siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 1313   1454   1466   1467   1482   1490   1491   1534   1577   1585   1586   1645   1646   1658   1660   1666   1667   1801   1803   1806  
1966   1968   2000  
Biltr, Ernai, Rnaxs 1377   1424   1426   1427   1428  
Biltr, Ernai, Rnaxs, Sidirect 1109  
Biltr, Rnaxs 33   65   66   67   68   88   89   90   94   108   109   273   279   280   281   315   319   338   339   348  
349   350   396   397   398   415   416   439   440   441   484   485   520   561   562   563   564   565   573   574  
575   581   582   583   584   585   586   588   589   590   595   624   627   628   629   631   649   650   651   675  
676   677   688   689   699   731   732   733   734   735   736   737   738   770   771   810   813   814   827   828  
829   831   832   846   847   848   853   854   856   884   885   886   887   906   907   912   915   917   918   919  
920   923   924   926   927   928   929   930   931   936   937   963   964   998   1002   1057   1063   1064   1065   1066  
1068   1071   1072   1103   1104   1105   1106   1107   1108   1110   1111   1116   1117   1118   1119   1120   1144   1147   1157   1158  
1159   1163   1164   1184   1186   1189   1190   1191   1201   1218   1219   1220   1227   1228   1237   1239   1240   1241   1246   1298  
1299   1300   1301   1302   1312   1314   1322   1323   1324   1325   1336   1337   1344   1345   1349   1350   1351   1352   1353   1363  
1364   1365   1370   1371   1372   1375   1376   1378   1379   1382   1383   1384   1385   1387   1388   1389   1409   1412   1413   1414  
1417   1418   1419   1422   1423   1425   1429   1444   1447   1448   1449   1453   1458   1459   1462   1463   1464   1465   1468   1470  
1471   1472   1477   1480   1481   1483   1484   1485   1486   1487   1488   1489   1492   1493   1496   1508   1513   1514   1515   1527  
1528   1529   1542   1547   1548   1549   1556   1557   1575   1576   1578   1579   1584   1587   1595   1596   1597   1606   1607   1608  
1632   1634   1635   1636   1639   1640   1644   1647   1653   1654   1655   1657   1659   1665   1668   1669   1702   1703   1773   1774  
1775   1777   1792   1793   1794   1795   1796   1797   1798   1799   1800   1802   1804   1805   1862   1863   1864   1865   1962   1963  
1964   1965   1967   1974   1975   1976   1977   1978   1979   1980   1981   1982   1987   1988   1989   1990   1991   1992   1993   1994  
1995   1996   1997   1998   1999   2001   2002  
Biltr, Ernai 1098   1162   1257   1265  
Biltr, Sidirect 1168   1267   1310   1569   1650  


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794ACCCUGUCUCUACUAAAAA82.9832222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701812ACCCTGTCTCTACTAAAAATTTTTAGTAGAGACAGGGT0.322900.016100.853400.750001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383CUCCUUCCCAUUUCUCUAC61.64641283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311401CTCCTTCCCATTTCTCTACGTAGAGAAATGGGAAGGAG0.816300.722800.629300.500001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GUCUCUACUAAAAAUACAA94.289417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331817GTCTCTACTAAAAATACAATTGTATTTTTAGTAGAGAC0.946700.159500.672400.750001.000001.00000


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528GCUUUGCCAUUGUGCGAUU79.2905363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291546GCTTTGCCATTGTGCGATTAATCGCACAATGGCAAAGC0.150800.001600.844801.000000.951101.00000


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227AGGAAGAAAAGCUGCCAUU74.6174558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841245AGGAAGAAAAGCTGCCATTAATGGCAGCTTTTCTTCCT0.039300.014100.836200.750000.989100.62500


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906CAGAGAUGUUUCGUCGAAA94.916813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314924CAGAGATGTTTCGTCGAAATTTCGACGAAACATCTCTG0.027200.003000.784500.750001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163CAGCACUCUUAUCUACAUA96.13348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631181CAGCACTCTTATCTACATATATGTAGATAAGAGTGCTG0.049800.016300.741400.750000.983700.62500


Target Position: 1428, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428CUUUCCCUACCUUUAUAUU78.0186407

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5142819CTTTCCCTACCTTTATATT1/1/0/091.46CDK4NM_000075.21NANANA12:58142066..58142084(-)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761446CTTTCCCTACCTTTATATTAATATAAAGGTAGGGAAAG0.715800.188600.629300.750001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806CUAAAAAUACAAAAUUAGU80.1296330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451824CTAAAAATACAAAATTAGTACTAATTTTGTATTTTTAG0.214100.146500.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1804-1826TACTAAAAATACAAAATTAGTCAACUAAUUUUGUAUUUUUAGUACUAAAAAUACAAAAUUAGUCAU-4.3-9.700


Target Position: 1492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492UCUUUUUUUUUUUUUUAAU68.0246921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931510TCTTTTTTTTTTTTTTAATATTAAAAAAAAAAAAAAGA0.320000.192300.715500.750001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658CUGAAAUUGCUUCUUUGAA84.8742160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1901676CTGAAATTGCTTCTTTGAATTCAAAGAAGCAATTTCAG0.254400.061200.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1656-1678AACTGAAATTGCTTCTTTGAATAUUCAAAGAAGCAAUUUCAGUUCUGAAAUUGCUUCUUUGAAUAU20.47.4


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GUCCACAUAUGCAACACCU79.7132352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340874GTCCACATATGCAACACCTAGGTGTTGCATATGTGGAC0.033400.003200.474100.500001.000001.00000


Target Position: 1606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1606CAGGGCCUAGGAAGUCAGU70.113807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471624CAGGGCCTAGGAAGTCAGTACTGACTTCCTAGGCCCTG0.035700.001200.577600.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UGUUCCCUCUUGUCCCUUU70.773767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1151431TGTTCCCTCTTGTCCCTTTAAAGGGACAAGAGGGAACA0.233400.067900.706900.750001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774AGCCUGACUAACAUGGUGA80.3258322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881792AGCCTGACTAACATGGTGATCACCATGTTAGTCAGGCT0.094100.002900.629300.500000.962000.62500


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397GAGUGUGAGAGUCCCCAAU84.5554177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283415GAGTGTGAGAGTCCCCAATATTGGGGACTCTCACACTC0.039500.003400.801700.750000.902200.75000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635GACUGACAAAGCUUAGAAA100.4241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361653GACTGACAAAGCTTAGAAATTTCTAAGCTTTGTCAGTC0.054800.001500.819000.750001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596GGUUAAAUUACAGGGCCUA86.5221122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351614GGTTAAATTACAGGGCCTATAGGCCCTGTAATTTAACC0.020100.004700.681001.000001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GACUUUUAACCCACACAAG77.8051420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521138GACTTTTAACCCACACAAGCTTGTGTGGGTTAAAAGTC0.282500.052300.681000.500001.000001.00000


Target Position: 1862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862GGGAGACUGAGGCAGGAGG63.77881164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511880GGGAGACTGAGGCAGGAGGCCTCCTGCCTCAGTCTCCC0.012800.001200.646600.500001.000001.00000


Target Position: 1147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147UGCCUUUCGAGCUCUGCAG57.1631499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111165TGCCTTTCGAGCTCTGCAGCTGCAGAGCTCGAAAGGCA0.081500.021900.569000.500000.918500.62500


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485AUAAUGGUCUUUUUUUUUU70.6637775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411503ATAATGGTCTTTTTTTTTTAAAAAAAAAAGACCATTAT0.420200.134600.543100.500001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646CUUAGAAAGGAACUGAAAU81.9989252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781664CTTAGAAAGGAACTGAAATATTTCAGTTCCTTTCTAAG0.235400.042600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1644-1666AGCTTAGAAAGGAACTGAAATTGAUUUCAGUUCCUUUCUAAGCUCUUAGAAAGGAACUGAAAUUGU19.27.1


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733GGUGACAAGUGGUGGAACA91.236341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226751GGTGACAAGTGGTGGAACATGTTCCACCACTTGTCACC0.075700.012800.646600.750001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575CAUGUAGACCAGGACCUAA95.568410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223593CATGTAGACCAGGACCTAATTAGGTCCTGGTCTACATG0.077800.010800.620700.750001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CCAUCAGCACAGUUCGUGA92.689828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246459CCATCAGCACAGTTCGTGATCACGAACTGTGCTGATGG0.057800.007800.620700.750000.967400.62500


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885GGAGUGUUGGCUGUAUCUU80.7564305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230903GGAGTGTTGGCTGTATCTTAAGATACAGCCAACACTCC0.071900.016100.732801.000001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795CCCUGUCUCUACUAAAAAU91.943534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571813CCCTGTCTCTACTAAAAATATTTTTAGTAGAGACAGGG0.333300.018400.982801.000001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854CAGUCCACAUAUGCAACAC73.0115658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343872CAGTCCACATATGCAACACGTGTTGCATATGTGGACTG0.191900.004100.491400.500001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924AGCCUCUCUUCUGUGGAAA76.323489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248942AGCCTCTCTTCTGTGGAAATTTCCACAGAAGAGAGGCT0.078800.004800.853400.750001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281CUUGAUCUGAGAAUGGCUA83.7426201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348299CTTGATCTGAGAATGGCTATAGCCATTCTCAGATCAAG0.039700.004500.465500.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372GGCUUCUCCUUCUCCUUCC64.09171142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171390GGCTTCTCCTTCTCCTTCCGGAAGGAGAAGGAGAAGCC0.836200.713700.629300.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962CUGUGUCAAAAAAAAAAAA86.4519127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021980CTGTGTCAAAAAAAAAAAATTTTTTTTTTTTGACACAG0.577100.011500.784500.750001.000001.00000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190GGUAAUCCGGAGUGAGCAA91.020343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1061208GGTAATCCGGAGTGAGCAATTGCTCACTCCGGATTACC0.266600.048100.706901.000001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514UCUUCCUCUGUUUGGCUUU61.27741303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301532TCTTCCTCTGTTTGGCTTTAAAGCCAAACAGAGGAAGA0.020700.017300.724100.750000.994601.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339CCUAUGGGACAGUGUACAA93.042725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306357CCTATGGGACAGTGTACAATTGTACACTGTCCCATAGG0.096900.002300.698301.000000.989100.62500


