siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 4316  
Biltr, Ernai, Rnaxs 1002   2417   2968   3848  
Biltr, Ernai, Sidirect 4772  
Biltr, Ernai 1244   1350   3024   3467  
Biltr, Rnaxs 53   101   102   214   215   241   242   282   327   347   348   351   353   355   356   364   365   383   434   440  
449   450   456   457   458   460   466   489   490   503   602   627   670   671   672   673   674   676   677   678  
679   681   682   683   684   685   686   688   689   690   695   728   730   732   739   760   761   764   765   766  
776   799   800   806   897   898   899   900   925   926   927   931   932   933   979   1001   1003   1008   1015   1016  
1017   1021   1023   1028   1029   1036   1037   1038   1040   1041   1042   1043   1044   1045   1046   1047   1048   1049   1050   1068  
1069   1070   1071   1072   1073   1074   1075   1129   1141   1145   1146   1147   1148   1149   1150   1151   1153   1155   1163   1218  
1219   1247   1248   1264   1291   1300   1301   1304   1310   1314   1316   1317   1318   1334   1335   1336   1337   1354   1355   1356  
1357   1358   1360   1369   1377   1378   1379   1380   1382   1387   1388   1394   1395   1396   1413   1433   1454   1459   1460   1493  
1505   1514   1518   1519   1557   1558   1559   1602   1603   1604   1606   1657   1658   1663   1664   1665   1666   1667   1668   1673  
1675   1676   1677   1680   1684   1685   1792   1793   1794   1836   1837   1843   1844   1845   1846   1852   1853   1854   1855   1856  
1905   1906   1907   1908   1909   1910   1919   1920   1921   1925   1927   1928   1938   1956   1966   1971   1972   1973   1976   1977  
2000   2001   2002   2004   2036   2037   2038   2044   2045   2058   2087   2090   2091   2092   2093   2106   2126   2143   2144   2145  
2147   2148   2149   2150   2161   2163   2164   2169   2170   2171   2172   2176   2236   2254   2255   2256   2257   2258   2259   2261  
2262   2316   2317   2336   2337   2338   2350   2356   2357   2358   2362   2363   2364   2365   2393   2394   2395   2396   2397   2398  
2399   2400   2401   2407   2408   2409   2412   2414   2415   2416   2467   2468   2479   2480   2481   2482   2539   2540   2541   2545  
2546   2547   2548   2566   2567   2569   2570   2574   2577   2586   2587   2589   2594   2595   2597   2609   2612   2633   2634   2635  
2636   2642   2655   2656   2657   2666   2674   2675   2676   2678   2679   2681   2682   2683   2684   2685   2688   2697   2712   2713  
2718   2719   2720   2721   2722   2734   2735   2748   2749   2752   2791   2792   2796   2797   2798   2799   2800   2801   2804   2810  
2811   2813   2816   2817   2830   2831   2834   2835   2849   2850   2851   2853   2854   2855   2856   2863   2872   2913   2914   2915  
2922   2951   2963   2964   2965   2966   2967   2969   2970   2971   2972   2976   2977   2990   2991   2992   3004   3039   3043   3044  
3045   3046   3047   3048   3054   3057   3058   3065   3066   3068   3095   3096   3216   3217   3219   3220   3226   3228   3229   3296  
3298   3358   3359   3391   3392   3393   3394   3395   3396   3398   3400   3402   3403   3427   3428   3469   3470   3471   3472   3473  
3474   3477   3481   3543   3544   3566   3581   3582   3583   3589   3590   3591   3600   3601   3606   3609   3611   3623   3624   3625  
3663   3664   3670   3671   3683   3684   3690   3691   3692   3693   3694   3717   3724   3725   3726   3748   3749   3750   3752   3760  
3769   3773   3777   3781   3782   3783   3784   3787   3790   3800   3801   3802   3826   3827   3833   3834   3835   3836   3843   3845  
3846   3847   3849   3850   3892   3895   3896   3898   3901   3902   3903   3904   3907   3908   3909   3917   3920   3921   3956   3957  
3958   3959   3997   3998   3999   4002   4003   4012   4015   4020   4021   4022   4023   4024   4044   4045   4046   4047   4050   4052  
4053   4192   4237   4269   4275   4276   4308   4309   4311   4317   4322   4323   4325   4339   4340   4342   4343   4344   4367   4368  
4369   4370   4391   4446   4448   4449   4454   4455   4456   4457   4459   4463   4464   4466   4472   4473   4482   4483   4485   4488  
4493   4523   4524   4567   4569   4572   4573   4574   4575   4576   4614   4615   4616   4617   4623   4624   4625   4627   4628   4661  
4662   4663   4695   4696   4697   4698   4700   4701   4702   4708   4713   4714   4718   4719   4720   4722   4723   4724   4781   4795  
4796   4797   4798   4799   4800   4801   4802   4803   4804   4805   4806   4818   4828   4829   4831   4832   4834   4835   4847   4848  
4850   4855   4856   4857   4858   4860   4863   4864   4865   4866   4867   4868   4870   4872   4873   4874   4875   4893   4894   4897  
4898   4901   4908   4909   4910   4911   4913   4917   4918   4920   4923   4932   4933   4934   4935  
Biltr, Sidirect 376   469   472   687   726   1005   1013   1277   1669   1670   2153   2608   2613   2658   2725   2845   3027   3031   3092   3097  
3553   3696   3698   3978   4267   4462   4467   4470   4486   4520   4609   4760   4810   4820   4825   4827   4837   4895  
Biltr, Rnaxs, Sidirect 459   729   731   1022   1051   1152   1154   1289   1292   1299   1381   1678   1679   1847   1857   1858   2413   2420   2610   2616  
2677   2686   2687   2689   2727   2728   2802   2803   2812   2857   2921   3035   3067   3225   3227   3230   3397   3399   3401   3580  
3584   3585   3610   4268   4310   4318   4324   4465   4478   4479   4484   4577   4578   4618   4626   4830   4833   4859   4861   4862  
4869   4871   4902   4912   4921   4922  


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938AAGUACAUCCUGGCCCUUU68.27952499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481956AAGTACATCCTGGCCCTTTAAAGGGCCAGGATGTACTT0.070400.005500.637900.500001.000001.00000


Target Position: 4857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4857GUGAGGUUUUUUGUCUUUU74.95211587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2084875GTGAGGTTTTTTGTCTTTTAAAAGACAAAAAACCTCAC0.779000.079400.793100.750001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547UGCAGAAAGAUACGACUGA76.38871396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962565TGCAGAAAGATACGACTGATCAGTCGTATCTTTCTGCA0.068400.039900.629300.500001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682UGCAGGAUCUAGAACAGAA92.669129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551700TGCAGGATCTAGAACAGAATTCTGTTCTAGATCCTGCA0.378600.144000.681000.750001.000001.00000


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170CUGAAAUCAUCAUGGGCUA87.0822379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902188CTGAAATCATCATGGGCTATAGCCCATGATGATTTCAG0.267100.167600.612100.750000.983700.62500


Target Position: 3469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469UUCAGGCUGGUAAUUUAUA73.63941766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783487TTCAGGCTGGTAATTTATATATAAATTACCAGCCTGAA0.615600.002200.629300.500001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143AGCAGCAGCUGAACAACAU81.5502821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252161AGCAGCAGCTGAACAACATATGTTGTTCAGCTGCTGCT0.105800.002900.698300.750000.902200.62500


Target Position: 2164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164CAUUUGCUGAAAUCAUCAU84.187578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542182CATTTGCTGAAATCATCATATGATGATTTCAGCAAATG0.282300.003200.500000.750000.983700.62500


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898AGAGGGGGAGAGAGUUACA85.9068455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473916AGAGGGGGAGAGAGTTACATGTAACTCTCTCCCCCTCT0.494900.116900.517200.500001.000001.00000


Target Position: 2969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2969UGGCAUUGCACUUUUUAAC60.17733541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8492987TGGCATTGCACTTTTTAACGTTAAAAAGTGCAATGCCA0.656900.012400.698300.500001.000001.00000


Target Position: 3581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3581UAAGCAUUUUAGACUUUUU80.1183954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803599TAAGCATTTTAGACTTTTTAAAAAGTCTAAAATGCTTA0.132000.042400.534500.500001.000001.00000


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068GCAAAAAACACUGUAUCAG72.48041938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6523086GCAAAAAACACTGTATCAGCTGATACAGTGTTTTTTGC0.352200.343600.569000.750001.000001.00000


Target Position: 4848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4848UAUAUUAUUGUGAGGUUUU73.37611808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8064866TATATTATTGTGAGGTTTTAAAACCTCACAATAATATA0.055300.018900.543100.500001.000001.00000


Target Position: 2857, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2857GCUUUUUGUUAUUGUUGUU83.3589649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802875GCTTTTTGTTATTGTTGTTAACAACAATAACAAAAAGC0.056600.023200.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2855-2877CAGCTTTTTGTTATTGTTGTTGTAACAACAAUAACAAAAAGCUGGCUUUUUGUUAUUGUUGUUGUU19.32.111


Target Position: 726, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726GAUGACUUUGAUUUCAACU80.5207914

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
724-746AGGATGACTTTGATTTCAACTATAGUUGAAAUCAAAGUCAUCCUGAUGACUUUGAUUUCAACUAUU14.919.222


Target Position: 472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472GAAUCAAGCAGUUUCUUCA97.908722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
470-492AAGAATCAAGCAGTTTCTTCAGAUGAAGAAACUGCUUGAUUCUUGAAUCAAGCAGUUUCUUCAGAU14.812.022


Target Position: 4024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024CGUCUUCAUUCAGUUCAUG74.92921590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8144042CGTCTTCATTCAGTTCATGCATGAACTGAATGAAGACG0.051500.012100.620700.750001.000001.00000


Target Position: 3920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3920UGGACAUGAUGCACACUAU88.6334290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553938TGGACATGATGCACACTATATAGTGTGCATCATGTCCA0.045600.011400.801700.750001.000001.00000


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226UCUACUAAAAGUACAAAAA81.7191802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263244TCTACTAAAAGTACAAAAATTTTTGTACTTTTAGTAGA0.507600.275400.724100.750000.994600.62500


Target Position: 2172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172GAAAUCAUCAUGGGCUAUA85.0228515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302190GAAATCATCATGGGCTATATATAGCCCATGATGATTTC0.282600.168200.629300.750001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685GGCACUUUUAAAAAUAGAG74.71531618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942703GGCACTTTTAAAAATAGAGCTCTATTTTTAAAAGTGCC0.597300.056500.689700.750001.000001.00000


Target Position: 4806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4806ACUGCAUUCAAAUUCCAAU78.40721131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2684824ACTGCATTCAAATTCCAATATTGGAATTTGAATGCAGT0.317600.067900.698300.750001.000001.00000


Target Position: 3047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047AGAAAUAAUAACAAUUAAA93.3255110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1813065AGAAATAATAACAATTAAATTTAATTGTTATTATTTCT0.492900.144100.724100.750001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490AGAGCAGGUAUCUUGAGAA94.642277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
955508AGAGCAGGTATCTTGAGAATTCTCAAGATACCTGCTCT0.032800.004200.551700.750001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927GACGAGGAGCUGGCUGACU73.00531856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846945GACGAGGAGCTGGCTGACTAGTCAGCCAGCTCCTCGTC0.046800.017500.612100.500001.000001.00000


Target Position: 1152, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152CUGUUUAGAAACUUAAUGA88.0342322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881170CTGTTTAGAAACTTAATGATCATTAAGTTTCTAAACAG0.160900.080600.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1150-1172AGCTGTTTAGAAACTTAATGAAAUCAUUAAGUUUCUAAACAGCUCUGUUUAGAAACUUAAUGAAAU3.511.822


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364AAGAAUCACAUGCCACUUU73.83171743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947382AAGAATCACATGCCACTTTAAAGTGGCATGTGATTCTT0.066300.011800.637900.500001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004UAGAAGAUAGGACUAUCUA87.8938325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973022TAGAAGATAGGACTATCTATAGATAGTCCTATCTTCTA0.147000.002000.500000.500000.902200.62500


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065AGGGCAAAAAACACUGUAU81.2034851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2333083AGGGCAAAAAACACTGTATATACAGTGTTTTTTGCCCT0.373400.072100.801700.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676AGAGAGUGCAGGAUCUAGA87.5853352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953694AGAGAGTGCAGGATCTAGATCTAGATCCTGCACTCTCT0.238400.031800.500000.500001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792UGACUACACUGGCAGAGAA92.3183143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711810TGACTACACTGGCAGAGAATTCTCTGCCAGTGTAGTCA0.029900.004800.551700.750000.918500.87500


Target Position: 4933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4933GUUAUAUAGGAACCGUAAA87.6973341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4254951GTTATATAGGAACCGTAAATTTACGGTTCCTATATAAC0.327900.226700.646600.750001.000001.00000


Target Position: 4920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4920UCCAGAAAUAAACGUUAUA77.75411214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5114938TCCAGAAATAAACGTTATATATAACGTTTATTTCTGGA0.605200.087100.827600.750001.000001.00000


Target Position: 376, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CCACUUUGGUGUUUCAUAA94.588678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
374-396TGCCACTTTGGTGTTTCATAATCUUAUGAAACACCAAAGUGGCACCACUUUGGUGUUUCAUAAUCU8.916.721


Target Position: 1277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277CAAAUUCCCUGAGUUGAAU80.2861936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1275-1297GTCAAATTCCCTGAGTTGAATTAAUUCAACUCAGGGAAUUUGACCAAAUUCCCUGAGUUGAAUUAU19.214.222


Target Position: 4803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4803GCCACUGCAUUCAAAUUCC67.84572551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7654821GCCACTGCATTCAAATTCCGGAATTTGAATGCAGTGGC0.923400.022100.629300.500001.000001.00000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351UAUGCGGCCAGCAAAGAAU69.66152326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789369TATGCGGCCAGCAAAGAATATTCTTTGCTGGCCGCATA0.160300.007100.534500.500000.918500.75000


Target Position: 4909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4909CUACUUUAACUUCCAGAAA86.1661433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9364927CTACTTTAACTTCCAGAAATTTCTGGAAGTTAAAGTAG0.035200.017900.672400.750001.000001.00000


Target Position: 3401, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401CAAAAAAAAAAAAAAAAAA86.7759395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4183419CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.972700.961300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3399-3421CTCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGAGCAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728UGACUUUGAUUUCAACUAU81.2171847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972746TGACTTTGATTTCAACTATATAGTTGAAATCAAAGTCA0.398500.002200.681000.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CGUCAACAAAUUAAGAAAC72.41471950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511068CGTCAACAAATTAAGAAACGTTTCTTAATTTGTTGACG0.231100.091500.629300.750001.000001.00000


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663GGGUGCUUACAACCUUGAC71.28242104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5963681GGGTGCTTACAACCTTGACGTCAAGGTTGTAAGCACCC0.105200.048300.672400.750000.967400.62500


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396CCCCCGCACUUUAGAUUCA80.151952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902414CCCCCGCACTTTAGATTCATGAATCTAAAGTGCGGGGG0.145000.062000.767200.750001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072AGGAGUUGCAGCAAAAAGU73.6491763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911090AGGAGTTGCAGCAAAAAGTACTTTTTGCTGCAACTCCT0.112000.020800.637900.500001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627GUGACGGAGAAGCAGCAGA80.0378960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941645GTGACGGAGAAGCAGCAGATCTGCTGCTTCTCCGTCAC0.043400.002700.569000.500001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163CUUAAUGAAAAGUGCCUUU74.61871627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151181CTTAATGAAAAGTGCCTTTAAAGGCACTTTTCATTAAG0.037800.012600.637900.750001.000001.00000


Target Position: 4772, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4772CCUAUAAGGUGGUUUAUAA100.9767

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5477219CCTATAAGGTGGTTTATAA1/1/0/0100.00STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40465501..40465519(-)00STAT3(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4770-4792TACCTATAAGGTGGTTTATAAGCUUAUAAACCACCUUAUAGGUACCUAUAAGGUGGUUUAUAAGCU1.42.822


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670UCCGGAAGAGAGUGCAGGA74.94821589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
965688TCCGGAAGAGAGTGCAGGATCCTGCACTCTCTTCCGGA0.184200.006900.500000.500001.000001.00000


Target Position: 2748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2748AGGAUGUGUUCUCUGAGAC71.22062110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042766AGGATGTGTTCTCTGAGACGTCTCAGAGAACACATCCT0.039400.004700.525900.500001.000001.00000


Target Position: 3225, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225CUCUACUAAAAGUACAAAA88.2772309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3643243CTCTACTAAAAGTACAAAATTTTGTACTTTTAGTAGAG0.478000.266000.810300.750000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3223-3245GTCTCTACTAAAAGTACAAAAAAUUUUGUACUUUUAGUAGAGACCUCUACUAAAAGUACAAAAAAU14.720.100


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971AUCAUGGGCUUUAUCAGUA82.0096767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281989ATCATGGGCTTTATCAGTATACTGATAAAGCCCATGAT0.128900.005600.500000.500001.000001.00000


Target Position: 4833, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4833CAUAGUGUAAAAAUUUAUA95.0967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454851CATAGTGTAAAAATTTATATATAAATTTTTACACTATG0.205600.002600.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4831-4853TTCATAGTGTAAAAATTTATATTUAUAAAUUUUUACACUAUGAACAUAGUGUAAAAAUUUAUAUUU-10.319.022


Target Position: 2845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845CCUUUCUCAGCAGCUUUUU66.36252738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2843-2865CTCCTTTCTCAGCAGCTTTTTGTAAAAAGCUGCUGAGAAAGGAGCCUUUCUCAGCAGCUUUUUGUU17.019.122


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336GACCAAGUUUAUCUGUGUG78.80031092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982354GACCAAGTTTATCTGTGTGCACACAGATAAACTTGGTC0.040400.017900.525900.500001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761UCAAGGAGACAUGCAAGAU74.16681694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758779TCAAGGAGACATGCAAGATATCTTGCATGTCTCCTTGA0.317500.101700.543100.750001.000001.00000


