTAATAGGAAGAGTATAAAAA0.179900.088100.491400.500001.000001.00000


Target Position: 2773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773GCAUGGGUGCAAGGAAAAU78.2125949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362791GCATGGGTGCAAGGAAAATATTTTCCTTGCACCCATGC0.182700.017900.844801.000001.000001.00000


Target Position: 2445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445GGUUAUCUUAGAUGUUUCA92.8129109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2443-2465AGGGTTATCTTAGATGTTTCACAUGAAACAUCUAAGAUAACCCUGGUUAUCUUAGAUGUUUCACAU14.814.533


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779CACAGAUGUGAAGUUCAUU85.3614421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773797CACAGATGTGAAGTTCATTAATGAACTTCACATCTGTG0.230900.010100.784500.750000.983700.62500


Target Position: 2835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2835CUGCCCCUUCCUUUAAAAA78.9597890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1162853CTGCCCCTTCCTTTAAAAATTTTTAAAGGAAGGGGCAG0.866900.402900.784500.750001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218AGAUGCCUUUUUUGUAGUU77.29571042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933236AGATGCCTTTTTTGTAGTTAACTACAAAAAAGGCATCT0.142900.047500.577600.750001.000001.00000


Target Position: 2471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471AGGUUUUUAAACACUAAAA86.2796361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8802489AGGTTTTTAAACACTAAAATTTTAGTGTTTAAAAACCT0.050200.018300.844800.750001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224CUUUUUUGUAGUUUUUUUU73.72351430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4523242CTTTTTTGTAGTTTTTTTTAAAAAAAACTACAAAAAAG0.449600.132200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3222-3244GCCTTTTTTGTAGTTTTTTTTTTAAAAAAAACUACAAAAAAGGCCUUUUUUGUAGUUUUUUUUUUU-11.3-2.910


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502AGUUAAGGCUAAAAAGUAU89.3242222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652520AGTTAAGGCTAAAAAGTATATACTTTTTAGCCTTAACT0.097700.010300.663800.750001.000001.00000


Target Position: 3963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3963UCACGCUUACCUCAACCAU68.89521984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6363981TCACGCTTACCTCAACCATATGGTTGAGGTAAGCGTGA0.475500.189000.569000.750000.956500.87500


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724UGUAACCUCUUCACCUUAU74.87121297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611742TGTAACCTCTTCACCTTATATAAGGTGAAGAGGTTACA0.031500.010600.663800.750000.972800.62500


Target Position: 4242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4242ACAAAAAGACAAACAUGAA90.7391176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254260ACAAAAAGACAAACATGAATTCATGTTTGTCTTTTTGT0.716200.191000.534500.750001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496AUUUAUAGUUAAGGCUAAA84.5107463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722514ATTTATAGTTAAGGCTAAATTTAGCCTTAACTATAAAT0.036100.010500.508600.500001.000001.00000


Target Position: 2652, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652CAGUUUAUUUUUAAAGAUA96.956735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752670CAGTTTATTTTTAAAGATATATCTTTAAAAATAAACTG0.051500.015800.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2650-2672TACAGTTTATTTTTAAAGATAGAUAUCUUUAAAAAUAAACUGUACAGUUUAUUUUUAAAGAUAGAU6.94.622


Target Position: 1585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585GGUAGAAAAACAUAUUCUU90.652178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1583-1605TAGGTAGAAAAACATATTCTTGTAAGAAUAUGUUUUUCUACCUAGGUAGAAAAACAUAUUCUUGUU6.614.612


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860GAGGAGCCCCAACAACUUC69.43121914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788878GAGGAGCCCCAACAACTTCGAAGTTGTTGGGGCTCCTC0.184500.009600.637900.500000.962000.75000


Target Position: 403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403UGGAGGUCUGCGAGGAACA75.19011268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978421TGGAGGTCTGCGAGGAACATGTTCCTCGCAGACCTCCA0.064000.002500.637900.500001.000001.00000


Target Position: 3600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600UUAUAACAAGUGUGUCUUA84.264484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813618TTATAACAAGTGTGTCTTATAAGACACACTTGTTATAA0.050000.030900.500000.500000.962000.87500