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107UGCUGGAAAUGCUGACUUU80.6124309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341125TGCTGGAAATGCTGACTTTAAAGTCAGCATTTCCAGCA0.133100.006500.853400.750000.978300.75000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624GCUUGCCAGCCGAAACGAU78.7706379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161642GCTTGCCAGCCGAAACGATATCGTTTCGGCTGGCAAGC0.348400.018000.672401.000000.923900.62500


Target Position: 1489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489UGGUCUUUUUUUUUUUUUU70.5582780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951507TGGTCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGACCA0.313800.205000.844800.750001.000001.00000


Target Position: 1979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979AAAGAAUAUAGAUUUUUAA92.717727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471997AAAGAATATAGATTTTTAATTAAAAATCTATATTCTTT0.147800.143100.465500.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884UGGAGUGUUGGCUGUAUCU73.5167620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279902TGGAGTGTTGGCTGTATCTAGATACAGCCAACACTCCA0.054600.003200.620700.500001.000001.00000


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323AGAUUACUUUGCUGCCUUA94.655214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921341AGATTACTTTGCTGCCTTATAAGGCAGCAAAGTAATCT0.341200.225600.689700.750001.000001.00000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GGUACCGAGCUCCCGAAGU68.2133908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285846GGTACCGAGCTCCCGAAGTACTTCGGGAGCTCGGTACC0.072600.003000.646600.750000.978300.87500


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449GGGUCCUUUUUUAUACAGG68.745888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361467GGGTCCTTTTTTATACAGGCCTGTATAAAAAAGGACCC0.061900.022800.646600.500000.913000.62500


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UCCCUUUCCCUACCUUUAU62.47471237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941443TCCCTTTCCCTACCTTTATATAAAGGTAGGGAAAGGGA0.467600.074900.827600.750001.000001.00000


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982GAAUAUAGAUUUUUAAAUG87.2388109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2662000GAATATAGATTTTTAAATGCATTTAAAAATCTATATTC0.123100.109100.517200.500001.000001.00000


Target Position: 1666, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666GCUUCUUUGAAUAUGGAUU80.5652313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471684GCTTCTTTGAATATGGATTAATCCATATTCAAAGAAGC0.104900.004900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1664-1686TTGCTTCTTTGAATATGGATTTTAAUCCAUAUUCAAAGAAGCAAGCUUCUUUGAAUAUGGAUUUUU21.210.3


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929CUCUUCUGUGGAAACUCUG65.55381051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308947CTCTTCTGTGGAAACTCTGCAGAGTTTCCACAGAAGAG0.198700.015000.525900.500001.000001.00000


Target Position: 1579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1579GCAAAACCUUAAAGACUGG68.9213881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321597GCAAAACCTTAAAGACTGGCCAGTCTTTAAGGTTTTGC0.020300.012100.508600.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GGGCAAUCUUUGCCUUUAU85.8312140

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1126519GGGCAATCTTTGCCTTTAT1/1/0/097.21CDK4NM_000075.21NANANA12:58142229..58142247(-)00CDK4(0.002)


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186UGAAGGUAAUCCGGAGUGA74.5629564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881204TGAAGGTAATCCGGAGTGATCACTCCGGATTACCTTCA0.094800.012700.500000.500000.989101.00000


Target Position: 67, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
67GCCCUCCCAGUUUCCGCGC41.14791934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27385GCCCTCCCAGTTTCCGCGCGCGCGGAAACTGGGAGGGC0.041600.040800.577600.500000.913000.75000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773CAGCCUGACUAACAUGGUG76.4495484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171791CAGCCTGACTAACATGGTGCACCATGTTAGTCAGGCTG0.091200.002300.491400.500000.962000.62500


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GCCUUAAUGACAUUCCCCU75.7062513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1271354GCCTTAATGACATTCCCCTAGGGGAATGTCATTAAGGC0.930700.292600.655200.750001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GAAAUUGCUUCUUUGAAUA94.425416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731678GAAATTGCTTCTTTGAATATATTCAAAGAAGCAATTTC0.312200.086900.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1658-1680CTGAAATTGCTTCTTTGAATATGUAUUCAAAGAAGCAAUUUCAGGAAAUUGCUUCUUUGAAUAUGU7.414.0


Target Position: 1364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364CCUUUUGAGGCUUCUCCUU73.2978635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171382CCTTTTGAGGCTTCTCCTTAAGGAGAAGCCTCAAAAGG0.832700.002000.706901.000000.902200.87500


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470AAACAAAACAAAGAAAUAA85.7144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521488AAACAAAACAAAGAAATAATTATTTCTTTGTTTTGTTT0.098600.100700.465500.500001.000001.00000


Target Position: 1534, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534CCAUUGUGCGAUUUGGAAA87.3315108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551552CCATTGTGCGATTTGGAAATTTCCAAATCGCACAATGG0.011600.003500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1532-1554TGCCATTGTGCGATTTGGAAAAAUUUCCAAAUCGCACAAUGGCACCAUUGUGCGAUUUGGAAAAAU20.118.1


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389CCCAUUUCUCUACACUAAG69.6262834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3391407CCCATTTCTCTACACTAAGCTTAGTGTAGAGAAATGGG0.017900.019500.853400.750001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349UCCCCUCCCACCUCUCCUU57.78151470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931367TCCCCTCCCACCTCTCCTTAAGGAGAGGTGGGAGGGGA0.488700.517200.732800.750001.000001.00000


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575UCCUGCAAAACCUUAAAGA69.6735830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3141593TCCTGCAAAACCTTAAAGATCTTTAAGGTTTTGCAGGA0.132000.038800.646600.500001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458UUUAUACAGGAAAAACAAA77.8022421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071476TTTATACAGGAAAAACAAATTTGTTTTTCCTGTATAAA0.342700.020600.500000.500001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370GAGGCUUCUCCUUCUCCUU81.8272257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1231388GAGGCTTCTCCTTCTCCTTAAGGAGAAGGAGAAGCCTC0.792200.046000.672400.750000.934800.62500


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465AGGAAAAACAAAACAAAGA79.5928354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231483AGGAAAAACAAAACAAAGATCTTTGTTTTGTTTTTCCT0.158200.029100.620700.500001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382UCUCCUUCCCAUUUCUCUA79.7495350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281400TCTCCTTCCCATTTCTCTATAGAGAAATGGGAAGGAGA0.825800.702400.551700.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159UCUGCAGCACUCUUAUCUA87.6046102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2361177TCTGCAGCACTCTTATCTATAGATAAGAGTGCTGCAGA0.069300.006300.551700.750001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463ACAGGAAAAACAAAACAAA87.0607111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371481ACAGGAAAAACAAAACAAATTTGTTTTGTTTTTCCTGT0.190100.006300.706900.750001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775GCCUGACUAACAUGGUGAA91.813335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731793GCCTGACTAACATGGTGAATTCACCATGTTAGTCAGGC0.102000.003500.827601.000000.962000.62500


Target Position: 1578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578UGCAAAACCUUAAAGACUG64.79581090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901596TGCAAAACCTTAAAGACTGCAGTCTTTAAGGTTTTGCA0.036000.026500.569000.500001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632CUUGACUGACAAAGCUUAG68.3763902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501650CTTGACTGACAAAGCTTAGCTAAGCTTTGTCAGTCAAG0.084500.006500.465500.500001.000001.00000


Target Position: 66, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
66CGCCCUCCCAGUUUCCGCG55.34561580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34484CGCCCTCCCAGTTTCCGCGCGCGGAAACTGGGAGGGCG0.057500.033800.500000.500000.923900.62500


Target Position: 1801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801CUCUACUAAAAAUACAAAA86.0729137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821819CTCTACTAAAAATACAAAATTTTGTATTTTTAGTAGAG0.928900.237100.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1799-1821GTCTCTACTAAAAATACAAAATTUUUUGUAUUUUUAGUAGAGACCUCUACUAAAAAUACAAAAUUU6.920.100


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810CCGUGGUUGUUACACUCUG72.5156673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341828CCGTGGTTGTTACACTCTGCAGAGTGTAACAACCACGG0.052700.001300.629300.750000.962000.75000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886GAGUGUUGGCUGUAUCUUU92.983826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
213904GAGTGTTGGCTGTATCTTTAAAGATACAGCCAACACTC0.084000.027900.810300.750001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564UGGUGUUUGAGCAUGUAGA79.9871336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319582TGGTGTTTGAGCATGTAGATCTACATGCTCAAACACCA0.049800.005100.620700.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967UCAAAAAAAAAAAAAGAAU68.941879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611985TCAAAAAAAAAAAAAGAATATTCTTTTTTTTTTTTTGA0.593800.399600.715500.750001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375UUCUCCUUCUCCUUCCCAU66.6404990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811393TTCTCCTTCTCCTTCCCATATGGGAAGGAGAAGGAGAA0.831700.640000.517200.500001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237GCUGCCAUUUCCCUUCUGG61.36441298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511255GCTGCCATTTCCCTTCTGGCCAGAAGGGAAATGGCAGC0.032100.001100.508600.500000.967400.62500


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429UUUCCCUACCUUUAUAUUU65.26571065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051447TTTCCCTACCTTTATATTTAAATATAAAGGTAGGGAAA0.464200.177400.500000.500001.000001.00000


