siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 448   2999  
Biltr, Rnaxs, Sidirect 626   790   852   877   878   983   988   994   1021   1022   1049   1078   1229   1255   1256   1447   1487   1500   1506   1609  
1610   1917   2010   2011   2020   2021   2071   2771   2773   2781   3070   3081   3139   3147   3148   3208   3209   3210   3216   3232  
3242   3278   3283   3310   3408   3441   3461   3465   3485   3493   3496   3504   3606   3607   3609   3646   3648   3654   3796   3798  
3817   3828   3829   3838   3873   3990   4000   4131   4141   4146   4161   4165   4168   4286   4289   4300  
Biltr, Sidirect 230   587   597   629   639   640   649   650   651   736   788   819   890   893   899   951   968   977   979   1028  
1069   1232   1266   1335   1462   1466   1468   1481   1492   1498   1515   1615   2008   2016   2300   2324   2326   2383   2389   2474  
2475   2609   2612   2622   2634   2636   2643   2644   2726   2794   2800   2802   2826   2833   2834   2878   2898   2947   2957   2958  
2964   2968   3005   3012   3013   3069   3072   3089   3109   3112   3122   3123   3244   3253   3259   3269   3299   3320   3331   3343  
3358   3363   3469   3477   3524   3533   3534   3550   3569   3638   3652   3675   3686   3698   3709   3711   3718   3760   3791   3801  
3808   3840   3842   3897   3906   3949   3952   3953   3966   3976   3985   3993   3995   4020   4024   4026   4031   4120   4121   4125  
4129   4134   4151   4173   4204   4270   4272   4274   4279  
Biltr, Ernai, Rnaxs 1441   1675   2473   3795  
Biltr, Ernai 1068   3207   3707  
Biltr, Ernai, Sidirect 2380  
Biltr, Rnaxs 199   203   204   227   245   246   247   283   284   334   336   337   391   392   393   409   410   411   412   445  
446   447   467   468   489   490   493   494   498   539   540   544   545   571   573   574   575   577   583   584  
596   625   652   678   684   685   686   687   707   708   711   712   713   714   715   748   757   758   759   760  
761   762   782   783   784   785   789   824   825   831   832   859   862   863   867   868   871   873   874   875  
880   881   886   889   915   919   924   925   947   948   949   950   955   982   984   993   1002   1003   1006   1017  
1020   1024   1043   1047   1048   1056   1057   1058   1075   1076   1077   1079   1080   1099   1104   1162   1163   1164   1165   1227  
1228   1230   1231   1237   1240   1242   1243   1257   1258   1259   1269   1297   1298   1432   1434   1435   1439   1440   1442   1445  
1446   1485   1486   1491   1494   1495   1496   1499   1603   1604   1608   1632   1674   1678   1679   1680   1683   1684   1685   1797  
1800   1801   1996   2000   2001   2009   2014   2015   2018   2019   2026   2066   2067   2068   2070   2143   2144   2145   2197   2271  
2276   2277   2286   2301   2310   2311   2314   2315   2319   2320   2321   2322   2328   2350   2351   2354   2355   2365   2366   2367  
2368   2369   2374   2375   2376   2378   2392   2471   2472   2479   2480   2486   2487   2527   2534   2535   2536   2547   2548   2549  
2608   2611   2618   2620   2621   2659   2660   2664   2667   2688   2689   2690   2695   2696   2699   2700   2731   2732   2736   2741  
2772   2774   2775   2780   2832   2840   2841   2845   2846   2876   2886   2887   2939   2941   2942   2945   2954   2956   2998   3000  
3040   3041   3042   3043   3044   3045   3046   3079   3080   3098   3099   3102   3126   3127   3132   3133   3136   3137   3138   3141  
3145   3146   3149   3150   3174   3228   3229   3230   3231   3234   3235   3240   3241   3243   3276   3277   3309   3317   3345   3357  
3377   3395   3396   3397   3400   3401   3402   3403   3404   3405   3406   3407   3409   3410   3415   3440   3442   3449   3450   3454  
3455   3459   3460   3463   3464   3476   3483   3491   3492   3494   3495   3497   3501   3505   3543   3588   3593   3594   3595   3608  
3612   3613   3614   3622   3623   3625   3632   3633   3647   3653   3655   3661   3739   3742   3743   3744   3747   3748   3787   3793  
3794   3797   3805   3815   3816   3824   3827   3833   3835   3836   3837   3839   3861   3880   3881   3904   3905   3915   3922   3923  
3924   3925   3927   3928   3929   3930   3938   3939   3940   3999   4019   4023   4090   4093   4108   4109   4110   4132   4133   4140  
4145   4160   4164   4166   4167   4179   4240   4241   4244   4245   4265   4266   4267   4285   4287   4288   4298   4299   4306   4307  
4308  


Target Position: 3709, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3709CUGAUAUAUGUGUUUUUCA89.5151352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3707-3729CGCTGATATATGTGTTTTTCACAUGAAAAACACAUAUAUCAGCGCUGAUAUAUGUGUUUUUCACAU8.710.222


Target Position: 3607, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3607CAGUAACUGACAACUUGAA94.5981131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6413625CAGTAACTGACAACTTGAATTCAAGTTGTCAGTTACTG0.384800.105200.612100.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3605-3627AGCAGTAACTGACAACTTGAATAUUCAAGUUGUCAGUUACUGCUCAGUAACUGACAACUUGAAUAU19.217.621


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199GCCCCCGCCUAGCCCUUCC46.6044147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943217GCCCCCGCCTAGCCCTTCCGGAAGGGCTAGGCGGGGGC0.188300.007900.629300.500000.989100.75000


Target Position: 890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GAUGAAUAUGACUUCAAAU96.177885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
888-910AAGATGAATATGACTTCAAATGCAUUUGAAGUCAUAUUCAUCUUGAUGAAUAUGACUUCAAAUGCU12.28.722


Target Position: 3938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3938AACUAUAUUAUCAUGCAAA91.2016244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7823956AACTATATTATCATGCAAATTTGCATGATAATATAGTT0.103100.103000.646600.500001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445CCAGCUUUAUGAUGACAGU82.5604859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619463CCAGCTTTATGATGACAGTACTGTCATCATAAAGCTGG0.126500.020800.637900.750001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993UGUAUUUAAUGCUUGACAA88.4172415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871011TGTATTTAATGCTTGACAATTGTCAAGCATTAAATACA0.095700.060000.560300.750001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017GAAAGGAAGUAGUUCACAA104.2065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681035GAAAGGAAGTAGTTCACAATTGTGAACTACTTCCTTTC0.058400.044600.525900.750001.000001.00000


Target Position: 1441, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GCAAGAGCUGAAUUAUAAU91.9015213

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4144119GCAAGAGCTGAATTATAAT1/1/0/097.75STAT1NM_007315.3+NM_139266.21+1NANANA2:191854367..191854385(-)00STAT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501459GCAAGAGCTGAATTATAATATTATAATTCAGCTCTTGC0.234300.059100.844801.000000.994600.75000


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310CUGUUACUUUCCCUGACAU84.1248723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552328CTGTTACTTTCCCTGACATATGTCAGGGAAAGTAACAG0.184300.010600.629300.750001.000001.00000


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708GCUGUCUGAAGGAAGAAAG70.30892307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911726GCTGTCTGAAGGAAGAAAGCTTTCTTCCTTCAGACAGC0.267500.008800.715500.750001.000001.00000


Target Position: 3501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3501ACUCAGAAAUUUAAUUCAU81.9982909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453519ACTCAGAAATTTAATTCATATGAATTAAATTTCTGAGT0.628400.021700.551700.750000.983700.75000


Target Position: 2775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2775UGAUAGCAAGUGAAUUUUU77.71971388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082793TGATAGCAAGTGAATTTTTAAAAATTCACTTGCTATCA0.122500.029700.724100.750001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434UGAAAUUGCAAGAGCUGAA82.6452847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431452TGAAATTGCAAGAGCTGAATTCAGCTCTTGCAATTTCA0.160900.033600.551700.750000.923901.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447AGCUUUAUGAUGACAGUUU78.35131318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998465AGCTTTATGATGACAGTTTAAACTGTCATCATAAAGCT0.134800.006200.853400.750001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684UCCAGAUGUCUAUGAUCAU79.49411185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870702TCCAGATGTCTATGATCATATGATCATAGACATCTGGA0.090100.010200.715500.750001.000001.00000


Target Position: 3089, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3089CUUUGCUUUAAGUGUAACU73.36741927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3087-3109TTCTTTGCTTTAAGTGTAACTGGAGUUACACUUAAAGCAAAGAACUUUGCUUUAAGUGUAACUGGU21.518.632


Target Position: 1232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232GAAUUGGAACAGAAAUACA97.796559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1230-1252AGGAATTGGAACAGAAATACACCUGUAUUUCUGUUCCAAUUCCUGAAUUGGAACAGAAAUACACCU10.020.122


Target Position: 3495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495AGAUAAACUCAGAAAUUUA100.51618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8103513AGATAAACTCAGAAATTTATAAATTTCTGAGTTTATCT0.083500.051100.689700.750001.000001.00000


Target Position: 4120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4120CCUAAGUUUCAGUUGAUUU83.5852769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4118-4140AACCTAAGTTTCAGTTGATTTTAAAAUCAACUGAAACUUAGGUUCCUAAGUUUCAGUUGAUUUUAU14.89.822


Target Position: 2660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660CUUCUCUGGCGACAGUUUU70.89622251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582678CTTCTCTGGCGACAGTTTTAAAACTGTCGCCAGAGAAG0.079800.010500.637900.750000.962001.00000


Target Position: 4133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4133UGAUUUUACAAUUGAAAUG64.69022957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244151TGATTTTACAATTGAAATGCATTTCAATTGTAAAATCA0.116500.019600.569000.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680ACUCCCUUAGUUUUGAAAC58.63833512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631698ACTCCCTTAGTTTTGAAACGTTTCAAAACTAAGGGAGT0.347300.100300.560300.500001.000001.00000


Target Position: 4146, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4146GAAAUGACUAAAAAACAAA94.714125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5514164GAAATGACTAAAAAACAAATTTGTTTTTTAGTCATTTC0.512700.079600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4144-4166TTGAAATGACTAAAAAACAAAGAUUUGUUUUUUAGUCAUUUCAAGAAAUGACUAAAAAACAAAGAU5.614.822


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GAAAUACACCUACGAACAU87.6701458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761261GAAATACACCTACGAACATATGTTCGTAGGTGTATTTC0.309300.194700.517200.750001.000001.00000


Target Position: 2878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878GUUUCACAAGUGAAAAACA90.9971259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2876-2898GGGTTTCACAAGTGAAAAACATCUGUUUUUCACUUGUGAAACCCGUUUCACAAGUGAAAAACAUCU8.720.521


Target Position: 3990, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3990CUUGAGUUUUGUUUUAAAA89.0256371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9264008CTTGAGTTTTGTTTTAAAATTTTAAAACAAAACTCAAG0.396600.008300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3988-4010TTCTTGAGTTTTGTTTTAAAATTUUUUAAAACAAAACUCAAGAACUUGAGUUUUGUUUUAAAAUUU-9.119.222


Target Position: 3928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3928CUGCUACCACAACUAUAUU83.8185745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4873946CTGCTACCACAACTATATTAATATAGTTGTGGTAGCAG0.687000.099700.775900.750000.978300.62500


Target Position: 3993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3993GAGUUUUGUUUUAAAAUUA96.539581

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3991-4013TTGAGTTTTGTTTTAAAATTAAAUAAUUUUAAAACAAAACUCAAGAGUUUUGUUUUAAAAUUAAAU-9.710.311


Target Position: 629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629CAUAACAUAAGGAAAAGCA84.1961714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
627-649AGCATAACATAAGGAAAAGCAAGUGCUUUUCCUUAUGUUAUGCUCAUAACAUAAGGAAAAGCAAGU21.06.732


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604CACCUGCAAUUGAAAGAAC74.03631844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041622CACCTGCAATTGAAAGAACGTTCTTTCAATTGCAGGTG0.296400.012000.646600.500001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800UCCUUUGGUACAACAUGCU63.4163097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861818TCCTTTGGTACAACATGCTAGCATGTTGTACCAAAGGA0.068300.012500.517200.500001.000001.00000


Target Position: 3483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483AACCAUAGAUGUAGAUAAA95.597998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113501AACCATAGATGTAGATAAATTTATCTACATCTATGGTT0.341500.185100.646600.500001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982ACUCAAGAAGAUGUAUUUA86.1426560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501000ACTCAAGAAGATGTATTTATAAATACATCTTCTTGAGT0.351000.007600.672400.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748GAGAUUUAAUCAGGCUCAG72.62732021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941766GAGATTTAATCAGGCTCAGCTGAGCCTGATTAAATCTC0.087300.039000.525900.500001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760GGCUCAGUCGGGGAAUAUU82.7481841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769778GGCTCAGTCGGGGAATATTAATATTCCCCGACTGAGCC0.390200.013200.991401.000001.000001.00000


Target Position: 4270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4270GAGACUUUACUUUUAAGAA98.020553

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4268-4290AAGAGACTTTACTTTTAAGAAGTUUCUUAAAAGUAAAGUCUCUUGAGACUUUACUUUUAAGAAGUU7.117.722


Target Position: 3148, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148CAAGUUUAUAUACAAUUAU87.5561464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6723166CAAGTTTATATACAATTATATAATTGTATATAAACTTG0.355400.255600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3146-3168GCCAAGTTTATATACAATTATATAUAAUUGUAUAUAAACUUGGCCAAGUUUAUAUACAAUUAUAUU6.94.922


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018AAGGAAAAUAUAAAUGAUA89.3288363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572036AAGGAAAATATAAATGATATATCATTTATATTTTCCTT0.821400.032100.594800.500001.000001.00000


Target Position: 3040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3040GCUUGACGUAGGAACGGUA94.0694144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653058GCTTGACGTAGGAACGGTATACCGTTCCTACGTCAAGC0.058600.007100.672401.000000.951100.87500


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412GCAGCUUGACUCAAAAUUC76.92341493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792430GCAGCTTGACTCAAAATTCGAATTTTGAGTCAAGCTGC0.163500.012500.681000.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871GAGCCUGGAAGAUUUACAA94.9737118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498889GAGCCTGGAAGATTTACAATTGTAAATCTTCCAGGCTC0.363300.064500.663800.750001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020AGGAAGUAGUUCACAAAAU83.6823758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321038AGGAAGTAGTTCACAAAATATTTTGTGAACTACTTCCT0.097100.039700.836200.750001.000001.00000


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664UCUGGCGACAGUUUUCCUU62.39383200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142682TCTGGCGACAGTTTTCCTTAAGGAAAACTGTCGCCAGA0.726900.011700.586200.750000.962000.62500


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245UGCUGUAUGCCAUCCUCGA77.47051416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942263TGCTGTATGCCATCCTCGATCGAGGATGGCATACAGCA0.255600.016400.560300.500000.967400.75000


Target Position: 4173, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4173CAUUAAAACAAUAUUGUUU86.2921548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4171-4193AACATTAAAACAATATTGTTTCTAAACAAUAUUGUUUUAAUGUUCAUUAAAACAAUAUUGUUUCUU6.9-9.722


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203CCGCCUAGCCCUUCCGGAU71.20692209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998221CCGCCTAGCCCTTCCGGATATCCGGAAGGGCTAGGCGG0.055400.009200.732801.000000.913000.62500


Target Position: 2355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355CUGAGAAUAUUCCUGAGAA96.85976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182373CTGAGAATATTCCTGAGAATTCTCAGGAATATTCTCAG0.066300.008800.612100.750001.000001.00000


Target Position: 3796, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3796GUGAAGUAUACUGUAUUUU77.6721392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113814GTGAAGTATACTGTATTTTAAAATACAGTATACTTCAC0.102600.024300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3794-3816TCGTGAAGTATACTGTATTTTTAAAAAUACAGUAUACUUCACGAGUGAAGUAUACUGUAUUUUUAU6.920.331


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174CUCUUUCAAAGGUAGCCAU77.35371430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943192CTCTTTCAAAGGTAGCCATATGGCTACCTTTGAAAGAG0.105700.110600.655200.750001.000001.00000


Target Position: 3661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661UCAAAACUCAUUUCCUAUG59.96423429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453679TCAAAACTCATTTCCTATGCATAGGAAATGAGTTTTGA0.206600.109700.569000.500001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043UGACGUAGGAACGGUAAAU72.79972004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6693061TGACGTAGGAACGGTAAATATTTACCGTTCCTACGTCA0.149600.018400.715500.750000.951100.87500


Target Position: 3147, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147CCAAGUUUAUAUACAAUUA98.007654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1623165CCAAGTTTATATACAATTATAATTGTATATAAACTTGG0.390600.173800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3145-3167AGCCAAGTTTATATACAATTATAUAAUUGUAUAUAAACUUGGCUCCAAGUUUAUAUACAAUUAUAU6.910.322


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832UGUGAAGGACAAGGUUAUG63.04183143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921850TGTGAAGGACAAGGTTATGCATAACCTTGTCCTTCACA0.102800.015600.551700.500001.000001.00000


Target Position: 4145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4145UGAAAUGACUAAAAAACAA88.0477436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7444163TGAAATGACTAAAAAACAATTGTTTTTTAGTCATTTCA0.856600.191500.577600.750001.000001.00000


Target Position: 2957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957GCAACAUCUAGCAAAUGUU87.6122461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2955-2977AAGCAACATCTAGCAAATGTTATAACAUUUGCUAGAUGUUGCUUGCAACAUCUAGCAAAUGUUAUU12.120.523


Target Position: 3240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3240UUGGCUAUUUAAAGACAAA81.03571008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853258TTGGCTATTTAAAGACAAATTTGTCTTTAAATAGCCAA0.210200.120200.646600.500001.000001.00000


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137UAGUUCAAAGCCAAGUUUA78.79791274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653155TAGTTCAAAGCCAAGTTTATAAACTTGGCTTTGAACTA0.122800.035900.637900.500001.000001.00000


Target Position: 3242, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242GGCUAUUUAAAGACAAAGA88.8801382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4943260GGCTATTTAAAGACAAAGATCTTTGTCTTTAAATAGCC0.207600.110400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3240-3262TTGGCTATTTAAAGACAAAGACAUCUUUGUCUUUAAAUAGCCAAGGCUAUUUAAAGACAAAGACAU19.213.622


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145GAGAGCGUGCCCUGUUGAA88.5979404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982163GAGAGCGTGCCCTGTTGAATTCAACAGGGCACGCTCTC0.130700.022100.637900.750000.929300.62500


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816ACCUUUUUCCUUCCUUAUC56.10483705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813834ACCTTTTTCCTTCCTTATCGATAAGGAAGGAAAAAGGT0.117700.111200.672400.500001.000001.00000


Target Position: 2964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964CUAGCAAAUGUUAUGCAUA93.6531157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2962-2984ATCTAGCAAATGTTATGCATAAAUAUGCAUAACAUUUGCUAGAUCUAGCAAAUGUUAUGCAUAAAU21.119.722


Target Position: 1499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499AGAAAUACAGUAAAAGGAU82.946827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601517AGAAATACAGTAAAAGGATATCCTTTTACTGTATTTCT0.597300.432900.543100.750001.000001.00000