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943UGUGGAGGCUGACGUGUGA80.3827751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9992961TGTGGAGGCTGACGTGTGATCACACGTCAGCCTCCACA0.042400.006100.482800.500001.000001.00000


Target Position: 3753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3753ACCAUAAUGCUAAUUUAAA85.8501391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843771ACCATAATGCTAATTTAAATTTAAATTAGCATTATGGT0.286100.055200.853400.750001.000001.00000


Target Position: 2702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702GGAAGAAAAAAACCACACA91.1436163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422720GGAAGAAAAAAACCACACATGTGTGGTTTTTTTCTTCC0.613600.223900.663800.750001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311AGAGAGAGAGAAAAAAAAA93.64185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711329AGAGAGAGAGAAAAAAAAATTTTTTTTTCTCTCTCTCT0.921800.178000.724100.750001.000001.00000


Target Position: 2497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497UUUAUAGUUAAGGCUAAAA72.92221527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702515TTTATAGTTAAGGCTAAAATTTTAGCCTTAACTATAAA0.029800.010600.500000.500001.000001.00000


Target Position: 1936, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1936GACGAAAUAGUGACAUAAU93.116698

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10193619GACGAAATAGTGACATAAT1/1/0/094.96CCND1NM_053056.21NANANA11:69466889..69466907(+)00CCND1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961954GACGAAATAGTGACATAATATTATGTCACTATTTCGTC0.479700.032800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1934-1956AAGACGAAATAGTGACATAATATAUUAUGUCACUAUUUCGUCUUGACGAAAUAGUGACAUAAUAUU16.115.222


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688AAGUCAUUGUAUGUUAUUA92.695113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171706AAGTCATTGTATGTTATTATAATAACATACAATGACTT0.041300.006700.603400.500001.000001.00000


Target Position: 4286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4286CCCAAAAAAAAAAAAAAAA80.9759701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404304CCCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGGG0.999200.695800.991401.000001.000001.00000


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255CAGUGGAGGUGGGGUGUUU80.0213781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372273CAGTGGAGGTGGGGTGTTTAAACACCCCACCTCCACTG0.366000.044900.784500.750001.000001.00000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254CGCGUACCCCGAUGCCAAC65.66642378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559272CGCGTACCCCGATGCCAACGTTGGCATCGGGGTACGCG0.307300.024700.775900.750001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608CACACACACACAAACCUUC73.03731513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702626CACACACACACAAACCTTCGAAGGTTTGTGTGTGTGTG0.186300.166100.620700.500001.000001.00000


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285CCCCAAAAAAAAAAAAAAA81.4616661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584303CCCCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGGGG0.999000.633800.991401.000001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589ACAGAUACACACACACACA91.9551135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982607ACAGATACACACACACACATGTGTGTGTGTGTATCTGT0.982800.552000.500000.500001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569UCUCCCCUUGAUUUAAACA71.2391701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602587TCTCCCCTTGATTTAAACATGTTTAAATCAAGGGGAGA0.517800.234900.517200.500001.000001.00000


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824CAAACCAUCCAGUGACAAA94.736873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281842CAAACCATCCAGTGACAAATTTGTCACTGGATGGTTTG0.037300.039800.646600.750001.000001.00000


Target Position: 3702, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702GUUUAAUCUGUUAUGUACU82.0807623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3700-3722ATGTTTAATCTGTTATGTACTAGAGUACAUAACAGAUUAAACAUGUUUAAUCUGUUAUGUACUAGU15.82.122


Target Position: 3953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3953AGAACACGGCUCACGCUUA88.6353257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5843971AGAACACGGCTCACGCTTATAAGCGTGAGCCGTGTTCT0.265900.023000.689700.750000.929300.62500


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361UGAAGUUUAGGAAUCCUUU75.46921235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442379TGAAGTTTAGGAATCCTTTAAAGGATTCCTAAACTTCA0.035000.013200.724100.750000.972800.75000


Target Position: 1520, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520CAUAAAAACAUUUUAAAAA92.2231127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741538CATAAAAACATTTTAAAAATTTTTAAAATGTTTTTATG0.512300.425900.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1518-1540AGCATAAAAACATTTTAAAAACAUUUUUAAAAUGUUUUUAUGCUCAUAAAAACAUUUUAAAAACAU-9.1-9.711