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928CCUUGUGAAAAAGUACAUC67.90542547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381946CCTTGTGAAAAAGTACATCGATGTACTTTTTCACAAGG0.123100.038100.663800.750001.000001.00000


Target Position: 2684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GGGCACUUUUAAAAAUAGA87.0039386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792702GGGCACTTTTAAAAATAGATCTATTTTTAAAAGTGCCC0.611200.056400.767200.750001.000001.00000


Target Position: 2656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656UCCUACUUCUGCUAUCUUU74.69741619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652674TCCTACTTCTGCTATCTTTAAAGATAGCAGAAGTAGGA0.060300.053700.870700.750001.000001.00000


Target Position: 3826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3826GUCUCCUUGCGUGUCUAAA81.7854793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773844GTCTCCTTGCGTGTCTAAATTTAGACACGCAAGGAGAC0.047300.002200.819000.750001.000001.00000


Target Position: 3998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3998GUGAUAUCCAGUGGCACUU72.86961875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274016GTGATATCCAGTGGCACTTAAGTGCCACTGGATATCAC0.036200.010700.655200.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898CGAUGGAGUACGUGCAGAA99.411913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790916CGATGGAGTACGTGCAGAATTCTGCACGTACTCCATCG0.055000.013400.620701.000001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685AGGAUCUAGAACAGAAAAU76.32591401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313703AGGATCTAGAACAGAAAATATTTTCTGTTCTAGATCCT0.312000.136800.836200.750001.000001.00000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327UGGAUUGAGAGUCAAGAUU70.42182223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973345TGGATTGAGAGTCAAGATTAATCTTGACTCTCAATCCA0.029500.002800.836200.750001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695ACAGAAAAUGAAAGUGGUA86.2469429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994713ACAGAAAATGAAAGTGGTATACCACTTTCATTTTCTGT0.027100.020400.525900.750001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356CACCAACGACCUGCAGCAA85.2846493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512374CACCAACGACCTGCAGCAATTGCTGCAGGTCGTTGGTG0.119100.114000.646600.750001.000001.00000


Target Position: 3399, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3399CUCAAAAAAAAAAAAAAAA81.5223823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5423417CTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAG0.990500.396700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3397-3419GTCTCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGAGACCUCAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 4339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4339AAUUAGCUGGUCUCUGAAU79.57841008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9364357AATTAGCTGGTCTCTGAATATTCAGAGACCAGCTAATT0.240400.087100.500000.500001.000001.00000


Target Position: 3220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220CCCGUCUCUACUAAAAGUA81.71805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2453238CCCGTCTCTACTAAAAGTATACTTTTAGTAGAGACGGG0.323900.068400.810301.000000.978300.75000


Target Position: 1657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657ACAACAUGCUGACCAACAA90.8634190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101675ACAACATGCTGACCAACAATTGTTGGTCAGCATGTTGT0.182800.016900.560300.750000.989100.62500


Target Position: 4002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4002UAUCCAGUGGCACUUGUAA82.6544713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984020TATCCAGTGGCACTTGTAATTACAAGTGCCACTGGATA0.051200.009200.508600.500001.000001.00000


Target Position: 3391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3391GACUCUGUCUCAAAAAAAA99.739712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103409GACTCTGTCTCAAAAAAAATTTTTTTTGAGACAGAGTC0.374600.037700.819000.750001.000001.00000


Target Position: 4367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4367GACGACCUUCUCUAAGAUG74.33961673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7974385GACGACCTTCTCTAAGATGCATCTTAGAGAAGGTCGTC0.059000.005500.663800.500000.951100.62500


Target Position: 2817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2817GUCUUGUGUUGUUUUGUUC71.46132077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272835GTCTTGTGTTGTTTTGTTCGAACAAAACAACACAAGAC0.208800.109800.646600.500001.000001.00000


Target Position: 4479, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4479CUUAACUGAUAAACAGAAU81.4509828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454497CTTAACTGATAAACAGAATATTCTGTTTATCAGTTAAG0.511900.036600.629300.750000.956500.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4477-4499AGCTTAACTGATAAACAGAATATAUUCUGUUUAUCAGUUAAGCUCUUAACUGAUAAACAGAAUAUU19.211.822


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904GGAGAGAGUUACAGGUUGG76.8521327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8273922GGAGAGAGTTACAGGTTGGCCAACCTGTAACTCTCTCC0.100400.055300.525900.500001.000001.00000


Target Position: 4863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4863UUUUUUGUCUUUUUUUUUU62.58873226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394881TTTTTTGTCTTTTTTTTTTAAAAAAAAAAGACAAAAAA0.911000.688900.500000.500001.000001.00000


Target Position: 4020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4020AUGGCGUCUUCAUUCAGUU75.26691549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8844038ATGGCGTCTTCATTCAGTTAACTGAATGAAGACGCCAT0.157800.017500.508600.500001.000001.00000


Target Position: 3691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3691CCCUGGACUUGAUCUGCUG72.77581886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6353709CCCTGGACTTGATCTGCTGCAGCAGATCAAGTCCAGGG0.094800.055200.706900.750001.000001.00000


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258GGAGGCAUUCGGAAAGUAU88.418300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722276GGAGGCATTCGGAAAGTATATACTTTCCGAATGCCTCC0.356500.016000.827601.000001.000001.00000


Target Position: 4868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4868UGUCUUUUUUUUUUUUUUU68.25792500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2474886TGTCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGACA0.985100.762700.706900.750001.000001.00000


Target Position: 2595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595CACAGCCAAACCCCAGAUC58.72033694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312613CACAGCCAAACCCCAGATCGATCTGGGGTTTGGCTGTG0.259200.217900.612100.500001.000001.00000


Target Position: 4850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4850UAUUAUUGUGAGGUUUUUU72.03022002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7534868TATTATTGTGAGGTTTTTTAAAAAACCTCACAATAATA0.116300.027000.543100.500001.000001.00000


Target Position: 3398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3398UCUCAAAAAAAAAAAAAAA77.18071280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2183416TCTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAGA0.992600.192100.724100.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398CCCGCACUUUAGAUUCAUU85.1503505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872416CCCGCACTTTAGATTCATTAATGAATCTAAAGTGCGGG0.146300.039600.982801.000001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036CUCAACUUCAGACCCGUCA70.88912159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191054CTCAACTTCAGACCCGTCATGACGGGTCTGAAGTTGAG0.284400.072400.586200.500001.000001.00000


Target Position: 2683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683UGGGCACUUUUAAAAAUAG68.99162421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532701TGGGCACTTTTAAAAATAGCTATTTTTAAAAGTGCCCA0.638400.027800.672400.500001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GAGACAUGCAAGAUCUGAA102.3774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909784GAGACATGCAAGATCTGAATTCAGATCTTGCATGTCTC0.039000.032400.637900.750001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304UAAAAUUAAAGUGUGCAUU65.76042811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021322TAAAATTAAAGTGTGCATTAATGCACACTTTAATTTTA0.153500.125500.525900.500001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676AGCAAUCUGGGCACUUUUA81.6324813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202694AGCAATCTGGGCACTTTTATAAAAGTGCCCAGATTGCT0.177400.008100.819000.750001.000001.00000


Target Position: 4871, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4871CUUUUUUUUUUUUUUUUUU70.15912261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4844889CTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAG0.746000.695300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4869-4891GTCTTTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAGACCUUUUUUUUUUUUUUUUUUUUU-11.3-11.300


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041CUUCAGACCCGUCAACAAA88.0843320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061059CTTCAGACCCGTCAACAAATTTGTTGACGGGTCTGAAG0.552800.055500.637900.750001.000001.00000


Target Position: 4022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4022GGCGUCUUCAUUCAGUUCA79.1811050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4444040GGCGTCTTCATTCAGTTCATGAACTGAATGAAGACGCC0.172300.029900.775900.750001.000001.00000


Target Position: 2971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2971GCAUUGCACUUUUUAACCU80.9022874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832989GCATTGCACTTTTTAACCTAGGTTAAAAAGTGCAATGC0.593000.248700.508600.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518GAGGAGCUGCACCUGAUCA90.5109199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751536GAGGAGCTGCACCTGATCATGATCAGGTGCAGCTCCTC0.059500.003700.586200.500000.940200.62500


Target Position: 4615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4615UCUGGUCUUAACUCUGAUU72.61961918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8744633TCTGGTCTTAACTCTGATTAATCAGAGTTAAGACCAGA0.065300.003700.715500.750001.000001.00000


Target Position: 2725, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725CUGCUUUUAUCUAAAUGCA86.246430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2723-2745ATCTGCTTTTATCTAAATGCAAAUGCAUUUAGAUAAAAGCAGAUCUGCUUUUAUCUAAAUGCAAAU15.318.622


Target Position: 4858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4858UGAGGUUUUUUGUCUUUUU76.0581431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3924876TGAGGTTTTTTGTCTTTTTAAAAAGACAAAAAACCTCA0.784800.125400.724100.750001.000001.00000


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317UGCAUUGACAAAGACUCUG56.94263857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861335TGCATTGACAAAGACTCTGCAGAGTCTTTGTCAATGCA0.055400.009200.569000.500001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394AGUGAUGAACAUGGAAGAA86.3116423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651412AGTGATGAACATGGAAGAATTCTTCCATGTTCATCACT0.044700.005200.534500.750001.000001.00000


Target Position: 3848, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3848CCCUCAUCCUGUUUGUUUU82.7907703

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3384819CCCTCATCCTGTTTGTTTT1/1/0/0100.00STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40466425..40466443(-)00STAT3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6223866CCCTCATCCTGTTTGTTTTAAAACAAACAGGATGAGGG0.099100.031300.991401.000001.000001.00000


Target Position: 4309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4309AGUUUCUGUGGAAUUCUGU72.22051981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9804327AGTTTCTGTGGAATTCTGTACAGAATTCCACAGAAACT0.028900.004800.500000.500001.000001.00000


Target Position: 3358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3358GCACACUGCACUCCAUCCU72.59771922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713376GCACACTGCACTCCATCCTAGGATGGAGTGCAGTGTGC0.083500.010800.508600.750001.000001.00000


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903GGGAGAGAGUUACAGGUUG77.5451241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2753921GGGAGAGAGTTACAGGTTGCAACCTGTAACTCTCTCCC0.279100.078600.844800.750001.000001.00000


Target Position: 3683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3683CCCUUUCUCCCUGGACUUG58.31193727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3713701CCCTTTCTCCCTGGACTTGCAAGTCCAGGGAGAAAGGG0.233000.037900.844800.750001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854UGGGCUAAAUUUUGCAAAG63.08013166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8821872TGGGCTAAATTTTGCAAAGCTTTGCAAAATTTAGCCCA0.128000.045500.706900.500000.989100.87500


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218GACCGGCCCCUCGUCAUCA79.8723978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771236GACCGGCCCCTCGTCATCATGATGACGAGGGGCCGGTC0.177600.009800.594800.500000.967400.62500


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972UCAUGGGCUUUAUCAGUAA85.4409481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351990TCATGGGCTTTATCAGTAATTACTGATAAAGCCCATGA0.473000.004700.689700.750001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GAUCACAUGGGCUAAAUUU85.3689488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331865GATCACATGGGCTAAATTTAAATTTAGCCCATGTGATC0.095400.016900.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1845-1867CAGATCACATGGGCTAAATTTTGAAAUUUAGCCCAUGUGAUCUGGAUCACAUGGGCUAAAUUUUGU-4.320.522


Target Position: 2004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2004GCCAUCUUGAGCACUAAGC56.22353933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172022GCCATCTTGAGCACTAAGCGCTTAGTGCTCAAGATGGC0.062200.006200.646600.500000.945700.75000


Target Position: 3474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474GCUGGUAAUUUAUAUAAUC81.655810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4813492GCTGGTAATTTATATAATCGATTATATAAATTACCAGC0.475900.084900.672400.750001.000001.00000


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688ACUUUUAAAAAUAGAGAAA83.148671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2962706ACTTTTAAAAATAGAGAAATTTCTCTATTTTTAAAAGT0.562300.089000.706900.750001.000001.00000


Target Position: 4616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4616CUGGUCUUAACUCUGAUUG60.99543428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7564634CTGGTCTTAACTCTGATTGCAATCAGAGTTAAGACCAG0.099300.012100.637900.500001.000001.00000


Target Position: 2853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2853AGCAGCUUUUUGUUAUUGU72.12541992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932871AGCAGCTTTTTGTTATTGTACAATAACAAAAAGCTGCT0.196300.005600.646600.500001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070GGAGGAGUUGCAGCAAAAA91.2863179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141088GGAGGAGTTGCAGCAAAAATTTTTGCTGCAACTCCTCC0.332500.003100.870701.000001.000001.00000


Target Position: 4316, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4316GUGGAAUUCUGUUUGUUAA94.860872

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4431619GTGGAATTCTGTTTGTTAA1/1/0/0100.00STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANANA00STAT3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9694334GTGGAATTCTGTTTGTTAATTAACAAACAGAATTCCAC0.054200.002300.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4314-4336CTGTGGAATTCTGTTTGTTAAATUUAACAAACAGAAUUCCACAGGUGGAAUUCUGUUUGUUAAAUU7.220.122


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217AACCCCGUCUCUACUAAAA81.6897808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5873235AACCCCGTCTCTACTAAAATTTTAGTAGAGACGGGGTT0.310100.043600.646600.500001.000001.00000


Target Position: 4574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4574GGAGCAGAUAUUGUCAAGU79.9017974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6644592GGAGCAGATATTGTCAAGTACTTGACAATATCTGCTCC0.119100.010600.663800.750001.000001.00000


Target Position: 3684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3684CCUUUCUCCCUGGACUUGA72.67891908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5693702CCTTTCTCCCTGGACTTGATCAAGTCCAGGGAGAAAGG0.225900.041800.620700.750001.000001.00000


Target Position: 4829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4829ACUUCAUAGUGUAAAAAUU85.4079484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7434847ACTTCATAGTGTAAAAATTAATTTTTACACTATGAAGT0.223700.007300.698300.750001.000001.00000


Target Position: 3846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3846GUCCCUCAUCCUGUUUGUU73.68251760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7083864GTCCCTCATCCTGTTTGTTAACAAACAGGATGAGGGAC0.072600.045900.672400.750001.000001.00000


Target Position: 3892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3892GGAAGAAGAGGGGGAGAGA85.3613489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4303910GGAAGAAGAGGGGGAGAGATCTCTCCCCCTCTTCTTCC0.432300.077800.646600.750001.000001.00000


Target Position: 4713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4713UCCACUGCCCCCUCCCCAU58.14953736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2044731TCCACTGCCCCCTCCCCATATGGGGAGGGGGCAGTGGA0.503000.251400.715500.750001.000001.00000


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907CUGGCUGGACAAUAUCAUU83.7999599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201925CTGGCTGGACAATATCATTAATGATATTGTCCAGCCAG0.188000.071000.775900.750001.000001.00000


Target Position: 3403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3403AAAAAAAAAAAAAAAAAAA83.5835622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503421AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.929700.926000.500000.500001.000001.00000


Target Position: 4867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4867UUGUCUUUUUUUUUUUUUU64.3632979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9344885TTGTCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGACAA0.987500.764600.646600.500001.000001.00000


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001CGGGCCAUCUUGAGCACUA88.8069276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082019CGGGCCATCTTGAGCACTATAGTGCTCAAGATGGCCCG0.072800.003100.741401.000000.951100.87500


Target Position: 4577, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4577GCAGAUAUUGUCAAGUUCA93.579106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6544595GCAGATATTGTCAAGTTCATGAACTTGACAATATCTGC0.089700.052600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4575-4597GAGCAGATATTGTCAAGTTCATGUGAACUUGACAAUAUCUGCUCGCAGAUAUUGUCAAGUUCAUGU19.213.332


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602GGCCAACCACCCCACAGCA83.5624628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
639620GGCCAACCACCCCACAGCATGCTGTGGGGTGGTTGGCC0.093200.032600.646600.750000.934800.62500


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900AUGGAGUACGUGCAGAAAA80.5452909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970918ATGGAGTACGTGCAGAAAATTTTCTGCACGTACTCCAT0.030100.009400.655200.500001.000001.00000


Target Position: 2153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153GAACAACAUGUCAUUUGCU84.8863530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2151-2173CTGAACAACATGTCATTTGCTGAAGCAAAUGACAUGUUGUUCAGGAACAACAUGUCAUUUGCUGAU20.019.322


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379GGGCACAAACACAAAAGUG76.4191393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391397GGGCACAAACACAAAAGTGCACTTTTGTGTTTGTGCCC0.066700.034500.698300.750000.923900.62500


Target Position: 4618, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4618GGUCUUAACUCUGAUUGUA96.888235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5584636GGTCTTAACTCTGATTGTATACAATCAGAGTTAAGACC0.273600.017200.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4616-4638CTGGTCTTAACTCTGATTGTAGCUACAAUCAGAGUUAAGACCAGGGUCUUAACUCUGAUUGUAGCU20.514.623


Target Position: 2863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2863UGUUAUUGUUGUUGUUGUU78.09581174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732881TGTTATTGTTGTTGTTGTTAACAACAACAACAATAACA0.043500.014100.560300.750001.000001.00000


Target Position: 4325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4325UGUUUGUUAAAUCAAAUUA80.4981917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4774343TGTTTGTTAAATCAAATTATAATTTGATTTAACAAACA0.203700.023800.672400.750001.000001.00000


Target Position: 3402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3402AAAAAAAAAAAAAAAAAAA83.5835621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293420AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.948500.945600.500000.500001.000001.00000


Target Position: 2749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2749GGAUGUGUUCUCUGAGACC77.98561190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182767GGATGTGTTCTCTGAGACCGGTCTCAGAGAACACATCC0.037200.003200.517200.500001.000001.00000


Target Position: 1836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1836UCAGGGUGUCAGAUCACAU81.6994807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9241854TCAGGGTGTCAGATCACATATGTGATCTGACACCCTGA0.126900.002900.569000.750000.956500.75000


Target Position: 4895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4895GUAUAUUGCUGUAUCUACU90.6249194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4893-4915TGGTATATTGCTGTATCTACTTTAGUAGAUACAGCAAUAUACCAGUAUAUUGCUGUAUCUACUUUU15.80.022