Target Position: 3496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496GAUAAACUCAGAAAUUUAA97.221166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113514GATAAACTCAGAAATTTAATTAAATTTCTGAGTTTATC0.083400.045300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3494-3516TAGATAAACTCAGAAATTTAATTUUAAAUUUCUGAGUUUAUCUAGAUAAACUCAGAAAUUUAAUUU-9.74.612


Target Position: 2071, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071CCUAGAACUCAUUAAAAAA98.324248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542089CCTAGAACTCATTAAAAAATTTTTTAATGAGTTCTAGG0.944500.346900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2069-2091ATCCTAGAACTCATTAAAAAACAUUUUUUAAUGAGUUCUAGGAUCCUAGAACUCAUUAAAAAACAU-9.118.922


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731UCUAGGGAAAUGAAAGAAA78.73631278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6042749TCTAGGGAAATGAAAGAAATTTCTTTCATTTCCCTAGA0.125300.021700.724100.750001.000001.00000


Target Position: 2300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2300GAACUUUCUGCUGUUACUU80.14561119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2298-2320AAGAACTTTCTGCTGTTACTTTCAAGUAACAGCAGAAAGUUCUUGAACUUUCUGCUGUUACUUUCU19.013.322


Target Position: 3363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363GUUGUGUUUGAUAUCCAAA90.289306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3361-3383AAGTTGTGTTTGATATCCAAAGCUUUGGAUAUCAAACACAACUUGUUGUGUUUGAUAUCCAAAGCU21.219.332


Target Position: 3465, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3465CAUUCAAAAGUUGAAAUUA92.3754195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983483CATTCAAAAGTTGAAATTATAATTTCAACTTTTGAATG0.104600.040200.620700.750000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3463-3485CTCATTCAAAAGTTGAAATTAACUAAUUUCAACUUUUGAAUGAGCAUUCAAAAGUUGAAAUUAACU7.47.422


Target Position: 4164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4164AGAAGACAACAUUAAAACA92.5738190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9784182AGAAGACAACATTAAAACATGTTTTAATGTTGTCTTCT0.198100.104100.517200.500001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984UCAAGAAGAUGUAUUUAAU85.4281596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811002TCAAGAAGATGTATTTAATATTAAATACATCTTCTTGA0.289500.161900.715500.750001.000001.00000


Target Position: 3492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492UGUAGAUAAACUCAGAAAU78.2561330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7483510TGTAGATAAACTCAGAAATATTTCTGAGTTTATCTACA0.094800.052100.698300.750001.000001.00000


Target Position: 2958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2958CAACAUCUAGCAAAUGUUA94.2539141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2956-2978AGCAACATCTAGCAAATGTTATGUAACAUUUGCUAGAUGUUGCUCAACAUCUAGCAAAUGUUAUGU5.319.232


Target Position: 2876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2876GGGUUUCACAAGUGAAAAA93.8452149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902894GGGTTTCACAAGTGAAAAATTTTTCACTTGTGAAACCC0.347000.006400.991401.000000.945700.62500


Target Position: 3133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3133GAAAUAGUUCAAAGCCAAG77.73611387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913151GAAATAGTTCAAAGCCAAGCTTGGCTTTGAACTATTTC0.147900.036300.534500.500001.000001.00000


Target Position: 1229, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229GAGGAAUUGGAACAGAAAU85.392601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971247GAGGAATTGGAACAGAAATATTTCTGTTCCAATTCCTC0.410900.031100.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1227-1249TGGAGGAATTGGAACAGAAATACAUUUCUGUUCCAAUUCCUCCAGAGGAAUUGGAACAGAAAUACU19.218.722


Target Position: 4151, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4151GACUAAAAAACAAAGAAGA88.7904389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4149-4171ATGACTAAAAAACAAAGAAGACAUCUUCUUUGUUUUUUAGUCAUGACUAAAAAACAAAGAAGACAU10.34.922


Target Position: 448, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448GCUUUAUGAUGACAGUUUU88.6842394

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1044819GCTTTATGATGACAGTTTT1/1/0/097.21STAT1NM_007315.3+NM_139266.21+1NANANA4:170234065..170234083(+)00STAT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958466GCTTTATGATGACAGTTTTAAAACTGTCATCATAAAGC0.122300.007200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
446-468CAGCTTTATGATGACAGTTTTCCAAAACUGUCAUCAUAAAGCUGGCUUUAUGAUGACAGUUUUCCU17.83.522


Target Position: 3686, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3686CAUUGAGAACUGCAUAUGU87.4595467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3684-3706TGCATTGAGAACTGCATATGTTTACAUAUGCAGUUCUCAAUGCACAUUGAGAACUGCAUAUGUUUU21.120.423


Target Position: 3828, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828CCUUAUCACUGACACAAAA95.650196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3413846CCTTATCACTGACACAAAATTTTGTGTCAGTGATAAGG0.918700.055000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3826-3848TTCCTTATCACTGACACAAAAAGUUUUGUGUCAGUGAUAAGGAACCUUAUCACUGACACAAAAAGU19.313.422


Target Position: 640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640GAAAAGCAAGCGUAAUCUU84.984642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
638-660AGGAAAAGCAAGCGTAATCTTCAAAGAUUACGCUUGCUUUUCCUGAAAAGCAAGCGUAAUCUUCAU14.518.633


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334GUAGCUGCUCCUUUGGUUG68.71922498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966352GTAGCTGCTCCTTTGGTTGCAACCAAAGGAGCAGCTAC0.168300.007000.534500.500001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685CUUAGUUUUGAAACCCAAU77.37791426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811703CTTAGTTTTGAAACCCAATATTGGGTTTCAAAACTAAG0.187600.046100.629300.750000.978300.87500


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AACAUGACCCUAUCACAAA87.6631460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241275AACATGACCCTATCACAAATTTGTGATAGGGTCATGTT0.425400.194100.646600.500000.907600.75000


Target Position: 4161, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4161CAAAGAAGACAACAUUAAA100.4619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4974179CAAAGAAGACAACATTAAATTTAATGTTGTCTTCTTTG0.161000.148200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4159-4181AACAAAGAAGACAACATTAAAACUUUAAUGUUGUCUUCUUUGUUCAAAGAAGACAACAUUAAAACU6.910.322


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674AGCUUCACUCCCUUAGUUU76.52611537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001692AGCTTCACTCCCTTAGTTTAAACTAAGGGAGTGAAGCT0.184900.033100.853400.750001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889AGAUGAAUAUGACUUCAAA102.38811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
784907AGATGAATATGACTTCAAATTTGAAGTCATATTCATCT0.088800.054500.724100.750000.918500.62500


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234UUCACAUUGGCUAUUUAAA75.78411632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603252TTCACATTGGCTATTTAAATTTAAATAGCCAATGTGAA0.349100.150000.672400.500001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242AGAAAUACACCUACGAACA85.7689575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881260AGAAATACACCTACGAACATGTTCGTAGGTGTATTTCT0.305100.223900.517200.500001.000001.00000


Target Position: 2774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2774UUGAUAGCAAGUGAAUUUU62.38133203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052792TTGATAGCAAGTGAATTTTAAAATTCACTTGCTATCAA0.103500.026000.646600.500001.000001.00000


Target Position: 2612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612GAAUUCGACAGUAUGAUGA87.3966473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2610-2632TAGAATTCGACAGTATGATGAACUCAUCAUACUGUCGAAUUCUAGAAUUCGACAGUAUGAUGAACU14.916.733


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058ACUGAACUUACCCAGAAUG65.05972915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961076ACTGAACTTACCCAGAATGCATTCTGGGTAAGTTCAGT0.055500.024700.551700.500000.918500.62500


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GAGCUGAAUUAUAAUUUGA95.1255109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7031463GAGCTGAATTATAATTTGATCAAATTATAATTCAGCTC0.352000.063800.586200.500001.000001.00000


Target Position: 3633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3633CCAGAGAUAAUAUGAGAAU86.4802541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663651CCAGAGATAATATGAGAATATTCTCATATTATCTCTGG0.073900.073600.836201.000001.000001.00000


Target Position: 3112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3112GUUUUCCAUUGGUUUACCU72.59952027

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3110-3132CAGTTTTCCATTGGTTTACCTGTAGGUAAACCAAUGGAAAACUGGUUUUCCAUUGGUUUACCUGUU21.120.112


Target Position: 3609, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3609GUAACUGACAACUUGAAUA93.6803155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5443627GTAACTGACAACTTGAATATATTCAAGTTGTCAGTTAC0.397100.130600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3607-3629CAGTAACTGACAACTTGAATAATUAUUCAAGUUGUCAGUUACUGGUAACUGACAACUUGAAUAAUU12.020.322


Target Position: 3081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081CAUGUUUUCUUUGCUUUAA85.887570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543099CATGTTTTCTTTGCTTTAATTAAAGCAAAGAAAACATG0.076000.031800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3079-3101TACATGTTTTCTTTGCTTTAAGTUUAAAGCAAAGAAAACAUGUACAUGUUUUCUUUGCUUUAAGUU19.75.322


Target Position: 3216, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216GUGUAUUUUAUUACAUCUU81.07021002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463234GTGTATTTTATTACATCTTAAGATGTAATAAAATACAC0.211000.169900.655200.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3214-3236ATGTGTATTTTATTACATCTTTCAAGAUGUAAUAAAAUACACAUGUGUAUUUUAUUACAUCUUUCU20.36.922


Target Position: 2834, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834CAUCUUACUGAAGGUAAAA89.3569358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2832-2854TGCATCTTACTGAAGGTAAAATTUUUUACCUUCAGUAAGAUGCACAUCUUACUGAAGGUAAAAUUU18.614.523


Target Position: 3838, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3838GACACAAAAAGUAGAUUAA97.083172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6043856GACACAAAAAGTAGATTAATTAATCTACTTTTTGTGTC0.123400.058800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3836-3858CTGACACAAAAAGTAGATTAAGAUUAAUCUACUUUUUGUGUCAGGACACAAAAAGUAGAUUAAGAU8.419.331


Target Position: 2472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2472GCCCUAAAGGAACUGGAUA85.7337577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392490GCCCTAAAGGAACTGGATATATCCAGTTCCTTTAGGGC0.116500.031800.956901.000000.978300.62500


Target Position: 2311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311UGUUACUUUCCCUGACAUC62.79963172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582329TGTTACTTTCCCTGACATCGATGTCAGGGAAAGTAACA0.179500.015500.525900.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253GACAAAGACAAAUUCUGUU85.1652618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3251-3273AAGACAAAGACAAATTCTGTTTCAACAGAAUUUGUCUUUGUCUUGACAAAGACAAAUUCUGUUUCU19.219.222


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CCUGGAAGAUUUACAAGAU90.6303290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444892CCTGGAAGATTTACAAGATATCTTGTAAATCTTCCAGG0.335500.166900.663801.000001.000001.00000


Target Position: 3415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3415ACAAUUAUUUUUACAGUUC65.91712811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9133433ACAATTATTTTTACAGTTCGAACTGTAAAAATAATTGT0.167600.164500.534500.500001.000001.00000


Target Position: 3897, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897GUCUAUGUGGCUGUAUCUU77.0221477

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3895-3917CTGTCTATGTGGCTGTATCTTGTAAGAUACAGCCACAUAGACAGGUCUAUGUGGCUGUAUCUUGUU20.320.323


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GUGGCAAAGAGUGAUCAGA82.399875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
977965GTGGCAAAGAGTGATCAGATCTGATCACTCTTTGCCAC0.056900.037500.569000.500001.000001.00000


Target Position: 4160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4160ACAAAGAAGACAACAUUAA85.034632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4914178ACAAAGAAGACAACATTAATTAATGTTGTCTTCTTTGT0.163500.163300.672400.750001.000001.00000


Target Position: 3711, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3711GAUAUAUGUGUUUUUCACA95.3001103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3709-3731CTGATATATGTGTTTTTCACATTUGUGAAAAACACAUAUAUCAGGAUAUAUGUGUUUUUCACAUUU14.9-0.322


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784CACAGUGAUGUUAGACAAA94.1933142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627802CACAGTGATGTTAGACAAATTTGTCTAACATCACTGTG0.215300.035200.793100.750001.000001.00000


Target Position: 3402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3402AUCUUGGUCACAUACAAUU73.04551971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153420ATCTTGGTCACATACAATTAATTGTATGTGACCAAGAT0.585400.101300.672400.500001.000001.00000


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079UACAUGUUUUCUUUGCUUU70.98992236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8463097TACATGTTTTCTTTGCTTTAAAGCAAAGAAAACATGTA0.078500.011900.681000.500001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231UCUUUCACAUUGGCUAUUU65.51612862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2603249TCTTTCACATTGGCTATTTAAATAGCCAATGTGAAAGA0.339000.075800.724100.750001.000001.00000


Target Position: 3102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3102GUAACUGGCAGUUUUCCAU81.01261013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473120GTAACTGGCAGTTTTCCATATGGAAAACTGCCAGTTAC0.205700.010200.525900.750000.945700.62500


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690GUGAUUCCCUCCUGCUACU77.00311481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042708GTGATTCCCTCCTGCTACTAGTAGCAGGAGGGAATCAC0.450600.189300.586200.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CUAUCACAAAAAACAAACA87.4472469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1264-1286CCCTATCACAAAAAACAAACAAGUGUUUGUUUUUUGUGAUAGGGCUAUCACAAAAAACAAACAAGU13.321.521


Target Position: 2010, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010GGUUUUGUAAGGAAAAUAU89.1538365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982028GGTTTTGTAAGGAAAATATATATTTTCCTTACAAAACC0.068100.033300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2008-2030GAGGTTTTGTAAGGAAAATATAAAUAUUUUCCUUACAAAACCUCGGUUUUGUAAGGAAAAUAUAAU2.113.321


Target Position: 1462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GAAAGUCAAAGUCUUAUUU84.787659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1460-1482TTGAAAGTCAAAGTCTTATTTGAAAAUAAGACUUUGACUUUCAAGAAAGUCAAAGUCUUAUUUGAU6.919.222


Target Position: 4141, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141CAAUUGAAAUGACUAAAAA99.024135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4774159CAATTGAAATGACTAAAAATTTTTAGTCATTTCAATTG0.804400.126800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161TACAATTGAAATGACTAAAAAACUUUUUAGUCAUUUCAAUUGUACAAUUGAAAUGACUAAAAAACU4.97.412


Target Position: 230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230CAGAAAAGUUUCAUUUGCU86.0709563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
228-250CGCAGAAAAGTTTCATTTGCTGTAGCAAAUGAAACUUUUCUGCGCAGAAAAGUUUCAUUUGCUGUU20.010.322


Target Position: 3915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3915UGUUUUUCCACUACUGCUA77.41731423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123933TGTTTTTCCACTACTGCTATAGCAGTAGTGGAAAAACA0.145600.081500.534500.750001.000001.00000


Target Position: 3606, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606GCAGUAACUGACAACUUGA93.9028147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943624GCAGTAACTGACAACTTGATCAAGTTGTCAGTTACTGC0.312400.095800.629300.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3604-3626AAGCAGTAACTGACAACTTGAATUCAAGUUGUCAGUUACUGCUUGCAGUAACUGACAACUUGAAUU16.719.021


Target Position: 2998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998UGUUAUAGGUUGUUGGAUA90.3188302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403016TGTTATAGGTTGTTGGATATATCCAACAACCTATAACA0.096500.014500.663800.750001.000001.00000


Target Position: 3953, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3953CAAAUGCUGUAUUCUUCUU84.6775669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3951-3973TGCAAATGCTGTATTCTTCTTTGAAGAAGAAUACAGCAUUUGCACAAAUGCUGUAUUCUUCUUUGU19.118.522


Target Position: 2009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2009AGGUUUUGUAAGGAAAAUA83.9484736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842027AGGTTTTGTAAGGAAAATATATTTTCCTTACAAAACCT0.071300.013800.801700.750001.000001.00000


Target Position: 3410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3410CACAUACAAUUAUUUUUAC78.11591345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503428CACATACAATTATTTTTACGTAAAAATAATTGTATGTG0.822400.527700.612100.500001.000001.00000


Target Position: 3208, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3208GGGAAAAUGUGUAUUUUAU93.3943164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473226GGGAAAATGTGTATTTTATATAAAATACACATTTTCCC0.472400.007800.948301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3206-3228GGGGGAAAATGTGTATTTTATTAAUAAAAUACACAUUUUCCCCCGGGAAAAUGUGUAUUUUAUUAU-7.514.221


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954UAAGCAACAUCUAGCAAAU81.7619935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802972TAAGCAACATCTAGCAAATATTTGCTAGATGTTGCTTA0.056700.011100.525900.500000.934800.87500


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366CCUGAGAAUCCCCUGAAGU73.78841876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282384CCTGAGAATCCCCTGAAGTACTTCAGGGGATTCTCAGG0.097800.026000.637900.750000.945700.87500


Target Position: 3718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3718GUGUUUUUCACAUUUGCGA77.65821394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3716-3738ATGTGTTTTTCACATTTGCGAATUCGCAAAUGUGAAAAACACAUGUGUUUUUCACAUUUGCGAAUU20.65.622


Target Position: 3461, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3461CACUCAUUCAAAAGUUGAA93.2909169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023479CACTCATTCAAAAGTTGAATTCAACTTTTGAATGAGTG0.067800.030000.620700.750000.907600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3459-3481ACCACTCATTCAAAAGTTGAAATUUCAACUUUUGAAUGAGUGGUCACUCAUUCAAAAGUUGAAAUU19.219.232


Target Position: 3648, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648GAAUCAGAUCAUUUCAAAA104.4534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4543666GAATCAGATCATTTCAAAATTTTGAAATGATCTGATTC0.178000.072800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3646-3668GAGAATCAGATCATTTCAAAACTUUUUGAAAUGAUCUGAUUCUCGAAUCAGAUCAUUUCAAAACUU7.720.412


Target Position: 3550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550GUUAUUAGGGUGGUAUUUA86.6929522

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3548-3570TTGTTATTAGGGTGGTATTTAGTUAAAUACCACCCUAAUAACAAGUUAUUAGGGUGGUAUUUAGUU13.9-2.333


Target Position: 2947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947GAGAAGUUAAGCAACAUCU84.3108708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2945-2967AGGAGAAGTTAAGCAACATCTAGAGAUGUUGCUUAACUUCUCCUGAGAAGUUAAGCAACAUCUAGU20.517.712


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229CAUCUUUCACAUUGGCUAU85.2307616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6523247CATCTTTCACATTGGCTATATAGCCAATGTGAAAGATG0.307000.072900.612100.750001.000001.00000


Target Position: 3595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595GAGUAGAAAAAGCAGUAAC77.82421371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633613GAGTAGAAAAAGCAGTAACGTTACTGCTTTTTCTACTC0.148200.013300.663800.500001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374UCCCCUGAAGUAUCUGUAU70.97792238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202392TCCCCTGAAGTATCTGTATATACAGATACTTCAGGGGA0.191800.046100.827600.750001.000001.00000


Target Position: 1446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446AGCUGAAUUAUAAUUUGAA92.3917194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331464AGCTGAATTATAATTTGAATTCAAATTATAATTCAGCT0.382700.114100.681000.750001.000001.00000