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676UAGUCACUUUAUAAGUCAU85.7341396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871694TAGTCACTTTATAAGTCATATGACTTATAAAGTGACTA0.117000.063200.517200.500000.994600.62500


Target Position: 3946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3946CCCCUCCAGAACACGGCUC50.91033749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013964CCCCTCCAGAACACGGCTCGAGCCGTGTTCTGGAGGGG0.044900.023900.681000.750000.913000.62500


Target Position: 2928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2928GGGAGGUGGCAAGAGUGUG70.03821819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962946GGGAGGTGGCAAGAGTGTGCACACTCTTGCCACCTCCC0.201400.021900.698300.750001.000001.00000


Target Position: 2473, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2473GUUUUUAAACACUAAAAUA95.84353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812491GTTTTTAAACACTAAAATATATTTTAGTGTTTAAAAAC0.077400.025600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2471-2493AGGTTTTTAAACACTAAAATATAUAUUUUAGUGUUUAAAAACCUGUUUUUAAACACUAAAAUAUAU-4.3-9.122


Target Position: 2654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2654GUUUAUUUUUAAAGAUAGA88.0487275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2652-2674CAGTTTATTTTTAAAGATAGATCUCUAUCUUUAAAAAUAAACUGGUUUAUUUUUAAAGAUAGAUCU11.6-9.712


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313AGAGAGAGAAAAAAAAAAU83.0193557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221331AGAGAGAGAAAAAAAAAATATTTTTTTTTTCTCTCTCT0.911600.249100.715500.750001.000001.00000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443AGGGUUAUCUUAGAUGUUU77.7681996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882461AGGGTTATCTTAGATGTTTAAACATCTAAGATAACCCT0.027300.003800.844800.750001.000001.00000


Target Position: 2971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2971GGCGGGAGGAGGUGUGAGG61.05392866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672989GGCGGGAGGAGGTGTGAGGCCTCACACCTCCTCCCGCC0.297300.006000.655200.500001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710UCCGUAGGUAGAUGUGUAA79.7222808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151728TCCGTAGGTAGATGTGTAATTACACATCTACCTACGGA0.041600.005200.836200.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504UUAAGGCUAAAAAGUAUAU69.98211827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512522TTAAGGCTAAAAAGTATATATATACTTTTTAGCCTTAA0.114100.011600.491400.500001.000001.00000


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827GCAAGCUGCCGAACCAAAA84.6814454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6293845GCAAGCTGCCGAACCAAAATTTTGGTTCGGCAGCTTGC0.534800.018600.853401.000001.000001.00000


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160CCCAGCCAGGACCCACAGC48.23543905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
976178CCCAGCCAGGACCCACAGCGCTGTGGGTCCTGGCTGGG0.243400.025600.637900.500000.934800.75000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159ACCCAGCCAGGACCCACAG53.5813559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980177ACCCAGCCAGGACCCACAGCTGTGGGTCCTGGCTGGGT0.204300.002400.569000.500000.929300.62500


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944AGUGACAUAAUAUAUUCUA90.0349201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321962AGTGACATAATATATTCTATAGAATATATTATGTCACT0.327600.094000.534500.750001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GAUUUUAUACCCCAAUAAU91.1229164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201406GATTTTATACCCCAATAATATTATTGGGGTATAAAATC0.159500.058100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1386-1408AGGATTTTATACCCCAATAATCAAUUAUUGGGGUAUAAAAUCCUGAUUUUAUACCCCAAUAAUCAU12.8-10.332


Target Position: 2101, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101CCAUUUCCAAGCACUUUCA82.9537566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212119CCATTTCCAAGCACTTTCATGAAAGTGCTTGGAAATGG0.126200.135700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2099-2121TTCCATTTCCAAGCACTTTCAGTUGAAAGUGCUUGGAAAUGGAACCAUUUCCAAGCACUUUCAGUU19.220.121


Target Position: 2855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855CUUAGUGACAAAAUAGACA86.3559356

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2853-2875AACTTAGTGACAAAATAGACAATUGUCUAUUUUGUCACUAAGUUCUUAGUGACAAAAUAGACAAUU14.520.322


Target Position: 3739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3739GUUUUGUUAAUUACACCAU78.6606916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573757GTTTTGTTAATTACACCATATGGTGTAATTAACAAAAC0.107600.027800.491400.750001.000001.00000