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33CGGUCACGUGCCCAGAACG69.6538831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34451CGGTCACGTGCCCAGAACGCGTTCTGGGCACGTGACCG0.014800.001700.637900.500000.902200.75000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CUAAGGACAUAUCUGGACA89.243671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346608CTAAGGACATATCTGGACATGTCCAGATATGTCCTTAG0.019300.018200.465500.500001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887AGUGUUGGCUGUAUCUUUG73.259641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295905AGTGTTGGCTGTATCTTTGCAAAGATACAGCCAACACT0.034700.015300.560300.500001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483AAAUAAUGGUCUUUUUUUU81.7181262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2961501AAATAATGGTCTTTTTTTTAAAAAAAAGACCATTATTT0.399700.062400.500000.500001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300GGUCCUCCUCCAUCUUUCU81.5391271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691318GGTCCTCCTCCATCTTTCTAGAAAGATGGAGGAGGACC0.130200.026200.629300.750001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792AAACCCUGUCUCUACUAAA90.058956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011810AAACCCTGTCTCTACTAAATTTAGTAGAGACAGGGTTT0.287100.010400.500000.500001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968CAAAAAAAAAAAAAGAAUA89.068775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931986CAAAAAAAAAAAAAGAATATATTCTTTTTTTTTTTTTG0.615000.388600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1966-1988GTCAAAAAAAAAAAAAGAATATAUAUUCUUUUUUUUUUUUUGACCAAAAAAAAAAAAAGAAUAUAU5.3-11.300


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GGCUGAAAUUGGUGUCGGU85.7077143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311337GGCTGAAATTGGTGTCGGTACCGACACCAATTTCAGCC0.027800.028600.646600.750001.000001.00000


Target Position: 562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
562CCUGGUGUUUGAGCAUGUA88.546587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332580CCTGGTGTTTGAGCATGTATACATGCTCAAACACCAGG0.230400.001500.663801.000001.000001.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655GAACUGAAAUUGCUUCUUU89.047276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1391673GAACTGAAATTGCTTCTTTAAAGAAGCAATTTCAGTTC0.182700.030500.672400.750001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191GUAAUCCGGAGUGAGCAAU69.4491841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441209GTAATCCGGAGTGAGCAATATTGCTCACTCCGGATTAC0.258500.060300.672400.750001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CUGGUGUUUGAGCAUGUAG70.3907791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339581CTGGTGTTTGAGCATGTAGCTACATGCTCAAACACCAG0.217200.001300.612100.500001.000001.00000


Target Position: 573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
573AGCAUGUAGACCAGGACCU68.1429912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309591AGCATGTAGACCAGGACCTAGGTCCTGGTCTACATGCT0.029000.008000.508600.500001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301GUCCUCCUCCAUCUUUCUA81.1748286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441319GTCCTCCTCCATCTTTCTATAGAAAGATGGAGGAGGAC0.171300.033700.646600.750001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376UCUCCUUCUCCUUCCCAUU67.4326950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671394TCTCCTTCTCCTTCCCATTAATGGGAAGGAGAAGGAGA0.832500.639500.715500.750001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344GACAUUCCCCUCCCACCUC63.06661200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531362GACATTCCCCTCCCACCTCGAGGTGGGAGGGGAATGTC0.653700.710900.508600.500001.000001.00000


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992UUUUAAAUGGCAAAAAAAA74.6067560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2872010TTTTAAATGGCAAAAAAAATTTTTTTTGCCATTTAAAA0.830700.234300.500000.500001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508AAUGUUUCUUCCUCUGUUU78.1488400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761526AATGTTTCTTCCTCTGTTTAAACAGAGGAAGAAACATT0.170200.105400.508600.500001.000001.00000


Target Position: 1803, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803CUACUAAAAAUACAAAAUU81.2808282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1231821CTACTAAAAATACAAAATTAATTTTGTATTTTTAGTAG0.304700.214500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1801-1823CTCTACTAAAAATACAAAATTAGAAUUUUGUAUUUUUAGUAGAGCUACUAAAAAUACAAAAUUAGU5.36.600


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640ACAAAGCUUAGAAAGGAAC60.5331350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331658ACAAAGCTTAGAAAGGAACGTTCCTTTCTAAGCTTTGT0.187600.037900.560300.500001.000001.00000


Target Position: 1987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987UAGAUUUUUAAAUGGCAAA75.3336532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1982005TAGATTTTTAAATGGCAAATTTGCCATTTAAAAATCTA0.510400.111900.672400.500001.000001.00000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415UGGAGGAGGAGGUGGAGGA70.4385788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343433TGGAGGAGGAGGTGGAGGATCCTCCACCTCCTCCTCCA0.026800.001700.474100.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650GAAAGGAACUGAAAUUGCU84.7622167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1648-1670TAGAAAGGAACTGAAATTGCTTCAGCAAUUUCAGUUCCUUUCUAGAAAGGAACUGAAAUUGCUUCU14.018.7


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GGCCUGGCCAGAAUCUACA83.7508200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232788GGCCTGGCCAGAATCTACATGTAGATTCTGGCCAGGCC0.169200.006800.793100.750000.929300.62500


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001GCAAAAAAAAAAAAAAAAA85.9047139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112019GCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGC0.946600.830900.853401.000001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CAGUGUACAAGGCCCGUGA83.6002204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341366CAGTGTACAAGGCCCGTGATCACGGGCCTTGTACACTG0.015900.003300.560300.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CCCUCUUGUCCCUUUCCCU73.2387643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461435CCCTCTTGTCCCTTTCCCTAGGGAAAGGGACAAGAGGG0.183700.025100.646600.750001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201GUGAGCAAUGGAGUGGCUG60.81721332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771219GTGAGCAATGGAGTGGCTGCAGCCACTCCATTGCTCAC0.092400.004200.508600.500001.000001.00000


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379CCUUCUCCUUCCCAUUUCU77.2882450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831397CCTTCTCCTTCCCATTTCTAGAAATGGGAAGGAGAAGG0.867800.662500.620700.750001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68CCCUCCCAGUUUCCGCGCG46.99091842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
35286CCCTCCCAGTTTCCGCGCGCGCGCGGAAACTGGGAGGG0.012500.013000.569000.500000.907600.62500


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAUUUCCUUCAUGCCAAUU74.3915570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280695GATTTCCTTCATGCCAATTAATTGGCATGAAGGAAATC0.040000.004800.672400.750001.000001.00000


Target Position: 1863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1863GGAGACUGAGGCAGGAGGA82.9983220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481881GGAGACTGAGGCAGGAGGATCCTCCTGCCTCAGTCTCC0.013900.005900.500000.750001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072GGUACCUGAGAUGGAGGAG67.344955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161090GGTACCTGAGATGGAGGAGCTCCTCCATCTCAGGTACC0.136000.002000.543100.750000.989100.75000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865AGACUGAGGCAGGAGGAUC65.69261047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451883AGACTGAGGCAGGAGGATCGATCCTCCTGCCTCAGTCT0.102100.003300.543100.500001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CGGUGGUACCUGAGAUGGA88.886981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191086CGGTGGTACCTGAGATGGATCCATCTCAGGTACCACCG0.055600.001800.543100.750000.945700.62500


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117GCUGACUUUUAACCCACAC67.0189971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191135GCTGACTTTTAACCCACACGTGTGGGTTAAAAGTCAGC0.827400.266800.560300.750001.000001.00000


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241CCAUUUCCCUUCUGGACAC69.2331860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901259CCATTTCCCTTCTGGACACGTGTCCAGAAGGGAAATGG0.065300.002800.551700.750000.907600.87500


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064CAGUCGGUGGUACCUGAGA81.3742278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301082CAGTCGGTGGTACCTGAGATCTCAGGTACCACCGACTG0.034700.001600.560300.500000.945701.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349AGUGUACAAGGCCCGUGAU76.9972463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331367AGTGTACAAGGCCCGTGATATCACGGGCCTTGTACACT0.020400.003000.525900.750001.000001.00000


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607AGGGCCUAGGAAGUCAGUG57.24721496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501625AGGGCCTAGGAAGTCAGTGCACTGACTTCCTAGGCCCT0.020200.002700.551700.500001.000001.00000


Target Position: 574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574GCAUGUAGACCAGGACCUA93.235423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
237592GCATGTAGACCAGGACCTATAGGTCCTGGTCTACATGC0.066000.009100.681001.000001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246UCCCUUCUGGACACUGAGA69.1135871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341264TCCCTTCTGGACACTGAGATCTCAGTGTCCAGAAGGGA0.046300.002500.646600.500000.940200.62500


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827UGGUACCGAGCUCCCGAAG52.06741708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344845TGGTACCGAGCTCCCGAAGCTTCGGGAGCTCGGTACCA0.065300.001200.706900.500000.956500.75000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676AGAUUUCCUUCAUGCCAAU81.5685269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302694AGATTTCCTTCATGCCAATATTGGCATGAAGGAAATCT0.041400.002400.715500.750001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988AGAUUUUUAAAUGGCAAAA77.7303427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1012006AGATTTTTAAATGGCAAAATTTTGCCATTTAAAAATCT0.533700.127900.724100.750001.000001.00000


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928UCUCUUCUGUGGAAACUCU73.9042602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306946TCTCTTCTGTGGAAACTCTAGAGTTTCCACAGAAGAGA0.118900.013900.500000.500001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582ACCAGGACCUAAGGACAUA81.5494270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151600ACCAGGACCTAAGGACATATATGTCCTTAGGTCCTGGT0.428500.020100.810300.750001.000001.00000


Target Position: 90, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
90CUUUGGCAGCUGGUCACAU76.5289480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337108CTTTGGCAGCTGGTCACATATGTGACCAGCTGCCAAAG0.047700.002500.482800.750001.000001.00000


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608GGGCCUAGGAAGUCAGUGG68.1284913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471626GGGCCTAGGAAGTCAGTGGCCACTGACTTCCTAGGCCC0.014100.004500.646600.500001.000001.00000


Target Position: 1426, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426CCCUUUCCCUACCUUUAUA87.5416104

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6142619CCCTTTCCCTACCTTTATA1/1/0/090.92CDK4NM_000075.21NANANA12:58142068..58142086(-)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721444CCCTTTCCCTACCTTTATATATAAAGGTAGGGAAAGGG0.741800.137500.948301.000001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157GCUCUGCAGCACUCUUAUC74.7046557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461175GCTCTGCAGCACTCTTATCGATAAGAGTGCTGCAGAGC0.087500.005000.672400.750000.923900.62500