Target Position: 2236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236UCUAUCCUGACAUUCCCAA71.81492035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8802254TCTATCCTGACATTCCCAATTGGGAATGTCAGGATAGA0.042700.022000.577600.750001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678AGAGUGCAGGAUCUAGAAC69.07882410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786696AGAGTGCAGGATCTAGAACGTTCTAGATCCTGCACTCT0.232400.044000.577600.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458GCACAAUCUACGAAGAAUC75.48691513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584476GCACAATCTACGAAGAATCGATTCTTCGTAGATTGTGC0.109100.056800.672400.750000.994600.87500


Target Position: 2413, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413CAUUGAUGCAGUUUGGAAA94.906371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072431CATTGATGCAGTTTGGAAATTTCCAAACTGCATCAATG0.231800.043700.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2411-2433TTCATTGATGCAGTTTGGAAATAUUUCCAAACUGCAUCAAUGAACAUUGAUGCAGUUUGGAAAUAU20.113.632


Target Position: 2728, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728CUUUUAUCUAAAUGCAAAU80.0913957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712746CTTTTATCTAAATGCAAATATTTGCATTTAGATAAAAG0.252300.010000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2726-2748TGCTTTTATCTAAATGCAAATAAAUUUGCAUUUAGAUAAAAGCACUUUUAUCUAAAUGCAAAUAAU20.02.122


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671CCGGAAGAGAGUGCAGGAU72.14161989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774689CCGGAAGAGAGTGCAGGATATCCTGCACTCTCTTCCGG0.058000.007200.732801.000001.000001.00000


Target Position: 4023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023GCGUCUUCAUUCAGUUCAU88.3705303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4724041GCGTCTTCATTCAGTTCATATGAACTGAATGAAGACGC0.155200.037700.767201.000001.000001.00000


Target Position: 4448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4448UCUCCAGCAACACUCUUCA75.6211489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9564466TCTCCAGCAACACTCTTCATGAAGAGTGTTGCTGGAGA0.105700.040100.500000.500001.000001.00000


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724UUGUUUCUGUGGGUGCCUU61.78593330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943742TTGTTTCTGTGGGTGCCTTAAGGCACCCACAGAAACAA0.075200.016900.508600.500001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038CAACUUCAGACCCGUCAAC67.83272554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681056CAACTTCAGACCCGTCAACGTTGACGGGTCTGAAGTTG0.399200.063700.500000.500001.000001.00000


Target Position: 3833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3833UGCGUGUCUAAAGGUCCCU56.33963920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763851TGCGTGTCTAAAGGTCCCTAGGGACCTTTAGACACGCA0.128000.029400.508600.500001.000001.00000


Target Position: 4047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4047GCAAAGGCUUACUGAUAAA96.036347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5644065GCAAAGGCTTACTGATAAATTTATCAGTAAGCCTTTGC0.512900.016400.853401.000001.000001.00000


Target Position: 2810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810AGGAAAUGUCUUGUGUUGU70.5732206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142828AGGAAATGTCTTGTGTTGTACAACACAAGACATTTCCT0.141600.020900.637900.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAGAGUGCAGGAUCUAGAA98.226420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480695GAGAGTGCAGGATCTAGAATTCTAGATCCTGCACTCTC0.247300.039600.637900.750001.000001.00000


Target Position: 2610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610GAUCAUCUGAAACUACUAA97.759925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162628GATCATCTGAAACTACTAATTAGTAGTTTCAGATGATC0.104000.003000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2608-2630CAGATCATCTGAAACTACTAACTUUAGUAGUUUCAGAUGAUCUGGAUCAUCUGAAACUACUAACUU18.820.433


Target Position: 3845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3845GGUCCCUCAUCCUGUUUGU77.91971196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7313863GGTCCCTCATCCTGTTTGTACAAACAGGATGAGGGACC0.068500.022700.646600.750001.000001.00000


Target Position: 3896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3896GAAGAGGGGGAGAGAGUUA92.6644130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753914GAAGAGGGGGAGAGAGTTATAACTCTCTCCCCCTCTTC0.466200.109500.637900.750001.000001.00000


Target Position: 4872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4872UUUUUUUUUUUUUUUUUUU61.69033340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604890TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.650800.642300.500000.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087GGUGGAGAAGGACAUCAGC70.92232152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192105GGTGGAGAAGGACATCAGCGCTGATGTCCTTCTCCACC0.054900.026500.500000.500001.000001.00000


Target Position: 3978, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3978GGUUCUUAGCCAGUUUCUU81.1935852

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3976-3998ATGGTTCTTAGCCAGTTTCTTGGAAGAAACUGGCUAAGAACCAUGGUUCUUAGCCAGUUUCUUGGU17.714.632


Target Position: 4912, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4912CUUUAACUUCCAGAAAUAA88.9141270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6904930CTTTAACTTCCAGAAATAATTATTTCTGGAAGTTAAAG0.079500.019400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4910-4932TACTTTAACTTCCAGAAATAAACUUAUUUCUGGAAGUUAAAGUACUUUAACUUCCAGAAAUAAACU6.94.921


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058CAAUUAAAGGGCAAAAAAC75.21011556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233076CAATTAAAGGGCAAAAAACGTTTTTTGCCCTTTAATTG0.274400.183800.500000.500001.000001.00000


Target Position: 3836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3836GUGUCUAAAGGUCCCUCAU81.5714816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7243854GTGTCTAAAGGTCCCTCATATGAGGGACCTTTAGACAC0.233800.007900.637900.750001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739UCAACUAUAAAACCCUCAA77.66731225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630757TCAACTATAAAACCCTCAATTGAGGGTTTTATAGTTGA0.469600.379100.577600.750001.000001.00000


Target Position: 1244, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244CGUCCAGUUCACUACUAAA103.3393

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7124419CGTCCAGTTCACTACTAAA1/1/0/097.75STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40485696..40485714(-)00STAT3(0.002)


Target Position: 3670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3670UACAACCUUGACUCCCUUU65.9482781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6603688TACAACCTTGACTCCCTTTAAAGGGAGTCAAGGTTGTA0.087800.029700.681000.500001.000001.00000


Target Position: 3781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3781GCCCCACCCUCCCGACCCC49.64474493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893799GCCCCACCCTCCCGACCCCGGGGTCGGGAGGGTGGGGC0.137700.071500.508600.500001.000001.00000


Target Position: 4050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050AAGGCUUACUGAUAAACUU83.7814602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9774068AAGGCTTACTGATAAACTTAAGTTTATCAGTAAGCCTT0.138300.008500.500000.500000.956500.62500


Target Position: 2963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963UACUCCUGGCAUUGCACUU67.7432561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962981TACTCCTGGCATTGCACTTAAGTGCAATGCCAGGAGTA0.326800.004900.543100.500001.000001.00000


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219CCCCGUCUCUACUAAAAGU80.5407910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713237CCCCGTCTCTACTAAAAGTACTTTTAGTAGAGACGGGG0.315700.059400.784500.750000.978300.62500


Target Position: 4869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4869GUCUUUUUUUUUUUUUUUU73.06931845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4804887GTCTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGAC0.982000.811400.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4867-4889TTGTCTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGACAAGUCUUUUUUUUUUUUUUUUUUU-11.35.500


Target Position: 4454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4454GCAACACUCUUCAGUACAU92.6938126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3034472GCAACACTCTTCAGTACATATGTACTGAAGAGTGTTGC0.254100.091400.698301.000000.929300.87500


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684CAGGAUCUAGAACAGAAAA93.0037118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508702CAGGATCTAGAACAGAAAATTTTCTGTTCTAGATCCTG0.321300.135500.784500.750001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248CAGUUCACUACUAAAGUCA87.6437346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271266CAGTTCACTACTAAAGTCATGACTTTAGTAGTGAACTG0.170000.136100.560300.500000.972800.62500


Target Position: 1558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1558ACCAAGGCCUCAAGAUUGA73.41171800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391576ACCAAGGCCTCAAGATTGATCAATCTTGAGGCCTTGGT0.097000.002700.629300.500001.000001.00000


Target Position: 4344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4344GCUGGUCUCUGAAUUAAGG71.97242010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8984362GCTGGTCTCTGAATTAAGGCCTTAATTCAGAGACCAGC0.347700.006900.508600.500001.000001.00000


Target Position: 2967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2967CCUGGCAUUGCACUUUUUA81.741799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022985CCTGGCATTGCACTTTTTATAAAAAGTGCAATGCCAGG0.652800.005400.810301.000001.000001.00000


Target Position: 4482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4482AACUGAUAAACAGAAUAUU79.00321070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6734500AACTGATAAACAGAATATTAATATTCTGTTTATCAGTT0.399600.049700.637900.500000.956500.75000


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409GAUUCAUUGAUGCAGUUUG77.11191290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512427GATTCATTGATGCAGTTTGCAAACTGCATCAATGAATC0.114100.009100.534500.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003GGCUAGAAAACUGGAUAAC69.3452368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171021GGCTAGAAAACTGGATAACGTTATCCAGTTTTCTAGCC0.195800.008300.853400.750001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689UCUAGAACAGAAAAUGAAA85.4752477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342707TCTAGAACAGAAAATGAAATTTCATTTTCTGTTCTAGA0.586700.233200.724100.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040ACUUCAGACCCGUCAACAA90.339213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221058ACTTCAGACCCGTCAACAATTGTTGACGGGTCTGAAGT0.532600.056200.560300.750001.000001.00000


Target Position: 2802, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802GGAGAAAAAGGAAAUGUCU86.2386431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222820GGAGAAAAAGGAAATGTCTAGACATTTCCTTTTTCTCC0.050300.010700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2800-2822AGGGAGAAAAAGGAAATGTCTTGAGACAUUUCCUUUUUCUCCCUGGAGAAAAAGGAAAUGUCUUGU14.814.822


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719GGUGAUCUGCUUUUAUCUA96.773737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342737GGTGATCTGCTTTTATCTATAGATAAAAGCAGATCACC0.046200.002800.681001.000001.000001.00000


Target Position: 3601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3601UUAUAAAUAGACUUAUUUU81.3065840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503619TTATAAATAGACTTATTTTAAAATAAGTCTATTTATAA0.301600.145800.534500.500001.000001.00000


Target Position: 4368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4368ACGACCUUCUCUAAGAUGA77.67011224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9504386ACGACCTTCTCTAAGATGATCATCTTAGAGAAGGTCGT0.062900.005900.551700.500000.951100.62500


Target Position: 2834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834UCCCCUGCCCUCCUUUCUC47.44824604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662852TCCCCTGCCCTCCTTTCTCGAGAAAGGAGGGCAGGGGA0.321800.013500.560300.500001.000001.00000


Target Position: 4800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4800CUGGCCACUGCAUUCAAAU75.45971521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6354818CTGGCCACTGCATTCAAATATTTGAATGCAGTGGCCAG0.157200.011700.775900.750001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008GAAAACUGGAUAACGUCAU78.24471145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581026GAAAACTGGATAACGTCATATGACGTTATCCAGTTTTC0.237600.050700.517200.750000.983700.62500


Target Position: 2798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798AGAGGGAGAAAAAGGAAAU78.20091154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6852816AGAGGGAGAAAAAGGAAATATTTCCTTTTTCTCCCTCT0.080200.068700.715500.750001.000001.00000


Target Position: 2262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262GCAUUCGGAAAGUAUUGUC69.62642333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922280GCATTCGGAAAGTATTGTCGACAATACTTTCCGAATGC0.176000.027900.534500.750001.000001.00000


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335GGGGACGUUGCAGCUCUCA77.01481300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351353GGGGACGTTGCAGCTCTCATGAGAGCTGCAACGTCCCC0.048000.005500.767200.750001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577GCAUUCUGCCACCCCUCAC66.03712771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052595GCATTCTGCCACCCCTCACGTGAGGGGTGGCAGAATGC0.685400.090500.560300.750000.978300.62500


Target Position: 4569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4569UCUCUGGAGCAGAUAUUGU70.96082144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9594587TCTCTGGAGCAGATATTGTACAATATCTGCTCCAGAGA0.236500.002400.517200.500000.918500.75000


Target Position: 3467, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467CCUUCAGGCUGGUAAUUUA98.882415

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2346719CCTTCAGGCTGGTAATTTA1/1/0/0100.00STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40466806..40466824(-)00STAT3(0.002)


Target Position: 3847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3847UCCCUCAUCCUGUUUGUUU65.14192892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663865TCCCTCATCCTGTTTGTTTAAACAAACAGGATGAGGGA0.115900.041600.870700.750001.000001.00000


Target Position: 3543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3543GGCCUUUGGUGUUGAAAUA91.9688150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7983561GGCCTTTGGTGTTGAAATATATTTCAACACCAAAGGCC0.128100.005500.956901.000001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685UGUAAACUUUUUUACCAAG68.20012511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601703TGTAAACTTTTTTACCAAGCTTGGTAAAAAAGTTTACA0.181800.132300.569000.500000.923900.62500


Target Position: 4391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4391GGUUCGCCCCAGUCCUCCU76.57631370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9904409GGTTCGCCCCAGTCCTCCTAGGAGGACTGGGGCGAACC0.076500.002100.508600.750000.978300.75000


Target Position: 2804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2804AGAAAAAGGAAAUGUCUUG69.77052311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112822AGAAAAAGGAAATGTCTTGCAAGACATTTCCTTTTTCT0.199800.004500.577600.500001.000001.00000


Target Position: 4012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4012CACUUGUAAUGGCGUCUUC72.49381933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574030CACTTGTAATGGCGTCTTCGAAGACGCCATTACAAGTG0.031900.004500.620700.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979GCCCGCCCAACAUCUGCCU59.81023581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886997GCCCGCCCAACATCTGCCTAGGCAGATGTTGGGCGGGC0.042600.003600.655200.750001.000001.00000


Target Position: 3427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3427UUCAGUUAACAGCCUCCUU65.52752843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773445TTCAGTTAACAGCCTCCTTAAGGAGGCTGTTAACTGAA0.165600.118100.534500.500001.000001.00000


Target Position: 102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
102GGCUUGGCGCUGUCUCUCC65.19962883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853120GGCTTGGCGCTGTCTCTCCGGAGAGACAGCGCCAAGCC0.208100.005900.629300.500000.945700.62500


Target Position: 4464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4464UCAGUACAUAAUAAGCUUA84.5227560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2964482TCAGTACATAATAAGCTTATAAGCTTATTATGTACTGA0.603200.072800.689700.750001.000001.00000


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594ACACAGCCAAACCCCAGAU70.23252246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372612ACACAGCCAAACCCCAGATATCTGGGGTTTGGCTGTGT0.264600.222300.525900.750001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153UGUUUAGAAACUUAAUGAA86.4677410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771171TGTTTAGAAACTTAATGAATTCATTAAGTTTCTAAACA0.166800.136000.534500.750001.000001.00000


Target Position: 4662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662CCUGUUGUGGCCCAUUAAA82.8447699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6344680CCTGTTGTGGCCCATTAAATTTAATGGGCCACAACAGG0.279600.011700.844801.000001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776AGAUCUGAAUGGAAACAAC80.2761938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907794AGATCTGAATGGAAACAACGTTGTTTCCATTCAGATCT0.039200.003500.577600.500001.000001.00000


Target Position: 3769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3769GGCUUCCUUCCUGCCCCAC54.23854139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4413787GGCTTCCTTCCTGCCCCACGTGGGGCAGGAAGGAAGCC0.257500.065100.706900.750000.902200.62500


Target Position: 2791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791GGUGGCUAGAGGGAGAAAA83.9329590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442809GGTGGCTAGAGGGAGAAAATTTTCTCCCTCTAGCCACC0.257700.004500.853401.000001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GGAUCUAGAACAGAAAAUG79.37461026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238704GGATCTAGAACAGAAAATGCATTTTCTGTTCTAGATCC0.496500.141900.715500.750001.000001.00000


Target Position: 4614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4614AUCUGGUCUUAACUCUGAU80.0028963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9364632ATCTGGTCTTAACTCTGATATCAGAGTTAAGACCAGAT0.066200.002700.500000.500001.000001.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154GUUUAGAAACUUAAUGAAA92.5596131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551172GTTTAGAAACTTAATGAAATTTCATTAAGTTTCTAAAC0.219100.125900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1152-1174CTGTTTAGAAACTTAATGAAAAGUUUCAUUAAGUUUCUAAACAGGUUUAGAAACUUAAUGAAAAGU8.97.122


Target Position: 3693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3693CUGGACUUGAUCUGCUGUU71.68912049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5743711CTGGACTTGATCTGCTGTTAACAGCAGATCAAGTCCAG0.113800.037200.637900.750001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812GAAAUGUCUUGUGUUGUUU82.1722754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392830GAAATGTCTTGTGTTGTTTAAACAACACAAGACATTTC0.176900.060500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2810-2832AGGAAATGTCTTGTGTTGTTTTGAAACAACACAAGACAUUUCCUGAAAUGUCUUGUGUUGUUUUGU19.314.822


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066GGGCAAAAAACACUGUAUC72.32921963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5163084GGGCAAAAAACACTGTATCGATACAGTGTTTTTTGCCC0.383600.074700.810300.750001.000001.00000


Target Position: 3908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3908AGAGUUACAGGUUGGACAU80.6092900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793926AGAGTTACAGGTTGGACATATGTCCAACCTGTAACTCT0.042800.036800.569000.750001.000001.00000


Target Position: 3428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428UCAGUUAACAGCCUCCUUG60.6253478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453446TCAGTTAACAGCCTCCTTGCAAGGAGGCTGTTAACTGA0.096400.064000.577600.500001.000001.00000


Target Position: 3472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472AGGCUGGUAAUUUAUAUAA88.3885302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973490AGGCTGGTAATTTATATAATTATATAAATTACCAGCCT0.564900.043800.810300.750001.000001.00000


Target Position: 3611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3611ACUUAUUUUCCUUUGUAAU78.11521169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043629ACTTATTTTCCTTTGTAATATTACAAAGGAAAATAAGT0.257600.104400.698300.750001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503UGAGAAGCCAAUGGAGAUU67.28622619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392521TGAGAAGCCAATGGAGATTAATCTCCATTGGCTTCTCA0.239600.035600.715500.750001.000001.00000