Target Position: 3167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167UCAUAUACUGCCAUGUACU76.26841158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863185TCATATACTGCCATGTACTAGTACATGGCAGTATATGA0.104200.054800.517200.500000.918500.62500


Target Position: 2883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2883UCUUGGCUAUGUAAUUCUU76.70911113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862901TCTTGGCTATGTAATTCTTAAGAATTACATAGCCAAGA0.162800.134200.586200.750001.000001.00000


Target Position: 3708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3708UCUGUUAUGUACUAGUGUU80.3445753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6153726TCTGTTATGTACTAGTGTTAACACTAGTACATAACAGA0.128300.102600.577600.750001.000001.00000


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498UUAUAGUUAAGGCUAAAAA79.8436795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352516TTATAGTTAAGGCTAAAAATTTTTAGCCTTAACTATAA0.036400.010400.534500.500001.000001.00000


Target Position: 3121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121CACAUUGUUUGCUGCUAUU84.2311487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543139CACATTGTTTGCTGCTATTAATAGCAGCAAACAATGTG0.033100.017900.784500.750000.983700.62500


Target Position: 1937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937ACGAAAUAGUGACAUAAUA90.6196180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321955ACGAAATAGTGACATAATATATTATGTCACTATTTCGT0.632200.045400.732800.750001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680GCACGAUUUCAUUGAACAC78.5118929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657698GCACGATTTCATTGAACACGTGTTCAATGAAATCGTGC0.240500.145700.560300.750001.000001.00000


Target Position: 2687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687AGAAAAAAACAAUCUGGAA90.4103189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672705AGAAAAAAACAATCTGGAATTCCAGATTGTTTTTTTCT0.124500.090300.551700.750001.000001.00000


Target Position: 2879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2879CACAUCUUGGCUAUGUAAU78.3136942

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2877-2899TGCACATCTTGGCTATGTAATTCAUUACAUAGCCAAGAUGUGCACACAUCUUGGCUAUGUAAUUCU8.519.232


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896CCACCUGUCCCACUCCUAC69.58261882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191914CCACCTGTCCCACTCCTACGTAGGAGTGGGACAGGTGG0.121800.007800.663800.750001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503GUUAAGGCUAAAAAGUAUA86.5553345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512521GTTAAGGCTAAAAAGTATATATACTTTTTAGCCTTAAC0.105600.010700.603400.750001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301UCUUUAAAAGAGAGAGAGA79.7993797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531319TCTTTAAAAGAGAGAGAGATCTCTCTCTCTTTTAAAGA0.138500.031000.500000.500001.000001.00000


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175CCUCUCCGGAGCAUUUUGA74.17961364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261193CCTCTCCGGAGCATTTTGATCAAAATGCTCCGGAGAGG0.136900.003900.620700.750000.929300.62500


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232GUUUUUUCCUUUGCUCUUU71.23241703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011250GTTTTTTCCTTTGCTCTTTAAAGAGCAAAGGAAAAAAC0.358600.103600.646600.750001.000001.00000


Target Position: 2647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2647UAAUACAGUUUAUUUUUAA88.3107265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622665TAATACAGTTTATTTTTAATTAAAAATAAACTGTATTA0.058300.029500.500000.500001.000001.00000


Target Position: 2844, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844CCUUUAAAAAACUUAGUGA87.3804303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342862CCTTTAAAAAACTTAGTGATCACTAAGTTTTTTAAAGG0.192800.204400.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2842-2864TTCCTTTAAAAAACTTAGTGACAUCACUAAGUUUUUUAAAGGAACCUUUAAAAAACUUAGUGACAU16.4-3.822


Target Position: 1378, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378GAUGAUAGAGGAUUUUAUA102.7232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901396GATGATAGAGGATTTTATATATAAAATCCTCTATCATC0.342900.033600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1376-1398CAGATGATAGAGGATTTTATACCUAUAAAAUCCUCUAUCAUCUGGAUGAUAGAGGAUUUUAUACCU-10.313.322


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GCGUGCCAGUCAAGAAGAA90.2166195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192300GCGTGCCAGTCAAGAAGAATTCTTCTTGACTGGCACGC0.355300.019800.750001.000001.000001.00000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263UCUGACUUAAGCAAAAGAA77.28541043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741281TCTGACTTAAGCAAAAGAATTCTTTTGCTTAAGTCAGA0.169300.065600.551700.750001.000001.00000