Target Position: 3136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3136AUAGUUCAAAGCCAAGUUU69.68232376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563154ATAGTTCAAAGCCAAGTTTAAACTTGGCTTTGAACTAT0.148900.042000.543100.500001.000001.00000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571GUCACAGCUGGAUGAUCAA92.2692202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981589GTCACAGCTGGATGATCAATTGATCATCCAGCTGTGAC0.071600.006500.672400.750000.967400.62500


Target Position: 1487, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487GAUGUGAAUGAGAGAAAUA100.60717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241505GATGTGAATGAGAGAAATATATTTCTCTCATTCACATC0.250800.094500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1485-1507AAGATGTGAATGAGAGAAATACAUAUUUCUCUCAUUCACAUCUUGAUGUGAAUGAGAGAAAUACAU14.820.522


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859GCAUGAAAUCAAGAGCCUG76.42571555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756877GCATGAAATCAAGAGCCTGCAGGCTCTTGATTTCATGC0.248600.016700.569000.750001.000001.00000


Target Position: 2314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2314UACUUUCCCUGACAUCAUU74.6531772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6972332TACTTTCCCTGACATCATTAATGATGTCAGGGAAAGTA0.204600.016500.672400.500001.000001.00000


Target Position: 4134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4134GAUUUUACAAUUGAAAUGA83.5551772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4132-4154TTGATTTTACAATTGAAATGACTUCAUUUCAAUUGUAAAAUCAAGAUUUUACAAUUGAAAUGACUU13.8-0.322


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544UGCCACCAUCCGUUUUCAU68.49772525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584562TGCCACCATCCGTTTTCATATGAAAACGGATGGTGGCA0.129600.050500.698300.750001.000001.00000


Target Position: 4279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279CUUUUAAGAAGUAUUAAAA92.5972189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4277-4299TACTTTTAAGAAGTATTAAAATTUUUUAAUACUUCUUAAAAGUACUUUUAAGAAGUAUUAAAAUUU-7.5-3.821


Target Position: 4244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4244UGGUUUCAUUUUACUGCAC62.38453202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9024262TGGTTTCATTTTACTGCACGTGCAGTAAAATGAAACCA0.203800.024800.551700.500001.000001.00000


Target Position: 2197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197CAGUGAGAGCUCCCGGGAA88.3259422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912215CAGTGAGAGCTCCCGGGAATTCCCGGGAGCTCTCACTG0.132600.016700.612100.750000.945701.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442CAAGAGCUGAAUUAUAAUU85.2999611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681460CAAGAGCTGAATTATAATTAATTATAATTCAGCTCTTG0.190600.049700.637900.750001.000001.00000


Target Position: 3299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3299GUUUGUUAUGGCUUAAUGA89.5404347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3297-3319CTGTTTGTTATGGCTTAATGACAUCAUUAAGCCAUAACAAACAGGUUUGUUAUGGCUUAAUGACAU3.57.223


Target Position: 4140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4140ACAAUUGAAAUGACUAAAA83.1803810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2324158ACAATTGAAATGACTAAAATTTTAGTCATTTCAATTGT0.786700.113400.706900.750001.000001.00000


Target Position: 2380, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380GAAGUAUCUGUAUCCAAAU91.648222

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6238019GAAGTATCTGTATCCAAAT1/1/0/097.75STAT1NM_007315.3+NM_139266.21+1NANANA2:191841615..191841633(-)00STAT1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2378-2400CTGAAGTATCTGTATCCAAATATAUUUGGAUACAGAUACUUCAGGAAGUAUCUGUAUCCAAAUAUU20.114.523


Target Position: 3441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3441GGAGUUAGGCUAUUCACAA99.584328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103459GGAGTTAGGCTATTCACAATTGTGAATAGCCTAACTCC0.627100.015900.724101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3439-3461AGGGAGTTAGGCTATTCACAACCUUGUGAAUAGCCUAACUCCCUGGAGUUAGGCUAUUCACAACCU20.518.923


Target Position: 3593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593AGGAGUAGAAAAAGCAGUA88.4163416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173611AGGAGTAGAAAAAGCAGTATACTGCTTTTTCTACTCCT0.206600.011700.663800.750001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143GCGAGAGCGUGCCCUGUUG70.28812310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612161GCGAGAGCGTGCCCTGTTGCAACAGGGCACGCTCTCGC0.094500.010400.775900.750000.929300.87500


Target Position: 3005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005GGUUGUUGGAUAAAUCAGU82.1471896

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3003-3025TAGGTTGTTGGATAAATCAGTGGACUGAUUUAUCCAACAACCUAGGUUGUUGGAUAAAUCAGUGGU12.019.332


Target Position: 2473, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2473CCCUAAAGGAACUGGAUAU83.4578783

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7247319CCCTAAAGGAACTGGATAT1/1/0/097.75STAT1NM_007315.3+NM_139266.21+1NANANA2:191840570..191840588(-)00STAT1(0.002)&XRRA1(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942491CCCTAAAGGAACTGGATATATATCCAGTTCCTTTAGGG0.125800.037800.948301.000000.989100.75000


Target Position: 3748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3748CUCUCUCCUGUACUUUUUC65.32992883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363766CTCTCTCCTGTACTTTTTCGAAAAAGTACAGGAGAGAG0.754500.527100.637900.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789UGAUGUUAGACAAACAGAA88.4177414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839807TGATGTTAGACAAACAGAATTCTGTTTGTCTAACATCA0.403400.056600.551700.750000.962000.75000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886AGUGAAAAACAUCCAGAUA91.0428257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912904AGTGAAAAACATCCAGATATATCTGGATGTTTTTCACT0.138700.063400.663800.750000.967400.75000


Target Position: 3999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3999UGUUUUAAAAUUAAAGCUA79.36451204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8974017TGTTTTAAAATTAAAGCTATAGCTTTAATTTTAAAACA0.109800.021600.534500.750001.000001.00000


Target Position: 4265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4265GCCAAGAGACUUUACUUUU82.5729856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8084283GCCAAGAGACTTTACTTTTAAAAGTAAAGTCTCTTGGC0.092500.011901.000001.000000.962000.62500


Target Position: 899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GACUUCAAAUGCAAAACCU82.5166862

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
897-919ATGACTTCAAATGCAAAACCTTGAGGUUUUGCAUUUGAAGUCAUGACUUCAAAUGCAAAACCUUGU18.819.212


Target Position: 3588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3588GGGAAAGGAGUAGAAAAAG73.07271968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683606GGGAAAGGAGTAGAAAAAGCTTTTTCTACTCCTTTCCC0.073300.023300.853400.750001.000001.00000


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772UGUUGAUAGCAAGUGAAUU76.81831505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782790TGTTGATAGCAAGTGAATTAATTCACTTGCTATCAACA0.089600.020600.698300.750001.000001.00000


Target Position: 3707, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3707CGCUGAUAUAUGUGUUUUU87.4333470

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9370719CGCTGATATATGTGTTTTT1/1/0/097.75STAT1NM_007315.3+NM_139266.21+0NANANA2:191834345..191834363(-)00STAT1(0.002)


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104GGAAGCGGAGACAGCAGAG74.51661785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001122GGAAGCGGAGACAGCAGAGCTCTGCTGTCTCCGCTTCC0.085500.012700.560300.750001.000001.00000


Target Position: 3817, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3817CCUUUUUCCUUCCUUAUCA85.1039626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863835CCTTTTTCCTTCCTTATCATGATAAGGAAGGAAAAAGG0.107000.099400.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3815-3837TACCTTTTTCCTTCCTTATCACTUGAUAAGGAAGGAAAAAGGUACCUUUUUCCUUCCUUAUCACUU19.95.522


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CGCUUUUCUUUGGAGAAUA87.166489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978614CGCTTTTCTTTGGAGAATATATTCTCCAAAGAAAAGCG0.056800.012800.879301.000000.983700.75000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949GGCAAAGAGUGAUCAGAAA98.43746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805967GGCAAAGAGTGATCAGAAATTTCTGATCACTCTTTGCC0.084900.042501.000001.000001.000001.00000


Target Position: 2644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644CAUGAAUUUUUUUCAUCUU85.6785579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2642-2664AGCATGAATTTTTTTCATCTTCTAAGAUGAAAAAAAUUCAUGCUCAUGAAUUUUUUUCAUCUUCUU20.47.222


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679CACUCCCUUAGUUUUGAAA85.3381605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141697CACTCCCTTAGTTTTGAAATTTCAAAACTAAGGGAGTG0.247300.090800.793100.750001.000001.00000


Target Position: 3099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3099AGUGUAACUGGCAGUUUUC69.80442365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813117AGTGTAACTGGCAGTTTTCGAAAACTGCCAGTTACACT0.100700.019800.534500.500001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432GGUGAAAUUGCAAGAGCUG75.44081674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531450GGTGAAATTGCAAGAGCTGCAGCTCTTGCAATTTCACC0.117600.026800.569000.750000.923900.75000


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284CGCACUCUGUGUAUAUAAC80.44181070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876302CGCACTCTGTGTATATAACGTTATATACACAGAGTGCG0.167800.010000.775900.750001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CAUCCUAGAACUCAUUAAA95.630997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4712086CATCCTAGAACTCATTAAATTTAATGAGTTCTAGGATG0.912500.250400.655200.750001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761GCUCAGUCGGGGAAUAUUC70.26782312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771779GCTCAGTCGGGGAATATTCGAATATTCCCCGACTGAGC0.333200.013100.681000.750001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862UGAAAUCAAGAGCCUGGAA79.89961137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842880TGAAATCAAGAGCCTGGAATTCCAGGCTCTTGATTTCA0.181800.026500.551700.750001.000001.00000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006UGACAAUAAGAGAAAGGAA90.7693277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481024TGACAATAAGAGAAAGGAATTCCTTTCTCTTATTGTCA0.157700.097400.551700.750001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024AGUAGUUCACAAAAUAAUA93.7484153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711042AGTAGTTCACAAAATAATATATTATTTTGTGAACTACT0.696700.034100.663800.750001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840ACUGAAGGUAAAAUUGAAA84.7314666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532858ACTGAAGGTAAAATTGAAATTTCAATTTTACCTTCAGT0.208200.026100.706900.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240ACAGAAAUACACCUACGAA93.9329145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831258ACAGAAATACACCTACGAATTCGTAGGTGTATTTCTGT0.382800.294900.534500.750000.983700.62500


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350GGCUGCUGAGAAUAUUCCU81.4433965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152368GGCTGCTGAGAATATTCCTAGGAATATTCTCAGCAGCC0.066700.022900.655200.750001.000001.00000


Target Position: 3310, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3310CUUAAUGACACUAGCUAAU79.17931236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793328CTTAATGACACTAGCTAATATTAGCTAGTGTCATTAAG0.096000.010000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3308-3330GGCTTAATGACACTAGCTAATATAUUAGCUAGUGUCAUUAAGCCCUUAAUGACACUAGCUAAUAUU19.58.923


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227GCGCAGAAAAGUUUCAUUU79.67011169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854245GCGCAGAAAAGTTTCATTTAAATGAAACTTTTCTGCGC0.096100.010600.922401.000001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237GGAACAGAAAUACACCUAC78.14031342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921255GGAACAGAAATACACCTACGTAGGTGTATTTCTGTTCC0.374900.180500.689700.750000.983700.62500


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584GAUCAAUAUAGUCGCUUUU84.1544718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617602GATCAATATAGTCGCTTTTAAAAGCGACTATATTGATC0.161600.137500.681000.750001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047UGCUGAAUGUCACUGAACU78.57391295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541065TGCTGAATGTCACTGAACTAGTTCAGTGACATTCAGCA0.195200.027900.646600.500001.000001.00000


Target Position: 3652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652CAGAUCAUUUCAAAACUCA90.6641285

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3650-3672ATCAGATCATTTCAAAACTCATTUGAGUUUUGAAAUGAUCUGAUCAGAUCAUUUCAAAACUCAUUU13.320.432


Target Position: 1615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615GAAAGAACAGAAAAAUGCU84.6566671

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1613-1635TTGAAAGAACAGAAAAATGCTGGAGCAUUUUUCUGUUCUUUCAAGAAAGAACAGAAAAAUGCUGGU14.013.322


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498GGUUAGAAAAGCAAGACUG78.39141312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777516GGTTAGAAAAGCAAGACTGCAGTCTTGCTTTTCTAACC0.114300.029400.569000.750001.000001.00000


Target Position: 2021, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2021GAAAAUAUAAAUGAUAAAA93.1412172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632039GAAAATATAAATGATAAAATTTTATCATTTATATTTTC0.775300.093700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2019-2041AGGAAAATATAAATGATAAAAATUUUUAUCAUUUAUAUUUUCCUGAAAAUAUAAAUGAUAAAAAUU8.9-10.321


Target Position: 4241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4241GCAUGGUUUCAUUUUACUG77.85691365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7664259GCATGGTTTCATTTTACTGCAGTAAAATGAAACCATGC0.313800.031000.569000.750001.000001.00000


Target Position: 979, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979GUUACUCAAGAAGAUGUAU81.5653951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
977-999CTGTTACTCAAGAAGATGTATTTAUACAUCUUCUUGAGUAACAGGUUACUCAAGAAGAUGUAUUUU20.320.332


Target Position: 4274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4274CUUUACUUUUAAGAAGUAU78.35231317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4272-4294GACTTTACTTTTAAGAAGTATTAAUACUUCUUAAAAGUAAAGUCCUUUACUUUUAAGAAGUAUUAU18.94.921


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948UGGCAAAGAGUGAUCAGAA90.6093293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783966TGGCAAAGAGTGATCAGAATTCTGATCACTCTTTGCCA0.088900.040300.672400.750001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878GAAGAUUUACAAGAUGAAU87.1688486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425896GAAGATTTACAAGATGAATATTCATCTTGTAAATCTTC0.364000.149400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
876-898TGGAAGATTTACAAGATGAATATAUUCAUCUUGUAAAUCUUCCAGAAGAUUUACAAGAUGAAUAUU20.45.323


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575CAGCUGGAUGAUCAAUAUA94.9665119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867593CAGCTGGATGATCAATATATATATTGATCATCCAGCTG0.552300.010300.741400.750001.000001.00000


Target Position: 2020, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020GGAAAAUAUAAAUGAUAAA99.392631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852038GGAAAATATAAATGATAAATTTATCATTTATATTTTCC0.765900.065900.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2018-2040AAGGAAAATATAAATGATAAAAAUUUAUCAUUUAUAUUUUCCUUGGAAAAUAUAAAUGAUAAAAAU8.72.121


Target Position: 3837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3837UGACACAAAAAGUAGAUUA85.041631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443855TGACACAAAAAGTAGATTATAATCTACTTTTTGTGTCA0.114900.055300.689700.750001.000001.00000


Target Position: 2939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939UGGGAAAGGAGAAGUUAAG63.8883039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272957TGGGAAAGGAGAAGTTAAGCTTAACTTCTCCTTTCCCA0.080200.009400.706900.500001.000001.00000


Target Position: 2942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942GAAAGGAGAAGUUAAGCAA96.353182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582960GAAAGGAGAAGTTAAGCAATTGCTTAACTTCTCCTTTC0.059300.019200.525900.750001.000001.00000


Target Position: 3442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3442GAGUUAGGCUAUUCACAAC84.6362673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723460GAGTTAGGCTATTCACAACGTTGTGAATAGCCTAACTC0.479300.089600.663800.500001.000001.00000


Target Position: 3459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459ACCACUCAUUCAAAAGUUG66.70772718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033477ACCACTCATTCAAAAGTTGCAACTTTTGAATGAGTGGT0.067900.032500.706900.500000.907600.62500


Target Position: 4240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4240GGCAUGGUUUCAUUUUACU81.5271958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7954258GGCATGGTTTCATTTTACTAGTAAAATGAAACCATGCC0.437500.012400.793100.750001.000001.00000


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285AGAAGUAUUAAAAUUCUAA94.6085129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7964303AGAAGTATTAAAATTCTAATTAGAATTTTAATACTTCT0.286300.012300.689700.750001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146GCCAAGUUUAUAUACAAUU80.42741075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1713164GCCAAGTTTATATACAATTAATTGTATATAAACTTGGC0.376900.127800.991401.000001.000001.00000


Target Position: 3524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3524CUUAAAUGGGCUACUUUGU70.31592306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3522-3544TTCTTAAATGGGCTACTTTGTCCACAAAGUAGCCCAUUUAAGAACUUAAAUGGGCUACUUUGUCCU11.8-1.423


Target Position: 4204, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4204GUUUAGCUGUCAGUUCUUU79.52981178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4202-4224AGGTTTAGCTGTCAGTTCTTTTTAAAGAACUGACAGCUAAACCUGUUUAGCUGUCAGUUCUUUUUU17.718.322


Target Position: 852, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852GUAUAGAGCAUGAAAUCAA98.488545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984870GTATAGAGCATGAAATCAATTGATTTCATGCTCTATAC0.142400.006500.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
850-872GTGTATAGAGCATGAAATCAAGAUUGAUUUCAUGCUCUAUACACGUAUAGAGCAUGAAAUCAAGAU16.313.033


Target Position: 2321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2321CCUGACAUCAUUCGCAAUU70.93922245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2192339CCTGACATCATTCGCAATTAATTGCGAATGATGTCAGG0.778800.092600.836201.000001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000UUAUAGGUUGUUGGAUAAA73.10491961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233018TTATAGGTTGTTGGATAAATTTATCCAACAACCTATAA0.111300.019600.534500.500001.000001.00000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CCAUCCUUUGGUACAACAU79.81681147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251815CCATCCTTTGGTACAACATATGTTGTACCAAAGGATGG0.075400.008300.689701.000000.972800.62500


Target Position: 3791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3791GUUUCGUGAAGUAUACUGU80.01851129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3789-3811ATGTTTCGTGAAGTATACTGTATACAGUAUACUUCACGAAACAUGUUUCGUGAAGUAUACUGUAUU13.121.133


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411AGCAGCUUGACUCAAAAUU69.15692439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735429AGCAGCTTGACTCAAAATTAATTTTGAGTCAAGCTGCT0.181600.014600.844800.750001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625AUAAUACACCAGAGAUAAU84.3812698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993643ATAATACACCAGAGATAATATTATCTCTGGTGTATTAT0.280100.118800.534500.500001.000001.00000


Target Position: 4286, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4286GAAGUAUUAAAAUUCUAAA98.85637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7384304GAAGTATTAAAATTCTAAATTTAGAATTTTAATACTTC0.294600.014500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4284-4306AAGAAGTATTAAAATTCTAAAATUUUAGAAUUUUAAUACUUCUUGAAGUAUUAAAAUUCUAAAAUU6.94.622


Target Position: 2898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898CCAGAUACACCCAAAGUAU88.4893407

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2896-2918ATCCAGATACACCCAAAGTATCAAUACUUUGGGUGUAUCUGGAUCCAGAUACACCCAAAGUAUCAU11.820.323


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269UCACAAAAAACAAACAAGU66.66352725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901287TCACAAAAAACAAACAAGTACTTGTTTGTTTTTTGTGA0.121300.067800.517200.500001.000001.00000


Target Position: 3829, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3829CUUAUCACUGACACAAAAA87.4569468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463847CTTATCACTGACACAAAAATTTTTGTGTCAGTGATAAG0.144900.044900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3827-3849TCCTTATCACTGACACAAAAAGTUUUUUGUGUCAGUGAUAAGGACUUAUCACUGACACAAAAAGUU12.216.122