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038UGCUAAGAUUCAGUGAAAG67.26842623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442056TGCTAAGATTCAGTGAAAGCTTTCACTGAATCTTAGCA0.034100.006200.715500.500001.000001.00000


Target Position: 3749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3749GCUGGGAUACUUCUGAUUC72.64861914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073767GCTGGGATACTTCTGATTCGAATCAGAAGTATCCCAGC0.278600.003100.681000.750001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590UAGACUUUUUUUUAUAAAU78.01821182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593608TAGACTTTTTTTTATAAATATTTATAAAAAAAAGTCTA0.165900.029300.663800.500001.000001.00000


Target Position: 2616, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616CUGAAACUACUAACUUUGU75.42911528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812634CTGAAACTACTAACTTTGTACAAAGTTAGTAGTTTCAG0.028700.014100.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2614-2636ATCTGAAACTACTAACTTTGTGGACAAAGUUAGUAGUUUCAGAUCUGAAACUACUAACUUUGUGGU10.319.223


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856GGCUAAAUUUUGCAAAGAA98.283718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851874GGCTAAATTTTGCAAAGAATTCTTTGCAAAATTTAGCC0.147000.067300.827601.000000.989100.75000


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454CCUGAGGGAGCAGAGAUGU69.17882391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6531472CCTGAGGGAGCAGAGATGTACATCTCTGCTCCCTCAGG0.089800.013200.637900.750000.956500.62500


Target Position: 3609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3609AGACUUAUUUUCCUUUGUA91.834155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723627AGACTTATTTTCCTTTGTATACAAAGGAAAATAAGTCT0.242300.105000.543100.750001.000001.00000


Target Position: 3760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760UCUGAUUCUGGCUUCCUUC59.9313572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883778TCTGATTCTGGCTTCCTTCGAAGGAAGCCAGAATCAGA0.028200.002400.551700.500001.000001.00000


Target Position: 4046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046GGCAAAGGCUUACUGAUAA95.430459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5694064GGCAAAGGCTTACTGATAATTATCAGTAAGCCTTTGCC0.114900.017900.965501.000000.983700.62500


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604GGUGAUCUCCAACAUCUGU83.5744624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741622GGTGATCTCCAACATCTGTACAGATGTTGGAGATCACC0.224400.020100.646600.750000.972800.75000


Target Position: 4626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4626CUCUGAUUGUAGCAAAAGU81.7104804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8634644CTCTGATTGTAGCAAAAGTACTTTTGCTACAATCAGAG0.060100.036900.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4624-4646AACTCTGATTGTAGCAAAAGTTCACUUUUGCUACAAUCAGAGUUCUCUGAUUGUAGCAAAAGUUCU18.620.413


Target Position: 4045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045GGGCAAAGGCUUACUGAUA93.974296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8274063GGGCAAAGGCTTACTGATATATCAGTAAGCCTTTGCCC0.049400.005600.948301.000000.983700.75000


Target Position: 3671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3671ACAACCUUGACUCCCUUUC51.26874378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843689ACAACCTTGACTCCCTTTCGAAAGGGAGTCAAGGTTGT0.084700.026800.534500.500001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169GCUGAAAUCAUCAUGGGCU78.79271093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202187GCTGAAATCATCATGGGCTAGCCCATGATGATTTCAGC0.257600.037200.500000.750000.983700.75000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673GGAAGAGAGUGCAGGAUCU90.2194220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769691GGAAGAGAGTGCAGGATCTAGATCCTGCACTCTCTTCC0.059500.011400.646600.750001.000001.00000


Target Position: 3394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3394UCUGUCUCAAAAAAAAAAA71.69232047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5143412TCTGTCTCAAAAAAAAAAATTTTTTTTTTTGAGACAGA0.995800.086200.724100.750001.000001.00000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362CGACCUGCAGCAAUACCAU86.5179407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272380CGACCTGCAGCAATACCATATGGTATTGCTGCAGGTCG0.126300.051400.637901.000001.000001.00000


Target Position: 3624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3624UGUAAUGUAUUGGCCUUUU69.37462363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403642TGTAATGTATTGGCCTTTTAAAAGGCCAATACATTACA0.066500.018200.706900.750001.000001.00000


Target Position: 3782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3782CCCCACCCUCCCGACCCCA58.07363748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5353800CCCCACCCTCCCGACCCCATGGGGTCGGGAGGGTGGGG0.123600.112400.646600.750001.000001.00000


Target Position: 4910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4910UACUUUAACUUCCAGAAAU77.62541232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604928TACTTTAACTTCCAGAAATATTTCTGGAAGTTAAAGTA0.031600.018800.672400.500001.000001.00000


Target Position: 3400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400UCAAAAAAAAAAAAAAAAA74.83931604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1803418TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.983700.969500.724100.750001.000001.00000


Target Position: 3610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610GACUUAUUUUCCUUUGUAA100.3379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3333628GACTTATTTTCCTTTGTAATTACAAAGGAAAATAAGTC0.251700.113600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3608-3630TAGACTTATTTTCCTTTGTAATGUUACAAAGGAAAAUAAGUCUAGACUUAUUUUCCUUUGUAAUGU11.84.622


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337ACCAAGUUUAUCUGUGUGA74.06931710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102355ACCAAGTTTATCTGTGTGATCACACAGATAAACTTGGT0.042400.019900.629300.500001.000001.00000


Target Position: 2613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613CAUCUGAAACUACUAACUU87.4229364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2611-2633ATCATCTGAAACTACTAACTTTGAAGUUAGUAGUUUCAGAUGAUCAUCUGAAACUACUAACUUUGU17.620.432


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GAAGAGAGUGCAGGAUCUA93.1333115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999692GAAGAGAGTGCAGGATCTATAGATCCTGCACTCTCTTC0.231300.014300.500000.750001.000001.00000


Target Position: 4719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4719GCCCCCUCCCCAUCCCCAG50.08864459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2544737GCCCCCTCCCCATCCCCAGCTGGGGATGGGGAGGGGGC0.282500.124700.715500.750001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043UCAGACCCGUCAACAAAUU66.39782736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601061TCAGACCCGTCAACAAATTAATTTGTTGACGGGTCTGA0.828800.062400.715500.750001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214ACAGGAUGGCCCAAUGGAA85.0789509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801232ACAGGATGGCCCAATGGAATTCCATTGGGCCATCCTGT0.237000.011600.534500.750000.967400.75000


Target Position: 2968, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968CUGGCAUUGCACUUUUUAA91.129183

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8296819CTGGCATTGCACTTTTTAA1/1/0/097.75STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40467305..40467323(-)00STAT3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842986CTGGCATTGCACTTTTTAATTAAAAAGTGCAATGCCAG0.855800.009600.750000.750001.000001.00000


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851UCAGCAGCUUUUUGUUAUU72.75821893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952869TCAGCAGCTTTTTGTTATTAATAACAAAAAGCTGCTGA0.656900.002000.715500.750001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028AGCAGAAUCUCAACUUCAG76.80221331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251046AGCAGAATCTCAACTTCAGCTGAAGTTGAGATTCTGCT0.136200.024500.569000.500001.000001.00000


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482CCUUUGACAUGGAGUUGAC75.55791505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952500CCTTTGACATGGAGTTGACGTCAACTCCATGTCAAAGG0.041000.009000.525900.750001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GCGCUGCCCCAUACCUGAA83.8612592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782335GCGCTGCCCCATACCTGAATTCAGGTATGGGGCAGCGC0.085500.003700.750001.000001.000001.00000


Target Position: 1002, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002CGGCUAGAAAACUGGAUAA92.8212125

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6100219CGGCTAGAAAACTGGATAA1/1/0/097.75STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40486063,40489453..40486067,40489466(-)00STAT3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611020CGGCTAGAAAACTGGATAATTATCCAGTTTTCTAGCCG0.120400.004100.879301.000001.000001.00000


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282UACAGUGACAGCUUCCCAA82.7333705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989300TACAGTGACAGCTTCCCAATTGGGAAGCTGTCACTGTA0.037300.005300.534500.500001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021CGUCAUUAGCAGAAUCUCA96.345144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321039CGTCATTAGCAGAATCTCATGAGATTCTGCTAATGACG0.178600.089200.551700.750001.000001.00000


Target Position: 4902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4902GCUGUAUCUACUUUAACUU85.6876466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2244920GCTGTATCTACTTTAACTTAAGTTAAAGTAGATACAGC0.384300.074400.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4900-4922TTGCTGTATCTACTTTAACTTCCAAGUUAAAGUAGAUACAGCAAGCUGUAUCUACUUUAACUUCCU4.920.333


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966GGUACAUCAUGGGCUUUAU89.2366251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381984GGTACATCATGGGCTTTATATAAAGCCCATGATGTACC0.035100.010700.810301.000001.000001.00000


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827UCUCCUUGCGUGUCUAAAG63.86073057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583845TCTCCTTGCGTGTCTAAAGCTTTAGACACGCAAGGAGA0.051700.002400.586200.500001.000001.00000


Target Position: 4860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4860AGGUUUUUUGUCUUUUUUU74.75341614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5254878AGGTTTTTTGTCTTTTTTTAAAAAAAGACAAAAAACCT0.796900.272300.844800.750001.000001.00000


Target Position: 4449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4449CUCCAGCAACACUCUUCAG71.84892030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9744467CTCCAGCAACACTCTTCAGCTGAAGAGTGTTGCTGGAG0.090800.040800.525900.500001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908UGGCUGGACAAUAUCAUUG63.57853093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821926TGGCTGGACAATATCATTGCAATGATATTGTCCAGCCA0.105800.005800.698300.500001.000001.00000


Target Position: 2257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257AGGAGGCAUUCGGAAAGUA84.5402557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172275AGGAGGCATTCGGAAAGTATACTTTCCGAATGCCTCCT0.318000.012800.663800.750001.000001.00000


Target Position: 3481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3481AUUUAUAUAAUCCCUGAAA81.9947769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993499ATTTATATAATCCCTGAAATTTCAGGGATTATATAAAT0.175200.112800.508600.500001.000001.00000


Target Position: 2479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479UCACCUUUGACAUGGAGUU67.46712601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562497TCACCTTTGACATGGAGTTAACTCCATGTCAAAGGTGA0.032700.011000.577600.750000.972800.62500


Target Position: 3477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477GGUAAUUUAUAUAAUCCCU88.5929293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103495GGTAATTTATATAATCCCTAGGGATTATATAAATTACC0.164800.111700.508600.750001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151GCUGUUUAGAAACUUAAUG69.53222342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551169GCTGTTTAGAAACTTAATGCATTAAGTTTCTAAACAGC0.164800.031300.698300.750001.000001.00000


Target Position: 2540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540CGGAAGCUGCAGAAAGAUA92.9568120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792558CGGAAGCTGCAGAAAGATATATCTTTCTGCAGCTTCCG0.223200.005900.870701.000001.000001.00000


Target Position: 3553, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3553GUUGAAAUAGGAAGGUUUA89.0625261

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3551-3573GTGTTGAAATAGGAAGGTTTAAGUAAACCUUCCUAUUUCAACACGUUGAAAUAGGAAGGUUUAAGU17.37.422


Target Position: 4021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4021UGGCGUCUUCAUUCAGUUC63.89633052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9164039TGGCGTCTTCATTCAGTTCGAACTGAATGAAGACGCCA0.165600.015700.672400.500001.000001.00000


Target Position: 4015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4015UUGUAAUGGCGUCUUCAUU69.89432300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8634033TTGTAATGGCGTCTTCATTAATGAAGACGCCATTACAA0.387100.003900.637900.500001.000001.00000


Target Position: 4796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4796UGUCCUGGCCACUGCAUUC64.29832986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8414814TGTCCTGGCCACTGCATTCGAATGCAGTGGCCAGGACA0.047400.011400.534500.500001.000001.00000


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126CGUGGAACCAUACACAAAG76.55571373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782144CGTGGAACCATACACAAAGCTTTGTGTATGGTTCCACG0.374100.031400.637900.750000.929300.62500


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460ACAAUCUACGAAGAAUCAA78.47461123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713478ACAATCTACGAAGAATCAATTGATTCTTCGTAGATTGT0.120100.052100.560300.750000.994601.00000


Target Position: 4917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4917ACUUCCAGAAAUAAACGUU73.45521792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7084935ACTTCCAGAAATAAACGTTAACGTTTATTTCTGGAAGT0.660000.015600.560300.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001UCGGCUAGAAAACUGGAUA75.60631496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811019TCGGCTAGAAAACTGGATATATCCAGTTTTCTAGCCGA0.128400.003600.750000.750001.000001.00000


Target Position: 1289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289GUUGAAUUAUCAGCUUAAA89.7846234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001307GTTGAATTATCAGCTTAAATTTAAGCTGATAATTCAAC0.053700.009500.646600.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1287-1309GAGTTGAATTATCAGCTTAAAATUUUAAGCUGAUAAUUCAACUCGUUGAAUUAUCAGCUUAAAAUU18.37.422


Target Position: 3784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3784CCACCCUCCCGACCCCAGU58.41333719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6153802CCACCCTCCCGACCCCAGTACTGGGGTCGGGAGGGTGG0.100900.083500.637900.750000.945700.62500


Target Position: 4832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4832UCAUAGUGUAAAAAUUUAU77.60571236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8824850TCATAGTGTAAAAATTTATATAAATTTTTACACTATGA0.217200.003600.681000.750001.000001.00000


Target Position: 4834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4834AUAGUGUAAAAAUUUAUAU79.15041054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9814852ATAGTGTAAAAATTTATATATATAAATTTTTACACTAT0.194200.002100.500000.500001.000001.00000


Target Position: 4922, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4922CAGAAAUAAACGUUAUAUA97.784124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5494940CAGAAATAAACGTTATATATATATAACGTTTATTTCTG0.596800.099900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4920-4942TCCAGAAATAAACGTTATATAGGUAUAUAACGUUUAUUUCUGGACAGAAAUAAACGUUAUAUAGGU1.16.923


Target Position: 2420, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2420GCAGUUUGGAAAUAAUGGU75.4621520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422438GCAGTTTGGAAATAATGGTACCATTATTTCCAAACTGC0.124200.024000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2418-2440ATGCAGTTTGGAAATAATGGTGAACCAUUAUUUCCAAACUGCAUGCAGUUUGGAAAUAAUGGUGAU12.616.733


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GACUGAGGAGCUGCACCUG73.06071846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851532GACTGAGGAGCTGCACCTGCAGGTGCAGCTCCTCAGTC0.042000.002100.534500.500000.940200.62500


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149GAGCUGUUUAGAAACUUAA94.514180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841167GAGCTGTTTAGAAACTTAATTAAGTTTCTAAACAGCTC0.458600.005800.775900.750001.000001.00000


Target Position: 466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466UACGAAGAAUCAAGCAGUU74.85091601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
775484TACGAAGAATCAAGCAGTTAACTGCTTGATTCTTCGTA0.057800.014400.534500.500001.000001.00000


Target Position: 1005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CUAGAAAACUGGAUAACGU81.5688817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1003-1025GGCTAGAAAACTGGATAACGTCAACGUUAUCCAGUUUUCUAGCCCUAGAAAACUGGAUAACGUCAU16.57.122


Target Position: 2856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856AGCUUUUUGUUAUUGUUGU71.89532022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512874AGCTTTTTGTTATTGTTGTACAACAATAACAAAAAGCT0.063300.022800.646600.500001.000001.00000


Target Position: 2697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697AAUAGAGAAAUGAGUGAAU82.254746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642715AATAGAGAAATGAGTGAATATTCACTCATTTCTCTATT0.045500.022000.500000.500001.000001.00000


Target Position: 2965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2965CUCCUGGCAUUGCACUUUU74.2021688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162983CTCCTGGCATTGCACTTTTAAAAGTGCAATGCCAGGAG0.513600.005100.810300.750001.000001.00000


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976GGGCUUUAUCAGUAAGGAG80.6739896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421994GGGCTTTATCAGTAAGGAGCTCCTTACTGATAAAGCCC0.069500.004600.681000.750001.000001.00000


Target Position: 2658, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658CUACUUCUGCUAUCUUUGA83.6705613

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2656-2678TCCTACTTCTGCTATCTTTGAGCUCAAAGAUAGCAGAAGUAGGACUACUUCUGCUAUCUUUGAGCU12.018.923


Target Position: 4567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4567CUUCUCUGGAGCAGAUAUU75.46411519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9824585CTTCTCTGGAGCAGATATTAATATCTGCTCCAGAGAAG0.040900.002100.629300.750000.918501.00000


Target Position: 4663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4663CUGUUGUGGCCCAUUAAAG70.01142282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7714681CTGTTGTGGCCCATTAAAGCTTTAATGGGCCACAACAG0.252400.010900.646600.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672CGGAAGAGAGUGCAGGAUC70.86612164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797690CGGAAGAGAGTGCAGGATCGATCCTGCACTCTCTTCCG0.054100.008900.732800.750001.000001.00000


Target Position: 1843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843GUCAGAUCACAUGGGCUAA87.0317384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341861GTCAGATCACATGGGCTAATTAGCCCATGTGATCTGAC0.057800.004700.784500.750001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760GUCAAGGAGACAUGCAAGA78.20031155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914778GTCAAGGAGACATGCAAGATCTTGCATGTCTCCTTGAC0.423800.043800.594800.500000.945700.62500


Target Position: 2259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2259GAGGCAUUCGGAAAGUAUU85.465478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2122277GAGGCATTCGGAAAGTATTAATACTTTCCGAATGCCTC0.421000.078400.801700.750001.000001.00000


Target Position: 2636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GUUCCAGAUUUUUUUUAAU85.0483512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612654GTTCCAGATTTTTTTTAATATTAAAAAAAATCTGGAAC0.337600.006700.637900.750001.000001.00000


Target Position: 4003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4003AUCCAGUGGCACUUGUAAU76.52661376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9774021ATCCAGTGGCACTTGTAATATTACAAGTGCCACTGGAT0.029100.007600.672400.500001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457AGCACAAUCUACGAAGAAU84.8601532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627475AGCACAATCTACGAAGAATATTCTTCGTAGATTGTGCT0.096900.052700.844800.750000.983700.62500