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412AUGUUCCCUCUUGUCCCUU59.11091417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651430ATGTTCCCTCTTGTCCCTTAAGGGACAAGAGGGAACAT0.226300.071600.517200.500001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439UCCCAUCAGCACAGUUCGU62.47061238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301457TCCCATCAGCACAGTTCGTACGAACTGTGCTGATGGGA0.052000.002400.594800.500000.962000.75000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923AAGCCUCUCUUCUGUGGAA87.878895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353941AAGCCTCTCTTCTGTGGAATTCCACAGAAGAGAGGCTT0.055600.003800.465500.500001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423UGUCCCUUUCCCUACCUUU68.9662876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1251441TGTCCCTTTCCCTACCTTTAAAGGTAGGGAAAGGGACA0.248000.096700.706900.750001.000001.00000


Target Position: 649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649UCUGAUGCGCCAGUUUCUA71.6495720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225667TCTGATGCGCCAGTTTCTATAGAAACTGGCGCATCAGA0.195500.007600.551700.750000.923900.62500


Target Position: 1302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302UCCUCCUCCAUCUUUCUAC56.60931529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431320TCCTCCTCCATCTTTCTACGTAGAAAGATGGAGGAGGA0.034000.001200.689700.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314UUUCUACAGAGAUUACUUU72.365685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301332TTTCTACAGAGATTACTTTAAAGTAATCTCTGTAGAAA0.403100.004300.500000.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108UGGUGAGGGUGGGGGUGAG59.21681411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259126TGGTGAGGGTGGGGGTGAGCTCACCCCCACCCTCACCA0.052200.026000.534500.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057CCCAGUGCAGUCGGUGGUA76.6072474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451075CCCAGTGCAGTCGGTGGTATACCACCGACTGCACTGGG0.036200.001200.810301.000000.956500.62500


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581GACCAGGACCUAAGGACAU82.0083251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177599GACCAGGACCTAAGGACATATGTCCTTAGGTCCTGGTC0.429800.014900.663800.750001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644AGCUUAGAAAGGAACUGAA89.870658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1551662AGCTTAGAAAGGAACTGAATTCAGTTCCTTTCTAAGCT0.153300.044400.681000.750001.000001.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298AGGGUCCUCCUCCAUCUUU69.4969840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171316AGGGTCCTCCTCCATCTTTAAAGATGGAGGAGGACCCT0.080900.010000.844800.750000.940200.62500


Target Position: 1109, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109CUGGAAAUGCUGACUUUUA89.785161

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2110919CTGGAAATGCTGACTTTTA1/1/0/094.96CDK4NM_000075.21NANANA12:58142385,58142965..58142400,58142967(-)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1181127CTGGAAATGCTGACTTTTATAAAAGTCAGCATTTCCAG0.318500.037800.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1107-1129TGCTGGAAATGCTGACTTTTAACUAAAAGUCAGCAUUUCCAGCACUGGAAAUGCUGACUUUUAACU13.320.131


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CAAGUGGUGGAACAGUCAA89.608464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306756CAAGTGGTGGAACAGTCAATTGACTGTTCCACCACTTG0.032600.008100.500000.750001.000001.00000


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144CUCUGCCUUUCGAGCUCUG65.07821078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781162CTCTGCCTTTCGAGCTCTGCAGAGCTCGAAAGGCAGAG0.040300.007000.525900.500000.918501.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736GACAAGUGGUGGAACAGUC78.128401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293754GACAAGTGGTGGAACAGTCGACTGTTCCACCACTTGTC0.068200.016400.500000.500001.000001.00000


Target Position: 65, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
65CCGCCCUCCCAGUUUCCGC49.11511781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32283CCGCCCTCCCAGTTTCCGCGCGGAAACTGGGAGGGCGG0.081500.014300.491400.500000.956500.62500


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220CCAUGGAAGGAAGAAAAGC60.29851363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201238CCATGGAAGGAAGAAAAGCGCTTTTCTTCCTTCCATGG0.087200.013000.491400.500000.994600.75000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CUGGUGACAAGUGGUGGAA77.4745443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333749CTGGTGACAAGTGGTGGAATTCCACCACTTGTCACCAG0.128200.001500.612100.750001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487AAUGGUCUUUUUUUUUUUU74.3935569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721505AATGGTCTTTTTTTTTTTTAAAAAAAAAAAAGACCATT0.447100.173800.508600.500001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595UGGUUAAAUUACAGGGCCU71.5314729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271613TGGTTAAATTACAGGGCCTAGGCCCTGTAATTTAACCA0.021400.002500.500000.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313CUUUCUACAGAGAUUACUU87.3632107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911331CTTTCTACAGAGATTACTTAAGTAATCTCTGTAGAAAG0.066900.004100.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1311-1333ATCTTTCTACAGAGATTACTTTGAAGUAAUCUCUGUAGAAAGAUCUUUCUACAGAGAUUACUUUGU14.514.610


Target Position: 561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
561CCCUGGUGUUUGAGCAUGU77.4056445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322579CCCTGGTGTTTGAGCATGTACATGCTCAAACACCAGGG0.626000.001800.784500.750001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847UCUUCUGCAGUCCACAUAU75.8016510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292865TCTTCTGCAGTCCACATATATATGTGGACTGCAGAAGA0.035700.026000.681000.750001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813UGGUUGUUACACUCUGGUA86.0753136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216831TGGTTGTTACACTCTGGTATACCAGAGTGTAACAACCA0.082200.009100.663800.750001.000001.00000


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337CCUUAAUGACAUUCCCCUC71.4972730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491355CCTTAATGACATTCCCCTCGAGGGGAATGTCATTAAGG0.959200.295800.534500.750000.989100.62500


Target Position: 1427, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427CCUUUCCCUACCUUUAUAU77.8898414

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4142719CCTTTCCCTACCTTTATAT1/1/0/091.46CDK4NM_000075.21NANANA12:58142067..58142085(-)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521445CCTTTCCCTACCTTTATATATATAAAGGTAGGGAAAGG0.724000.190300.801701.000001.000001.00000


Target Position: 1168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CUCUUAUCUACAUAAGGAU85.007156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1166-1188CACTCTTATCTACATAAGGATGAAUCCUUAUGUAGAUAAGAGUGCUCUUAUCUACAUAAGGAUGAU19.916.020


Target Position: 1447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447UGGGGUCCUUUUUUAUACA79.5245356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181465TGGGGTCCTTTTTTATACATGTATAAAAAAGGACCCCA0.177700.005900.637900.500001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066GUCGGUGGUACCUGAGAUG69.2552855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711084GTCGGTGGTACCTGAGATGCATCTCAGGTACCACCGAC0.054600.003500.663800.500000.945700.87500


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387UUCCCAUUUCUCUACACUA81.8094259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3121405TTCCCATTTCTCTACACTATAGTGTAGAGAAATGGGAA0.249100.233700.500000.500001.000001.00000


Target Position: 1997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997AAUGGCAAAAAAAAAAAAA77.1262455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792015AATGGCAAAAAAAAAAAAATTTTTTTTTTTTTGCCATT0.894400.703600.508600.500001.000001.00000


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378UCCUUCUCCUUCCCAUUUC50.39581754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501396TCCTTCTCCTTCCCATTTCGAAATGGGAAGGAGAAGGA0.866100.645300.698300.500001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688UGCCAAUUGCAUCGUUCAC59.07871418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
242706TGCCAATTGCATCGTTCACGTGAACGATGCAATTGGCA0.062400.009400.560300.500000.945700.62500


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584ACCUUAAAGACUGGUUAAA76.6712471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171602ACCTTAAAGACTGGTTAAATTTAACCAGTCTTTAAGGT0.026500.007000.853400.750000.978300.62500


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917CGUCGAAAGCCUCUCUUCU82.4786236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289935CGTCGAAAGCCTCTCTTCTAGAAGAGAGGCTTTCGACG0.036100.013000.551700.750000.978300.62500


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481AGAAAUAAUGGUCUUUUUU77.6968431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301499AGAAATAATGGTCTTTTTTAAAAAAGACCATTATTTCT0.391700.028100.724100.750001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631AGCCGAAACGAUCAAGGAU78.4885388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340649AGCCGAAACGATCAAGGATATCCTTGATCGTTTCGGCT0.017000.007700.672400.750001.000001.00000


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448GGGGUCCUUUUUUAUACAG72.0395704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701466GGGGTCCTTTTTTATACAGCTGTATAAAAAAGGACCCC0.129900.017700.706900.750001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111GGAAAUGCUGACUUUUAAC77.6354436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421129GGAAATGCTGACTTTTAACGTTAAAAGTCAGCATTTCC0.342500.101200.724100.750001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312UCUUUCUACAGAGAUUACU62.57111228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761330TCTTTCTACAGAGATTACTAGTAATCTCTGTAGAAAGA0.040800.003900.517200.500000.989100.62500


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486UAAUGGUCUUUUUUUUUUU73.7288613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511504TAATGGTCTTTTTTTTTTTAAAAAAAAAAAGACCATTA0.437200.147400.534500.500001.000001.00000


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804UACUAAAAAUACAAAAUUA93.620421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721822TACTAAAAATACAAAATTATAATTTTGTATTTTTAGTA0.245100.159000.646600.500001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565GGUGUUUGAGCAUGUAGAC76.9871464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328583GGTGTTTGAGCATGTAGACGTCTACATGCTCAAACACC0.021200.002700.534500.750001.000001.00000


Target Position: 1467, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467GAAAAACAAAACAAAGAAA93.857619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641485GAAAAACAAAACAAAGAAATTTCTTTGTTTTGTTTTTC0.134400.126000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1465-1487AGGAAAAACAAAACAAAGAAATAUUUCUUUGUUUUGUUUUUCCUGAAAAACAAAACAAAGAAAUAU12.25.610