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GCAAAGAGUGAUCAGAAAC74.85861750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
855968GCAAAGAGTGATCAGAAACGTTTCTGATCACTCTTTGC0.075600.038500.706900.750001.000001.00000


Target Position: 994, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994GUAUUUAAUGCUUGACAAU85.9937564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111012GTATTTAATGCTTGACAATATTGTCAAGCATTAAATAC0.153900.060400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
992-1014ATGTATTTAATGCTTGACAATAAAUUGUCAAGCAUUAAAUACAUGUAUUUAAUGCUUGACAAUAAU20.5-7.522


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043GAGUUGCUGAAUGUCACUG70.99032235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421061GAGTTGCTGAATGTCACTGCAGTGACATTCAGCAACTC0.105400.011100.525900.500001.000001.00000


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688CUGUGAUUCCCUCCUGCUA86.1463559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492706CTGTGATTCCCTCCTGCTATAGCAGGAGGGAATCACAG0.533700.131300.612100.750001.000001.00000


Target Position: 3317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317ACACUAGCUAAUAUCAAUA90.8881266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4153335ACACTAGCTAATATCAATATATTGATATTAGCTAGTGT0.440100.079800.663800.750001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646GAGAAUCAGAUCAUUUCAA95.2616105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563664GAGAATCAGATCATTTCAATTGAAATGATCTGATTCTC0.137500.056600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3644-3666ATGAGAATCAGATCATTTCAAAAUUGAAAUGAUCUGAUUCUCAUGAGAAUCAGAUCAUUUCAAAAU13.820.422


Target Position: 3929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3929UGCUACCACAACUAUAUUA84.1067727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6213947TGCTACCACAACTATATTATAATATAGTTGTGGTAGCA0.685700.219000.819000.750001.000001.00000


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019AGGAAAAUAUAAAUGAUAA97.994255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4452037AGGAAAATATAAATGATAATTATCATTTATATTTTCCT0.807300.046300.810300.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GUAAAGUCAGAAAUGUGAA91.3837230

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
817-839CAGTAAAGTCAGAAATGTGAAGGUUCACAUUUCUGACUUUACUGGUAAAGUCAGAAAUGUGAAGGU20.514.623


Target Position: 2689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689UGUGAUUCCCUCCUGCUAC62.6583180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382707TGTGATTCCCTCCTGCTACGTAGCAGGAGGGAATCACA0.534400.209400.525900.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231GGAAUUGGAACAGAAAUAC71.2712195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881249GGAATTGGAACAGAAATACGTATTTCTGTTCCAATTCC0.451300.118400.689700.750001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782AGCACAGUGAUGUUAGACA87.547465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734800AGCACAGTGATGTTAGACATGTCTAACATCACTGTGCT0.166300.026600.646600.500001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500GAAAUACAGUAAAAGGAUU89.5351349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391518GAAATACAGTAAAAGGATTAATCCTTTTACTGTATTTC0.597600.433100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1498-1520GAGAAATACAGTAAAAGGATTTAAAUCCUUUUACUGUAUUUCUCGAAAUACAGUAAAAGGAUUUAU18.76.922


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832UGCAUCUUACUGAAGGUAA79.26541216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6872850TGCATCTTACTGAAGGTAATTACCTTCAGTAAGATGCA0.158500.017000.819000.750001.000001.00000


Target Position: 3842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3842CAAAAAGUAGAUUAAGAGA91.2911238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3840-3862CACAAAAAGTAGATTAAGAGATGUCUCUUAAUCUACUUUUUGUGCAAAAAGUAGAUUAAGAGAUGU11.73.212


Target Position: 3798, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3798GAAGUAUACUGUAUUUUUA104.4853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6673816GAAGTATACTGTATTTTTATAAAAATACAGTATACTTC0.111400.035200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3796-3818GTGAAGTATACTGTATTTTTACCUAAAAAUACAGUAUACUUCACGAAGUAUACUGUAUUUUUACCU-9.76.322


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228ACAUCUUUCACAUUGGCUA83.6597764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883246ACATCTTTCACATTGGCTATAGCCAATGTGAAAGATGT0.317200.049600.534500.750001.000001.00000


Target Position: 3881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3881CCUUUUACAUACUGCUGUC75.95251609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393899CCTTTTACATACTGCTGTCGACAGCAGTATGTAAAAGG0.300600.130100.525900.750000.962000.62500


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539UCAUUUGCCACCAUCCGUU66.53632735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822557TCATTTGCCACCATCCGTTAACGGATGGTGGCAAATGA0.082100.019000.577600.750001.000001.00000


Target Position: 3400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400UCAUCUUGGUCACAUACAA87.7587453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373418TCATCTTGGTCACATACAATTGTATGTGACCAAGATGA0.442300.097300.577600.750001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714UGAAGGAAGAAAGGAAAAU68.6632502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440732TGAAGGAAGAAAGGAAAATATTTTCCTTTCTTCCTTCA0.184100.081000.715500.750001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230AGGAAUUGGAACAGAAAUA85.8308574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921248AGGAATTGGAACAGAAATATATTTCTGTTCCAATTCCT0.414700.110700.801700.750001.000001.00000


Target Position: 4026, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4026GUAUUGCAUUAAAUAUAAU92.1858204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4024-4046CTGTATTGCATTAAATATAATATAUUAUAUUUAAUGCAAUACAGGUAUUGCAUUAAAUAUAAUAUU-8.021.122


Target Position: 3276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276GAGAAGAGAAUAUUAGCUU87.8431448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8323294GAGAAGAGAATATTAGCTTAAGCTAATATTCTCTTCTC0.108900.011300.672400.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625ACAGCAUAACAUAAGGAAA90.2345311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622643ACAGCATAACATAAGGAAATTTCCTTATGTTATGCTGT0.506300.335000.706900.750001.000001.00000


Target Position: 3801, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801GUAUACUGUAUUUUUACCU74.97561739

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3799-3821AAGTATACTGTATTTTTACCTTTAGGUAAAAAUACAGUAUACUUGUAUACUGUAUUUUUACCUUUU14.013.112


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GGAGUGGAAGCGGAGACAG70.84542260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081117GGAGTGGAAGCGGAGACAGCTGTCTCCGCTTCCACTCC0.118700.017900.586200.750001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164UGCAGAACUGGUUCACUAU80.93121019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621182TGCAGAACTGGTTCACTATATAGTGAACCAGTTCTGCA0.111900.023100.810300.750001.000001.00000


Target Position: 3209, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209GGAAAAUGUGUAUUUUAUU89.9723324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5363227GGAAAATGTGTATTTTATTAATAAAATACACATTTTCC0.211900.027700.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3207-3229GGGGAAAATGTGTATTTTATTACAAUAAAAUACACAUUUUCCCCGGAAAAUGUGUAUUUUAUUACU-10.37.421


Target Position: 3930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3930GCUACCACAACUAUAUUAU85.0136636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943948GCTACCACAACTATATTATATAATATAGTTGTGGTAGC0.684700.234800.810301.000001.000001.00000


Target Position: 3675, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675CUAUGUAACUGCAUUGAGA95.0211112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3673-3695TCCTATGTAACTGCATTGAGAACUCUCAAUGCAGUUACAUAGGACUAUGUAACUGCAUUGAGAACU18.18.532


Target Position: 3505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3505AGAAAUUUAAUUCAUGUUU73.42831917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5983523AGAAATTTAATTCATGTTTAAACATGAATTAAATTTCT0.137500.036300.724100.750000.983700.62500


Target Position: 3797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3797UGAAGUAUACUGUAUUUUU84.3254704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273815TGAAGTATACTGTATTTTTAAAAATACAGTATACTTCA0.098000.029800.724100.750001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490GGCACAGUGGUUAGAAAAG74.47071786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972508GGCACAGTGGTTAGAAAAGCTTTTCTAACCACTGTGCC0.117800.006900.862100.750001.000001.00000


Target Position: 3109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109GCAGUUUUCCAUUGGUUUA87.3575475

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3107-3129TGGCAGTTTTCCATTGGTTTACCUAAACCAAUGGAAAACUGCCAGCAGUUUUCCAUUGGUUUACCU18.810.322


Target Position: 3460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460CCACUCAUUCAAAAGUUGA82.8891830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073478CCACTCATTCAAAAGTTGATCAACTTTTGAATGAGTGG0.067300.030400.620700.750000.907600.62500


Target Position: 2999, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2999GUUAUAGGUUGUUGGAUAA94.618128

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1299919GTTATAGGTTGTTGGATAA1/1/0/0100.00STAT1NM_007315.3+NM_139266.21+0NANANA2:191835053..191835071(-)00STAT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7133017GTTATAGGTTGTTGGATAATTATCCAACAACCTATAAC0.102100.017700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2997-3019CTGTTATAGGTTGTTGGATAAATUUAUCCAACAACCUAUAACAGGUUAUAGGUUGUUGGAUAAAUU21.212.333


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494CAGUGGUUAGAAAAGCAAG77.16141456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753512CAGTGGTTAGAAAAGCAAGCTTGCTTTTCTAACCACTG0.371700.013800.646600.500001.000001.00000


Target Position: 3949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3949CAUGCAAAUGCUGUAUUCU81.6945939

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3947-3969ATCATGCAAATGCTGTATTCTTCAGAAUACAGCAUUUGCAUGAUCAUGCAAAUGCUGUAUUCUUCU16.120.022


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711GUCUGAAGGAAGAAAGGAA94.1617143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848729GTCTGAAGGAAGAAAGGAATTCCTTTCTTCCTTCAGAC0.282000.010800.646600.750001.000001.00000


Target Position: 574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574ACAGCUGGAUGAUCAAUAU87.3345477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842592ACAGCTGGATGATCAATATATATTGATCATCCAGCTGT0.614100.011000.663800.750001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002UGCUUGACAAUAAGAGAAA80.42951073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331020TGCTTGACAATAAGAGAAATTTCTCTTATTGTCAAGCA0.265400.068400.853400.750001.000001.00000


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653AGAUCAUUUCAAAACUCAU89.3986356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783671AGATCATTTCAAAACTCATATGAGTTTTGAAATGATCT0.386700.082200.569000.750001.000001.00000


Target Position: 3760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760CUUUUUCCAGACACUUUUU75.95671606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3758-3780TACTTTTTCCAGACACTTTTTTGAAAAAGUGUCUGGAAAAAGUACUUUUUCCAGACACUUUUUUGU10.314.321


Target Position: 2389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389GUAUCCAAAUAUUGACAAA95.975290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2387-2409CTGTATCCAAATATTGACAAAGAUUUGUCAAUAUUUGGAUACAGGUAUCCAAAUAUUGACAAAGAU20.521.223


Target Position: 3269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GUUUCUUGAGAAGAGAAUA89.3504360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3267-3289CTGTTTCTTGAGAAGAGAATATTUAUUCUCUUCUCAAGAAACAGGUUUCUUGAGAAGAGAAUAUUU19.112.222


Target Position: 4125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4125GUUUCAGUUGAUUUUACAA94.3634135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4123-4145AAGTTTCAGTTGATTTTACAATTUUGUAAAAUCAACUGAAACUUGUUUCAGUUGAUUUUACAAUUU7.219.221


Target Position: 3543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3543CCUUUUUGUUAUUAGGGUG71.34662184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283561CCTTTTTGTTATTAGGGTGCACCCTAATAACAAAAAGG0.108500.030200.551700.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CAAAGAGUGAUCAGAAACA92.3178200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971GGCAAAGAGTGATCAGAAACAAGUGUUUCUGAUCACUCUUUGCCCAAAGAGUGAUCAGAAACAAGU19.217.722


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925CAGAGAACACGAGACCAAU88.0001440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643943CAGAGAACACGAGACCAATATTGGTCTCGTGTTCTCTG0.115300.029200.775900.750001.000001.00000


Target Position: 4179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4179AACAAUAUUGUUUCUAAUU76.45151549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8724197AACAATATTGTTTCTAATTAATTAGAAACAATATTGTT0.145800.044200.637900.500001.000001.00000


Target Position: 3041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041CUUGACGUAGGAACGGUAA79.22361229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573059CTTGACGTAGGAACGGTAATTACCGTTCCTACGTCAAG0.059900.007200.603400.750000.951101.00000


Target Position: 3534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534CUACUUUGUCCUUUUUGUU79.2451222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3532-3554GGCTACTTTGTCCTTTTTGTTATAACAAAAAGGACAAAGUAGCCCUACUUUGUCCUUUUUGUUAUU5.611.822


Target Position: 3952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3952GCAAAUGCUGUAUUCUUCU79.88471139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3950-3972ATGCAAATGCTGTATTCTTCTTTAGAAGAAUACAGCAUUUGCAUGCAAAUGCUGUAUUCUUCUUUU14.820.022


Target Position: 877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GGAAGAUUUACAAGAUGAA98.518144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276895GGAAGATTTACAAGATGAATTCATCTTGTAAATCTTCC0.353200.154700.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
875-897CTGGAAGATTTACAAGATGAATAUUCAUCUUGUAAAUCUUCCAGGGAAGAUUUACAAGAUGAAUAU20.414.822


Target Position: 2800, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800CUCAGAAACAUCAGUUACU79.28661214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2798-2820AACTCAGAAACATCAGTTACTCTAGUAACUGAUGUUUCUGAGUUCUCAGAAACAUCAGUUACUCUU19.020.422


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CAUGACCCUAUCACAAAAA87.5166466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531277CATGACCCTATCACAAAAATTTTTGTGATAGGGTCATG0.391500.175600.655200.750000.907600.62500


Target Position: 4267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4267CAAGAGACUUUACUUUUAA97.115871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6614285CAAGAGACTTTACTTTTAATTAAAAGTAAAGTCTCTTG0.244300.019200.612100.750001.000001.00000


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165GCAGAACUGGUUCACUAUA92.904179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851183GCAGAACTGGTTCACTATATATAGTGAACCAGTTCTGC0.129500.030800.810301.000001.000001.00000


Target Position: 3259, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259GACAAAUUCUGUUUCUUGA92.2846201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3257-3279AAGACAAATTCTGTTTCTTGAGAUCAAGAAACAGAAUUUGUCUUGACAAAUUCUGUUUCUUGAGAU12.25.322


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489UGGCACAGUGGUUAGAAAA81.2023989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993507TGGCACAGTGGTTAGAAAATTTTCTAACCACTGTGCCA0.141100.006300.844800.750001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684CCUUAGUUUUGAAACCCAA90.6599287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331702CCTTAGTTTTGAAACCCAATTGGGTTTCAAAACTAAGG0.186800.044300.698301.000000.978300.87500


Target Position: 1481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481GAUAAAGAUGUGAAUGAGA93.9112146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1479-1501TTGATAAAGATGTGAATGAGAGAUCUCAUUCACAUCUUUAUCAAGAUAAAGAUGUGAAUGAGAGAU20.46.922


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258ACAUGACCCUAUCACAAAA93.3768166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521276ACATGACCCTATCACAAAATTTTGTGATAGGGTCATGT0.426200.184400.706900.750000.907600.75000


Target Position: 1466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466GUCAAAGUCUUAUUUGAUA93.358167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1464-1486AAGTCAAAGTCTTATTTGATAAAUAUCAAAUAAGACUUUGACUUGUCAAAGUCUUAUUUGAUAAAU7.219.222


Target Position: 3612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3612ACUGACAACUUGAAUAAUA89.3412362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4223630ACTGACAACTTGAATAATATATTATTCAAGTTGTCAGT0.494000.160600.663800.750001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003GCUUGACAAUAAGAGAAAG79.23931224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771021GCTTGACAATAAGAGAAAGCTTTCTCTTATTGTCAAGC0.250300.073200.715500.750001.000001.00000


Target Position: 3485, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3485CCAUAGAUGUAGAUAAACU93.0533174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5643503CCATAGATGTAGATAAACTAGTTTATCTACATCTATGG0.304200.200400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3483-3505AACCATAGATGTAGATAAACTCAAGUUUAUCUACAUCUAUGGUUCCAUAGAUGUAGAUAAACUCAU10.013.332


Target Position: 2945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945AGGAGAAGUUAAGCAACAU84.3791699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512963AGGAGAAGTTAAGCAACATATGTTGCTTAACTTCTCCT0.076800.018000.689700.750001.000001.00000


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045ACGUAGGAACGGUAAAUUU78.60991287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943063ACGTAGGAACGGTAAATTTAAATTTACCGTTCCTACGT0.161700.016700.775900.750000.951100.62500


Target Position: 1496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496GAGAGAAAUACAGUAAAAG79.49891184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171514GAGAGAAATACAGTAAAAGCTTTTACTGTATTTCTCTC0.669400.268900.672400.500001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632CUGGCACCAGAACGAAUGA79.18761232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7951650CTGGCACCAGAACGAATGATCATTCGTTCTGGTGCCAG0.086100.015100.560300.500000.989100.62500


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486AGAUGUGAAUGAGAGAAAU86.9084506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471504AGATGTGAATGAGAGAAATATTTCTCTCATTCACATCT0.239700.080300.715500.750001.000001.00000


Target Position: 3654, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654GAUCAUUUCAAAACUCAUU84.8156656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783672GATCATTTCAAAACTCATTAATGAGTTTTGAAATGATC0.364400.090800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3652-3674CAGATCATTTCAAAACTCATTTCAAUGAGUUUUGAAAUGAUCUGGAUCAUUUCAAAACUCAUUUCU19.27.232


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868CAAGAGCCUGGAAGAUUUA90.1309318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665886CAAGAGCCTGGAAGATTTATAAATCTTCCAGGCTCTTG0.357100.058800.612100.750001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983CUCAAGAAGAUGUAUUUAA90.2496309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361001CTCAAGAAGATGTATTTAATTAAATACATCTTCTTGAG0.347000.196600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
981-1003TACTCAAGAAGATGTATTTAATGUUAAAUACAUCUUCUUGAGUACUCAAGAAGAUGUAUUUAAUGU1.420.422


Target Position: 4020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4020GUAUCUGUAUUGCAUUAAA98.870236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4018-4040AAGTATCTGTATTGCATTAAATAUUUAAUGCAAUACAGAUACUUGUAUCUGUAUUGCAUUAAAUAU15.320.333


Target Position: 3440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3440GGGAGUUAGGCUAUUCACA90.924263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373458GGGAGTTAGGCTATTCACATGTGAATAGCCTAACTCCC0.362100.008000.784500.750001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480GGAACUGGAUAUAUCAAGA98.27250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882498GGAACTGGATATATCAAGATCTTGATATATCCAGTTCC0.056200.008400.646600.750001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548AGACAACCUGCUCCCCAUG64.58192969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272566AGACAACCTGCTCCCCATGCATGGGGAGCAGGTTGTCT0.117000.116300.569000.500000.994600.62500


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144CGAGAGCGUGCCCUGUUGA83.4438786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462162CGAGAGCGTGCCCTGTTGATCAACAGGGCACGCTCTCG0.109800.016200.569000.750000.929300.75000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873GCCUGGAAGAUUUACAAGA84.4162694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255891GCCTGGAAGATTTACAAGATCTTGTAAATCTTCCAGGC0.369800.078500.775900.750001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204CGCCUAGCCCUUCCGGAUC57.09633624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954222CGCCTAGCCCTTCCGGATCGATCCGGAAGGGCTAGGCG0.059800.015000.741400.750000.913000.75000