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675GAGCAAUCUGGGCACUUUU84.3283571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122693GAGCAATCTGGGCACTTTTAAAAGTGCCCAGATTGCTC0.051600.005400.810300.750001.000001.00000


Target Position: 2161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161UGUCAUUUGCUGAAAUCAU79.11621057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482179TGTCATTTGCTGAAATCATATGATTTCAGCAAATGACA0.068100.007000.551700.750000.989100.75000


Target Position: 4697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4697CCCUGCCCGCUUCCUGUCC45.2084704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924715CCCTGCCCGCTTCCTGTCCGGACAGGAAGCGGGCAGGG0.497700.044500.620700.500001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241AGCAGCUUGACACACGGUA76.43791388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681259AGCAGCTTGACACACGGTATACCGTGTGTCAAGCTGCT0.120800.009800.672400.750001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301GCUUAAAAUUAAAGUGUGC69.66472324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211319GCTTAAAATTAAAGTGTGCGCACACTTTAATTTTAAGC0.186200.032400.500000.500001.000001.00000


Target Position: 4723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4723CCUCCCCAUCCCCAGCCCA65.87822790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9744741CCTCCCCATCCCCAGCCCATGGGCTGGGGATGGGGAGG0.202300.040400.500000.750001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665CUGACCAACAAUCCCAAGA72.34681959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901683CTGACCAACAATCCCAAGATCTTGGGATTGTTGGTCAG0.458300.075400.560300.500001.000001.00000


Target Position: 4700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4700UGCCCGCUUCCUGUCCACU59.2633634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394718TGCCCGCTTCCTGTCCACTAGTGGACAGGAAGCGGGCA0.546300.165300.646600.500001.000001.00000


Target Position: 3396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3396UGUCUCAAAAAAAAAAAAA75.91011451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3083414TGTCTCAAAAAAAAAAAAATTTTTTTTTTTTTGAGACA0.995600.120200.706900.750001.000001.00000


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951CCUAUAGCUACAUACUCCU80.6681897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412969CCTATAGCTACATACTCCTAGGAGTATGTAGCTATAGG0.126700.047600.500000.750001.000001.00000


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044UUAAGAAAUAAUAACAAUU74.12471699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8223062TTAAGAAATAATAACAATTAATTGTTATTATTTCTTAA0.788900.190800.525900.500001.000001.00000


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216AAACCCCGUCUCUACUAAA86.4854409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9153234AAACCCCGTCTCTACTAAATTTAGTAGAGACGGGGTTT0.341600.038300.500000.500001.000001.00000


Target Position: 1910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910GCUGGACAAUAUCAUUGAC80.3091933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201928GCTGGACAATATCATTGACGTCAATGATATTGTCCAGC0.083400.012700.534500.750001.000001.00000


Target Position: 4864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4864UUUUUGUCUUUUUUUUUUU62.27493260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9594882TTTTTGTCTTTTTTTTTTTAAAAAAAAAAAGACAAAAA0.980100.715400.500000.500001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570CCUACCUGCAUUCUGCCAC59.21183644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302588CCTACCTGCATTCTGCCACGTGGCAGAATGCAGGTAGG0.123400.045800.551700.750000.945700.87500


Target Position: 3752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3752GGGAUACUUCUGAUUCUGG74.64021624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393770GGGATACTTCTGATTCTGGCCAGAATCAGAAGTATCCC0.085700.007300.646600.500001.000001.00000


Target Position: 3692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3692CCUGGACUUGAUCUGCUGU76.48031383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5033710CCTGGACTTGATCTGCTGTACAGCAGATCAAGTCCAGG0.138000.045300.637900.750001.000001.00000


Target Position: 3834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3834GCGUGUCUAAAGGUCCCUC65.86182791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923852GCGTGTCTAAAGGTCCCTCGAGGGACCTTTAGACACGC0.136700.036300.612100.750001.000001.00000


Target Position: 1927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927ACCUUGUGAAAAAGUACAU73.62511770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571945ACCTTGTGAAAAAGTACATATGTACTTTTTCACAAGGT0.164700.037800.698300.750001.000001.00000


Target Position: 3901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3901GGGGGAGAGAGUUACAGGU79.1981046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4873919GGGGGAGAGAGTTACAGGTACCTGTAACTCTCTCCCCC0.464600.270500.637900.750001.000001.00000


Target Position: 2797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2797UAGAGGGAGAAAAAGGAAA76.48581380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782815TAGAGGGAGAAAAAGGAAATTTCCTTTTTCTCCCTCTA0.114200.067700.672400.500001.000001.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412UCAUUGAUGCAGUUUGGAA85.1437507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7292430TCATTGATGCAGTTTGGAATTCCAAACTGCATCAATGA0.148600.031300.551700.750001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831UGUUCCCCUGCCCUCCUUU60.77353457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462849TGTTCCCCTGCCCTCCTTTAAAGGAGGGCAGGGGAACA0.875700.270300.706900.750001.000001.00000


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383GGUGUUUCAUAAUCUCCUG79.42591021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964401GGTGTTTCATAATCTCCTGCAGGAGATTATGAAACACC0.031100.002500.569000.750001.000001.00000


Target Position: 2922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922CUGUUUCUGUAAGCAAAUG67.09292649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392940CTGTTTCTGTAAGCAAATGCATTTGCTTACAGAAACAG0.035000.006600.629300.500001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434GCAAGAGUCGAAUGUUCUC74.54641640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814452GCAAGAGTCGAATGTTCTCGAGAACATTCGACTCTTGC0.072800.005100.543100.750000.978300.62500


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145CAGCAGCUGAACAACAUGU79.6377998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9992163CAGCAGCTGAACAACATGTACATGTTGTTCAGCTGCTG0.074300.002000.577600.500001.000001.00000


Target Position: 2816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816UGUCUUGUGUUGUUUUGUU76.7951333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942834TGTCTTGTGTTGTTTTGTTAACAAAACAACACAAGACA0.196300.096100.560300.750001.000001.00000


Target Position: 4695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4695GGCCCUGCCCGCUUCCUGU70.64372195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4754713GGCCCTGCCCGCTTCCTGTACAGGAAGCGGGCAGGGCC0.269200.028300.793100.750000.929300.62500


Target Position: 3585, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585CAUUUUAGACUUUUUUUUA93.6628104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373603CATTTTAGACTTTTTTTTATAAAAAAAAGTCTAAAATG0.094700.025200.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3583-3605AGCATTTTAGACTTTTTTTTATAUAAAAAAAAGUCUAAAAUGCUCAUUUUAGACUUUUUUUUAUAU-11.3-4.321


Target Position: 2970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2970GGCAUUGCACUUUUUAACC64.34282980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002988GGCATTGCACTTTTTAACCGGTTAAAAAGTGCAATGCC0.610900.112500.646600.500001.000001.00000


Target Position: 4053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4053GCUUACUGAUAAACUUGAG77.50551243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7694071GCTTACTGATAAACTTGAGCTCAAGTTTATCAGTAAGC0.079000.008800.543100.750001.000001.00000


Target Position: 4901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4901UGCUGUAUCUACUUUAACU84.0202586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7014919TGCTGTATCTACTTTAACTAGTTAAAGTAGATACAGCA0.294300.075700.646600.500001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CACAAACACAAAAGUGAUG70.70532184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241400CACAAACACAAAAGTGATGCATCACTTTTGTGTTTGTG0.069400.048400.637900.500000.918500.87500


Target Position: 3095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095UUCUGUAUUUAAGAAACUU71.15162120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7793113TTCTGTATTTAAGAAACTTAAGTTTCTTAAATACAGAA0.122200.039700.534500.500001.000001.00000


Target Position: 4698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4698CCUGCCCGCUUCCUGUCCA73.82881744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9464716CCTGCCCGCTTCCTGTCCATGGACAGGAAGCGGGCAGG0.541200.056400.500000.750001.000001.00000


Target Position: 3800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3800AGUCCCCCUGAUCCUGCUA73.91951729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733818AGTCCCCCTGATCCTGCTATAGCAGGATCAGGGGGACT0.151400.019800.534500.750001.000001.00000


Target Position: 4934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4934UUAUAUAGGAACCGUAAAA78.82221089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614952TTATATAGGAACCGTAAAATTTTACGGTTCCTATATAA0.437200.226200.534500.500001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973CAUGGGCUUUAUCAGUAAG77.26471267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401991CATGGGCTTTATCAGTAAGCTTACTGATAAAGCCCATG0.108100.002700.517200.500001.000001.00000


Target Position: 4369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4369CGACCUUCUCUAAGAUGAA96.757538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7274387CGACCTTCTCTAAGATGAATTCATCTTAGAGAAGGTCG0.070200.007800.620701.000000.951100.62500


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546CUGCAGAAAGAUACGACUG70.03392281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512564CTGCAGAAAGATACGACTGCAGTCGTATCTTTCTGCAG0.128100.003700.500000.500001.000001.00000


Target Position: 3031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031GUUUCUUUUUAAAUUAAGA87.3259368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3029-3051AGGTTTCTTTTTAAATTAAGAAAUCUUAAUUUAAAAAGAAACCUGUUUCUUUUUAAAUUAAGAAAU-4.35.521


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664GGUGCUUACAACCUUGACU81.2176846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253682GGTGCTTACAACCTTGACTAGTCAAGGTTGTAAGCACC0.097300.050500.646600.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145CGUGGAGCUGUUUAGAAAC75.07861573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571163CGTGGAGCTGTTTAGAAACGTTTCTAAACAGCTCCACG0.229800.002400.629300.750001.000001.00000


Target Position: 3359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3359CACACUGCACUCCAUCCUG73.02091854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933377CACACTGCACTCCATCCTGCAGGATGGAGTGCAGTGTG0.045000.008300.508600.500001.000001.00000


Target Position: 2792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792GUGGCUAGAGGGAGAAAAA91.4356175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512810GTGGCTAGAGGGAGAAAAATTTTTCTCCCTCTAGCCAC0.233300.004400.793100.750001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548GCAGAAAGAUACGACUGAG83.1171677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672566GCAGAAAGATACGACTGAGCTCAGTCGTATCTTTCTGC0.044500.022700.543100.750001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919UAUCAUUGACCUUGUGAAA83.7179608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621937TATCATTGACCTTGTGAAATTTCACAAGGTCAATGATA0.138000.022900.543100.500001.000001.00000


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356GGCCAGCAAAGAAUCACAU83.1184676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337374GGCCAGCAAAGAATCACATATGTGATTCTTTGCTGGCC0.281600.043000.844801.000000.983700.75000


Target Position: 4861, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4861GGUUUUUUGUCUUUUUUUU82.3226737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294879GGTTTTTTGTCTTTTTTTTAAAAAAAAGACAAAAAACC0.843800.645100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4859-4881GAGGTTTTTTGTCTTTTTTTTTTAAAAAAAAGACAAAAAACCUCGGUUUUUUGUCUUUUUUUUUUU-11.3-1.811


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058AGCAAAGAAGGAGGCGUCA72.00432006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322076AGCAAAGAAGGAGGCGTCATGACGCCTCCTTCTTTGCT0.088500.007700.629300.500001.000001.00000


Target Position: 1355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1355AGGAUCCCGGAAAUUUAAC56.49363894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811373AGGATCCCGGAAATTTAACGTTAAATTTCCGGGATCCT0.160100.035200.698300.500001.000001.00000


Target Position: 3298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298GGCAGGAGAAUCGCUUGAA86.8013394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813316GGCAGGAGAATCGCTTGAATTCAAGCGATTCTCCTGCC0.042700.003800.827601.000000.983700.62500


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069UGGAGGAGUUGCAGCAAAA87.1236376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3241087TGGAGGAGTTGCAGCAAAATTTTGCTGCAACTCCTCCA0.298700.044200.844800.750001.000001.00000


Target Position: 2976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976GCACUUUUUAACCUUGCUG67.03312663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842994GCACTTTTTAACCTTGCTGCAGCAAGGTTAAAAAGTGC0.148700.111000.569000.750001.000001.00000


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872UGUUGUUGUUCUUAGACAA91.0825186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472890TGTTGTTGTTCTTAGACAATTGTCTAAGAACAACAACA0.057500.004500.560300.750001.000001.00000


Target Position: 4831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4831UUCAUAGUGUAAAAAUUUA80.8241881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8294849TTCATAGTGTAAAAATTTATAAATTTTTACACTATGAA0.383000.004800.637900.500001.000001.00000


Target Position: 2467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467AGUUUGAGUCCCUCACCUU82.2025748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512485AGTTTGAGTCCCTCACCTTAAGGTGAGGGACTCAAACT0.071500.002500.569000.750000.918501.00000


Target Position: 2921, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2921CCUGUUUCUGUAAGCAAAU77.78751209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872939CCTGTTTCTGTAAGCAAATATTTGCTTACAGAAACAGG0.123200.005700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2919-2941TGCCTGTTTCTGTAAGCAAATGCAUUUGCUUACAGAAACAGGCACCUGUUUCUGUAAGCAAAUGCU18.619.222


Target Position: 3600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600UUUAUAAAUAGACUUAUUU71.29732100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353618TTTATAAATAGACTTATTTAAATAAGTCTATTTATAAA0.303500.092400.500000.500001.000001.00000


Target Position: 2813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813AAAUGUCUUGUGUUGUUUU80.8765879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622831AAATGTCTTGTGTTGTTTTAAAACAACACAAGACATTT0.194900.073300.500000.500001.000001.00000


Target Position: 1292, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292GAAUUAUCAGCUUAAAAUU90.4827202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531310GAATTATCAGCTTAAAATTAATTTTAAGCTGATAATTC0.198100.023800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1290-1312TTGAATTATCAGCTTAAAATTAAAAUUUUAAGCUGAUAAUUCAAGAAUUAUCAGCUUAAAAUUAAU-9.71.822


Target Position: 1334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334UGGGGACGUUGCAGCUCUC64.85972922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861352TGGGGACGTTGCAGCTCTCGAGAGCTGCAACGTCCCCA0.042500.002100.534500.500001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800AGUGACCAGGCAGAAGAUG59.04943660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
896818AGTGACCAGGCAGAAGATGCATCTTCTGCCTGGTCACT0.076300.003300.551700.500001.000001.00000


Target Position: 3921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3921GGACAUGAUGCACACUAUG80.583904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933939GGACATGATGCACACTATGCATAGTGTGCATCATGTCC0.078400.011100.715500.750001.000001.00000


Target Position: 3777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3777UCCUGCCCCACCCUCCCGA51.30354377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273795TCCTGCCCCACCCTCCCGATCGGGAGGGTGGGGCAGGA0.328800.075000.577600.500001.000001.00000


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GGAGGAGGCAUUCGGAAAG69.68762322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712273GGAGGAGGCATTCGGAAAGCTTTCCGAATGCCTCCTCC0.258100.006100.732800.750001.000001.00000


Target Position: 2752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2752UGUGUUCUCUGAGACCCAU74.96131585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802770TGTGTTCTCTGAGACCCATATGGGTCTCAGAGAACACA0.035800.002100.551700.750001.000001.00000


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355CGGCCAGCAAAGAAUCACA89.5986240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811373CGGCCAGCAAAGAATCACATGTGATTCTTTGCTGGCCG0.255800.005200.706900.750000.983700.62500


Target Position: 3694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3694UGGACUUGAUCUGCUGUUU70.95722147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7853712TGGACTTGATCTGCTGTTTAAACAGCAGATCAAGTCCA0.055900.034400.844800.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046GACCCGUCAACAAAUUAAG72.18921983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6561064GACCCGTCAACAAATTAAGCTTAATTTGTTGACGGGTC0.532700.309200.681000.500001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677GCAAUCUGGGCACUUUUAA82.3961730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372695GCAATCTGGGCACTTTTAATTAAAAGTGCCCAGATTGC0.178600.018600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2675-2697GAGCAATCTGGGCACTTTTAAAAUUAAAAGUGCCCAGAUUGCUCGCAAUCUGGGCACUUUUAAAAU4.918.122


Target Position: 2720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720GUGAUCUGCUUUUAUCUAA91.607166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422738GTGATCTGCTTTTATCTAATTAGATAAAAGCAGATCAC0.048400.002700.758600.750001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569GCCUACCUGCAUUCUGCCA77.62671231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102587GCCTACCTGCATTCTGCCATGGCAGAATGCAGGTAGGC0.132900.059100.655200.750000.945700.75000


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106GGUAAGACCCAGAUCCAGU84.1405579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8102124GGTAAGACCCAGATCCAGTACTGGATCTGGGTCTTACC0.051800.015400.646600.750000.972800.87500


Target Position: 2316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316GGCGCUGCCCCAUACCUGA81.1308854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602334GGCGCTGCCCCATACCTGATCAGGTATGGGGCAGCGCC0.092500.004100.775900.750000.929300.62500


Target Position: 2990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2990UGCUGACAUCCAAAUAGAA90.3709211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393008TGCTGACATCCAAATAGAATTCTATTTGGATGTCAGCA0.196800.110900.681000.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414AUUGAUGCAGUUUGGAAAU68.79942446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172432ATTGATGCAGTTTGGAAATATTTCCAAACTGCATCAAT0.236100.060700.500000.500001.000001.00000


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586CACCCCUCACACAGCCAAA85.9389452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1132604CACCCCTCACACAGCCAAATTTGGCTGTGTGAGGGGTG0.801700.588400.793100.750000.951100.62500


Target Position: 4856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4856UGUGAGGUUUUUUGUCUUU72.61841919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2864874TGTGAGGTTTTTTGTCTTTAAAGACAAAAAACCTCACA0.749700.061500.706900.750001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GUCUGGCUGGACAAUAUCA89.826232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901923GTCTGGCTGGACAATATCATGATATTGTCCAGCCAGAC0.151000.067900.594800.500000.989100.62500


Target Position: 4908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4908UCUACUUUAACUUCCAGAA78.22791148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9194926TCTACTTTAACTTCCAGAATTCTGGAAGTTAAAGTAGA0.037200.017900.551700.750001.000001.00000