Target Position: 1585, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585CCUUAAAGACUGGUUAAAU85.4388148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041603CCTTAAAGACTGGTTAAATATTTAACCAGTCTTTAAGG0.033000.009300.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1583-1605AACCTTAAAGACTGGTTAAATTAAUUUAACCAGUCUUUAAGGUUCCUUAAAGACUGGUUAAAUUAU14.01.3


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918GUCGAAAGCCUCUCUUCUG73.2049647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299936GTCGAAAGCCTCTCTTCTGCAGAAGAGAGGCTTTCGAC0.033900.013200.534500.500000.978300.62500


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CCUAAGGACAUAUCUGGAC67.3453954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329607CCTAAGGACATATCTGGACGTCCAGATATGTCCTTAGG0.021100.020100.525900.750001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GUUAAAUUACAGGGCCUAG69.1723867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491615GTTAAATTACAGGGCCTAGCTAGGCCCTGTAATTTAAC0.013200.013100.474100.500001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703CUCACGCCUAUAAUCCCAG63.50811179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371721CTCACGCCTATAATCCCAGCTGGGATTATAGGCGTGAG0.062400.003600.525900.500001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931CUUCUGUGGAAACUCUGAA85.014155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349949CTTCTGTGGAAACTCTGAATTCAGAGTTTCCACAGAAG0.235500.027600.465500.750001.000001.00000


Target Position: 1576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1576CCUGCAAAACCUUAAAGAC74.3235578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521594CCTGCAAAACCTTAAAGACGTCTTTAAGGTTTTGCAGG0.654000.020700.525900.750001.000001.00000


Target Position: 1482, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GAAAUAAUGGUCUUUUUUU86.6391120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1141500GAAATAATGGTCTTTTTTTAAAAAAAGACCATTATTTC0.394100.040800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1480-1502AAGAAATAATGGTCTTTTTTTTTAAAAAAAGACCAUUAUUUCUUGAAAUAAUGGUCUUUUUUUUUU-5.9-10.320


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109GGUGAGGGUGGGGGUGAGG54.35141620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
273127GGTGAGGGTGGGGGTGAGGCCTCACCCCCACCCTCACC0.054200.022400.508600.500001.000001.00000


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365CUUUUGAGGCUUCUCCUUC64.08691143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541383CTTTTGAGGCTTCTCCTTCGAAGGAGAAGCCTCAAAAG0.801400.002200.465500.500000.902201.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800UCUCUACUAAAAAUACAAA84.717171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601818TCTCTACTAAAAATACAAATTTGTATTTTTAGTAGAGA0.947900.205200.724100.750001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371AGGCUUCUCCUUCUCCUUC61.68821280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621389AGGCTTCTCCTTCTCCTTCGAAGGAGAAGGAGAAGCCT0.791500.407600.672400.500000.956500.62500


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218UGCCAUGGAAGGAAGAAAA78.9186373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651236TGCCATGGAAGGAAGAAAATTTTCTTCCTTCCATGGCA0.435500.415500.853400.750000.972800.75000


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384UCCUUCCCAUUUCUCUACA68.6235893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971402TCCTTCCCATTTCTCTACATGTAGAGAAATGGGAAGGA0.728300.639600.663800.500001.000001.00000


Target Position: 1990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1990AUUUUUAAAUGGCAAAAAA82.5302233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3062008ATTTTTAAATGGCAAAAAATTTTTTGCCATTTAAAAAT0.571500.139800.508600.500001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639GACAAAGCUUAGAAAGGAA98.39034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221657GACAAAGCTTAGAAAGGAATTCCTTTCTAAGCTTTGTC0.078400.054900.646600.750001.000001.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418CCUCUUGUCCCUUUCCCUA83.8292197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201436CCTCTTGTCCCTTTCCCTATAGGGAAAGGGACAAGAGG0.225900.037200.672401.000001.000001.00000


Target Position: 1480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480AAGAAAUAAUGGUCUUUUU82.4425238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961498AAGAAATAATGGTCTTTTTAAAAAGACCATTATTTCTT0.234000.017000.637900.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GCCUGGCCAGAAUCUACAG72.2666690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159789GCCTGGCCAGAATCTACAGCTGTAGATTCTGGCCAGGC0.209500.018100.715500.750001.000001.00000


Target Position: 1975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975AAAAAAAGAAUAUAGAUUU80.9902295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021993AAAAAAAGAATATAGATTTAAATCTATATTCTTTTTTT0.198700.195200.500000.500001.000001.00000


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GAUGAAGGUAAUCCGGAGU74.488566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411202GATGAAGGTAATCCGGAGTACTCCGGATTACCTTCATC0.070700.005600.474100.500000.989101.00000


Target Position: 1993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1993UUUAAAUGGCAAAAAAAAA74.3769572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3042011TTTAAATGGCAAAAAAAAATTTTTTTTTGCCATTTAAA0.882700.626600.500000.500001.000001.00000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595GACAUAUCUGGACAAGGCA88.889680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351613GACATATCTGGACAAGGCATGCCTTGTCCAGATATGTC0.024700.004000.465500.500001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557ACUUGGAAGAAGGGACUUU70.2351800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3261575ACTTGGAAGAAGGGACTTTAAAGTCCCTTCTTCCAAGT0.024000.002100.706900.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586GGACCUAAGGACAUAUCUG84.3313184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270604GGACCTAAGGACATATCTGCAGATATGTCCTTAGGTCC0.042400.009900.586200.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UGUCUCUACUAAAAAUACA83.9407192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941816TGTCTCTACTAAAAATACATGTATTTTTAGTAGAGACA0.474700.158200.500000.500001.000001.00000


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299GGGUCCUCCUCCAUCUUUC72.4166678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951317GGGTCCTCCTCCATCTTTCGAAAGATGGAGGAGGACCC0.096900.018100.819000.750001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471AACAAAACAAAGAAAUAAU80.4757317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101489AACAAAACAAAGAAATAATATTATTTCTTTGTTTTGTT0.084500.088200.637900.500001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796CCUGUCUCUACUAAAAAUA86.1958134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1561814CCTGTCTCTACTAAAAATATATTTTTAGTAGAGACAGG0.332900.018700.801701.000001.000001.00000


Target Position: 1322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1322GAGAUUACUUUGCUGCCUU84.7687166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1531340GAGATTACTTTGCTGCCTTAAGGCAGCAAAGTAATCTC0.228900.234700.672400.750001.000001.00000


Target Position: 1496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496UUUUUUUUUUUUAAUGUUU61.9761269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471514TTTTTTTTTTTTAATGTTTAAACATTAAAAAAAAAAAA0.341300.145900.500000.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257CACUGAGAGGGCAAUCUUU87.671199

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10125719CACTGAGAGGGCAATCTTT1/1/0/088.31CDK4NM_000075.21NANANANA00CDK4(0.002)


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629CCAGCCGAAACGAUCAAGG56.46671533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312647CCAGCCGAAACGATCAAGGCCTTGATCGTTTCGGCTGG0.027700.010600.500000.500001.000001.00000


Target Position: 1098, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098CACAGCUGCUGCUGGAAAU82.8873226

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3109819CACAGCTGCTGCTGGAAAT1/1/0/093.71CDK4NM_000075.21NANANA12:58142396,58142965..58142400,58142978(-)00CDK4(0.002)


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385CCUUCCCAUUUCUCUACAC70.5897779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291403CCTTCCCATTTCTCTACACGTGTAGAGAAATGGGAAGG0.711800.634700.551700.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414GUUCCCUCUUGUCCCUUUC60.58951345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3391432GTTCCCTCTTGTCCCTTTCGAAAGGGACAAGAGGGAAC0.156400.015800.474100.500001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110UGGAAAUGCUGACUUUUAA86.7299119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761128TGGAAATGCTGACTTTTAATTAAAAGTCAGCATTTCCA0.353700.095000.810300.750001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735UGACAAGUGGUGGAACAGU69.1392870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348753TGACAAGTGGTGGAACAGTACTGTTCCACCACTTGTCA0.065200.013300.517200.500001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513UUCUUCCUCUGUUUGGCUU59.9451380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151531TTCTTCCTCTGTTTGGCTTAAGCCAAACAGAGGAAGAA0.027000.021700.534500.500000.994600.87500


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472ACAAAACAAAGAAAUAAUG66.5441998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221490ACAAAACAAAGAAATAATGCATTATTTCTTTGTTTTGT0.094800.073700.551700.500001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529CUUUGCCAUUGUGCGAUUU68.8177885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201547CTTTGCCATTGTGCGATTTAAATCGCACAATGGCAAAG0.118500.001800.637900.750000.951101.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556CACUUGGAAGAAGGGACUU71.847712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911574CACTTGGAAGAAGGGACTTAAGTCCCTTCTTCCAAGTG0.040900.002800.655200.750001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464CAGGAAAAACAAAACAAAG77.557439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151482CAGGAAAAACAAAACAAAGCTTTGTTTTGTTTTTCCTG0.170400.005600.646600.500001.000001.00000


Target Position: 1422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422UUGUCCCUUUCCCUACCUU62.31131242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781440TTGTCCCTTTCCCTACCTTAAGGTAGGGAAAGGGACAA0.260500.074800.508600.500001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585AGGACCUAAGGACAUAUCU73.1295651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340603AGGACCTAAGGACATATCTAGATATGTCCTTAGGTCCT0.073000.020900.620700.500001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829GUACCGAGCUCCCGAAGUU81.6559264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250847GTACCGAGCTCCCGAAGTTAACTTCGGGAGCTCGGTAC0.080600.007000.534500.750000.978300.87500


Target Position: 1991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1991UUUUUAAAUGGCAAAAAAA77.2791451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382009TTTTTAAATGGCAAAAAAATTTTTTTGCCATTTAAAAA0.593500.164800.500000.500001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659UGAAAUUGCUUCUUUGAAU79.0539369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991677TGAAATTGCTTCTTTGAATATTCAAAGAAGCAATTTCA0.288400.074200.715500.750001.000001.00000