Target Position: 3407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3407GGUCACAUACAAUUAUUUU89.5901343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843425GGTCACATACAATTATTTTAAAATAATTGTATGTGACC0.734400.378100.853401.000001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545GCCACCAUCCGUUUUCAUG67.07432677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818563GCCACCATCCGTTTTCATGCATGAAAACGGATGGTGGC0.082400.036600.844800.750000.972800.62500


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CUCAGUCGGGGAAUAUUCA82.4525868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909780CTCAGTCGGGGAATATTCATGAATATTCCCCGACTGAG0.373800.258600.586200.500001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015UGUAAGGAAAAUAUAAAUG65.17812903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212033TGTAAGGAAAATATAAATGCATTTATATTTTCCTTACA0.233900.041300.551700.500001.000001.00000


Target Position: 3403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3403UCUUGGUCACAUACAAUUA85.5161590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6553421TCTTGGTCACATACAATTATAATTGTATGTGACCAAGA0.620200.107100.689700.750001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955GAGUGAUCAGAAACAAGAA102.61810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619973GAGTGATCAGAAACAAGAATTCTTGTTTCTGATCACTC0.796000.028500.637900.750001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139GUUCAAAGCCAAGUUUAUA89.8181331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6773157GTTCAAAGCCAAGTTTATATATAAACTTGGCTTTGAAC0.199900.056600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3137-3159TAGTTCAAAGCCAAGTTTATATAUAUAAACUUGGCUUUGAACUAGUUCAAAGCCAAGUUUAUAUAU4.612.233


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881GAUUUACAAGAUGAAUAUG78.93841264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
935899GATTTACAAGATGAATATGCATATTCATCTTGTAAATC0.297500.196500.525900.500001.000001.00000


Target Position: 3638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3638GAUAAUAUGAGAAUCAGAU92.8575180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3636-3658GAGATAATATGAGAATCAGATCAAUCUGAUUCUCAUAUUAUCUCGAUAAUAUGAGAAUCAGAUCAU20.4-8.632


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298CGCACCUUCAGUCUUUUCC56.94843634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261316CGCACCTTCAGTCTTTTCCGGAAAAGACTGAAGGTGCG0.167500.160400.551700.500001.000001.00000


Target Position: 3331, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3331CAAUAGAAGGAUGUACAUU86.8899507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3329-3351ATCAATAGAAGGATGTACATTTCAAUGUACAUCCUUCUAUUGAUCAAUAGAAGGAUGUACAUUUCU20.46.922


Target Position: 790, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790GAUGUUAGACAAACAGAAA99.471529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322808GATGTTAGACAAACAGAAATTTCTGTTTGTCTAACATC0.409700.111700.681000.750000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
788-810GTGATGTTAGACAAACAGAAAGAUUUCUGUUUGUCUAACAUCACGAUGUUAGACAAACAGAAAGAU19.211.623


Target Position: 3614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3614UGACAACUUGAAUAAUACA88.1947427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813632TGACAACTTGAATAATACATGTATTATTCAAGTTGTCA0.542200.289200.517200.500001.000001.00000


Target Position: 3927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3927ACUGCUACCACAACUAUAU80.14771117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4093945ACTGCTACCACAACTATATATATAGTTGTGGTAGCAGT0.435100.096600.663800.750000.967400.62500


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758CAGGCUCAGUCGGGGAAUA83.9725732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883776CAGGCTCAGTCGGGGAATATATTCCCCGACTGAGCCTG0.395300.009800.741400.750001.000001.00000


Target Position: 3613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613CUGACAACUUGAAUAAUAC80.34941085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193631CTGACAACTTGAATAATACGTATTATTCAAGTTGTCAG0.539100.280400.603400.500001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077CCCUGAUUAAUGAUGAACU81.2784977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541095CCCTGATTAATGATGAACTAGTTCATCATTAATCAGGG0.232100.072500.784500.750001.000001.00000


Target Position: 4019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4019AGUAUCUGUAUUGCAUUAA80.21141105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9844037AGTATCTGTATTGCATTAATTAATGCAATACAGATACT0.056300.009800.672400.750001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825UCAGAAAUGUGAAGGACAA85.5903585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
766843TCAGAAATGTGAAGGACAATTGTCCTTCACATTTCTGA0.092000.031500.577600.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070UCCUAGAACUCAUUAAAAA87.3044480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3902088TCCTAGAACTCATTAAAAATTTTTAATGAGTTCTAGGA0.928900.333200.870700.750001.000001.00000


Target Position: 2736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GGAAAUGAAAGAAAGGCCA82.8198834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482754GGAAATGAAAGAAAGGCCATGGCCTTTCTTTCATTTCC0.208200.049400.525900.750001.000001.00000


Target Position: 2328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2328UCAUUCGCAAUUACAAAGU57.67323582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802346TCATTCGCAATTACAAAGTACTTTGTAATTGCGAATGA0.116100.067100.517200.500000.940200.62500


Target Position: 2475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475CUAAAGGAACUGGAUAUAU82.0017906

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2473-2495CCCTAAAGGAACTGGATATATCAAUAUAUCCAGUUCCUUUAGGGCUAAAGGAACUGGAUAUAUCAU16.719.922


Target Position: 2320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320CCCUGACAUCAUUCGCAAU84.7431664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292338CCCTGACATCATTCGCAATATTGCGAATGATGTCAGGG0.753200.088000.982801.000001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547CAGACAACCUGCUCCCCAU88.788390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6112565CAGACAACCTGCTCCCCATATGGGGAGCAGGTTGTCTG0.151300.021300.629300.750000.978300.62500


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GAAUAUGACUUCAAAUGCA97.214367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913ATGAATATGACTTCAAATGCAAAUGCAUUUGAAGUCAUAUUCAUGAAUAUGACUUCAAAUGCAAAU20.08.722


Target Position: 3793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3793UUCGUGAAGUAUACUGUAU73.60551896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413811TTCGTGAAGTATACTGTATATACAGTATACTTCACGAA0.180200.026100.629300.500001.000001.00000


Target Position: 392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
392UCUCAGUGGUACGAACUUC62.70893176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861410TCTCAGTGGTACGAACTTCGAAGTTCGTACCACTGAGA0.169900.012800.551700.500001.000001.00000


Target Position: 3836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3836CUGACACAAAAAGUAGAUU76.35881566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6693854CTGACACAAAAAGTAGATTAATCTACTTTTTGTGTCAG0.110700.049100.775900.750001.000001.00000


Target Position: 3608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3608AGUAACUGACAACUUGAAU78.37111315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2793626AGTAACTGACAACTTGAATATTCAAGTTGTCAGTTACT0.390400.116600.698300.750001.000001.00000


Target Position: 4308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4308CAAAAAAAAAAAAAAAAAA86.7759514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5124326CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.997400.970600.646600.750001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048GCUGAAUGUCACUGAACUU90.639288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221066GCTGAATGTCACTGAACTTAAGTTCAGTGACATTCAGC0.190500.045000.715501.000001.000001.00000


Target Position: 3880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3880CCCUUUUACAUACUGCUGU69.50572396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4793898CCCTTTTACATACTGCTGTACAGCAGTATGTAAAAGGG0.231800.109200.784500.750000.983700.62500


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787UGAUGUUUCGUGAAGUAUA89.5587345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6713805TGATGTTTCGTGAAGTATATATACTTCACGAAACATCA0.110100.069200.681000.750001.000001.00000


Target Position: 2315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2315ACUUUCCCUGACAUCAUUC62.06443242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892333ACTTTCCCTGACATCATTCGAATGATGTCAGGGAAAGT0.201200.016700.534500.500001.000001.00000


Target Position: 2392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2392UCCAAAUAUUGACAAAGAC64.08063024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602410TCCAAATATTGACAAAGACGTCTTTGTCAATATTTGGA0.252700.042000.551700.500001.000001.00000


Target Position: 3833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3833UCACUGACACAAAAAGUAG68.50462524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243851TCACTGACACAAAAAGTAGCTACTTTTTGTGTCAGTGA0.100200.032800.551700.500001.000001.00000


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905GGCUGUAUCUUGUUUUUCC77.18011453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663923GGCTGTATCTTGTTTTTCCGGAAAAACAAGATACAGCC0.275300.018900.629300.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GAUUUAGGAAGUUCAACAU89.539348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1513-1535AGGATTTAGGAAGTTCAACATTTAUGUUGAACUUCCUAAAUCCUGAUUUAGGAAGUUCAACAUUUU20.510.913


Target Position: 2696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696CCCUCCUGCUACUCUGUUC69.24282430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302714CCCTCCTGCTACTCTGTTCGAACAGAGTAGCAGGAGGG0.291400.194900.819000.750001.000001.00000


Target Position: 3940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3940CUAUAUUAUCAUGCAAAUG72.56882032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923958CTATATTATCATGCAAATGCATTTGCATGATAATATAG0.059600.053400.517200.500001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686CAGAUGUCUAUGAUCAUUU86.648528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805704CAGATGTCTATGATCATTTAAATGATCATAGACATCTG0.106300.012000.784500.750001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056UCACUGAACUUACCCAGAA82.3018881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221074TCACTGAACTTACCCAGAATTCTGGGTAAGTTCAGTGA0.066000.021100.551700.750000.918500.62500


Target Position: 3357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3357UCACAAGUUGUGUUUGAUA85.0105637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953375TCACAAGTTGTGTTTGATATATCAAACACAACTTGTGA0.055600.010500.681000.750000.913000.62500


Target Position: 2486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2486GGAUAUAUCAAGACUGAGU88.7781392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722504GGATATATCAAGACTGAGTACTCAGTCTTGATATATCC0.090900.014800.663800.750001.000001.00000


Target Position: 4090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090CUCUCUCAGUUUUUAUAUA94.8853121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954108CTCTCTCAGTTTTTATATATATATAAAAACTGAGAGAG0.231400.006300.767200.750001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CUGAAGGAAGAAAGGAAAA82.0349905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476731CTGAAGGAAGAAAGGAAAATTTTCCTTTCTTCCTTCAG0.273100.104300.784500.750001.000001.00000


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535GACUUCAGACCACAGACAA93.3769165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852553GACTTCAGACCACAGACAATTGTCTGTGGTCTGAAGTC0.088400.017000.672400.750001.000001.00000


Target Position: 3377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3377CCAAAGCUGAAUACAUUCU75.4741670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7433395CCAAAGCTGAATACATTCTAGAATGTATTCAGCTTTGG0.108400.014300.620700.750001.000001.00000


Target Position: 3569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3569GUCUAUUAGCCACAAAAUU80.30021091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3567-3589TAGTCTATTAGCCACAAAATTGGAAUUUUGUGGCUAAUAGACUAGUCUAUUAGCCACAAAAUUGGU5.38.433


Target Position: 1335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335CGUUUGUGGUGGAAAGACA93.3078168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1333-1355CTCGTTTGTGGTGGAAAGACAGCUGUCUUUCCACCACAAACGAGCGUUUGUGGUGGAAAGACAGCU21.519.332


Target Position: 2479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479AGGAACUGGAUAUAUCAAG68.01762562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242497AGGAACTGGATATATCAAGCTTGATATATCCAGTTCCT0.065000.009400.706900.500001.000001.00000


Target Position: 650, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650CGUAAUCUUCAGGAUAAUU84.4344689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
648-670AGCGTAATCTTCAGGATAATTTTAAUUAUCCUGAAGAUUACGCUCGUAAUCUUCAGGAUAAUUUUU15.414.532


Target Position: 3072, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3072GAAUUCUUACAUGUUUUCU77.85071368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3070-3092GAGAATTCTTACATGTTTTCTTTAGAAAACAUGUAAGAAUUCUCGAAUUCUUACAUGUUUUCUUUU14.95.322


Target Position: 3476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476UGAAAUUAACCAUAGAUGU72.99921976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833494TGAAATTAACCATAGATGTACATCTATGGTTAATTTCA0.305600.118600.517200.500001.000001.00000


Target Position: 3396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3396GCUUUCAUCUUGGUCACAU81.7871931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5083414GCTTTCATCTTGGTCACATATGTGACCAAGATGAAAGC0.155000.032900.698301.000001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230AUCUUUCACAUUGGCUAUU62.14453235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393248ATCTTTCACATTGGCTATTAATAGCCAATGTGAAAGAT0.298600.073500.672400.500001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534AGACUUCAGACCACAGACA85.0791628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842552AGACTTCAGACCACAGACATGTCTGTGGTCTGAAGTCT0.140500.029400.517200.500001.000001.00000


Target Position: 467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467CCCAUGGAAAUCAGACAGU69.88022361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627485CCCATGGAAATCAGACAGTACTGTCTGATTTCCATGGG0.180500.020400.784500.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066AGCAUCCUAGAACUCAUUA82.039903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2732084AGCATCCTAGAACTCATTATAATGAGTTCTAGGATGCT0.600800.203200.819000.750001.000001.00000


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001CGUGGACGAGGUUUUGUAA95.2735104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702019CGTGGACGAGGTTTTGTAATTACAAAACCTCGTCCACG0.259300.024500.741401.000001.000001.00000


Target Position: 4121, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4121CUAAGUUUCAGUUGAUUUU78.31831321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4119-4141ACCTAAGTTTCAGTTGATTTTACAAAAUCAACUGAAACUUAGGUCUAAGUUUCAGUUGAUUUUACU7.44.932


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283UCGCACUCUGUGUAUAUAA82.302880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960301TCGCACTCTGTGTATATAATTATATACACAGAGTGCGA0.123100.007200.758600.750001.000001.00000


Target Position: 3232, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232CUUUCACAUUGGCUAUUUA95.3128102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6703250CTTTCACATTGGCTATTTATAAATAGCCAATGTGAAAG0.377900.085900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3230-3252ATCTTTCACATTGGCTATTTAAAUAAAUAGCCAAUGUGAAAGAUCUUUCACAUUGGCUAUUUAAAU13.620.532


Target Position: 3805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3805ACUGUAUUUUUACCUUUUU74.31831807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2903823ACTGTATTTTTACCTTTTTAAAAAGGTAAAAATACAGT0.284600.097000.706900.750001.000001.00000


Target Position: 3406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406UGGUCACAUACAAUUAUUU79.40381198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6113424TGGTCACATACAATTATTTAAATAATTGTATGTGACCA0.684800.355600.844800.750001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801CCUUUGGUACAACAUGCUG68.83932477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941819CCTTTGGTACAACATGCTGCAGCATGTTGTACCAAAGG0.069900.006300.560300.750001.000001.00000


Target Position: 3080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3080ACAUGUUUUCUUUGCUUUA84.6263674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213098ACATGTTTTCTTTGCTTTATAAAGCAAAGAAAACATGT0.082200.019600.672400.750001.000001.00000


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741UGAAAGAAAGGCCAGCAAA80.20791106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142759TGAAAGAAAGGCCAGCAAATTTGCTGGCCTTTCTTTCA0.066700.017000.724100.750001.000001.00000


Target Position: 1498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498GAGAAAUACAGUAAAAGGA90.7247280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1496-1518GAGAGAAATACAGTAAAAGGATTUCCUUUUACUGUAUUUCUCUCGAGAAAUACAGUAAAAGGAUUU11.06.922


Target Position: 3207, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3207GGGGAAAAUGUGUAUUUUA98.262851

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8320719GGGGAAAATGTGTATTTTA1/1/0/097.75STAT1NM_007315.3+NM_139266.21+0NANANA2:191834845..191834863(-)00STAT1(0.002)


Target Position: 1021, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GGAAGUAGUUCACAAAAUA103.2629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411039GGAAGTAGTTCACAAAATATATTTTGTGAACTACTTCC0.618200.037800.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1019-1041AAGGAAGTAGTTCACAAAATAATUAUUUUGUGAACUACUUCCUUGGAAGUAGUUCACAAAAUAAUU5.318.932


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286CCUACACGAAGAAAGAACU79.04021252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892304CCTACACGAAGAAAGAACTAGTTCTTTCTTCGTGTAGG0.056200.018900.637900.750001.000001.00000


Target Position: 2773, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773GUUGAUAGCAAGUGAAUUU84.1722717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572791GTTGATAGCAAGTGAATTTAAATTCACTTGCTATCAAC0.093500.022400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2771-2793CTGTTGATAGCAAGTGAATTTTTAAAUUCACUUGCUAUCAACAGGUUGAUAGCAAGUGAAUUUUUU14.813.432


Target Position: 1049, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CUGAAUGUCACUGAACUUA83.5841770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931067CTGAATGTCACTGAACTTATAAGTTCAGTGACATTCAG0.204900.051600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1047-1069TGCTGAATGTCACTGAACTTACCUAAGUUCAGUGACAUUCAGCACUGAAUGUCACUGAACUUACCU19.220.522


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577GCUGGAUGAUCAAUAUAGU90.0419322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707595GCTGGATGATCAATATAGTACTATATTGATCATCCAGC0.483400.016100.646600.750001.000001.00000


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618GACAGUAUGAUGAACACAG81.6325946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9072636GACAGTATGATGAACACAGCTGTGTTCATCATACTGTC0.095400.041000.534500.500000.967400.62500


Target Position: 1491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1491UGAAUGAGAGAAAUACAGU76.46241546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9891509TGAATGAGAGAAATACAGTACTGTATTTCTCTCATTCA0.598600.151300.517200.500001.000001.00000


Target Position: 2271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271UCCAUGCGGUUGAACCCUA74.08761842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5202289TCCATGCGGTTGAACCCTATAGGGTTCAACCGCATGGA0.166000.028900.698300.750000.902200.75000


Target Position: 3345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3345ACAUUUCCAAAUUCACAAG65.83792817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823363ACATTTCCAAATTCACAAGCTTGTGAATTTGGAAATGT0.131100.018500.569000.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783GCACAGUGAUGUUAGACAA101.32813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540801GCACAGTGATGTTAGACAATTGTCTAACATCACTGTGC0.180300.027400.706901.000001.000001.00000


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079CUGAUUAAUGAUGAACUAG72.3112065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281097CTGATTAATGATGAACTAGCTAGTTCATCATTAATCAG0.204500.126600.612100.500001.000001.00000


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996CAUUCCGUGGACGAGGUUU70.96792240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882014CATTCCGTGGACGAGGTTTAAACCTCGTCCACGGAATG0.071000.006400.655200.750000.983700.87500


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110AUGGCGAGAACCUAAGUUU72.9681980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9554128ATGGCGAGAACCTAAGTTTAAACTTAGGTTCTCGCCAT0.087800.007300.655200.500000.902200.75000


Target Position: 3504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3504CAGAAAUUUAAUUCAUGUU83.6246766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813522CAGAAATTTAATTCATGTTAACATGAATTAAATTTCTG0.130400.029200.637900.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3502-3524CTCAGAAATTTAATTCATGTTTCAACAUGAAUUAAAUUUCUGAGCAGAAAUUUAAUUCAUGUUUCU20.55.332


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493ACAGUGGUUAGAAAAGCAA82.1285898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852511ACAGTGGTTAGAAAAGCAATTGCTTTTCTAACCACTGT0.406000.010600.560300.750001.000001.00000