Target Position: 4865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4865UUUUGUCUUUUUUUUUUUU64.75672935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454883TTTTGTCTTTTTTTTTTTTAAAAAAAAAAAAGACAAAA0.982600.748300.500000.500001.000001.00000


Target Position: 3717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3717GGCUAGGUUGUUUCUGUGG64.83172926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8583735GGCTAGGTTGTTTCTGTGGCCACAGAAACAACCTAGCC0.104600.013800.655200.500001.000001.00000


Target Position: 4572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4572CUGGAGCAGAUAUUGUCAA85.8113458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8704590CTGGAGCAGATATTGTCAATTGACAATATCTGCTCCAG0.155600.003800.637900.750001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545GCUGCAGAAAGAUACGACU82.1874751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252563GCTGCAGAAAGATACGACTAGTCGTATCTTTCTGCAGC0.170300.004900.646600.750001.000001.00000


Target Position: 3726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3726GUUUCUGUGGGUGCCUUAU74.18431689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003744GTTTCTGTGGGTGCCTTATATAAGGCACCCACAGAAAC0.110400.020800.603400.750001.000001.00000


Target Position: 1147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147UGGAGCUGUUUAGAAACUU68.98752422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661165TGGAGCTGTTTAGAAACTTAAGTTTCTAAACAGCTCCA0.220500.003900.706900.750001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GGGACGUUGCAGCUCUCAG75.96071446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931354GGGACGTTGCAGCTCTCAGCTGAGAGCTGCAACGTCCC0.041100.009200.706900.750001.000001.00000


Target Position: 4044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4044AGGGCAAAGGCUUACUGAU79.9398971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8604062AGGGCAAAGGCTTACTGATATCAGTAAGCCTTTGCCCT0.045200.006700.663800.750000.983700.87500


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337GGACGUUGCAGCUCUCAGA92.9362121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611355GGACGTTGCAGCTCTCAGATCTGAGAGCTGCAACGTCC0.045200.012900.646600.750001.000001.00000


Target Position: 4318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4318GGAAUUCUGUUUGUUAAAU83.206663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9314336GGAATTCTGTTTGTTAAATATTTAACAAACAGAATTCC0.040800.002800.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4316-4338GTGGAATTCTGTTTGTTAAATCAAUUUAACAAACAGAAUUCCACGGAAUUCUGUUUGUUAAAUCAU7.214.822


Target Position: 4870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4870UCUUUUUUUUUUUUUUUUU63.34463124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3254888TCTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAGA0.977500.837600.724100.750001.000001.00000


Target Position: 3392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392ACUCUGUCUCAAAAAAAAA85.9541451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3553410ACTCTGTCTCAAAAAAAAATTTTTTTTTGAGACAGAGT0.985800.050100.706900.750001.000001.00000


Target Position: 3470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3470UCAGGCUGGUAAUUUAUAU77.09941292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513488TCAGGCTGGTAATTTATATATATAAATTACCAGCCTGA0.615600.006900.681000.750001.000001.00000


Target Position: 4317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4317UGGAAUUCUGUUUGUUAAA78.63161109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9484335TGGAATTCTGTTTGTTAAATTTAACAAACAGAATTCCA0.035700.002600.844800.750001.000001.00000


Target Position: 2393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2393GUCCCCCCGCACUUUAGAU72.62431915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4952411GTCCCCCCGCACTTTAGATATCTAAAGTGCGGGGGGAC0.248300.227300.637900.750000.967400.62500


Target Position: 4609, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4609CAUGUAUCUGGUCUUAACU83.5308633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4607-4629AGCATGTATCTGGTCTTAACTCTAGUUAAGACCAGAUACAUGCUCAUGUAUCUGGUCUUAACUCUU14.616.032


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GAUCCCGGAAAUUUAACAU80.5735905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411375GATCCCGGAAATTTAACATATGTTAAATTTCCGGGATC0.144700.033900.525900.750001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493UUGUGAUGCUUCCCUGAUU72.26041971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411511TTGTGATGCTTCCCTGATTAATCAGGGAAGCATCACAA0.073600.006900.637900.500001.000001.00000


Target Position: 3801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801GUCCCCCUGAUCCUGCUAG58.68253698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693819GTCCCCCTGATCCTGCTAGCTAGCAGGATCAGGGGGAC0.112700.063000.646600.500001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667GACCAACAAUCCCAAGAAU88.4874297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061685GACCAACAATCCCAAGAATATTCTTGGGATTGTTGGTC0.432200.080800.810300.750001.000001.00000


Target Position: 3725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725UGUUUCUGUGGGUGCCUUA78.15661158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5623743TGTTTCTGTGGGTGCCTTATAAGGCACCCACAGAAACA0.116400.018600.672400.750001.000001.00000


Target Position: 3748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3748GGCUGGGAUACUUCUGAUU82.7314706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883766GGCTGGGATACTTCTGATTAATCAGAAGTATCCCAGCC0.193200.003500.991401.000001.000001.00000


Target Position: 3750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3750CUGGGAUACUUCUGAUUCU84.5117561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573768CTGGGATACTTCTGATTCTAGAATCAGAAGTATCCCAG0.286800.004300.560300.500001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897GCGAUGGAGUACGUGCAGA82.9652689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
784915GCGATGGAGTACGTGCAGATCTGCACGTACTCCATCGC0.056100.016300.698300.750001.000001.00000


Target Position: 4576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4576AGCAGAUAUUGUCAAGUUC73.29321818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6964594AGCAGATATTGTCAAGTTCGAACTTGACAATATCTGCT0.077000.055800.681000.500001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852CAUGGGCUAAAUUUUGCAA86.5488405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001870CATGGGCTAAATTTTGCAATTGCAAAATTTAGCCCATG0.126100.010100.508600.750000.989100.75000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043AUUAAGAAAUAAUAACAAU83.8049596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763061ATTAAGAAATAATAACAATATTGTTATTATTTCTTAAT0.802700.183000.500000.500001.000001.00000


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029GCAGAAUCUCAACUUCAGA91.1255184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381047GCAGAATCTCAACTTCAGATCTGAAGTTGAGATTCTGC0.125800.022200.629300.750000.994600.62500


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356GGAUCCCGGAAAUUUAACA84.8057539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341374GGATCCCGGAAATTTAACATGTTAAATTTCCGGGATCC0.961000.028500.663800.750001.000001.00000


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602GUGGUGAUCUCCAACAUCU85.0268514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701620GTGGTGATCTCCAACATCTAGATGTTGGAGATCACCAC0.230300.005600.569000.500000.929300.62500


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071GAGGAGUUGCAGCAAAAAG76.37391397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301089GAGGAGTTGCAGCAAAAAGCTTTTTGCTGCAACTCCTC0.124100.022400.672400.500001.000001.00000


Target Position: 4825, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4825GUGUACUUCAUAGUGUAAA83.5303634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4823-4845ATGTGTACTTCATAGTGTAAAAAUUUACACUAUGAAGUACACAUGUGUACUUCAUAGUGUAAAAAU19.019.023


Target Position: 3473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473GGCUGGUAAUUUAUAUAAU94.997969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2813491GGCTGGTAATTTATATAATATTATATAAATTACCAGCC0.563600.056200.991401.000001.000001.00000


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369UUAACAUUCUGGGCACAAA78.81761091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001387TTAACATTCTGGGCACAAATTTGTGCCCAGAATGTTAA0.051500.010100.534500.500001.000001.00000


Target Position: 4267, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4267CCGGAUUUGGCAACUCAAA81.8693783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4265-4287GGCCGGATTTGGCAACTCAAAACUUUGAGUUGCCAAAUCCGGCCCCGGAUUUGGCAACUCAAAACU19.220.733


Target Position: 4873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4873UUUUUUUUUUUUUUUUUUU61.69033341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9784891TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.611200.604700.500000.500001.000001.00000


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395GUGAUGAACAUGGAAGAAU78.7161100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541413GTGATGAACATGGAAGAATATTCTTCCATGTTCATCAC0.032800.026200.784500.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925CGGACGAGGAGCUGGCUGA81.8193790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762943CGGACGAGGAGCTGGCTGATCAGCCAGCTCCTCGTCCG0.061800.011400.689700.750001.000001.00000


Target Position: 3395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395CUGUCUCAAAAAAAAAAAA86.0743440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1593413CTGTCTCAAAAAAAAAAAATTTTTTTTTTTTGAGACAG0.996100.104800.784500.750001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023UCAUUAGCAGAAUCUCAAC66.78162689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351041TCATTAGCAGAATCTCAACGTTGAGATTCTGCTAATGA0.214500.082400.577600.500001.000001.00000


Target Position: 4459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4459ACUCUUCAGUACAUAAUAA95.776755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3524477ACTCTTCAGTACATAATAATTATTATGTACTGAAGAGT0.716300.076200.672400.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GUCAACAAAUUAAGAAACU74.29431677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191069GTCAACAAATTAAGAAACTAGTTTCTTAATTTGTTGAC0.101000.088900.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1049-1071CCGTCAACAAATTAAGAAACTGGAGUUUCUUAAUUUGUUGACGGGUCAACAAAUUAAGAAACUGGU13.320.522


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338CCAAGUUUAUCUGUGUGAC71.1092124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252356CCAAGTTTATCTGTGTGACGTCACACAGATAAACTTGG0.049700.022200.525900.750001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589CCCUCACACAGCCAAACCC61.12693412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482607CCCTCACACAGCCAAACCCGGGTTTGGCTGTGTGAGGG0.931500.609000.500000.500001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690CUAGAACAGAAAAUGAAAG72.39981952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786708CTAGAACAGAAAATGAAAGCTTTCATTTTCTGTTCTAG0.306500.176200.534500.500001.000001.00000


Target Position: 4484, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484CUGAUAAACAGAAUAUUUA93.2678112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2564502CTGATAAACAGAATATTTATAAATATTCTGTTTATCAG0.506600.118600.750000.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4482-4504AACTGATAAACAGAATATTTAGAUAAAUAUUCUGUUUAUCAGUUCUGAUAAACAGAAUAUUUAGAU-10.38.912


Target Position: 4455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4455CAACACUCUUCAGUACAUA92.8592124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6044473CAACACTCTTCAGTACATATATGTACTGAAGAGTGTTG0.254600.091300.603400.750000.929300.87500


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350GUGUGACACCAACGACCUG74.77291611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872368GTGTGACACCAACGACCTGCAGGTCGTTGGTGTCACAC0.215800.004500.508600.500001.000001.00000


Target Position: 4921, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4921CCAGAAAUAAACGUUAUAU84.6471551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1774939CCAGAAATAAACGTTATATATATAACGTTTATTTCTGG0.575100.092400.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4919-4941TTCCAGAAATAAACGTTATATAGAUAUAACGUUUAUUUCUGGAACCAGAAAUAAACGUUAUAUAGU8.512.022


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044GAUUCAGUGAAAGCAGCAA90.3018216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9262062GATTCAGTGAAAGCAGCAATTGCTGCTTTCACTGAATC0.036300.003300.534500.750001.000001.00000


Target Position: 4323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4323UCUGUUUGUUAAAUCAAAU76.30831404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7604341TCTGTTTGTTAAATCAAATATTTGATTTAACAAACAGA0.320800.006700.715500.750001.000001.00000


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793GACUACACUGGCAGAGAAA93.8128100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281811GACTACACTGGCAGAGAAATTTCTCTGCCAGTGTAGTC0.036200.004800.819000.750000.918500.75000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519AGGAGCUGCACCUGAUCAC64.70882941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231537AGGAGCTGCACCTGATCACGTGATCAGGTGCAGCTCCT0.125800.009900.551700.500000.956500.62500


Target Position: 3959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3959GGUUGAGCUCAGGGAAUAU89.6277238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6883977GGTTGAGCTCAGGGAATATATATTCCCTGAGCTCAACC0.079600.018100.810301.000001.000001.00000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045AUUCAGUGAAAGCAGCAAA80.766890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732063ATTCAGTGAAAGCAGCAAATTTGCTGCTTTCACTGAAT0.042800.002200.508600.500001.000001.00000


Target Position: 2966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2966UCCUGGCAUUGCACUUUUU70.94192149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152984TCCTGGCATTGCACTTTTTAAAAAGTGCAATGCCAGGA0.601100.005100.870700.750001.000001.00000


Target Position: 3067, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3067GGCAAAAAACACUGUAUCA95.426460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3683085GGCAAAAAACACTGTATCATGATACAGTGTTTTTTGCC0.385800.359200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3065-3087AGGGCAAAAAACACTGTATCAGCUGAUACAGUGUUUUUUGCCCUGGCAAAAAACACUGUAUCAGCU20.314.112


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GCAGCUUGACACACGGUAC76.56441372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643260GCAGCTTGACACACGGTACGTACCGTGTGTCAAGCTGC0.117900.011400.672400.750001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480CACCUUUGACAUGGAGUUG67.08642651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432498CACCTTTGACATGGAGTTGCAACTCCATGTCAAAGGTG0.034300.011300.646600.500001.000001.00000


Target Position: 4311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4311UUUCUGUGGAAUUCUGUUU62.98933179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9664329TTTCTGTGGAATTCTGTTTAAACAGAATTCCACAGAAA0.032900.009700.500000.500001.000001.00000


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176UCAUCAUGGGCUAUAAGAU80.4498921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682194TCATCATGGGCTATAAGATATCTTATAGCCCATGATGA0.068600.044000.543100.750001.000001.00000


Target Position: 4340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4340AUUAGCUGGUCUCUGAAUU70.57832204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854358ATTAGCTGGTCTCTGAATTAATTCAGAGACCAGCTAAT0.241000.091400.500000.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574CCUGCAUUCUGCCACCCCU75.73791469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902592CCTGCATTCTGCCACCCCTAGGGGTGGCAGAATGCAGG0.265800.036200.500000.750000.945700.87500


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377CUGGGCACAAACACAAAAG65.50972849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991395CTGGGCACAAACACAAAAGCTTTTGTGTTTGTGCCCAG0.101200.005000.646600.500001.000001.00000


Target Position: 4718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4718UGCCCCCUCCCCAUCCCCA57.40533804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8864736TGCCCCCTCCCCATCCCCATGGGGATGGGGAGGGGGCA0.278800.102900.508600.500001.000001.00000


Target Position: 2357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357ACCAACGACCUGCAGCAAU67.18552632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5882375ACCAACGACCTGCAGCAATATTGCTGCAGGTCGTTGGT0.108600.106100.844800.750001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075AGUUGCAGCAAAAAGUUUC63.60523090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921093AGTTGCAGCAAAAAGTTTCGAAACTTTTTGCTGCAACT0.041300.020400.534500.500001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044CAGACCCGUCAACAAAUUA88.3039308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381062CAGACCCGTCAACAAATTATAATTTGTTGACGGGTCTG0.922700.278100.750000.750001.000001.00000


Target Position: 687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GAUCUAGAACAGAAAAUGA98.459117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
685-707AGGATCTAGAACAGAAAATGAAAUCAUUUUCUGUUCUAGAUCCUGAUCUAGAACAGAAAAUGAAAU7.420.212


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UCCAACAACGGCAGCCUCU57.46363798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761431TCCAACAACGGCAGCCTCTAGAGGCTGCCGTTGTTGGA0.029100.005400.646600.500000.923900.62500


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566GGCGCCUACCUGCAUUCUG66.51552723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002584GGCGCCTACCTGCATTCTGCAGAATGCAGGTAGGCGCC0.075800.023800.715500.750000.951100.87500


Target Position: 4805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4805CACUGCAUUCAAAUUCCAA92.5176135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4464823CACTGCATTCAAATTCCAATTGGAATTTGAATGCAGTG0.345700.042800.646600.750001.000001.00000


Target Position: 2036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036CCUGCUAAGAUUCAGUGAA87.6591343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142054CCTGCTAAGATTCAGTGAATTCACTGAATCTTAGCAGG0.323600.008300.672401.000000.913000.62500


Target Position: 4835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4835UAGUGUAAAAAUUUAUAUU80.4131924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964853TAGTGTAAAAATTTATATTAATATAAATTTTTACACTA0.027700.002000.663800.500001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853AUGGGCUAAAUUUUGCAAA71.09632128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831871ATGGGCTAAATTTTGCAAATTTGCAAAATTTAGCCCAT0.119000.039000.655200.500000.989100.87500


Target Position: 4052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052GGCUUACUGAUAAACUUGA88.1838313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7124070GGCTTACTGATAAACTTGATCAAGTTTATCAGTAAGCC0.102600.008400.775900.750000.956500.62500


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144GCAGCAGCUGAACAACAUG77.43391255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602162GCAGCAGCTGAACAACATGCATGTTGTTCAGCTGCTGC0.343700.002400.698300.750000.994600.75000


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150AGCUGUUUAGAAACUUAAU82.0073768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651168AGCTGTTTAGAAACTTAATATTAAGTTTCTAAACAGCT0.185400.016400.844800.750001.000001.00000


Target Position: 4573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4573UGGAGCAGAUAUUGUCAAG69.71382318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8524591TGGAGCAGATATTGTCAAGCTTGACAATATCTGCTCCA0.116000.005200.706900.500001.000001.00000


Target Position: 4866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4866UUUGUCUUUUUUUUUUUUU57.28573820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9184884TTTGTCTTTTTTTTTTTTTAAAAAAAAAAAAAGACAAA0.987700.754400.500000.500001.000001.00000


Target Position: 4862, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4862GUUUUUUGUCUUUUUUUUU75.64381487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5044880GTTTTTTGTCTTTTTTTTTAAAAAAAAAGACAAAAAAC0.870800.656600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4860-4882AGGTTTTTTGTCTTTTTTTTTTTAAAAAAAAAGACAAAAAACCUGUUUUUUGUCUUUUUUUUUUUU-11.3-2.910


Target Position: 2539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539ACGGAAGCUGCAGAAAGAU71.57812066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032557ACGGAAGCTGCAGAAAGATATCTTTCTGCAGCTTCCGT0.219300.005400.594800.750001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459GGGAGCAGAGAUGUGGGAA85.2314498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301477GGGAGCAGAGATGTGGGAATTCCCACATCTCTGCTCCC0.113000.002800.819001.000001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GAAUCGUGGAGCUGUUUAG79.23721043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701159GAATCGTGGAGCTGTTTAGCTAAACAGCTCCACGATTC0.038500.002400.500000.500001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909GGCUGGACAAUAUCAUUGA90.3141214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411927GGCTGGACAATATCATTGATCAATGATATTGTCCAGCC0.096600.007300.775900.750001.000001.00000