Target Position: 1490, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1490GGUCUUUUUUUUUUUUUUA89.809960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881508GGTCTTTTTTTTTTTTTTATAAAAAAAAAAAAAAGACC0.328900.216800.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1488-1510ATGGTCTTTTTTTTTTTTTTAATUAAAAAAAAAAAAAAGACCAUGGUCUUUUUUUUUUUUUUAAUU-11.313.300


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542CGAUUUGGAAAAACCACUU79.145368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421560CGATTTGGAAAAACCACTTAAGTGGTTTTTCCAAATCG0.067900.001300.655201.000000.913000.87500


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995UAAAUGGCAAAAAAAAAAA73.9884597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2412013TAAATGGCAAAAAAAAAAATTTTTTTTTTTGCCATTTA0.876200.649700.534500.500001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669UCUUUGAAUAUGGAUUUUA76.5617477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461687TCTTTGAATATGGATTTTATAAAATCCATATTCAAAGA0.014400.002300.689700.750001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106CUGCUGGAAAUGCUGACUU72.6996668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521124CTGCTGGAAATGCTGACTTAAGTCAGCATTTCCAGCAG0.120100.004700.646600.750000.978300.75000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239UGCCAUUUCCCUUCUGGAC56.14821543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341257TGCCATTTCCCTTCTGGACGTCCAGAAGGGAAATGGCA0.051500.001500.534500.500000.907600.62500


Target Position: 350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
350GUGUACAAGGCCCGUGAUC61.01581319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336368GTGTACAAGGCCCGTGATCGATCACGGGCCTTGTACAC0.019700.003800.612100.500001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919UCGAAAGCCUCUCUUCUGU65.30551063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285937TCGAAAGCCTCTCTTCTGTACAGAAGAGAGGCTTTCGA0.038800.013400.586200.500000.978300.62500


Target Position: 1310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310CAUCUUUCUACAGAGAUUA88.742684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1308-1330TCCATCTTTCTACAGAGATTACTUAAUCUCUGUAGAAAGAUGGACAUCUUUCUACAGAGAUUACUU19.114.820


Target Position: 1377, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377CUCCUUCUCCUUCCCAUUU68.7107889

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8137719CTCCTTCTCCTTCCCATTT1/1/0/088.67CDK4NM_000075.21NANANAY:16248191..16248209(+)|15:23017411..23017429(+)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1371395CTCCTTCTCCTTCCCATTTAAATGGGAAGGAGAAGGAG0.837600.651300.810300.750001.000001.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912UGUUUCGUCGAAAGCCUCU62.60091227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342930TGTTTCGTCGAAAGCCTCTAGAGGCTTTCGACGAAACA0.067800.002900.482800.500001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GGUUGUUACACUCUGGUAC75.3411531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196832GGTTGTTACACTCTGGTACGTACCAGAGTGTAACAACC0.115500.012400.672400.750001.000001.00000


Target Position: 279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279CCCUUGAUCUGAGAAUGGC61.25471307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349297CCCTTGATCTGAGAATGGCGCCATTCTCAGATCAAGGG0.014900.003500.491400.500001.000001.00000


Target Position: 1657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657ACUGAAAUUGCUUCUUUGA79.0003370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311675ACTGAAATTGCTTCTTTGATCAAAGAAGCAATTTCAGT0.221000.048700.482800.500001.000001.00000


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964GUGUCAAAAAAAAAAAAAG72.7986665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921982GTGTCAAAAAAAAAAAAAGCTTTTTTTTTTTTTGACAC0.499100.170100.655200.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440CCCAUCAGCACAGUUCGUG58.87141426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
262458CCCATCAGCACAGTTCGTGCACGAACTGTGCTGATGGG0.051200.007500.698300.750000.962000.62500


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647UUAGAAAGGAACUGAAAUU72.0937703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541665TTAGAAAGGAACTGAAATTAATTTCAGTTCCTTTCTAA0.209600.030300.525900.500001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805ACUAAAAAUACAAAAUUAG70.6157778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831823ACTAAAAATACAAAATTAGCTAATTTTGTATTTTTAGT0.221300.142600.534500.500001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119UGACUUUUAACCCACACAA80.7241306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071137TGACTTTTAACCCACACAATTGTGTGGGTTAAAAGTCA0.709000.205000.577600.750001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699UCGUUCACCGAGAUCUGAA79.783348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308717TCGTTCACCGAGATCTGAATTCAGATCTCGGTGAACGA0.029000.002700.620700.750000.934800.62500


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118CUGACUUUUAACCCACACA81.3249280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931136CTGACTTTTAACCCACACATGTGTGGGTTAAAAGTCAG0.812800.285200.577600.500001.000001.00000


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GGAAGAAAAGCUGCCAUUU80.6056310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971246GGAAGAAAAGCTGCCATTTAAATGGCAGCTTTTCTTCC0.034400.015100.870701.000001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352CCUCCCACCUCUCCUUUUG61.99031266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181370CCTCCCACCTCTCCTTTTGCAAAAGGAGAGGTGGGAGG0.026500.024600.698300.750001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CUUUUUUUUUUUUUUAAUG64.63241104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301511CTTTTTTTTTTTTTTAATGCATTAAAAAAAAAAAAAAG0.329200.200900.482800.500001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GCUUUUGAGCAUCCCAAUG67.7197938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287503GCTTTTGAGCATCCCAATGCATTGGGATGCTCAAAAGC0.037000.003200.698300.750000.918500.75000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002ACUGGCCUCGAGAUGUAUC62.56081231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551020ACTGGCCTCGAGATGTATCGATACATCTCGAGGCCAGT0.084300.001000.525900.500001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964CAAAAUCUUUGACCUGAUU82.1863246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
245982CAAAATCTTTGACCTGATTAATCAGGTCAAAGATTTTG0.101200.005100.637900.750001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515CUUCCUCUGUUUGGCUUUG59.82881386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501533CTTCCTCTGTTTGGCTTTGCAAAGCCAAACAGAGGAAG0.013100.013700.491400.500000.994600.87500


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462UACAGGAAAAACAAAACAA82.3477241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2441480TACAGGAAAAACAAAACAATTGTTTTGTTTTTCCTGTA0.224700.009400.534500.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853GCAGUCCACAUAUGCAACA82.5184234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352871GCAGTCCACATATGCAACATGTTGCATATGTGGACTGC0.191100.001100.646600.750001.000001.00000


Target Position: 1994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1994UUAAAUGGCAAAAAAAAAA71.0501751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2522012TTAAATGGCAAAAAAAAAATTTTTTTTTTGCCATTTAA0.878800.636900.534500.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645GCUUAGAAAGGAACUGAAA92.406230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421663GCTTAGAAAGGAACTGAAATTTCAGTTCCTTTCTAAGC0.174900.043800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1643-1665AAGCTTAGAAAGGAACTGAAATTUUUCAGUUCCUUUCUAAGCUUGCUUAGAAAGGAACUGAAAUUU19.211.7


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189AGGUAAUCCGGAGUGAGCA79.2433365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191207AGGTAATCCGGAGTGAGCATGCTCACTCCGGATTACCT0.252900.037300.491400.500000.989100.75000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CUGUCUCUACUAAAAAUAC76.6866470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661815CTGTCTCTACTAAAAATACGTATTTTTAGTAGAGACAG0.348700.045900.603400.500001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937UGGAAACUCUGAAGCCGAC64.23631133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325955TGGAAACTCTGAAGCCGACGTCGGCTTCAGAGTTTCCA0.094900.010800.525900.500001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737ACAAGUGGUGGAACAGUCA82.7511230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334755ACAAGTGGTGGAACAGTCATGACTGTTCCACCACTTGT0.073800.025300.482800.500001.000001.00000


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802UCUACUAAAAAUACAAAAU74.2708582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721820TCTACTAAAAATACAAAATATTTTGTATTTTTAGTAGA0.440600.226900.715500.750001.000001.00000


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998AUGGCAAAAAAAAAAAAAA77.6653433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1842016ATGGCAAAAAAAAAAAAAATTTTTTTTTTTTTTGCCAT0.923300.739800.655200.500001.000001.00000


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963GCAAAAUCUUUGACCUGAU87.98592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251981GCAAAATCTTTGACCTGATATCAGGTCAAAGATTTTGC0.086900.004700.672401.000001.000001.00000


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353CUCCCACCUCUCCUUUUGA78.1131403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541371CTCCCACCTCTCCTTTTGATCAAAAGGAGAGGTGGGAG0.011900.011400.586200.500001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549GAAAAACCACUUGGAAGAA87.731396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191567GAAAAACCACTTGGAAGAATTCTTCCAAGTGGTTTTTC0.026300.006300.500000.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777CUGACUAACAUGGUGAAAC65.9591035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201795CTGACTAACATGGTGAAACGTTTCACCATGTTAGTCAG0.025700.002100.637900.500001.000001.00000


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977AAAAAGAAUAUAGAUUUUU73.0719652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901995AAAAAGAATATAGATTTTTAAAAATCTATATTCTTTTT0.154300.150600.500000.500001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927CUCUCUUCUGUGGAAACUC64.7681093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297945CTCTCTTCTGTGGAAACTCGAGTTTCCACAGAAGAGAG0.101000.012400.500000.500001.000001.00000


Target Position: 1999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1999UGGCAAAAAAAAAAAAAAA77.6412435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1462017TGGCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGCCA0.930700.766000.844800.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338GCCUAUGGGACAGUGUACA80.7945303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307356GCCTATGGGACAGTGTACATGTACACTGTCCCATAGGC0.105200.002300.793100.750000.989100.75000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734GUGACAAGUGGUGGAACAG71.1617745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275752GTGACAAGTGGTGGAACAGCTGTTCCACCACTTGTCAC0.054300.012600.508600.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280CCUUGAUCUGAGAAUGGCU82.9896221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353298CCTTGATCTGAGAATGGCTAGCCATTCTCAGATCAAGG0.012100.003500.491400.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848CUUCUGCAGUCCACAUAUG73.9825598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338866CTTCTGCAGTCCACATATGCATATGTGGACTGCAGAAG0.019000.013500.482800.500001.000001.00000