Target Position: 3278, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278GAAGAGAAUAUUAGCUUUA95.0885110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113296GAAGAGAATATTAGCTTTATAAAGCTAATATTCTCTTC0.105000.015900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3276-3298GAGAAGAGAATATTAGCTTTACTUAAAGCUAAUAUUCUCUUCUCGAAGAGAAUAUUAGCUUUACUU18.319.122


Target Position: 3747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3747UCUCUCUCCUGUACUUUUU68.83792478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923765TCTCTCTCCTGTACTTTTTAAAAAGTACAGGAGAGAGA0.752000.417500.724100.750001.000001.00000


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319UCCCUGACAUCAUUCGCAA79.50271182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602337TCCCTGACATCATTCGCAATTGCGAATGATGTCAGGGA0.694500.087200.724100.750001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446CAGCUUUAUGAUGACAGUU81.204988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862464CAGCTTTATGATGACAGTTAACTGTCATCATAAAGCTG0.168900.010400.637900.750001.000001.00000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067GCAUCCUAGAACUCAUUAA94.3692134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812085GCATCCTAGAACTCATTAATTAATGAGTTCTAGGATGC0.908300.236600.819001.000001.000001.00000


Target Position: 3922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922CCACUACUGCUACCACAAC72.59082028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3493940CCACTACTGCTACCACAACGTTGTGGTAGCAGTAGTGG0.234300.082800.698300.750000.967400.62500


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075UGCCCUGAUUAAUGAUGAA86.5933532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201093TGCCCTGATTAATGATGAATTCATCATTAATCAGGGCA0.469700.075300.681000.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439UUGCAAGAGCUGAAUUAUA81.5839948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461457TTGCAAGAGCTGAATTATATATAATTCAGCTCTTGCAA0.339400.069700.603400.500000.923900.75000


Target Position: 3742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3742UCCAUUCUCUCUCCUGUAC57.70223578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143760TCCATTCTCTCTCCTGTACGTACAGGAGAGAGAATGGA0.616700.121900.689700.500001.000001.00000


Target Position: 2011, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2011GUUUUGUAAGGAAAAUAUA91.3901228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232029GTTTTGTAAGGAAAATATATATATTTTCCTTACAAAAC0.082000.038900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2009-2031AGGTTTTGTAAGGAAAATATAAAUAUAUUUUCCUUACAAAACCUGUUUUGUAAGGAAAAUAUAAAU-10.37.222


Target Position: 2611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611AGAAUUCGACAGUAUGAUG76.60031526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292629AGAATTCGACAGTATGATGCATCATACTGTCGAATTCT0.171700.057900.569000.500001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277CGGUUGAACCCUACACGAA92.9571176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142295CGGTTGAACCCTACACGAATTCGTGTAGGGTTCAACCG0.345900.059600.741401.000000.902200.75000


Target Position: 4109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4109GAUGGCGAGAACCUAAGUU79.4161196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9134127GATGGCGAGAACCTAAGTTAACTTAGGTTCTCGCCATC0.109400.012100.534500.750000.902200.87500


Target Position: 573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
573CACAGCUGGAUGAUCAAUA89.9624325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899591CACAGCTGGATGATCAATATATTGATCATCCAGCTGTG0.151000.009300.750000.750001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368UGAGAAUCCCCUGAAGUAU74.8031755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162386TGAGAATCCCCTGAAGTATATACTTCAGGGGATTCTCA0.083100.018800.681000.750000.945700.62500


Target Position: 3794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3794UCGUGAAGUAUACUGUAUU77.14871458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6463812TCGTGAAGTATACTGTATTAATACAGTATACTTCACGA0.114500.022000.784500.750001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924ACAGAGAACACGAGACCAA87.3283478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
784942ACAGAGAACACGAGACCAATTGGTCTCGTGTTCTCTGT0.127400.038000.560300.750001.000001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652UAAUCUUCAGGAUAAUUUU79.32151209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894670TAATCTTCAGGATAATTTTAAAATTATCCTGAAGATTA0.071000.015800.534500.500001.000001.00000


Target Position: 3744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3744CAUUCUCUCUCCUGUACUU91.0766253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853762CATTCTCTCTCCTGTACTTAAGTACAGGAGAGAGAATG0.615800.151800.517200.750001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863GAAAUCAAGAGCCUGGAAG68.05092559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
893881GAAATCAAGAGCCTGGAAGCTTCCAGGCTCTTGATTTC0.085400.029600.534500.500001.000001.00000


Target Position: 3840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3840CACAAAAAGUAGAUUAAGA94.6673127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3838-3860GACACAAAAAGTAGATTAAGAGAUCUUAAUCUACUUUUUGUGUCCACAAAAAGUAGAUUAAGAGAU6.95.632


Target Position: 2636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GUAUAGAGCAUGAAUUUUU86.9394502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2634-2656CAGTATAGAGCATGAATTTTTTTAAAAAUUCAUGCUCUAUACUGGUAUAGAGCAUGAAUUUUUUUU0.413.022


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GACAACCUGCUCCCCAUGU68.01982561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842567GACAACCTGCTCCCCATGTACATGGGGAGCAGGTTGTC0.103800.098100.612100.500001.000001.00000


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861UGGGUUUGACAAGGUUCUU64.88822930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353879TGGGTTTGACAAGGTTCTTAAGAACCTTGTCAAACCCA0.062600.030000.706900.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736GGAAAACGCCCAGAGAUUU79.561177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
734-756CTGGAAAACGCCCAGAGATTTAAAAAUCUCUGGGCGUUUUCCAGGGAAAACGCCCAGAGAUUUAAU19.115.323


Target Position: 3408, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3408GUCACAUACAAUUAUUUUU82.6031853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2903426GTCACATACAATTATTTTTAAAAATAATTGTATGTGAC0.864600.414200.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3406-3428TGGTCACATACAATTATTTTTACAAAAAUAAUUGUAUGUGACCAGUCACAUACAAUUAUUUUUACU-9.721.522


Target Position: 3098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098AAGUGUAACUGGCAGUUUU83.9322737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123116AAGTGTAACTGGCAGTTTTAAAACTGCCAGTTACACTT0.083300.016100.637900.500001.000001.00000


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044GACGUAGGAACGGUAAAUU79.84461144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033062GACGTAGGAACGGTAAATTAATTTACCGTTCCTACGTC0.067700.018500.810300.750000.951100.75000


Target Position: 2845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845AGGUAAAAUUGAAAGGCAU83.9616734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9992863AGGTAAAATTGAAAGGCATATGCCTTTCAATTTTACCT0.055000.011500.689700.750001.000001.00000


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623GAAUAAUACACCAGAGAUA101.54812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913641GAATAATACACCAGAGATATATCTCTGGTGTATTATTC0.158800.139700.629300.750001.000001.00000


Target Position: 3012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3012GGAUAAAUCAGUGGUUAUU85.847573

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3010-3032TTGGATAAATCAGTGGTTATTTAAAUAACCACUGAUUUAUCCAAGGAUAAAUCAGUGGUUAUUUAU20.01.823


Target Position: 2008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2008GAGGUUUUGUAAGGAAAAU80.8341033

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2006-2028ACGAGGTTTTGTAAGGAAAATATAUUUUCCUUACAAAACCUCGUGAGGUUUUGUAAGGAAAAUAUU18.717.322


Target Position: 2726, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726GUGUUUCUAGGGAAAUGAA92.3708196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2724-2746CTGTGTTTCTAGGGAAATGAAAGUUCAUUUCCCUAGAAACACAGGUGUUUCUAGGGAAAUGAAAGU16.319.223


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GGAGGAAUUGGAACAGAAA98.812641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951246GGAGGAATTGGAACAGAAATTTCTGTTCCAATTCCTCC0.407900.016700.870701.000001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886ACAAGAUGAAUAUGACUUC70.36722299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
895904ACAAGATGAATATGACTTCGAAGTCATATTCATCTTGT0.078700.047300.534500.500000.956500.62500


Target Position: 4266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4266CCAAGAGACUUUACUUUUA94.7799123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8034284CCAAGAGACTTTACTTTTATAAAAGTAAAGTCTCTTGG0.085300.025200.810301.000001.000001.00000


Target Position: 3906, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906GCUGUAUCUUGUUUUUCCA91.1068248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3904-3926TGGCTGTATCTTGTTTTTCCACTUGGAAAAACAAGAUACAGCCAGCUGUAUCUUGUUUUUCCACUU14.320.321


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678ACCCAAUCCAGAUGUCUAU76.6361521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974696ACCCAATCCAGATGTCTATATAGACATCTGGATTGGGT0.057600.048900.810300.750001.000001.00000


Target Position: 2968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968CAAAUGUUAUGCAUAAAGU85.1137625

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2966-2988AGCAAATGTTATGCATAAAGTCAACUUUAUGCAUAACAUUUGCUCAAAUGUUAUGCAUAAAGUCAU3.55.332


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367CUGAGAAUCCCCUGAAGUA93.0637173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912385CTGAGAATCCCCTGAAGTATACTTCAGGGGATTCTCAG0.108100.029400.603400.750000.945700.75000


Target Position: 988, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GAAGAUGUAUUUAAUGCUU88.7796391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011006GAAGATGTATTTAATGCTTAAGCATTAAATACATCTTC0.095000.068200.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
986-1008AAGAAGATGTATTTAATGCTTGAAAGCAUUAAAUACAUCUUCUUGAAGAUGUAUUUAAUGCUUGAU19.719.212


Target Position: 1447, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447GCUGAAUUAUAAUUUGAAA98.33147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1901465GCTGAATTATAATTTGAAATTTCAAATTATAATTCAGC0.362600.125300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1445-1467GAGCTGAATTATAATTTGAAAGTUUUCAAAUUAUAAUUCAGCUCGCUGAAUUAUAAUUUGAAAGUU7.412.031


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875CUGGAAGAUUUACAAGAUG73.02581974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767893CTGGAAGATTTACAAGATGCATCTTGTAAATCTTCCAG0.336800.160200.629300.500001.000001.00000


Target Position: 2609, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609GUAGAAUUCGACAGUAUGA90.8547271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2607-2629CTGTAGAATTCGACAGTATGATGUCAUACUGUCGAAUUCUACAGGUAGAAUUCGACAGUAUGAUGU17.96.932


Target Position: 977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977CUGUUACUCAAGAAGAUGU79.00951257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
975-997AGCTGTTACTCAAGAAGATGTATACAUCUUCUUGAGUAACAGCUCUGUUACUCAAGAAGAUGUAUU20.419.022


Target Position: 1256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GAACAUGACCCUAUCACAA99.064734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451274GAACATGACCCTATCACAATTGTGATAGGGTCATGTTC0.274900.111600.525900.750000.907600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1254-1276ACGAACATGACCCTATCACAAAAUUGUGAUAGGGUCAUGUUCGUGAACAUGACCCUAUCACAAAAU21.520.532


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759AGGCUCAGUCGGGGAAUAU72.10252087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853777AGGCTCAGTCGGGGAATATATATTCCCCGACTGAGCCT0.406500.010600.801700.750001.000001.00000


Target Position: 2780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780GCAAGUGAAUUUUUCUCUA94.9086120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892798GCAAGTGAATTTTTCTCTATAGAGAAAAATTCACTTGC0.164200.036600.681001.000001.000001.00000


Target Position: 4300, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4300CUAAAAUUCAAAAAAAAAA85.414599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3754318CTAAAATTCAAAAAAAAAATTTTTTTTTTGAATTTTAG0.973900.822200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4298-4320TTCTAAAATTCAAAAAAAAAAAAUUUUUUUUUUGAAUUUUAGAACUAAAAUUCAAAAAAAAAAAAU-11.3-9.711


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715GAAGGAAGAAAGGAAAAUU86.0973561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843733GAAGGAAGAAAGGAAAATTAATTTTCCTTTCTTCCTTC0.078700.037700.663800.750001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610CAAUUGAAAGAACAGAAAA93.6216159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791628CAATTGAAAGAACAGAAAATTTTCTGTTCTTTCAATTG0.308900.122800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1608-1630TGCAATTGAAAGAACAGAAAAATUUUUCUGUUCUUUCAAUUGCACAAUUGAAAGAACAGAAAAAUU19.27.420


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687AGAUGUCUAUGAUCAUUUA101.15314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
682705AGATGTCTATGATCATTTATAAATGATCATAGACATCT0.124300.017600.689700.750001.000001.00000


Target Position: 2634, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634CAGUAUAGAGCAUGAAUUU90.6646284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2632-2654CACAGTATAGAGCATGAATTTTTAAAUUCAUGCUCUAUACUGUGCAGUAUAGAGCAUGAAUUUUUU7.211.223


Target Position: 3824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3824CCUUCCUUAUCACUGACAC69.92882351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253842CCTTCCTTATCACTGACACGTGTCAGTGATAAGGAAGG0.134300.060400.551700.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536ACUUCAGACCACAGACAAC74.64161774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262554ACTTCAGACCACAGACAACGTTGTCTGTGGTCTGAAGT0.081400.018200.560300.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057CACUGAACUUACCCAGAAU92.3465198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461075CACTGAACTTACCCAGAATATTCTGGGTAAGTTCAGTG0.061200.020600.784500.750000.918500.62500


Target Position: 4024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024CUGUAUUGCAUUAAAUAUA91.4859226

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4022-4044ATCTGTATTGCATTAAATATAATUAUAUUUAAUGCAAUACAGAUCUGUAUUGCAUUAAAUAUAAUU-8.013.522


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494AUGAGAGAAAUACAGUAAA84.3606701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751512ATGAGAGAAATACAGTAAATTTACTGTATTTCTCTCAT0.621200.220200.655200.500001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867UCAAGAGCCUGGAAGAUUU76.95751489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569885TCAAGAGCCTGGAAGATTTAAATCTTCCAGGCTCTTGA0.346100.056300.724100.750001.000001.00000


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527CCCUUCUAGACUUCAGACC56.40333681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382545CCCTTCTAGACTTCAGACCGGTCTGAAGTCTAGAAGGG0.062000.025900.637900.500000.967400.75000


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632ACCAGAGAUAAUAUGAGAA89.1024367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813650ACCAGAGATAATATGAGAATTCTCATATTATCTCTGGT0.089200.086600.681000.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583UGAUCAAUAUAGUCGCUUU87.8366449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464601TGATCAATATAGTCGCTTTAAAGCGACTATATTGATCA0.173400.163700.724100.750001.000001.00000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468CCAUGGAAAUCAGACAGUA95.012113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530486CCATGGAAATCAGACAGTATACTGTCTGATTTCCATGG0.278700.028200.663801.000001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150AGUUUAUAUACAAUUAUAU89.8524329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4123168AGTTTATATACAATTATATATATAATTGTATATAAACT0.412400.260100.663800.750001.000001.00000


Target Position: 3995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3995GUUUUGUUUUAAAAUUAAA90.1903315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3993-4015GAGTTTTGTTTTAAAATTAAAGCUUUAAUUUUAAAACAAAACUCGUUUUGUUUUAAAAUUAAAGCU-9.75.611


Target Position: 2833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833GCAUCUUACUGAAGGUAAA98.138552

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2831-2853ATGCATCTTACTGAAGGTAAAATUUUACCUUCAGUAAGAUGCAUGCAUCUUACUGAAGGUAAAAUU18.613.432


Target Position: 1068, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CCCAGAAUGCCCUGAUUAA90.8814267

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3106819CCCAGAATGCCCTGATTAA1/1/0/097.75STAT1NM_007315.3+NM_139266.21+1NANANA2:191862669..191862687(-)00STAT1(0.002)


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141UCAAAGCCAAGUUUAUAUA79.08911247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5283159TCAAAGCCAAGTTTATATATATATAAACTTGGCTTTGA0.370000.077100.681000.750001.000001.00000


Target Position: 968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968CAAGAACAGCUGUUACUCA97.440864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
966-988AACAAGAACAGCTGTTACTCAAGUGAGUAACAGCUGUUCUUGUUCAAGAACAGCUGUUACUCAAGU21.419.221


Target Position: 3985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3985GAUUUCUUGAGUUUUGUUU77.4831414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3983-4005AAGATTTCTTGAGTTTTGTTTTAAAACAAAACUCAAGAAAUCUUGAUUUCUUGAGUUUUGUUUUAU5.65.322


Target Position: 4288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4288AGUAUUAAAAUUCUAAAAU79.14191240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3284306AGTATTAAAATTCTAAAATATTTTAGAATTTTAATACT0.312900.095200.698300.750001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246GCUGUAUGCCAUCCUCGAG74.61571779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870264GCTGTATGCCATCCTCGAGCTCGAGGATGGCATACAGC0.196900.060000.543100.750001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255CGAACAUGACCCUAUCACA99.434730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131273CGAACATGACCCTATCACATGTGATAGGGTCATGTTCG0.254400.111900.586200.750000.907600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1253-1275TACGAACATGACCCTATCACAAAUGUGAUAGGGUCAUGUUCGUACGAACAUGACCCUAUCACAAAU20.320.532


Target Position: 3070, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070GAGAAUUCUUACAUGUUUU90.3156303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433088GAGAATTCTTACATGTTTTAAAACATGTAAGAATTCTC0.061300.008400.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090GGGAGAATTCTTACATGTTTTCTAAAACAUGUAAGAAUUCUCCCGAGAAUUCUUACAUGUUUUCUU12.114.822


Target Position: 4132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4132UUGAUUUUACAAUUGAAAU69.02362459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8964150TTGATTTTACAATTGAAATATTTCAATTGTAAAATCAA0.104200.010200.637900.500001.000001.00000


Target Position: 3283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3283GAAUAUUAGCUUUACUGUU90.4048297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693301GAATATTAGCTTTACTGTTAACAGTAAAGCTAATATTC0.261900.010000.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3281-3303GAGAATATTAGCTTTACTGTTTGAACAGUAAAGCUAAUAUUCUCGAAUAUUAGCUUUACUGUUUGU19.0-8.023


Target Position: 1069, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069CCAGAAUGCCCUGAUUAAU80.80861037

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1067-1089ACCCAGAATGCCCTGATTAATGAAUUAAUCAGGGCAUUCUGGGUCCAGAAUGCCCUGAUUAAUGAU8.918.122


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904UGGCUGUAUCUUGUUUUUC56.72793649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853922TGGCTGTATCTTGTTTTTCGAAAAACAAGATACAGCCA0.272500.009800.672400.500001.000001.00000


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887GUGAAAAACAUCCAGAUAC72.1542081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942905GTGAAAAACATCCAGATACGTATCTGGATGTTTTTCAC0.174400.064700.612100.500000.967400.62500


Target Position: 3126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126UACCUGUGAAAUAGUUCAA79.48591186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443144TACCTGTGAAATAGTTCAATTGAACTATTTCACAGGTA0.095200.007900.534500.500000.989100.62500


Target Position: 3235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3235UCACAUUGGCUAUUUAAAG65.23152898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553253TCACATTGGCTATTTAAAGCTTTAAATAGCCAATGTGA0.397100.137900.586200.500001.000001.00000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337GCUGCUCCUUUGGUUGAAU78.97411260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819355GCTGCTCCTTTGGTTGAATATTCAACCAAAGGAGCAGC0.119700.011600.844801.000001.000001.00000


Target Position: 3320, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3320CUAGCUAAUAUCAAUAGAA97.44663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3318-3340CACTAGCTAATATCAATAGAAGGUUCUAUUGAUAUUAGCUAGUGCUAGCUAAUAUCAAUAGAAGGU13.419.523