Target Position: 2803, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2803GAGAAAAAGGAAAUGUCUU85.2751495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892821GAGAAAAAGGAAATGTCTTAAGACATTTCCTTTTTCTC0.158800.005700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2801-2823GGGAGAAAAAGGAAATGTCTTGTAAGACAUUUCCUUUUUCUCCCGAGAAAAAGGAAAUGUCUUGUU19.25.522


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CAGGCAGAAGAUGCAGCAG70.38062227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937824CAGGCAGAAGATGCAGCAGCTGCTGCATCTTCTGCCTG0.047800.007500.500000.500000.951100.87500


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GAGGAUCCCGGAAAUUUAA89.667235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041372GAGGATCCCGGAAATTTAATTAAATTTCCGGGATCCTC0.102800.042100.775900.750001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682CUGGGCACUUUUAAAAAUA84.8576533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822700CTGGGCACTTTTAAAAATATATTTTTAAAAGTGCCCAG0.559700.023200.741400.750001.000001.00000


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977GGCUUUAUCAGUAAGGAGC65.3732863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461995GGCTTTATCAGTAAGGAGCGCTCCTTACTGATAAAGCC0.064500.007100.646600.500001.000001.00000


Target Position: 4801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4801UGGCCACUGCAUUCAAAUU74.76311613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5474819TGGCCACTGCATTCAAATTAATTTGAATGCAGTGGCCA0.216900.017900.836200.750001.000001.00000


Target Position: 2687, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687CACUUUUAAAAAUAGAGAA91.709162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732705CACTTTTAAAAATAGAGAATTCTCTATTTTTAAAAGTG0.586200.069500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2685-2707GGCACTTTTAAAAATAGAGAAATUUCUCUAUUUUUAAAAGUGCCCACUUUUAAAAAUAGAGAAAUU20.24.912


Target Position: 4837, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4837GUGUAAAAAUUUAUAUUAU93.4486108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4835-4857TAGTGTAAAAATTTATATTATTGAUAAUAUAAAUUUUUACACUAGUGUAAAAAUUUAUAUUAUUGU-5.97.212


Target Position: 2712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2712GAAUGUGGGUGAUCUGCUU90.3706212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622730GAATGTGGGTGATCTGCTTAAGCAGATCACCCACATTC0.031200.003800.534500.750001.000001.00000


Target Position: 4875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4875UUUUUUUUUUUUUUUUUUU61.69033343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9384893TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.544600.539700.500000.500001.000001.00000


Target Position: 1670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670CAACAAUCCCAAGAAUGUA92.8901123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1668-1690ACCAACAATCCCAAGAATGTAAAUACAUUCUUGGGAUUGUUGGUCAACAAUCCCAAGAAUGUAAAU19.214.832


Target Position: 3999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3999UGAUAUCCAGUGGCACUUG63.2973133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9584017TGATATCCAGTGGCACTTGCAAGTGCCACTGGATATCA0.031900.010100.577600.500001.000001.00000


Target Position: 3698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3698CUUGAUCUGCUGUUUCAGA84.814538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3696-3718GACTTGATCTGCTGTTTCAGAGGUCUGAAACAGCAGAUCAAGUCCUUGAUCUGCUGUUUCAGAGGU19.220.422


Target Position: 4324, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4324CUGUUUGUUAAAUCAAAUU77.10191291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4484342CTGTTTGTTAAATCAAATTAATTTGATTTAACAAACAG0.239700.027600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4322-4344TTCTGTTTGTTAAATCAAATTAGAAUUUGAUUUAACAAACAGAACUGUUUGUUAAAUCAAAUUAGU7.219.322


Target Position: 4708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708UCCUGUCCACUGCCCCCUC49.96874471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7984726TCCTGTCCACTGCCCCCTCGAGGGGGCAGTGGACAGGA0.378000.259500.560300.500001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256GAGGAGGCAUUCGGAAAGU72.39061955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962274GAGGAGGCATTCGGAAAGTACTTTCCGAATGCCTCCTC0.270000.009100.603400.500001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045AGACCCGUCAACAAAUUAA86.0547442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991063AGACCCGTCAACAAATTAATTAATTTGTTGACGGGTCT0.914000.284900.689700.750001.000001.00000


Target Position: 1291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291UGAAUUAUCAGCUUAAAAU80.2805937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951309TGAATTATCAGCTTAAAATATTTTAAGCTGATAATTCA0.077600.019000.715500.750001.000001.00000


Target Position: 1299, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299CAGCUUAAAAUUAAAGUGU75.7141474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601317CAGCTTAAAATTAAAGTGTACACTTTAATTTTAAGCTG0.217700.016700.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1297-1319ATCAGCTTAAAATTAAAGTGTGCACACUUUAAUUUUAAGCUGAUCAGCUUAAAAUUAAAGUGUGCU11.818.322


Target Position: 4628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4628CUGAUUGUAGCAAAAGUUC65.42812857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9594646CTGATTGTAGCAAAAGTTCGAACTTTTGCTACAATCAG0.031900.024200.612100.500001.000001.00000


Target Position: 4322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4322UUCUGUUUGUUAAAUCAAA80.0097962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8014340TTCTGTTTGTTAAATCAAATTTGATTTAACAAACAGAA0.241200.005400.672400.500001.000001.00000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046AAGAAAUAAUAACAAUUAA93.7649102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6613064AAGAAATAATAACAATTAATTAATTGTTATTATTTCTT0.600900.147000.603400.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219ACCGGCCCCUCGUCAUCAA75.02711579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031237ACCGGCCCCTCGTCATCAATTGATGACGAGGGGCCGGT0.317100.013700.706900.750000.994600.75000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365AGAAUCACAUGCCACUUUG69.94422294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818383AGAATCACATGCCACTTTGCAAAGTGGCATGTGATTCT0.055300.005000.577600.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013CUGGAUAACGUCAUUAGCA87.1007378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1011-1033AACTGGATAACGTCATTAGCAGAUGCUAAUGACGUUAUCCAGUUCUGGAUAACGUCAUUAGCAGAU19.721.223


Target Position: 4520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4520CUUACCAUUGGGUUUAAAU77.80631206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4518-4540GGCTTACCATTGGGTTTAAATCAAUUUAAACCCAAUGGUAAGCCCUUACCAUUGGGUUUAAAUCAU0.020.032


Target Position: 4798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4798UCCUGGCCACUGCAUUCAA76.85341326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6394816TCCTGGCCACTGCATTCAATTGAATGCAGTGGCCAGGA0.115200.011500.724100.750001.000001.00000


Target Position: 2799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799GAGGGAGAAAAAGGAAAUG68.56122472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462817GAGGGAGAAAAAGGAAATGCATTTCCTTTTTCTCCCTC0.068400.053700.655200.500001.000001.00000


Target Position: 4918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4918CUUCCAGAAAUAAACGUUA85.6888465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5954936CTTCCAGAAATAAACGTTATAACGTTTATTTCTGGAAG0.643500.014900.603400.750001.000001.00000


Target Position: 2416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416UGAUGCAGUUUGGAAAUAA86.4619412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2972434TGATGCAGTTTGGAAATAATTATTTCCAAACTGCATCA0.283700.080900.689700.750001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830UUGUUCCCCUGCCCUCCUU54.60374104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822848TTGTTCCCCTGCCCTCCTTAAGGAGGGCAGGGGAACAA0.675800.260900.508600.500001.000001.00000


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394UCCCCCCGCACUUUAGAUU56.04833956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3242412TCCCCCCGCACTTTAGATTAATCTAAAGTGCGGGGGGA0.265100.213500.862100.750001.000001.00000


Target Position: 4457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4457ACACUCUUCAGUACAUAAU76.48421381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2704475ACACTCTTCAGTACATAATATTATGTACTGAAGAGTGT0.286900.091100.698300.750000.929300.62500


Target Position: 4269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4269GGAUUUGGCAACUCAAAAC76.19631413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9704287GGATTTGGCAACTCAAAACGTTTTGAGTTGCCAAATCC0.478500.002300.724100.750000.983700.62500


Target Position: 2849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2849UCUCAGCAGCUUUUUGUUA77.00341303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182867TCTCAGCAGCTTTTTGTTATAACAAAAAGCTGCTGAGA0.663500.003000.689700.750001.000001.00000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254AGGAGGAGGCAUUCGGAAA82.908693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392272AGGAGGAGGCATTCGGAAATTTCCGAATGCCTCCTCCT0.264300.004600.844800.750001.000001.00000


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559CCAAGGCCUCAAGAUUGAC65.76442809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271577CCAAGGCCTCAAGATTGACGTCAATCTTGAGGCCTTGG0.131400.002900.525900.750000.956500.62500


Target Position: 2002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002GGGCCAUCUUGAGCACUAA95.41261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982020GGGCCATCTTGAGCACTAATTAGTGCTCAAGATGGCCC0.091100.003300.956901.000000.951100.75000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567GCGCCUACCUGCAUUCUGC68.83382439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152585GCGCCTACCTGCATTCTGCGCAGAATGCAGGTAGGCGC0.085800.049400.569000.500000.929300.62500


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GCAGGAUCUAGAACAGAAA95.954452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209701GCAGGATCTAGAACAGAAATTTCTGTTCTAGATCCTGC0.339400.133300.853401.000001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681UCUGGGCACUUUUAAAAAU72.8571878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762699TCTGGGCACTTTTAAAAATATTTTTAAAAGTGCCCAGA0.562200.023900.715500.750001.000001.00000


Target Position: 4935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4935UAUAUAGGAACCGUAAAAA80.325930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514953TATATAGGAACCGTAAAAATTTTTACGGTTCCTATATA0.471900.230200.543100.500001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925UGACCUUGUGAAAAAGUAC68.29512494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531943TGACCTTGTGAAAAAGTACGTACTTTTTCACAAGGTCA0.183700.016000.543100.500000.951100.62500


Target Position: 4478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4478GCUUAACUGAUAAACAGAA94.39785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4014496GCTTAACTGATAAACAGAATTCTGTTTATCAGTTAAGC0.504300.034000.681001.000000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4476-4498AAGCTTAACTGATAAACAGAATAUUCUGUUUAUCAGUUAAGCUUGCUUAACUGAUAAACAGAAUAU19.29.822


Target Position: 3957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3957CUGGUUGAGCUCAGGGAAU73.86161737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433975CTGGTTGAGCTCAGGGAATATTCCCTGAGCTCAACCAG0.047300.026700.775900.750000.972800.62500


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674UGAGCAAUCUGGGCACUUU77.60931235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912692TGAGCAATCTGGGCACTTTAAAGTGCCCAGATTGCTCA0.041600.005400.724100.750001.000001.00000


Target Position: 2972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972CAUUGCACUUUUUAACCUU83.4902636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602990CATTGCACTTTTTAACCTTAAGGTTAAAAAGTGCAATG0.260000.112100.517200.750001.000001.00000


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042UUCAGACCCGUCAACAAAU69.15272396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791060TTCAGACCCGTCAACAAATATTTGTTGACGGGTCTGAA0.609500.062100.663800.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GUGUGCAUUGACAAAGACU81.4594827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111332GTGTGCATTGACAAAGACTAGTCTTTGTCAATGCACAC0.038600.016800.586200.500001.000001.00000


Target Position: 3580, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580CUAAGCAUUUUAGACUUUU75.3621536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5583598CTAAGCATTTTAGACTTTTAAAAGTCTAAAATGCTTAG0.117600.030800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3578-3600ATCTAAGCATTTTAGACTTTTTTAAAAGUCUAAAAUGCUUAGAUCUAAGCAUUUUAGACUUUUUUU17.719.722


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348GCAUAUGCGGCCAGCAAAG69.21582386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838366GCATATGCGGCCAGCAAAGCTTTGCTGGCCGCATATGC0.063100.004700.715500.750000.918500.87500


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450CUCUAUCAGCACAAUCUAC76.78121336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
610468CTCTATCAGCACAATCTACGTAGATTGTGCTGATAGAG0.281100.079200.629300.500000.994600.62500


Target Position: 4456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4456AACACUCUUCAGUACAUAA94.775174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9384474AACACTCTTCAGTACATAATTATGTACTGAAGAGTGTT0.259000.091900.612100.500000.929300.75000


Target Position: 4828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4828UACUUCAUAGUGUAAAAAU77.17741281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854846TACTTCATAGTGTAAAAATATTTTTACACTATGAAGTA0.028400.008600.672400.500001.000001.00000


Target Position: 2689, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689CUUUUAAAAAUAGAGAAAU76.76571339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572707CTTTTAAAAATAGAGAAATATTTCTCTATTTTTAAAAG0.555500.524000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2687-2709CACTTTTAAAAATAGAGAAATGAAUUUCUCUAUUUUUAAAAGUGCUUUUAAAAAUAGAGAAAUGAU19.1-9.122


Target Position: 4575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4575GAGCAGAUAUUGUCAAGUU94.295788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6544593GAGCAGATATTGTCAAGTTAACTTGACAATATCTGCTC0.109800.011000.663800.750001.000001.00000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387ACACAAAAGUGAUGAACAU86.2563428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451405ACACAAAAGTGATGAACATATGTTCATCACTTTTGTGT0.202500.021100.551700.750000.918500.62500


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623UUGUAAUGUAUUGGCCUUU61.06633420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173641TTGTAATGTATTGGCCTTTAAAGGCCAATACATTACAA0.051100.018200.646600.500001.000001.00000


Target Position: 4897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4897AUAUUGCUGUAUCUACUUU80.3764927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7524915ATATTGCTGTATCTACTTTAAAGTAGATACAGCAATAT0.109000.071100.543100.500001.000001.00000


Target Position: 4625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4625ACUCUGAUUGUAGCAAAAG63.57133095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8564643ACTCTGATTGTAGCAAAAGCTTTTGCTACAATCAGAGT0.070400.043400.569000.500001.000001.00000


Target Position: 2835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2835CCCCUGCCCUCCUUUCUCA78.91921078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4032853CCCCTGCCCTCCTTTCTCATGAGAAAGGAGGGCAGGGG0.262600.033800.767200.750001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GGGCUAAAUUUUGCAAAGA83.804597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431873GGGCTAAATTTTGCAAAGATCTTTGCAAAATTTAGCCC0.151000.061300.767200.750000.989100.75000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148GGAGCUGUUUAGAAACUUA103.9712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411166GGAGCTGTTTAGAAACTTATAAGTTTCTAAACAGCTCC0.470200.004600.836201.000001.000001.00000


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591AGACUUUUUUUUAUAAAUA91.5913167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4253609AGACTTTTTTTTATAAATATATTTATAAAAAAAAGTCT0.185000.038800.681000.750001.000001.00000


Target Position: 2147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2147GCAGCUGAACAACAUGUCA91.5092169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612165GCAGCTGAACAACATGTCATGACATGTTGTTCAGCTGC0.054200.002400.629300.750001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318GCAUUGACAAAGACUCUGG70.44322218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901336GCATTGACAAAGACTCTGGCCAGAGTCTTTGTCAATGC0.045900.009900.508600.500001.000001.00000


Target Position: 3393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3393CUCUGUCUCAAAAAAAAAA87.2208372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713411CTCTGTCTCAAAAAAAAAATTTTTTTTTTGAGACAGAG0.988600.063900.810300.750001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688AUCUAGAACAGAAAAUGAA86.1186435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874706ATCTAGAACAGAAAATGAATTCATTTTCTGTTCTAGAT0.546200.194600.508600.500001.000001.00000


Target Position: 1669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669CCAACAAUCCCAAGAAUGU78.14561163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1667-1689GACCAACAATCCCAAGAATGTAAACAUUCUUGGGAUUGUUGGUCCCAACAAUCCCAAGAAUGUAAU12.012.123


Target Position: 353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
353UGCGGCCAGCAAAGAAUCA69.72872316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745371TGCGGCCAGCAAAGAATCATGATTCTTTGCTGGCCGCA0.464100.008600.629300.500000.951100.62500


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597CAGCCAAACCCCAGAUCAU86.6775401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822615CAGCCAAACCCCAGATCATATGATCTGGGGTTTGGCTG0.056300.058900.629300.750001.000001.00000


Target Position: 3035, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035CUUUUUAAAUUAAGAAAUA90.1561222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6163053CTTTTTAAATTAAGAAATATATTTCTTAATTTAAAAAG0.194000.050300.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3033-3055TTCTTTTTAAATTAAGAAATAATUAUUUCUUAAUUUAAAAAGAACUUUUUAAAUUAAGAAAUAAUU5.3-9.111


Target Position: 4617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4617UGGUCUUAACUCUGAUUGU74.5761633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6594635TGGTCTTAACTCTGATTGTACAATCAGAGTTAAGACCA0.279900.015800.637900.500001.000001.00000


Target Position: 4578, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4578CAGAUAUUGUCAAGUUCAU89.2438250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5394596CAGATATTGTCAAGTTCATATGAACTTGACAATATCTG0.152800.051700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4576-4598AGCAGATATTGTCAAGTTCATGGAUGAACUUGACAAUAUCUGCUCAGAUAUUGUCAAGUUCAUGGU19.26.622


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045UAAGAAAUAAUAACAAUUA86.7734397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9313063TAAGAAATAATAACAATTATAATTGTTATTATTTCTTA0.793500.198700.500000.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CCCGUCAACAAAUUAAGAA83.0489681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1321066CCCGTCAACAAATTAAGAATTCTTAATTTGTTGACGGG0.486900.303600.819001.000001.000001.00000


Target Position: 4932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4932CGUUAUAUAGGAACCGUAA95.748357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2474950CGTTATATAGGAACCGTAATTACGGTTCCTATATAACG0.292800.234700.741401.000001.000001.00000


Target Position: 2609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609AGAUCAUCUGAAACUACUA96.923534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892627AGATCATCTGAAACTACTATAGTAGTTTCAGATGATCT0.117600.003400.551700.750001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092AGAAGGACAUCAGCGGUAA85.4429480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482110AGAAGGACATCAGCGGTAATTACCGCTGATGTCCTTCT0.194400.027500.689700.750001.000001.00000