Target Position: 3754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3754CCAUAAUGCUAAUUUAAAG83.6466514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863772CCATAATGCTAATTTAAAGCTTTAAATTAGCATTATGG0.094700.005300.706900.750001.000001.00000


Target Position: 1364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364AGGGUUGUGCUACAGAUGA78.9362893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551382AGGGTTGTGCTACAGATGATCATCTGTAGCACAACCCT0.335200.003200.620700.500001.000001.00000


Target Position: 2921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2921UGUUGAAGGGAGGUGGCAA79.8493793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872939TGTTGAAGGGAGGTGGCAATTGCCACCTCCCTTCAACA0.048600.017900.560300.750001.000001.00000


Target Position: 3743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3743UGUUAAUUACACCAUAAUG72.8821532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713761TGTTAATTACACCATAATGCATTATGGTGTAATTAACA0.107600.043800.551700.500001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CCUUCCAUCUCUGACUUAA89.0389238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361272CCTTCCATCTCTGACTTAATTAAGTCAGAGATGGAAGG0.120600.094500.810301.000001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506AAGGCUAAAAAGUAUAUUU81.9262633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342524AAGGCTAAAAAGTATATTTAAATATACTTTTTAGCCTT0.140100.018100.637900.500001.000001.00000


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CGCGGGGCAGCAGAAGCGA68.95991975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958145CGCGGGGCAGCAGAAGCGATCGCTTCTGCTGCCCCGCG0.165900.003100.629300.750000.929300.75000


Target Position: 1528, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528CAUUUUAAAAACAUAGAAA95.049664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751546CATTTTAAAAACATAGAAATTTCTATGTTTTTAAAATG0.534200.371900.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1526-1548AACATTTTAAAAACATAGAAAAAUUUCUAUGUUUUUAAAAUGUUCAUUUUAAAAACAUAGAAAAAU13.4-9.721


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703GAAGAAAAAAACCACACAA95.70854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582721GAAGAAAAAAACCACACAATTGTGTGGTTTTTTTCTTC0.609100.245900.525900.750001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231GUAGUUUUUUUUUUUUUUA86.1155373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5163249GTAGTTTTTTTTTTTTTTATAAAAAAAAAAAAAACTAC0.818000.319100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3229-3251TTGTAGTTTTTTTTTTTTTTATGUAAAAAAAAAAAAAACUACAAGUAGUUUUUUUUUUUUUUAUGU-11.34.900


Target Position: 2598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598CACACACACACACACACAC76.2791155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552616CACACACACACACACACACGTGTGTGTGTGTGTGTGTG0.860200.861400.500000.500001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278AGAAAAAGAUUACCCAAAA89.9911203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341296AGAAAAAGATTACCCAAAATTTTGGGTAATCTTTTTCT0.958600.520500.724100.750001.000001.00000


Target Position: 3727, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3727CUGUUUGUUAUUGUUUUGU64.53352500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7493745CTGTTTGTTATTGTTTTGTACAAAACAATAACAAACAG0.123500.084900.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3725-3747TTCTGTTTGTTATTGTTTTGTTAACAAAACAAUAACAAACAGAACUGUUUGUUAUUGUUUUGUUAU12.219.311


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079GCGGGACGUGGACAUCUGA86.1007374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091097GCGGGACGTGGACATCTGATCAGATGTCCACGTCCCGC0.325200.008200.698300.750000.907600.87500


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634GAUGUUACAGAUUUAAUAC82.1964617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672652GATGTTACAGATTTAATACGTATTAAATCTGTAACATC0.564500.086300.500000.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425AUGUACUUGUUUCUCUGUU70.93421736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621443ATGTACTTGTTTCTCTGTTAACAGAGAAACAAGTACAT0.061100.036200.508600.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680CACUUUAUAAGUCAUUGUA92.8406106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301698CACTTTATAAGTCATTGTATACAATGACTTATAAAGTG0.123400.054500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1678-1700GTCACTTTATAAGTCATTGTATGUACAAUGACUUAUAAAGUGACCACUUUAUAAGUCAUUGUAUGU20.54.633