Target Position: 1609, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609GCAAUUGAAAGAACAGAAA88.2371426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831627GCAATTGAAAGAACAGAAATTTCTGTTCTTTCAATTGC0.365900.121200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1607-1629CTGCAATTGAAAGAACAGAAAAAUUUCUGUUCUUUCAAUUGCAGGCAAUUGAAAGAACAGAAAAAU19.213.821


Target Position: 3123, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123GUUUACCUGUGAAAUAGUU81.4079968

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3121-3143TGGTTTACCTGTGAAATAGTTCAAACUAUUUCACAGGUAAACCAGUUUACCUGUGAAAUAGUUCAU4.618.632


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712UCUGAAGGAAGAAAGGAAA77.7731384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719730TCTGAAGGAAGAAAGGAAATTTCCTTTCTTCCTTCAGA0.261600.015500.724100.750001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163CUGCAGAACUGGUUCACUA95.747894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021181CTGCAGAACTGGTTCACTATAGTGAACCAGTTCTGCAG0.174800.016200.612100.750001.000001.00000


Target Position: 3533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3533GCUACUUUGUCCUUUUUGU79.50271183

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3531-3553GGGCTACTTTGTCCTTTTTGTTAACAAAAAGGACAAAGUAGCCCGCUACUUUGUCCUUUUUGUUAU2.19.822


Target Position: 2826, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826GCAUCAUGCAUCUUACUGA96.669179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2824-2846GGGCATCATGCATCTTACTGAAGUCAGUAAGAUGCAUGAUGCCCGCAUCAUGCAUCUUACUGAAGU16.419.432


Target Position: 4093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4093UCUCAGUUUUUAUAUAGAU80.75451044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8724111TCTCAGTTTTTATATAGATATCTATATAAAAACTGAGA0.263200.010200.543100.750001.000001.00000


Target Position: 3655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655AUCAUUUCAAAACUCAUUU66.36622758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323673ATCATTTCAAAACTCATTTAAATGAGTTTTGAAATGAT0.351400.101100.681000.500001.000001.00000


Target Position: 3477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477GAAAUUAACCAUAGAUGUA98.833440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3475-3497TTGAAATTAACCATAGATGTAGAUACAUCUAUGGUUAAUUUCAAGAAAUUAACCAUAGAUGUAGAU20.3-9.723


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080UGAUUAAUGAUGAACUAGU77.20421449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941098TGATTAATGATGAACTAGTACTAGTTCATCATTAATCA0.185300.102600.517200.500001.000001.00000


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603GCACCUGCAAUUGAAAGAA85.0237633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541621GCACCTGCAATTGAAAGAATTCTTTCAATTGCAGGTGC0.247100.013800.681001.000001.000001.00000


Target Position: 2322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322CUGACAUCAUUCGCAAUUA89.0035373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242340CTGACATCATTCGCAATTATAATTGCGAATGATGTCAG0.754000.113000.750000.750001.000001.00000


Target Position: 2667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2667GGCGACAGUUUUCCUUCUC66.24142776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782685GGCGACAGTTTTCCTTCTCGAGAAGGAAAACTGTCGCC0.729600.051300.689700.750000.978300.62500


Target Position: 4298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4298UUCUAAAAUUCAAAAAAAA81.04911006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9634316TTCTAAAATTCAAAAAAAATTTTTTTTGAATTTTAGAA0.970900.388000.672400.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685CCAGAUGUCUAUGAUCAUU85.9821566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916703CCAGATGTCTATGATCATTAATGATCATAGACATCTGG0.100200.008600.836201.000001.000001.00000


Target Position: 788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788GUGAUGUUAGACAAACAGA88.3705418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
786-808CAGTGATGTTAGACAAACAGAAAUCUGUUUGUCUAACAUCACUGGUGAUGUUAGACAAACAGAAAU16.720.522


Target Position: 4299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4299UCUAAAAUUCAAAAAAAAA81.9071915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4744317TCTAAAATTCAAAAAAAAATTTTTTTTTGAATTTTAGA0.970700.821100.724100.750001.000001.00000


Target Position: 3309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3309GCUUAAUGACACUAGCUAA103.9986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283327GCTTAATGACACTAGCTAATTAGCTAGTGTCATTAAGC0.086500.008200.819001.000001.000001.00000


Target Position: 3839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3839ACACAAAAAGUAGAUUAAG68.63642506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8483857ACACAAAAAGTAGATTAAGCTTAATCTACTTTTTGTGT0.077700.034200.569000.500001.000001.00000


Target Position: 4166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4166AAGACAACAUUAAAACAAU86.7124519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9644184AAGACAACATTAAAACAATATTGTTTTAATGTTGTCTT0.181400.077800.629300.500001.000001.00000


Target Position: 4023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023UCUGUAUUGCAUUAAAUAU79.68951166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894041TCTGTATTGCATTAAATATATATTTAATGCAATACAGA0.067700.006400.681000.750001.000001.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297CCGCACCUUCAGUCUUUUC64.27183006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031315CCGCACCTTCAGTCTTTTCGAAAAGACTGAAGGTGCGG0.184000.148500.741400.750001.000001.00000


Target Position: 649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649GCGUAAUCUUCAGGAUAAU85.3656603

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
647-669AAGCGTAATCTTCAGGATAATTTAUUAUCCUGAAGAUUACGCUUGCGUAAUCUUCAGGAUAAUUUU19.916.532


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227UGGAGGAAUUGGAACAGAA89.7021336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301245TGGAGGAATTGGAACAGAATTCTGTTCCAATTCCTCCA0.372900.011300.672400.750001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707AGCUGUCUGAAGGAAGAAA84.1303721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
952725AGCTGTCTGAAGGAAGAAATTTCTTCCTTCAGACAGCT0.274200.007500.853400.750001.000001.00000


Target Position: 3976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3976GGAGAUAAAGAUUUCUUGA94.2856138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3974-3996GTGGAGATAAAGATTTCTTGAGTUCAAGAAAUCUUUAUCUCCACGGAGAUAAAGAUUUCUUGAGUU12.216.032


Target Position: 2802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802CAGAAACAUCAGUUACUCU90.9898260

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2800-2822CTCAGAAACATCAGTTACTCTGAAGAGUAACUGAUGUUUCUGAGCAGAAACAUCAGUUACUCUGAU21.419.222


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880AGAUUUACAAGAUGAAUAU86.8502512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309898AGATTTACAAGATGAATATATATTCATCTTGTAAATCT0.343800.198200.681000.750001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824GUCAGAAAUGUGAAGGACA89.6165342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959842GTCAGAAATGTGAAGGACATGTCCTTCACATTTCTGAC0.119600.016800.612100.500001.000001.00000


Target Position: 3404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3404CUUGGUCACAUACAAUUAU81.3914970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983422CTTGGTCACATACAATTATATAATTGTATGTGACCAAG0.629900.120200.594800.750001.000001.00000


Target Position: 4031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4031GCAUUAAAUAUAAUAUGCA94.9997115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4029-4051TTGCATTAAATATAATATGCACAUGCAUAUUAUAUUUAAUGCAAGCAUUAAAUAUAAUAUGCACAU15.2-1.432


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464UCAUUCAAAAGUUGAAAUU66.46482745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083482TCATTCAAAAGTTGAAATTAATTTCAACTTTTGAATGA0.083900.039200.715500.750000.962000.75000


Target Position: 3698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3698CAUAUGUUUCGCUGAUAUA96.817577

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3696-3718TGCATATGTTTCGCTGATATATGUAUAUCAGCGAAACAUAUGCACAUAUGUUUCGCUGAUAUAUGU13.36.732


Target Position: 3808, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3808GUAUUUUUACCUUUUUCCU73.86971870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3806-3828CTGTATTTTTACCTTTTTCCTTCAGGAAAAAGGUAAAAAUACAGGUAUUUUUACCUUUUUCCUUCU14.3-9.722


Target Position: 1492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492GAAUGAGAGAAAUACAGUA103.737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1490-1512GTGAATGAGAGAAATACAGTAAAUACUGUAUUUCUCUCAUUCACGAAUGAGAGAAAUACAGUAAAU19.020.421


Target Position: 4000, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4000GUUUUAAAAUUAAAGCUAA94.6013130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6474018GTTTTAAAATTAAAGCTAATTAGCTTTAATTTTAAAAC0.124200.033000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3998-4020TTGTTTTAAAATTAAAGCTAAAGUUAGCUUUAAUUUUAAAACAAGUUUUAAAAUUAAAGCUAAAGU18.3-9.121


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678UCACUCCCUUAGUUUUGAA80.66451049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301696TCACTCCCTTAGTTTTGAATTCAAAACTAAGGGAGTGA0.218900.064200.551700.750001.000001.00000


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846GGUAAAAUUGAAAGGCAUU83.7908748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472864GGTAAAATTGAAAGGCATTAATGCCTTTCAATTTTACC0.061100.021000.844801.000001.000001.00000


Target Position: 4245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4245GGUUUCAUUUUACUGCACU80.50621061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5064263GGTTTCATTTTACTGCACTAGTGCAGTAAAATGAAACC0.204000.031200.646600.750001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485AAGAUGUGAAUGAGAGAAA86.6701526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321503AAGATGTGAATGAGAGAAATTTCTCTCATTCACATCTT0.239400.073400.637900.500001.000001.00000


Target Position: 4306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4306UUCAAAAAAAAAAAAAAAA69.55172391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9054324TTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAA0.995000.955300.672400.500001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365UCCUGAGAAUCCCCUGAAG62.83423165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352383TCCTGAGAATCCCCTGAAGCTTCAGGGGATTCTCAGGA0.080000.023400.732800.500000.945701.00000


Target Position: 4108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4108AGAUGGCGAGAACCUAAGU74.11841837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9824126AGATGGCGAGAACCTAAGTACTTAGGTTCTCGCCATCT0.141500.018400.517200.500000.902201.00000


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149AAGUUUAUAUACAAUUAUA99.862524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7083167AAGTTTATATACAATTATATATAATTGTATATAAACTT0.345000.260700.594800.500001.000001.00000


Target Position: 3743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3743CCAUUCUCUCUCCUGUACU76.39411561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5523761CCATTCTCTCTCCTGTACTAGTACAGGAGAGAGAATGG0.618200.136000.637900.750001.000001.00000


Target Position: 2324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2324GACAUCAUUCGCAAUUACA90.1783316

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2322-2344CTGACATCATTCGCAATTACAAAUGUAAUUGCGAAUGAUGUCAGGACAUCAUUCGCAAUUACAAAU6.920.521


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494UAGAUAAACUCAGAAAUUU77.45721417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863512TAGATAAACTCAGAAATTTAAATTTCTGAGTTTATCTA0.088300.056500.672400.500001.000001.00000


Target Position: 3739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3739GGUUCCAUUCUCUCUCCUG76.5571533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633757GGTTCCATTCTCTCTCCTGCAGGAGAGAGAATGGAACC0.488700.094000.569000.750001.000001.00000


Target Position: 3873, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3873GGUUCUUCCCUUUUACAUA97.004674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4843891GGTTCTTCCCTTTTACATATATGTAAAAGGGAAGAACC0.166300.044000.810301.000000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3871-3893AAGGTTCTTCCCTTTTACATACTUAUGUAAAAGGGAAGAACCUUGGUUCUUCCCUUUUACAUACUU6.921.532


Target Position: 2771, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CUGUUGAUAGCAAGUGAAU81.2547981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522789CTGTTGATAGCAAGTGAATATTCACTTGCTATCAACAG0.076700.019000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2769-2791ACCTGTTGATAGCAAGTGAATTTAUUCACUUGCUAUCAACAGGUCUGUUGAUAGCAAGUGAAUUUU19.220.522


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336AGCUGCUCCUUUGGUUGAA76.33211571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907354AGCTGCTCCTTTGGTTGAATTCAACCAAAGGAGCAGCT0.129700.009000.681000.750001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GCUGCAGAACUGGUUCACU80.46721069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041180GCTGCAGAACTGGTTCACTAGTGAACCAGTTCTGCAGC0.086200.009100.646600.750001.000001.00000


Target Position: 4272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4272GACUUUACUUUUAAGAAGU82.4118872

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4270-4292GAGACTTTACTTTTAAGAAGTATACUUCUUAAAAGUAAAGUCUCGACUUUACUUUUAAGAAGUAUU11.712.922


Target Position: 915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915CCUUGCAGAACAGAGAACA80.20621107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975933CCTTGCAGAACAGAGAACATGTTCTCTGTTCTGCAAGG0.163900.006700.637900.750001.000001.00000


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014UUGUAAGGAAAAUAUAAAU74.86071749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392032TTGTAAGGAAAATATAAATATTTATATTTTCCTTACAA0.194800.033000.637900.500001.000001.00000


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354GCUGAGAAUAUUCCUGAGA82.3223879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732372GCTGAGAATATTCCTGAGATCTCAGGAATATTCTCAGC0.057800.008600.629300.750001.000001.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495UGAGAGAAAUACAGUAAAA93.5591162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281513TGAGAGAAATACAGTAAAATTTTACTGTATTTCTCTCA0.623500.235300.724100.750001.000001.00000


Target Position: 1675, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675GCUUCACUCCCUUAGUUUU85.1196623

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5167519GCTTCACTCCCTTAGTTTT1/1/0/097.75STAT1NM_007315.3+NM_139266.21+1NANANA2:191849078..191849096(-)00STAT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521693GCTTCACTCCCTTAGTTTTAAAACTAAGGGAGTGAAGC0.179200.037900.853401.000001.000001.00000


Target Position: 587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587CAAUAUAGUCGCUUUUCUU91.9178211

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
585-607ATCAATATAGTCGCTTTTCTTTGAAGAAAAGCGACUAUAUUGAUCAAUAUAGUCGCUUUUCUUUGU10.3-2.733


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138AGUUCAAAGCCAAGUUUAU83.4557784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5473156AGTTCAAAGCCAAGTTTATATAAACTTGGCTTTGAACT0.139500.040900.663800.750001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831AUGUGAAGGACAAGGUUAU77.05261468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985849ATGTGAAGGACAAGGTTATATAACCTTGTCCTTCACAT0.056300.016600.612100.500001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CAUUUGCCACCAUCCGUUU76.75631511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773558CATTTGCCACCATCCGTTTAAACGGATGGTGGCAAATG0.090900.028500.655200.750001.000001.00000


Target Position: 4287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4287AAGUAUUAAAAUUCUAAAA87.6655459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9544305AAGTATTAAAATTCTAAAATTTTAGAATTTTAATACTT0.318600.020600.637900.500001.000001.00000


Target Position: 3132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3132UGAAAUAGUUCAAAGCCAA87.1661488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393150TGAAATAGTTCAAAGCCAATTGGCTTTGAACTATTTCA0.150500.031900.577600.750001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078CCUGAUUAAUGAUGAACUA95.769493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851096CCTGATTAATGATGAACTATAGTTCATCATTAATCAGG0.222900.081500.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1076-1098GCCCTGATTAATGATGAACTAGTUAGUUCAUCAUUAAUCAGGGCCCUGAUUAAUGAUGAACUAGUU19.213.423


Target Position: 2326, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326CAUCAUUCGCAAUUACAAA95.487299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2324-2346GACATCATTCGCAATTACAAAGTUUUGUAAUUGCGAAUGAUGUCCAUCAUUCGCAAUUACAAAGUU6.916.222


Target Position: 3405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3405UUGGUCACAUACAAUUAUU71.85242123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623423TTGGTCACATACAATTATTAATAATTGTATGTGACCAA0.633800.142200.637900.500001.000001.00000


Target Position: 3042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042UUGACGUAGGAACGGUAAA69.93432349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933060TTGACGTAGGAACGGTAAATTTACCGTTCCTACGTCAA0.092300.009400.646600.500000.951101.00000


Target Position: 3939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3939ACUAUAUUAUCAUGCAAAU84.1325720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673957ACTATATTATCATGCAAATATTTGCATGATAATATAGT0.091600.090100.698300.750001.000001.00000


Target Position: 3463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463CUCAUUCAAAAGUUGAAAU77.2441444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703481CTCATTCAAAAGTTGAAATATTTCAACTTTTGAATGAG0.073200.039700.801700.750000.962000.75000


Target Position: 3122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3122GGUUUACCUGUGAAAUAGU85.4214598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3120-3142TTGGTTTACCTGTGAAATAGTTCACUAUUUCACAGGUAAACCAAGGUUUACCUGUGAAAUAGUUCU6.921.132


Target Position: 2376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376CCCUGAAGUAUCUGUAUCC72.06432095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662394CCCTGAAGTATCTGTATCCGGATACAGATACTTCAGGG0.254600.054800.620700.500001.000001.00000


Target Position: 3455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3455CACAACCACUCAUUCAAAA90.6693283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2343473CACAACCACTCATTCAAAATTTTGAATGAGTGGTTGTG0.321000.094300.793100.750001.000001.00000


Target Position: 3343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3343GUACAUUUCCAAAUUCACA89.869328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3341-3363ATGTACATTTCCAAATTCACAAGUGUGAAUUUGGAAAUGUACAUGUACAUUUCCAAAUUCACAAGU14.86.912


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076GCCCUGAUUAAUGAUGAAC65.16452906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251094GCCCTGATTAATGATGAACGTTCATCATTAATCAGGGC0.375400.057700.853400.750001.000001.00000


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247CUGUAUGCCAUCCUCGAGA78.10821348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835265CTGTATGCCATCCTCGAGATCTCGAGGATGGCATACAG0.157200.025400.560300.500001.000001.00000


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145AGCCAAGUUUAUAUACAAU88.4112417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1853163AGCCAAGTTTATATACAATATTGTATATAAACTTGGCT0.371700.106500.844800.750001.000001.00000


Target Position: 3469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469CAAAAGUUGAAAUUAACCA82.7833836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3467-3489TTCAAAAGTTGAAATTAACCATAUGGUUAAUUUCAACUUUUGAACAAAAGUUGAAAUUAACCAUAU13.93.221


Target Position: 391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
391GUCUCAGUGGUACGAACUU79.29451211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809409GTCTCAGTGGTACGAACTTAAGTTCGTACCACTGAGAC0.174100.011900.681000.750001.000001.00000


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620CAGUAUGAUGAACACAGUA97.784760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192638CAGTATGATGAACACAGTATACTGTGTTCATCATACTG0.082400.043700.603400.750000.967400.75000


Target Position: 639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639GGAAAAGCAAGCGUAAUCU78.75271276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
637-659AAGGAAAAGCAAGCGTAATCTTCAGAUUACGCUUGCUUUUCCUUGGAAAAGCAAGCGUAAUCUUCU16.521.033


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCCUUAGUUUUGAAACCCA85.9894565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941701CCCTTAGTTTTGAAACCCATGGGTTTCAAAACTAAGGG0.194700.045200.646600.750000.978300.75000


Target Position: 3966, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3966CUUCUUUGGUGGAGAUAAA91.1323246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3964-3986TTCTTCTTTGGTGGAGATAAAGAUUUAUCUCCACCAAAGAAGAACUUCUUUGGUGGAGAUAAAGAU16.012.232