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978AAAAGAAUAUAGAUUUUUA99.40782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551996AAAAGAATATAGATTTTTATAAAAATCTATATTCTTTT0.150600.146900.465500.500001.000001.00000


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965UGUCAAAAAAAAAAAAAGA75.5683518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271983TGTCAAAAAAAAAAAAAGATCTTTTTTTTTTTTTGACA0.520400.195000.482800.500001.000001.00000


Target Position: 1981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1981AGAAUAUAGAUUUUUAAAU83.3626210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691999AGAATATAGATTTTTAAATATTTAAAAATCTATATTCT0.130000.118100.715500.750001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627UGCCAGCCGAAACGAUCAA70.6606776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222645TGCCAGCCGAAACGATCAATTGATCGTTTCGGCTGGCA0.127800.008000.706900.750001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CUCUGCAGCACUCUUAUCU74.0709592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101176CTCTGCAGCACTCTTATCTAGATAAGAGTGCTGCAGAG0.079100.006900.586200.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CUUAAAGACUGGUUAAAUU86.7675117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991604CTTAAAGACTGGTTAAATTAATTTAACCAGTCTTTAAG0.355100.012200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606ACCTTAAAGACTGGTTAAATTACAAUUUAACCAGUCUUUAAGGUCUUAAAGACUGGUUAAAUUACU-0.37.1


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930UCUUCUGUGGAAACUCUGA75.2234534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289948TCTTCTGTGGAAACTCTGATCAGAGTTTCCACAGAAGA0.291100.029600.500000.500001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CCGAGCUCCCGAAGUUCUU69.4125847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342850CCGAGCTCCCGAAGTTCTTAAGAACTTCGGGAGCTCGG0.015800.002100.775901.000000.983700.62500


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345ACAUUCCCCUCCCACCUCU65.09371076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281363ACATTCCCCTCCCACCTCTAGAGGTGGGAGGGGAATGT0.591700.641400.482800.500001.000001.00000


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628GCCAGCCGAAACGAUCAAG60.97111322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271646GCCAGCCGAAACGATCAAGCTTGATCGTTTCGGCTGGC0.042100.017700.862100.750001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548GGAAAAACCACUUGGAAGA84.1816185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821566GGAAAAACCACTTGGAAGATCTTCCAAGTGGTTTTTCC0.039800.003200.646600.750001.000001.00000


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484GGCUUUUGAGCAUCCCAAU82.1485248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268502GGCTTTTGAGCATCCCAATATTGGGATGCTCAAAAGCC0.044100.004000.991401.000000.918500.62500


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520CGUCUGUGCCACAUCCCGA87.6276100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345538CGTCTGTGCCACATCCCGATCGGGATGTGGCACAGACG0.014500.003000.482800.750000.940200.75000


Target Position: 2000, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000GGCAAAAAAAAAAAAAAAA86.8251115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272018GGCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGCC0.939100.817201.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1998-2020ATGGCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGCCAUGGCAAAAAAAAAAAAAAAAAAU-11.314.100


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907AGAGAUGUUUCGUCGAAAG74.4423567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321925AGAGATGTTTCGTCGAAAGCTTTCGACGAAACATCTCT0.043200.001800.586200.500001.000001.00000


Target Position: 1363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363UCCUUUUGAGGCUUCUCCU64.29321130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271381TCCTTTTGAGGCTTCTCCTAGGAGAAGCCTCAAAAGGA0.433000.001700.525900.500000.902200.75000


Target Position: 2002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002CAAAAAAAAAAAAAAAAAA86.7759116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1322020CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.953100.824300.646600.750001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702GCUCACGCCUAUAAUCCCA83.9715191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921720GCTCACGCCTATAATCCCATGGGATTATAGGCGTGAGC0.061700.002800.508600.750000.994600.75000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488AUGGUCUUUUUUUUUUUUU63.12961196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541506ATGGTCTTTTTTTTTTTTTAAAAAAAAAAAAAGACCAT0.320700.213700.655200.500001.000001.00000


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398AGUGUGAGAGUCCCCAAUG68.2653905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313416AGTGTGAGAGTCCCCAATGCATTGGGGACTCTCACACT0.027600.002300.551700.500000.902200.87500


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846UUCUUCUGCAGUCCACAUA70.2431799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322864TTCTTCTGCAGTCCACATATATGTGGACTGCAGAAGAA0.165700.038500.629300.500001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164AGCACUCUUAUCUACAUAA92.66729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2861182AGCACTCTTATCTACATAATTATGTAGATAAGAGTGCT0.038200.013600.819000.750000.983700.62500


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396AGAGUGUGAGAGUCCCCAA90.712948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227414AGAGTGTGAGAGTCCCCAATTGGGGACTCTCACACTCT0.076200.007200.577600.750000.902200.62500


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273GGGUCUCCCUUGAUCUGAG81.4379276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277291GGGTCTCCCTTGATCTGAGCTCAGATCAAGGGAGACCC0.157100.003300.681000.750000.923900.62500


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793AACCCUGUCUCUACUAAAA89.104574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2241811AACCCTGTCTCTACTAAAATTTTAGTAGAGACAGGGTT0.328600.010700.646600.500001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651UGAUGCGCCAGUUUCUAAG62.12651256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290669TGATGCGCCAGTTTCTAAGCTTAGAAACTGGCGCATCA0.199000.003600.586200.500001.000001.00000


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547UGGAAAAACCACUUGGAAG66.725987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541565TGGAAAAACCACTTGGAAGCTTCCAAGTGGTTTTTCCA0.040600.001000.706900.500000.945700.62500


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GCCAUUUCCCUUCUGGACA75.5479520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2961258GCCATTTCCCTTCTGGACATGTCCAGAAGGGAAATGGC0.056400.002500.793100.750000.907600.75000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88CUCUUUGGCAGCUGGUCAC63.18511195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333106CTCTTTGGCAGCTGGTCACGTGACCAGCTGCCAAAGAG0.020200.001700.517200.500001.000001.00000


Target Position: 1963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1963UGUGUCAAAAAAAAAAAAA75.2193535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661981TGTGTCAAAAAAAAAAAAATTTTTTTTTTTTTGACACA0.537500.174200.706900.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864GAGACUGAGGCAGGAGGAU77.657434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2561882GAGACTGAGGCAGGAGGATATCCTCCTGCCTCAGTCTC0.103900.004300.629300.750001.000001.00000


Target Position: 1569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569GGACUUUCCUGCAAAACCU84.5937176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1567-1589AGGGACTTTCCTGCAAAACCTTAAGGUUUUGCAGGAAAGUCCCUGGACUUUCCUGCAAAACCUUAU18.821.5


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653AGGAACUGAAAUUGCUUCU67.5994945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551671AGGAACTGAAATTGCTTCTAGAAGCAATTTCAGTTCCT0.094300.017100.620700.500001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CCAGGACCUAAGGACAUAU82.9483224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137601CCAGGACCTAAGGACATATATATGTCCTTAGGTCCTGG0.338400.025600.801701.000001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654GGAACUGAAAUUGCUUCUU75.9755502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841672GGAACTGAAATTGCTTCTTAAGAAGCAATTTCAGTTCC0.105000.022800.732801.000001.000001.00000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CAGGACCUAAGGACAUAUC69.2568854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232602CAGGACCTAAGGACATATCGATATGTCCTTAGGTCCTG0.104900.008600.603400.500001.000001.00000


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416GGAGGAGGAGGUGGAGGAG69.7868824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337434GGAGGAGGAGGTGGAGGAGCTCCTCCACCTCCTCCTCC0.024900.001400.560300.750001.000001.00000


Target Position: 1989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1989GAUUUUUAAAUGGCAAAAA84.442180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972007GATTTTTAAATGGCAAAAATTTTTGCCATTTAAAAATC0.558600.132800.681000.750001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588ACCUAAGGACAUAUCUGGA83.4375208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339606ACCTAAGGACATATCTGGATCCAGATATGTCCTTAGGT0.028500.005200.482800.500001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GCUGGAAAUGCUGACUUUU80.178328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051126GCTGGAAATGCTGACTTTTAAAAGTCAGCATTTCCAGC0.162500.010800.853401.000001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665UGCUUCUUUGAAUAUGGAU71.2748741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601683TGCTTCTTTGAATATGGATATCCATATTCAAAGAAGCA0.119700.004000.672400.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324GAUUACUUUGCUGCCUUAA83.9924190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331342GATTACTTTGCTGCCTTAATTAAGGCAGCAAAGTAATC0.333300.216900.646600.750001.000001.00000


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484AAUAAUGGUCUUUUUUUUU74.5902562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741502AATAATGGTCTTTTTTTTTAAAAAAAAAGACCATTATT0.406500.077300.508600.500001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527GGCUUUGCCAUUGUGCGAU72.395680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351545GGCTTTGCCATTGTGCGATATCGCACAATGGCAAAGCC0.154400.001500.819001.000000.929300.62500


Target Position: 1980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1980AAGAAUAUAGAUUUUUAAA91.044342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881998AAGAATATAGATTTTTAAATTTAAAAATCTATATTCTT0.150300.139100.637900.500001.000001.00000


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668UUCUUUGAAUAUGGAUUUU63.54731178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051686TTCTTTGAATATGGATTTTAAAATCCATATTCAAAGAA0.032900.003900.672400.500001.000001.00000


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419CUCUUGUCCCUUUCCCUAC63.39411184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421437CTCTTGTCCCTTTCCCTACGTAGGGAAAGGGACAAGAG0.254400.029700.629300.500001.000001.00000


Target Position: 650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650CUGAUGCGCCAGUUUCUAA90.207854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267668CTGATGCGCCAGTTTCTAATTAGAAACTGGCGCATCAG0.192500.003700.750000.750000.956500.62500