Target Position: 3200, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3200CUUAGAACAUUGUAUUACA96.513142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3198-3220CTCTTAGAACATTGTATTACAGAUGUAAUACAAUGUUCUAAGAGCUUAGAACAUUGUAUUACAGAU9.514.622


Target Position: 2705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2705AGAAAAAAACCACACAAAG71.61521657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172723AGAAAAAAACCACACAAAGCTTTGTGTGGTTTTTTTCT0.533700.417800.586200.500001.000001.00000


Target Position: 3545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3545GCUGUGUUAUUCUUUGCGU77.63961009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263563GCTGTGTTATTCTTTGCGTACGCAAAGAATAACACAGC0.037500.004200.577600.750001.000001.00000


Target Position: 3101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3101UCGCUUCUGUGUAUCUCUU73.27971488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063119TCGCTTCTGTGTATCTCTTAAGAGATACACAGAAGCGA0.267000.008300.655200.750001.000001.00000


Target Position: 2643, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643GAUUUAAUACAGUUUAUUU96.670139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362661GATTTAATACAGTTTATTTAAATAAACTGTATTAAATC0.086700.051200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2641-2663CAGATTTAATACAGTTTATTTTTAAAUAAACUGUAUUAAAUCUGGAUUUAAUACAGUUUAUUUUUU-0.3-10.322


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429ACUUGUUUCUCUGUUGUAA85.861390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061447ACTTGTTTCTCTGTTGTAATTACAACAGAGAAACAAGT0.043000.012800.672400.750001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786GUGAAGUUCAUUUCCAAUC64.6332490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764804GTGAAGTTCATTTCCAATCGATTGGAAATGAACTTCAC0.084600.043500.612100.500001.000001.00000


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881CAUCUUGGCUAUGUAAUUC74.11721371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872899CATCTTGGCTATGTAATTCGAATTACATAGCCAAGATG0.366000.217900.482800.500001.000001.00000


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641GGUGAACAAGCUCAAGUGG69.13241948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930659GGTGAACAAGCTCAAGTGGCCACTTGAGCTTGTTCACC0.051100.028100.508600.500001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428UACUUGUUUCUCUGUUGUA83.3534535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591446TACTTGTTTCTCTGTTGTATACAACAGAGAAACAAGTA0.256800.021100.500000.500001.000001.00000


Target Position: 2284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2284GUGCCAGUCAAGAAGAAAA92.3087124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272302GTGCCAGTCAAGAAGAAAATTTTCTTCTTGACTGGCAC0.389600.018700.793100.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894GGCCACCUGUCCCACUCCU71.25841698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731912GGCCACCTGTCCCACTCCTAGGAGTGGGACAGGTGGCC0.060700.005800.655200.750001.000001.00000


Target Position: 3570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3570AUGGAAGUUGCAUAAUUAU79.0225884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203588ATGGAAGTTGCATAATTATATAATTATGCAACTTCCAT0.042300.004000.612100.500001.000001.00000


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652CAUUCGGGAUGAUUGGAAU87.4783298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883670CATTCGGGATGATTGGAATATTCCAATCATCCCGAATG0.183600.002300.646600.750001.000001.00000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099UUCCAUUUCCAAGCACUUU59.50633041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762117TTCCATTTCCAAGCACTTTAAAGTGCTTGGAAATGGAA0.150400.158200.672400.500001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406UCAACUCGUUUUUAUAUUA84.8074447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421424TCAACTCGTTTTTATATTATAATATAAAAACGAGTTGA0.309600.111300.689700.750001.000001.00000


Target Position: 3966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3966CGCUUACCUCAACCAUCCU77.48821025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123984CGCTTACCTCAACCATCCTAGGATGGTTGAGGTAAGCG0.393800.187100.577600.750000.956500.62500


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GCUACUAUAAAGAGAAGAC78.4419933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351938GCTACTATAAAGAGAAGACGTCTTCTCTTTATAGTAGC0.257000.084300.534500.750001.000001.00000


Target Position: 2217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2217AAGCAGGACUUUGAGGCAA78.3488941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832235AAGCAGGACTTTGAGGCAATTGCCTCAAAGTCCTGCTT0.028000.002500.491400.500001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677AGUCACUUUAUAAGUCAUU74.97411286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011695AGTCACTTTATAAGTCATTAATGACTTATAAAGTGACT0.131100.058900.698300.750000.994600.75000