Target Position: 3925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925CUACUGCUACCACAACUAU84.9927640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923943CTACTGCTACCACAACTATATAGTTGTGGTAGCAGTAG0.339800.088300.629300.750000.967400.87500


Target Position: 3013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3013GAUAAAUCAGUGGUUAUUU84.7269667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3011-3033TGGATAAATCAGTGGTTATTTAGAAAUAACCACUGAUUUAUCCAGAUAAAUCAGUGGUUAUUUAGU13.91.832


Target Position: 3491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3491AUGUAGAUAAACUCAGAAA88.6693396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523509ATGTAGATAAACTCAGAAATTTCTGAGTTTATCTACAT0.113900.056700.655200.500001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GAAGUAGUUCACAAAAUAA104.5462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331040GAAGTAGTTCACAAAATAATTATTTTGTGAACTACTTC0.725100.035900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1020-1042AGGAAGTAGTTCACAAAATAATAUUAUUUUGUGAACUACUUCCUGAAGUAGUUCACAAAAUAAUAU-1.417.622


Target Position: 1917, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917CCAAAAGAGGUCUCAAUGU77.37291427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251935CCAAAAGAGGTCTCAATGTACATTGAGACCTCTTTTGG0.065000.013500.637900.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1915-1937CACCAAAAGAGGTCTCAATGTGGACAUUGAGACCUCUUUUGGUGCCAAAAGAGGUCUCAAUGUGGU18.112.222


Target Position: 2643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643GCAUGAAUUUUUUUCAUCU88.8637385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2641-2663GAGCATGAATTTTTTTCATCTTCAGAUGAAAAAAAUUCAUGCUCGCAUGAAUUUUUUUCAUCUUCU16.313.622


Target Position: 3127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3127ACCUGUGAAAUAGUUCAAA79.98231132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803145ACCTGTGAAATAGTTCAAATTTGAACTATTTCACAGGT0.097800.006600.853400.750000.989100.75000


Target Position: 3795, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3795CGUGAAGUAUACUGUAUUU94.8846122

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2379519CGTGAAGTATACTGTATTT1/1/0/0100.00STAT1NM_007315.3+NM_139266.21+0NANANA2:191834257..191834275(-)00STAT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7143813CGTGAAGTATACTGTATTTAAATACAGTATACTTCACG0.102000.024900.775901.000001.000001.00000


Target Position: 4165, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4165GAAGACAACAUUAAAACAA91.8507217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434183GAAGACAACATTAAAACAATTGTTTTAATGTTGTCTTC0.188700.090400.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4163-4185AAGAAGACAACATTAAAACAATAUUGUUUUAAUGUUGUCUUCUUGAAGACAACAUUAAAACAAUAU7.219.212


Target Position: 2474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474CCUAAAGGAACUGGAUAUA84.424691

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2472-2494GCCCTAAAGGAACTGGATATATCUAUAUCCAGUUCCUUUAGGGCCCUAAAGGAACUGGAUAUAUCU21.215.812


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CAGCAGCUUGACUCAAAAU87.3224479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629428CAGCAGCTTGACTCAAAATATTTTGAGTCAAGCTGCTG0.285100.028400.775900.750001.000001.00000


Target Position: 2699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2699UCCUGCUACUCUGUUCCUU64.92262926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912717TCCTGCTACTCTGTTCCTTAAGGAACAGAGTAGCAGGA0.126700.042700.732800.750001.000001.00000


Target Position: 3450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3450CUAUUCACAACCACUCAUU78.23061332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4183468CTATTCACAACCACTCATTAATGAGTGGTTGTGAATAG0.292600.106800.663800.750001.000001.00000


Target Position: 3409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3409UCACAUACAAUUAUUUUUA81.02691011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993427TCACATACAATTATTTTTATAAAAATAATTGTATGTGA0.857700.515100.689700.750001.000001.00000


Target Position: 3397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397CUUUCAUCUUGGUCACAUA98.834539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6963415CTTTCATCTTGGTCACATATATGTGACCAAGATGAAAG0.409000.052400.594800.750001.000001.00000


Target Position: 3210, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3210GAAAAUGUGUAUUUUAUUA99.273632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093228GAAAATGTGTATTTTATTATAATAAAATACACATTTTC0.229300.016000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3208-3230GGGAAAATGTGTATTTTATTACAUAAUAAAAUACACAUUUUCCCGAAAAUGUGUAUUUUAUUACAU-9.75.321


Target Position: 4289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289GUAUUAAAAUUCUAAAAUU92.6773184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3934307GTATTAAAATTCTAAAATTAATTTTAGAATTTTAATAC0.320000.246100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4287-4309AAGTATTAAAATTCTAAAATTCAAAUUUUAGAAUUUUAAUACUUGUAUUAAAAUUCUAAAAUUCAU-4.3-7.521


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409UCAGCAGCUUGACUCAAAA85.6924578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
612427TCAGCAGCTTGACTCAAAATTTTGAGTCAAGCTGCTGA0.228900.021100.724100.750001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608UGUAGAAUUCGACAGUAUG72.04342098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232626TGTAGAATTCGACAGTATGCATACTGTCGAATTCTACA0.216700.023400.551700.500001.000001.00000


Target Position: 2794, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2794CUCUAACUCAGAAACAUCA88.4616409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2792-2814TTCTCTAACTCAGAAACATCAGTUGAUGUUUCUGAGUUAGAGAACUCUAACUCAGAAACAUCAGUU14.818.922


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393CUCAGUGGUACGAACUUCA85.0173634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
737411CTCAGTGGTACGAACTTCATGAAGTTCGTACCACTGAG0.175400.014500.586200.500001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369GAGAAUCCCCUGAAGUAUC74.41571795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682387GAGAATCCCCTGAAGTATCGATACTTCAGGGGATTCTC0.086400.033200.629300.500001.000001.00000


Target Position: 3923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3923CACUACUGCUACCACAACU83.6884756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453941CACTACTGCTACCACAACTAGTTGTGGTAGCAGTAGTG0.247100.086500.586200.500000.967400.75000


Target Position: 4168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4168GACAACAUUAAAACAAUAU83.1105819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7054186GACAACATTAAAACAATATATATTGTTTTAATGTTGTC0.103500.050100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4166-4188AAGACAACATTAAAACAATATTGAUAUUGUUUUAAUGUUGUCUUGACAACAUUAAAACAAUAUUGU6.919.322


Target Position: 2732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732CUAGGGAAAUGAAAGAAAG76.37321564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892750CTAGGGAAATGAAAGAAAGCTTTCTTTCATTTCCCTAG0.139300.023100.534500.500001.000001.00000


Target Position: 3069, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069GGAGAAUUCUUACAUGUUU90.8758268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3067-3089TGGGAGAATTCTTACATGTTTTCAAACAUGUAAGAAUUCUCCCAGGAGAAUUCUUACAUGUUUUCU19.314.822


Target Position: 2695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2695UCCCUCCUGCUACUCUGUU60.12443413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5612713TCCCTCCTGCTACTCTGTTAACAGAGTAGCAGGAGGGA0.249400.195900.724100.750001.000001.00000


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621AGUAUGAUGAACACAGUAU85.0137635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552639AGTATGATGAACACAGTATATACTGTGTTCATCATACT0.059700.029900.663800.750000.967400.75000


Target Position: 3622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622UGAAUAAUACACCAGAGAU84.5987677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693640TGAATAATACACCAGAGATATCTCTGGTGTATTATTCA0.167400.148800.543100.750001.000001.00000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375CCCCUGAAGUAUCUGUAUC70.58342284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3572393CCCCTGAAGTATCTGTATCGATACAGATACTTCAGGGG0.242400.051600.810300.750001.000001.00000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046CGUAGGAACGGUAAAUUUC73.38121925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7243064CGTAGGAACGGTAAATTTCGAAATTTACCGTTCCTACG0.152400.015400.603400.750000.989100.62500


Target Position: 2659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659UCUUCUCUGGCGACAGUUU69.97832343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082677TCTTCTCTGGCGACAGTTTAAACTGTCGCCAGAGAAGA0.067300.010900.724100.750000.962000.87500


Target Position: 2622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622GUAUGAUGAACACAGUAUA97.927756

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2620-2642CAGTATGATGAACACAGTATAGAUAUACUGUGUUCAUCAUACUGGUAUGAUGAACACAGUAUAGAU19.014.933


Target Position: 597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597GCUUUUCUUUGGAGAAUAA95.3468101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
595-617TCGCTTTTCTTTGGAGAATAACTUUAUUCUCCAAAGAAAAGCGAGCUUUUCUUUGGAGAAUAACUU16.010.322


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435GAAAUUGCAAGAGCUGAAU76.77881508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781453GAAATTGCAAGAGCTGAATATTCAGCTCTTGCAATTTC0.131300.040900.663800.750000.923901.00000


Target Position: 3835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3835ACUGACACAAAAAGUAGAU73.39581921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623853ACTGACACAAAAAGTAGATATCTACTTTTTGTGTCAGT0.111600.046200.525900.750001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757UCAGGCUCAGUCGGGGAAU56.38593683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860775TCAGGCTCAGTCGGGGAATATTCCCCGACTGAGCCTGA0.411800.010400.715500.750001.000001.00000


Target Position: 3454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3454UCACAACCACUCAUUCAAA86.8635508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3313472TCACAACCACTCATTCAAATTTGAATGAGTGGTTGTGA0.337500.093000.724100.750001.000001.00000


Target Position: 4129, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4129CAGUUGAUUUUACAAUUGA90.5337296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4127-4149TTCAGTTGATTTTACAATTGAAAUCAAUUGUAAAAUCAACUGAACAGUUGAUUUUACAAUUGAAAU12.119.221


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026UAUAAAUGAUAAAAAUUUU81.00521015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572044TATAAATGATAAAAATTTTAAAATTTTTATCATTTATA0.213800.117900.543100.500001.000001.00000


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827UCCUUAUCACUGACACAAA85.5974584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2883845TCCTTATCACTGACACAAATTTGTGTCAGTGATAAGGA0.923000.065400.870700.750001.000001.00000


Target Position: 2781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781CAAGUGAAUUUUUCUCUAA97.537162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362799CAAGTGAATTTTTCTCTAATTAGAGAAAAATTCACTTG0.292500.040900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2779-2801AGCAAGTGAATTTTTCTCTAACTUUAGAGAAAAAUUCACUUGCUCAAGUGAAUUUUUCUCUAACUU20.219.231


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956AGCAACAUCUAGCAAAUGU74.82221754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752974AGCAACATCTAGCAAATGTACATTTGCTAGATGTTGCT0.084400.011700.646600.500000.934800.75000


Target Position: 2487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2487GAUAUAUCAAGACUGAGUU87.7135455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152505GATATATCAAGACTGAGTTAACTCAGTCTTGATATATC0.205100.014900.534500.750001.000001.00000


Target Position: 2301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301AACUUUCUGCUGUUACUUU79.28761213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372319AACTTTCTGCTGTTACTTTAAAGTAACAGCAGAAAGTT0.062400.009500.646600.500001.000001.00000


Target Position: 3497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497AUAAACUCAGAAAUUUAAU72.43612049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033515ATAAACTCAGAAATTTAATATTAAATTTCTGAGTTTAT0.095100.038000.534500.500001.000001.00000


Target Position: 2000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000CCGUGGACGAGGUUUUGUA88.6807395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342018CCGTGGACGAGGTTTTGTATACAAAACCTCGTCCACGG0.175100.020100.732801.000001.000001.00000


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594GGAGUAGAAAAAGCAGUAA92.0159208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643612GGAGTAGAAAAAGCAGTAATTACTGCTTTTTCTACTCC0.193800.013300.836201.000001.000001.00000


Target Position: 4307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4307UCAAAAAAAAAAAAAAAAA74.83931753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2004325TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.996600.953900.724100.750001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626CAGCAUAACAUAAGGAAAA90.6159291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317644CAGCATAACATAAGGAAAATTTTCCTTATGTTATGCTG0.267100.074000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
624-646TACAGCATAACATAAGGAAAAGCUUUUCCUUAUGUUAUGCUGUACAGCAUAACAUAAGGAAAAGCU18.719.723


Target Position: 2471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471GGCCCUAAAGGAACUGGAU81.1284996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7742489GGCCCTAAAGGAACTGGATATCCAGTTCCTTTAGGGCC0.108800.013000.819001.000000.956500.62500


Target Position: 3449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3449GCUAUUCACAACCACUCAU83.0621822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343467GCTATTCACAACCACTCATATGAGTGGTTGTGAATAGC0.186800.147200.698301.000001.000001.00000


Target Position: 3358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3358CACAAGUUGUGUUUGAUAU87.8452447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3356-3378TTCACAAGTTGTGTTTGATATCCAUAUCAAACACAACUUGUGAACACAAGUUGUGUUUGAUAUCCU8.917.832


Target Position: 2016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016GUAAGGAAAAUAUAAAUGA88.1566431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2014-2036TTGTAAGGAAAATATAAATGATAUCAUUUAUAUUUUCCUUACAAGUAAGGAAAAUAUAAAUGAUAU-1.819.921


Target Position: 1028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GUUCACAAAAUAAUAGAGU72.69562014

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1026-1048TAGTTCACAAAATAATAGAGTTGACUCUAUUAUUUUGUGAACUAGUUCACAAAAUAAUAGAGUUGU11.620.522


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440UGCAAGAGCUGAAUUAUAA89.9766323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451458TGCAAGAGCTGAATTATAATTATAATTCAGCTCTTGCA0.346700.081000.819000.750000.923900.75000


Target Position: 3924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3924ACUACUGCUACCACAACUA85.1546619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293942ACTACTGCTACCACAACTATAGTTGTGGTAGCAGTAGT0.330800.086400.534500.750000.967400.87500


Target Position: 651, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651GUAAUCUUCAGGAUAAUUU80.02231128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
649-671GCGTAATCTTCAGGATAATTTTCAAAUUAUCCUGAAGAUUACGCGUAAUCUUCAGGAUAAUUUUCU1.86.922


Target Position: 3243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243GCUAUUUAAAGACAAAGAC70.19772318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003261GCTATTTAAAGACAAAGACGTCTTTGTCTTTAAATAGC0.213700.127100.534500.750001.000001.00000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841CUGAAGGUAAAAUUGAAAG66.94282691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7092859CTGAAGGTAAAATTGAAAGCTTTCAATTTTACCTTCAG0.195500.025200.646600.500001.000001.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700CCUGCUACUCUGUUCCUUC74.33391806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662718CCTGCTACTCTGTTCCTTCGAAGGAACAGAGTAGCAGG0.058600.019000.672400.750001.000001.00000


Target Position: 4131, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4131GUUGAUUUUACAAUUGAAA86.1551558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674149GTTGATTTTACAATTGAAATTTCAATTGTAAAATCAAC0.093200.007000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4129-4151CAGTTGATTTTACAATTGAAATGUUUCAAUUGUAAAAUCAACUGGUUGAUUUUACAAUUGAAAUGU7.47.412


Target Position: 3244, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3244CUAUUUAAAGACAAAGACA90.8116274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3242-3264GGCTATTTAAAGACAAAGACAAAUGUCUUUGUCUUUAAAUAGCCCUAUUUAAAGACAAAGACAAAU19.2-7.521


Target Position: 2378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378CUGAAGUAUCUGUAUCCAA94.4715133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5262396CTGAAGTATCTGTATCCAATTGGATACAGATACTTCAG0.189400.040800.637900.750001.000001.00000


Target Position: 3815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3815UACCUUUUUCCUUCCUUAU70.05892332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953833TACCTTTTTCCTTCCTTATATAAGGAAGGAAAAAGGTA0.126400.119000.637900.500001.000001.00000


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277AGAAGAGAAUAUUAGCUUU89.6389340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7623295AGAAGAGAATATTAGCTTTAAAGCTAATATTCTCTTCT0.103500.013400.724100.750001.000001.00000


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351GCUGCUGAGAAUAUUCCUG72.15452080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482369GCTGCTGAGAATATTCCTGCAGGAATATTCTCAGCAGC0.061100.017700.569000.750001.000001.00000


Target Position: 3401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401CAUCUUGGUCACAUACAAU93.7499152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993419CATCTTGGTCACATACAATATTGTATGTGACCAAGATG0.550700.096600.646600.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647AGAAUCAGAUCAUUUCAAA93.0211175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5063665AGAATCAGATCATTTCAAATTTGAAATGATCTGATTCT0.156100.063900.724100.750001.000001.00000


Target Position: 2941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2941GGAAAGGAGAAGUUAAGCA91.0731254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982959GGAAAGGAGAAGTTAAGCATGCTTAACTTCTCCTTTCC0.058100.021400.517200.750001.000001.00000


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608UGCAAUUGAAAGAACAGAA82.8929829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181626TGCAATTGAAAGAACAGAATTCTGTTCTTTCAATTGCA0.474000.081400.681000.750001.000001.00000


Target Position: 1468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468CAAAGUCUUAUUUGAUAAA92.6373186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1466-1488GTCAAAGTCTTATTTGATAAAGAUUUAUCAAAUAAGACUUUGACCAAAGUCUUAUUUGAUAAAGAU8.917.722


Target Position: 3241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3241UGGCUAUUUAAAGACAAAG61.27333313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263259TGGCTATTTAAAGACAAAGCTTTGTCTTTAAATAGCCA0.204800.111600.706900.500001.000001.00000


Target Position: 2383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2383GUAUCUGUAUCCAAAUAUU93.8314150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2381-2403AAGTATCTGTATCCAAATATTGAAAUAUUUGGAUACAGAUACUUGUAUCUGUAUCCAAAUAUUGAU-1.820.332


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919GCAGAACAGAGAACACGAG77.28431440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862937GCAGAACAGAGAACACGAGCTCGTGTTCTCTGTTCTGC0.129300.077900.543100.750001.000001.00000


Target Position: 4167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4167AGACAACAUUAAAACAAUA96.991375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5014185AGACAACATTAAAACAATATATTGTTTTAATGTTGTCT0.158800.063800.681000.750001.000001.00000


Target Position: 3493, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493GUAGAUAAACUCAGAAAUU87.9447443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243511GTAGATAAACTCAGAAATTAATTTCTGAGTTTATCTAC0.081900.047300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3491-3513ATGTAGATAAACTCAGAAATTTAAAUUUCUGAGUUUAUCUACAUGUAGAUAAACUCAGAAAUUUAU12.08.422


Target Position: 2276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276GCGGUUGAACCCUACACGA83.0096824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902294GCGGTTGAACCCTACACGATCGTGTAGGGTTCAACCGC0.294500.033000.629300.750000.902200.75000


Target Position: 1506, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506CAGUAAAAGGAUUUAGGAA97.117170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601524CAGTAAAAGGATTTAGGAATTCCTAAATCCTTTTACTG0.581000.513800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1504-1526TACAGTAAAAGGATTTAGGAAGTUUCCUAAAUCCUUUUACUGUACAGUAAAAGGAUUUAGGAAGUU19.94.922


Target Position: 3395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395UGCUUUCAUCUUGGUCACA72.42152052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923413TGCTTTCATCTTGGTCACATGTGACCAAGATGAAAGCA0.147100.023200.646600.500001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785ACAGUGAUGUUAGACAAAC67.34752643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937803ACAGTGATGTTAGACAAACGTTTGTCTAACATCACTGT0.280600.034700.560300.500001.000001.00000