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587UUAAAGACUGGUUAAAUUA79.8842344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271605TTAAAGACTGGTTAAATTATAATTTAACCAGTCTTTAA0.376600.012400.500000.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351CCCUCCCACCUCUCCUUUU70.0604811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191369CCCTCCCACCTCTCCTTTTAAAAGGAGAGGTGGGAGGG0.079400.047200.991401.000001.000001.00000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071UGGUACCUGAGAUGGAGGA68.4868898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421089TGGTACCTGAGATGGAGGATCCTCCATCTCAGGTACCA0.141800.002200.474100.500000.989100.62500


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219GCCAUGGAAGGAAGAAAAG66.45571006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821237GCCATGGAAGGAAGAAAAGCTTTTCTTCCTTCCATGGC0.106200.014600.862100.750000.972800.75000


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998GAUGACUGGCCUCGAGAUG68.0915917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461016GATGACTGGCCTCGAGATGCATCTCGAGGCCAGTCATC0.034600.001200.525900.500001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459UUAUACAGGAAAAACAAAA75.4737525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391477TTATACAGGAAAAACAAAATTTTGTTTTTCCTGTATAA0.339900.021200.534500.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UAGAUUUCCUUCAUGCCAA82.2434245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346693TAGATTTCCTTCATGCCAATTGGCATGAAGGAAATCTA0.045000.001400.525900.500001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104UGCUGCUGGAAAUGCUGAC57.34621490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231122TGCTGCTGGAAATGCTGACGTCAGCATTTCCAGCAGCA0.103800.001800.534500.500000.978301.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831ACCGAGCUCCCGAAGUUCU66.34941014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335849ACCGAGCTCCCGAAGTTCTAGAACTTCGGGAGCTCGGT0.041700.002200.629300.500000.978300.62500


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103CUGCUGCUGGAAAUGCUGA77.811419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501121CTGCTGCTGGAAATGCTGATCAGCATTTCCAGCAGCAG0.094700.001100.560300.500000.978300.87500


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920CGAAAGCCUCUCUUCUGUG75.5315522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325938CGAAAGCCTCTCTTCTGTGCACAGAAGAGAGGCTTTCG0.024000.013000.500000.750000.978300.62500


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974AAAAAAAAGAAUAUAGAUU79.876346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181992AAAAAAAAGAATATAGATTAATCTATATTCTTTTTTTT0.248600.232000.491400.500001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667CUUCUUUGAAUAUGGAUUU74.8466549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171685CTTCTTTGAATATGGATTTAAATCCATATTCAAAGAAG0.085800.009100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1665-1687TGCTTCTTTGAATATGGATTTTAAAAUCCAUAUUCAAAGAAGCACUUCUUUGAAUAUGGAUUUUAU20.112.2


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732UGGUGACAAGUGGUGGAAC62.28591244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309750TGGTGACAAGTGGTGGAACGTTCCACCACTTGTCACCA0.076900.002200.698300.500001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GCAGUCGGUGGUACCUGAG68.3782901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491081GCAGTCGGTGGTACCTGAGCTCAGGTACCACCGACTGC0.035500.001200.543100.750000.945701.00000


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996AAAUGGCAAAAAAAAAAAA81.8803254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3322014AAATGGCAAAAAAAAAAAATTTTTTTTTTTTGCCATTT0.880300.668200.500000.500001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966GUCAAAAAAAAAAAAAGAA85.4342149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1491984GTCAAAAAAAAAAAAAGAATTCTTTTTTTTTTTTTGAC0.538500.398700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1964-1986GTGTCAAAAAAAAAAAAAGAATAUUCUUUUUUUUUUUUUGACACGUCAAAAAAAAAAAAAGAAUAU5.57.70


Target Position: 94, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
94GGCAGCUGGUCACAUGGUG70.333795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353112GGCAGCTGGTCACATGGTGCACCATGTGACCAGCTGCC0.025000.001000.706900.750001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466GGAAAAACAAAACAAAGAA93.529522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601484GGAAAAACAAAACAAAGAATTCTTTGTTTTGTTTTTCC0.147500.136500.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1464-1486CAGGAAAAACAAAACAAAGAAATUUCUUUGUUUUGUUUUUCCUGGGAAAAACAAAACAAAGAAAUU19.28.710


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636ACUGACAAAGCUUAGAAAG64.52221112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3241654ACTGACAAAGCTTAGAAAGCTTTCTAAGCTTTGTCAGT0.063500.001700.569000.500001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105GCUGCUGGAAAUGCUGACU71.0614749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831123GCTGCTGGAAATGCTGACTAGTCAGCATTTCCAGCAGC0.132500.003000.646600.750000.978300.87500


Target Position: 1162, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GCAGCACUCUUAUCUACAU93.700520

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7116219GCAGCACTCTTATCTACAT1/1/0/089.21CDK4NM_000075.21NANANANA00CDK4(0.002)


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634UGACUGACAAAGCUUAGAA86.1472135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181652TGACTGACAAAGCTTAGAATTCTAAGCTTTGTCAGTCA0.057000.001900.551700.750001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453CCUUUUUUAUACAGGAAAA91.302239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001471CCTTTTTTATACAGGAAAATTTTCCTGTATAAAAAAGG0.033900.019500.844801.000000.967400.62500


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388UCCCAUUUCUCUACACUAA83.2128214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931406TCCCATTTCTCTACACTAATTAGTGTAGAGAAATGGGA0.100000.080100.836200.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GUCCCUUUCCCUACCUUUA82.7797228

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9142419GTCCCTTTCCCTACCTTTA1/1/0/088.67CDK4NM_000075.21NANANA12:58142070..58142088(-)00CDK4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621442GTCCCTTTCCCTACCTTTATAAAGGTAGGGAAAGGGAC0.430800.084300.784500.750001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577CUGCAAAACCUUAAAGACU77.6967432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431595CTGCAAAACCTTAAAGACTAGTCTTTAAGGTTTTGCAG0.646000.016900.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1575-1597TCCTGCAAAACCTTAAAGACTGGAGUCUUUAAGGUUUUGCAGGACUGCAAAACCUUAAAGACUGGU14.620.0


Target Position: 1065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1065AGUCGGUGGUACCUGAGAU84.7957162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011083AGTCGGTGGTACCTGAGATATCTCAGGTACCACCGACT0.033600.002400.525900.750000.945701.00000


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936GUGGAAACUCUGAAGCCGA84.4642179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326954GTGGAAACTCTGAAGCCGATCGGCTTCAGAGTTTCCAC0.096700.018800.500000.500001.000001.00000


Target Position: 1491, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1491GUCUUUUUUUUUUUUUUAA84.7138172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771509GTCTTTTTTTTTTTTTTAATTAAAAAAAAAAAAAAGAC0.346400.222700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1489-1511TGGTCTTTTTTTTTTTTTTAATGUUAAAAAAAAAAAAAAGACCAGUCUUUUUUUUUUUUUUAAUGU-9.15.510


Target Position: 1454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454CUUUUUUAUACAGGAAAAA78.9319372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021472CTTTTTTATACAGGAAAAATTTTTCCTGTATAAAAAAG0.033500.020400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1452-1474TCCTTTTTTATACAGGAAAAACAUUUUUCCUGUAUAAAAAAGGACUUUUUUAUACAGGAAAAACAU18.7-9.120


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350CCCCUCCCACCUCUCCUUU62.6121224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801368CCCCTCCCACCTCTCCTTTAAAGGAGAGGTGGGAGGGG0.110200.092000.991401.000001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CCUCUCUUCUGUGGAAACU70.2268801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238944CCTCTCTTCTGTGGAAACTAGTTTCCACAGAAGAGAGG0.109100.006200.637900.750001.000001.00000


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444AUUUGGGGUCCUUUUUUAU72.9543660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441462ATTTGGGGTCCTTTTTTATATAAAAAAGGACCCCAAAT0.197200.001600.465500.500001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689GCCAAUUGCAUCGUUCACC57.52741481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277707GCCAATTGCATCGTTCACCGGTGAACGATGCAATTGGC0.213400.015200.646600.500001.000001.00000


Target Position: 89, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89UCUUUGGCAGCUGGUCACA66.04291031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313107TCTTTGGCAGCTGGTCACATGTGACCAGCTGCCAAAGA0.040200.002100.517200.500001.000001.00000


Target Position: 915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915UUCGUCGAAAGCCUCUCUU55.38611578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321933TTCGTCGAAAGCCTCTCTTAAGAGAGGCTTTCGACGAA0.025000.012100.534500.500001.000001.00000


Target Position: 315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315CAGUGGCUGAAAUUGGUGU75.4366527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340333CAGTGGCTGAAATTGGTGTACACCAATTTCAGCCACTG0.057600.001300.577600.500001.000001.00000


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976AAAAAAGAAUAUAGAUUUU83.0379218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2861994AAAAAAGAATATAGATTTTAAAATCTATATTCTTTTTT0.173200.169000.500000.500001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477ACAAAGAAAUAAUGGUCUU77.9759410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131495ACAAAGAAATAATGGTCTTAAGACCATTATTTCTTTGT0.176700.011400.569000.750001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468AAAAACAAAACAAAGAAAU70.4852782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231486AAAAACAAAACAAAGAAATATTTCTTTGTTTTGTTTTT0.122600.116900.491400.500001.000001.00000


Target Position: 1267, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267GCAAUCUUUGCCUUUAUCU75.5687517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1265-1287GGGCAATCTTTGCCTTTATCTCTAGAUAAAGGCAAAGAUUGCCCGCAAUCUUUGCCUUUAUCUCUU6.912.030


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409GGUAUGUUCCCUCUUGUCC66.06741030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321427GGTATGTTCCCTCTTGTCCGGACAAGAGGGAACATACC0.138500.034600.482800.500001.000001.00000


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116UGCUGACUUUUAACCCACA82.1802247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681134TGCTGACTTTTAACCCACATGTGGGTTAAAAGTCAGCA0.846100.127800.646600.500001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325AUUACUUUGCUGCCUUAAU70.9226761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551343ATTACTTTGCTGCCTTAATATTAAGGCAGCAAAGTAAT0.323000.202300.500000.500001.000001.00000