Target Position: 1980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1980UUUUUGUAGUGACCUGUUU66.14442316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041998TTTTTGTAGTGACCTGTTTAAACAGGTCACTACAAAAA0.124700.013000.500000.500001.000001.00000


Target Position: 3295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295GGUUGCUGUUUCACAAUAC80.3977747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703313GGTTGCTGTTTCACAATACGTATTGTGAAACAGCAACC0.053700.009900.672400.750000.940200.62500


Target Position: 2509, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2509GCUAAAAAGUAUAUUUAUU91.0354168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672527GCTAAAAAGTATATTTATTAATAAATATACTTTTTAGC0.054600.017400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2507-2529AGGCTAAAAAGTATATTTATTGCAAUAAAUAUACUUUUUAGCCUGCUAAAAAGUAUAUUUAUUGCU-8.0-3.822


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409ACUCGUUUUUAUAUUAAUG72.19911607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9241427ACTCGTTTTTATATTAATGCATTAATATAAAAACGAGT0.274600.117500.551700.500001.000001.00000


Target Position: 3574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3574AAGUUGCAUAAUUAUUAUU79.3338847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803592AAGTTGCATAATTATTATTAATAATAATTATGCAACTT0.472500.008100.629300.500001.000001.00000


Target Position: 3689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689AAGUUUUGGGUAUGUUUAA83.6767512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813707AAGTTTTGGGTATGTTTAATTAAACATACCCAAAACTT0.076600.002400.603400.500001.000001.00000


Target Position: 2975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2975GGAGGAGGUGUGAGGAGGA88.8475248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682993GGAGGAGGTGTGAGGAGGATCCTCCTCACACCTCCTCC0.293700.034600.500000.750001.000001.00000


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964UUUUAUACUCUUCCUAUUU69.57691884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451982TTTTATACTCTTCCTATTTAAATAGGAAGAGTATAAAA0.173200.118200.500000.500001.000001.00000


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586CACACAGAUACACACACAC76.12041175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202604CACACAGATACACACACACGTGTGTGTGTATCTGTGTG0.965500.543000.500000.500001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220UUGUUGUUGGUUGUUUUUU56.52333321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021238TTGTTGTTGGTTGTTTTTTAAAAAACAACCAACAACAA0.430800.086400.646600.500001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072UGUGUUCUUCUUCAUAUUC63.27022636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152090TGTGTTCTTCTTCATATTCGAATATGAAGAAGAACACA0.486300.104000.534500.500001.000001.00000


Target Position: 1655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CUUUGCUUGCUCAUAUGCA81.1144689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1653-1675TACTTTGCTTGCTCATATGCATGUGCAUAUGAGCAAGCAAAGUACUUUGCUUGCUCAUAUGCAUGU21.118.622


Target Position: 1910, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910CCUACGAUACGCUACUAUA98.823314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491928CCTACGATACGCTACTATATATAGTAGCGTATCGTAGG0.256500.108600.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1908-1930CTCCTACGATACGCTACTATAAAUAUAGUAGCGUAUCGUAGGAGCCUACGAUACGCUACUAUAAAU11.220.943


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207AGCUUCAUUCUCCUUGUUG64.32372526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181225AGCTTCATTCTCCTTGTTGCAACAAGGAGAATGAAGCT0.143300.018600.706900.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264CUGACUUAAGCAAAAGAAA87.0123320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731282CTGACTTAAGCAAAAGAAATTTCTTTTGCTTAAGTCAG0.182200.074700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1262-1284CTCTGACTTAAGCAAAAGAAAAAUUUCUUUUGCUUAAGUCAGAGCUGACUUAAGCAAAAGAAAAAU5.520.321


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182GGAGCAUUUUGAUACCAGA97.942122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6401200GGAGCATTTTGATACCAGATCTGGTATCAAAATGCTCC0.148000.017800.646600.750000.929300.62500


Target Position: 4283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4283AACCCCAAAAAAAAAAAAA73.76561423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6514301AACCCCAAAAAAAAAAAAATTTTTTTTTTTTTGGGGTT0.998100.396900.646600.500001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081CUUCAUAUUCUAAAACCAU85.1364433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892099CTTCATATTCTAAAACCATATGGTTTTAGAATATGAAG0.532300.380300.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2079-2101TTCTTCATATTCTAAAACCATTCAUGGUUUUAGAAUAUGAAGAACUUCAUAUUCUAAAACCAUUCU18.88.721


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407CAACUCGUUUUUAUAUUAA92.8042110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421425CAACTCGTTTTTATATTAATTAATATAAAAACGAGTTG0.293800.105100.612100.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372GCUACAGAUGAUAGAGGAU89.6066214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691390GCTACAGATGATAGAGGATATCCTCTATCATCTGTAGC0.112100.105900.672401.000001.000001.00000


Target Position: 2194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194GGAAUAUCCAUGUACUUGU85.2921425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2192-2214TGGGAATATCCATGTACTTGTTTACAAGUACAUGGAUAUUCCCAGGAAUAUCCAUGUACUUGUUUU19.011.632


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CUGUCCUACUACCGCCUCA82.2666607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942897CTGTCCTACTACCGCCTCATGAGGCGGTAGTAGGACAG0.035100.022400.560300.500001.000001.00000


Target Position: 3179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179AUGUACUAGUUUUAGUUUU73.45111465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933197ATGTACTAGTTTTAGTTTTAAAACTAAAACTAGTACAT0.195100.011900.655200.500000.945700.87500


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078UGCGGGACGUGGACAUCUG65.47842404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481096TGCGGGACGTGGACATCTGCAGATGTCCACGTCCCGCA0.184500.007400.569000.500000.907600.75000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CCUGUCCUACUACCGCCUC56.74053293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934896CCTGTCCTACTACCGCCTCGAGGCGGTAGTAGGACAGG0.036800.022300.534500.750001.000001.00000


Target Position: 3716, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3716GUACUAGUGUUCUGUUUGU82.5811586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3714-3736ATGTACTAGTGTTCTGTTTGTTAACAAACAGAACACUAGUACAUGUACUAGUGUUCUGUUUGUUAU16.718.812


Target Position: 2467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467CGGAAGGUUUUUAAACACU79.2765858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942485CGGAAGGTTTTTAAACACTAGTGTTTAAAAACCTTCCG0.187000.021900.706900.750001.000001.00000


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546AAAUUCAGCAAACCAUUUU70.05761816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211564AAATTCAGCAAACCATTTTAAAATGGTTTGCTGAATTT0.113300.096400.500000.500001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678GUCACUUUAUAAGUCAUUG71.95131628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861696GTCACTTTATAAGTCATTGCAATGACTTATAAAGTGAC0.115900.051700.672400.500000.994600.62500


Target Position: 3932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932CCCACCCCGCCCCACCCCU46.50733983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4453950CCCACCCCGCCCCACCCCTAGGGGTGGGGCGGGGTGGG0.710000.275700.646600.750001.000001.00000


Target Position: 1544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544AAAAAUUCAGCAAACCAUU73.51841458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901562AAAAATTCAGCAAACCATTAATGGTTTGCTGAATTTTT0.144500.125700.491400.500001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889ACCGCCUCACACGCUUCCU56.87333280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992907ACCGCCTCACACGCTTCCTAGGAAGCGTGTGAGGCGGT0.108000.002200.508600.500000.907600.75000


Target Position: 2974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2974GGGAGGAGGUGUGAGGAGG63.39452620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342992GGGAGGAGGTGTGAGGAGGCCTCCTCACACCTCCTCCC0.291600.037400.646600.500001.000001.00000


Target Position: 4063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4063UGGAUGUUGUGUGUAUCGA75.53481227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8374081TGGATGTTGTGTGTATCGATCGATACACACAACATCCA0.061200.024900.551700.500001.000001.00000


Target Position: 2295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295GAAGAAAAAGGUUUGCAUU86.4096352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2293-2315AAGAAGAAAAAGGTTTGCATTCTAAUGCAAACCUUUUUCUUCUUGAAGAAAAAGGUUUGCAUUCUU20.05.522


Target Position: 3042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042UCCAUUUUCUUAUUGCGCU62.3352734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493060TCCATTTTCTTATTGCGCTAGCGCAATAAGAAAATGGA0.106500.063700.517200.500001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result