Target Position: 4523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4523ACCAUUGGGUUUAAAUCAU73.58111774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4424541ACCATTGGGTTTAAATCATATGATTTAAACCCAATGGT0.173800.032100.698300.750000.972800.62500


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684AUGUAAACUUUUUUACCAA88.2206311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751702ATGTAAACTTTTTTACCAATTGGTAAAAAAGTTTACAT0.196600.079100.508600.500000.923900.62500


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380GGCACAAACACAAAAGUGA88.7533280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141398GGCACAAACACAAAAGTGATCACTTTTGTGTTTGTGCC0.070500.036100.775900.750000.918500.62500


Target Position: 2727, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727GCUUUUAUCUAAAUGCAAA96.58640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162745GCTTTTATCTAAATGCAAATTTGCATTTAGATAAAAGC0.253700.008300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2725-2747CTGCTTTTATCTAAATGCAAATAUUUGCAUUUAGAUAAAAGCAGGCUUUUAUCUAAAUGCAAAUAU20.0-4.322


Target Position: 4467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4467GUACAUAAUAAGCUUAACU83.6559614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4465-4487CAGTACATAATAAGCTTAACTGAAGUUAAGCUUAUUAUGUACUGGUACAUAAUAAGCUUAACUGAU20.98.523


Target Position: 3027, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3027CUAGGUUUCUUUUUAAAUU82.7978701

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3025-3047CCCTAGGTTTCTTTTTAAATTAAAAUUUAAAAAGAAACCUAGGGCUAGGUUUCUUUUUAAAUUAAU-9.718.622


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933GAGCUGGCUGACUGGAAGA85.7439462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813951GAGCTGGCTGACTGGAAGATCTTCCAGTCAGCCAGCTC0.107200.014100.586200.500001.000001.00000


Target Position: 4473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4473AAUAAGCUUAACUGAUAAA88.1412317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954491AATAAGCTTAACTGATAAATTTATCAGTTAAGCTTATT0.042300.024000.508600.500001.000001.00000


Target Position: 4701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4701GCCCGCUUCCUGUCCACUG63.29713132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2244719GCCCGCTTCCTGTCCACTGCAGTGGACAGGAAGCGGGC0.375400.184600.715500.750001.000001.00000


Target Position: 2811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2811GGAAAUGUCUUGUGUUGUU89.1071257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582829GGAAATGTCTTGTGTTGTTAACAACACAAGACATTTCC0.164400.043900.724101.000001.000001.00000


Target Position: 3690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3690UCCCUGGACUUGAUCUGCU67.24092626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533708TCCCTGGACTTGATCTGCTAGCAGATCAAGTCCAGGGA0.199400.016400.517200.500001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360CCCGGAAAUUUAACAUUCU78.74031097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721378CCCGGAAATTTAACATTCTAGAATGTTAAATTTCCGGG0.029700.005800.767200.750001.000001.00000


Target Position: 4847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4847UUAUAUUAUUGUGAGGUUU69.54242340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8204865TTATATTATTGTGAGGTTTAAACCTCACAATAATATAA0.050900.015200.534500.500001.000001.00000


Target Position: 2855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855CAGCUUUUUGUUAUUGUUG69.29922376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792873CAGCTTTTTGTTATTGTTGCAACAATAACAAAAAGCTG0.081100.019800.637900.500001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247CCAGUUCACUACUAAAGUC79.25481038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431265CCAGTTCACTACTAAAGTCGACTTTAGTAGTGAACTGG0.187600.134200.525900.750000.967400.62500


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732UUUGAUUUCAACUAUAAAA79.14011055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927750TTTGATTTCAACTATAAAATTTTATAGTTGAAATCAAA0.736900.113100.500000.500001.000001.00000


Target Position: 3397, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397GUCUCAAAAAAAAAAAAAA88.6411288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2833415GTCTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAGAC0.993900.159700.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3395-3417CTGTCTCAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUGAGACAGGUCUCAAAAAAAAAAAAAAAAU-11.320.400


Target Position: 4237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4237GGAUGGGCUGCCUCUGACU81.7232801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9714255GGATGGGCTGCCTCTGACTAGTCAGAGGCAGCCCATCC0.045600.002300.663800.750000.994600.62500


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148CAGCUGAACAACAUGUCAU88.3641305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652166CAGCTGAACAACATGTCATATGACATGTTGTTCAGCTG0.049100.003900.629300.750001.000001.00000


Target Position: 4310, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4310GUUUCUGUGGAAUUCUGUU81.9212779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9744328GTTTCTGTGGAATTCTGTTAACAGAATTCCACAGAAAC0.029400.007000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4308-4330GAGTTTCTGTGGAATTCTGTTTGAACAGAAUUCCACAGAAACUCGUUUCUGUGGAAUUCUGUUUGU19.219.222


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129UGCUGGAGGAGAGAAUCGU64.38442977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201147TGCTGGAGGAGAGAATCGTACGATTCTCTCCTCCAGCA0.115300.008000.577600.500001.000001.00000


Target Position: 4804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804CCACUGCAUUCAAAUUCCA86.9413389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854822CCACTGCATTCAAATTCCATGGAATTTGAATGCAGTGG0.365400.020300.500000.750001.000001.00000


Target Position: 4802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4802GGCCACUGCAUUCAAAUUC64.15473007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5224820GGCCACTGCATTCAAATTCGAATTTGAATGCAGTGGCC0.382000.027700.827600.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GGAGAAGGACAUCAGCGGU81.1276855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632108GGAGAAGGACATCAGCGGTACCGCTGATGTCCTTCTCC0.067600.027200.517200.750001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GACUUUGAUUUCAACUAUA99.994711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872747GACTTTGATTTCAACTATATATAGTTGAAATCAAAGTC0.707400.003800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
727-749ATGACTTTGATTTCAACTATAAAUAUAGUUGAAAUCAAAGUCAUGACUUUGAUUUCAACUAUAAAU11.619.212


Target Position: 2801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801GGGAGAAAAAGGAAAUGUC77.19551275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252819GGGAGAAAAAGGAAATGTCGACATTTCCTTTTTCTCCC0.036600.022500.672400.750001.000001.00000


Target Position: 4830, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4830CUUCAUAGUGUAAAAAUUU82.9403691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7764848CTTCATAGTGTAAAAATTTAAATTTTTACACTATGAAG0.230700.006000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4828-4850TACTTCATAGTGTAAAAATTTATAAAUUUUUACACUAUGAAGUACUUCAUAGUGUAAAAAUUUAUU-12.013.422


Target Position: 4446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446CUUCUCCAGCAACACUCUU72.35771958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9864464CTTCTCCAGCAACACTCTTAAGAGTGTTGCTGGAGAAG0.145200.054600.500000.750001.000001.00000


Target Position: 4913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4913UUUAACUUCCAGAAAUAAA76.16681416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9334931TTTAACTTCCAGAAATAAATTTATTTCTGGAAGTTAAA0.084200.017700.500000.500001.000001.00000


Target Position: 2395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395CCCCCCGCACUUUAGAUUC56.15343941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832413CCCCCCGCACTTTAGATTCGAATCTAAAGTGCGGGGGG0.147600.073800.819000.750001.000001.00000


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673CAAUCCCAAGAAUGUAAAC71.19782114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671691CAATCCCAAGAATGTAAACGTTTACATTCTTGGGATTG0.181200.141300.500000.500001.000001.00000


Target Position: 4760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4760GUUGCUUACCUACCUAUAA90.8894189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4758-4780GGGTTGCTTACCTACCTATAAGGUUAUAGGUAGGUAAGCAACCCGUUGCUUACCUACCUAUAAGGU19.819.733


Target Position: 3227, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227CUACUAAAAGUACAAAAAA92.0602146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3303245CTACTAAAAGTACAAAAAATTTTTTGTACTTTTAGTAG0.617900.292500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3225-3247CTCTACTAAAAGTACAAAAAATTUUUUUUGUACUUUUAGUAGAGCUACUAAAAGUACAAAAAAUUU5.66.600


Target Position: 4276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4276GCAACUCAAAACCACCUUG70.31332233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6454294GCAACTCAAAACCACCTTGCAAGGTGGTTTTGAGTTGC0.091900.032800.706900.750001.000001.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016GAUAACGUCAUUAGCAGAA87.3616365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971034GATAACGTCATTAGCAGAATTCTGCTAATGACGTTATC0.221900.121000.508600.750001.000001.00000


Target Position: 4720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4720CCCCCUCCCCAUCCCCAGC41.30824821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5784738CCCCCTCCCCATCCCCAGCGCTGGGGATGGGGAGGGGG0.267700.109900.637900.500001.000001.00000


Target Position: 4722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4722CCCUCCCCAUCCCCAGCCC42.30194798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9794740CCCTCCCCATCCCCAGCCCGGGCTGGGGATGGGGAGGG0.220300.055900.500000.500001.000001.00000


Target Position: 4724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4724CUCCCCAUCCCCAGCCCAG53.39694208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8364742CTCCCCATCCCCAGCCCAGCTGGGCTGGGGATGGGGAG0.138800.148800.525900.500001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932GGAGCUGGCUGACUGGAAG77.64481229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608950GGAGCTGGCTGACTGGAAGCTTCCAGTCAGCCAGCTCC0.336200.013400.732800.750001.000001.00000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721UGAUCUGCUUUUAUCUAAA90.5724197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632739TGATCTGCTTTTATCTAAATTTAGATAAAAGCAGATCA0.045100.002400.724100.750001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GUCAUUAGCAGAAUCUCAA90.8294191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291040GTCATTAGCAGAATCTCAATTGAGATTCTGCTAATGAC0.309800.107800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1020-1042ACGTCATTAGCAGAATCTCAACTUUGAGAUUCUGCUAAUGACGUGUCAUUAGCAGAAUCUCAACUU20.413.432


Target Position: 4874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4874UUUUUUUUUUUUUUUUUUU61.69033342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9614892TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.591700.587000.500000.500001.000001.00000


Target Position: 3902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902GGGGAGAGAGUUACAGGUU83.7801603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1903920GGGGAGAGAGTTACAGGTTAACCTGTAACTCTCTCCCC0.361000.203100.844801.000001.000001.00000


Target Position: 2608, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608CAGAUCAUCUGAAACUACU84.9896519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2606-2628CCCAGATCATCTGAAACTACTAAAGUAGUUUCAGAUGAUCUGGGCAGAUCAUCUGAAACUACUAAU12.920.423


Target Position: 3544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3544GCCUUUGGUGUUGAAAUAG67.2662624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8193562GCCTTTGGTGTTGAAATAGCTATTTCAACACCAAAGGC0.116900.005000.827600.750001.000001.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347GGCAUAUGCGGCCAGCAAA88.7298281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
935365GGCATATGCGGCCAGCAAATTTGCTGGCCGCATATGCC0.035200.005801.000001.000000.918500.75000


Target Position: 1858, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CUAAAUUUUGCAAAGAAAA83.6423617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501876CTAAATTTTGCAAAGAAAATTTTCTTTGCAAAATTTAG0.314400.084400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1856-1878GGCTAAATTTTGCAAAGAAAACAUUUUCUUUGCAAAAUUUAGCCCUAAAUUUUGCAAAGAAAACAU5.5-9.722


Target Position: 3057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057ACAAUUAAAGGGCAAAAAA81.5511820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2313075ACAATTAAAGGGCAAAAAATTTTTTGCCCTTTAATTGT0.313900.190400.706900.750001.000001.00000


Target Position: 4488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4488UAAACAGAAUAUUUAGAAA92.1595145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8604506TAAACAGAATATTTAGAAATTTCTAAATATTCTGTTTA0.487100.281700.534500.500001.000001.00000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794ACUACACUGGCAGAGAAAC62.1453280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321812ACTACACTGGCAGAGAAACGTTTCTCTGCCAGTGTAGT0.064400.004700.560300.500000.918500.62500


Target Position: 2914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914CCUUCUGCCUGUUUCUGUA93.0995116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382932CCTTCTGCCTGTTTCTGTATACAGAAACAGGCAGAAGG0.089400.002700.663801.000001.000001.00000


Target Position: 2417, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2417GAUGCAGUUUGGAAAUAAU95.956451

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10241719GATGCAGTTTGGAAATAAT1/1/0/097.21STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40468844..40468862(-)00STAT3(0.002)&GJC1(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842435GATGCAGTTTGGAAATAATATTATTTCCAAACTGCATC0.147600.034500.672400.750001.000001.00000


Target Position: 3582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3582AAGCAUUUUAGACUUUUUU72.0392001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553600AAGCATTTTAGACTTTTTTAAAAAAGTCTAAAATGCTT0.160600.053700.637900.500001.000001.00000


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589UUAGACUUUUUUUUAUAAA76.93041317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9903607TTAGACTTTTTTTTATAAATTTATAAAAAAAAGTCTAA0.120300.024800.534500.500001.000001.00000


Target Position: 469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469GAAGAAUCAAGCAGUUUCU84.1072581

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
467-489ACGAAGAATCAAGCAGTTTCTTCAGAAACUGCUUGAUUCUUCGUGAAGAAUCAAGCAGUUUCUUCU19.214.831


Target Position: 3048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3048GAAAUAAUAACAAUUAAAG80.5851903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7833066GAAATAATAACAATTAAAGCTTTAATTGTTATTATTTC0.396300.138300.534500.500001.000001.00000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073GGAGUUGCAGCAAAAAGUU83.3976646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801091GGAGTTGCAGCAAAAAGTTAACTTTTTGCTGCAACTCC0.082400.020100.724101.000001.000001.00000


Target Position: 4465, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4465CAGUACAUAAUAAGCUUAA91.8701154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4464483CAGTACATAATAAGCTTAATTAAGCTTATTATGTACTG0.171600.100800.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4463-4485TTCAGTACATAATAAGCTTAACTUUAAGCUUAUUAUGUACUGAACAGUACAUAAUAAGCUUAACUU18.319.032


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681GUGCAGGAUCUAGAACAGA83.1726668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716699GTGCAGGATCTAGAACAGATCTGTTCTAGATCCTGCAC0.495100.058000.569000.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730ACUUUGAUUUCAACUAUAA91.1212185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721748ACTTTGATTTCAACTATAATTATAGTTGAAATCAAAGT0.724000.008000.672400.750001.000001.00000


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634UGGUUCCAGAUUUUUUUUA71.94182016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052652TGGTTCCAGATTTTTTTTATAAAAAAAATCTGGAACCA0.339700.003200.810300.750001.000001.00000


Target Position: 3584, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3584GCAUUUUAGACUUUUUUUU78.21921151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443602GCATTTTAGACTTTTTTTTAAAAAAAAGTCTAAAATGC0.092000.022600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3582-3604AAGCATTTTAGACTTTTTTTTATAAAAAAAAGUCUAAAAUGCUUGCAUUUUAGACUUUUUUUUAUU-11.3-1.421


Target Position: 4855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4855UUGUGAGGUUUUUUGUCUU72.01332005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794873TTGTGAGGTTTTTTGTCTTAAGACAAAAAACCTCACAA0.726200.056500.508600.500001.000001.00000


Target Position: 1857, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857GCUAAAUUUUGCAAAGAAA94.913270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731875GCTAAATTTTGCAAAGAAATTTCTTTGCAAAATTTAGC0.155000.074700.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1855-1877GGGCTAAATTTTGCAAAGAAAACUUUCUUUGCAAAAUUUAGCCCGCUAAAUUUUGCAAAGAAAACU12.2-4.322


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668ACCAACAAUCCCAAGAAUG60.65543471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631686ACCAACAATCCCAAGAATGCATTCTTGGGATTGTTGGT0.196600.036600.698300.500001.000001.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481ACCUUUGACAUGGAGUUGA70.42962222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222499ACCTTTGACATGGAGTTGATCAACTCCATGTCAAAGGT0.037100.010000.629300.500001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845CAGAUCACAUGGGCUAAAU80.7184892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041863CAGATCACATGGGCTAAATATTTAGCCCATGTGATCTG0.073700.026700.775900.750001.000001.00000


Target Position: 4795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4795CUGUCCUGGCCACUGCAUU71.92242019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8304813CTGTCCTGGCCACTGCATTAATGCAGTGGCCAGGACAG0.048400.011400.775900.750001.000001.00000


Target Position: 4624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4624AACUCUGAUUGUAGCAAAA90.4851201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8684642AACTCTGATTGTAGCAAAATTTTGCTACAATCAGAGTT0.109000.020800.646600.500001.000001.00000


Target Position: 3566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3566GGUUUAAGGAGAAUCUAAG82.2153747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7573584GGTTTAAGGAGAATCTAAGCTTAGATTCTCCTTAAACC0.422400.006900.715500.750001.000001.00000


Target Position: 4493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4493AGAAUAUUUAGAAAGGUGA82.4802727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9164511AGAATATTTAGAAAGGTGATCACCTTTCTAAATATTCT0.043700.041900.500000.500001.000001.00000


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541GGAAGCUGCAGAAAGAUAC74.12991697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372559GGAAGCTGCAGAAAGATACGTATCTTTCTGCAGCTTCC0.425500.004700.689700.750000.994600.62500


Target Position: 2261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261GGCAUUCGGAAAGUAUUGU69.92432296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362279GGCATTCGGAAAGTATTGTACAATACTTTCCGAATGCC0.193500.038200.793100.750001.000001.00000


Target Position: 4894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4894GGUAUAUUGCUGUAUCUAC85.5719474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6364912GGTATATTGCTGTATCTACGTAGATACAGCAATATACC0.094700.060900.672400.750001.000001.00000


Target Position: 4485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4485UGAUAAACAGAAUAUUUAG77.47011250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8034503TGATAAACAGAATATTTAGCTAAATATTCTGTTTATCA0.582000.308600.551700.500001.000001.00000


Target Position: 4343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4343AGCUGGUCUCUGAAUUAAG75.23941552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8444361AGCTGGTCTCTGAATTAAGCTTAATTCAGAGACCAGCT0.516600.100000.715500.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440GUCGAAUGUUCUCUAUCAG77.97651191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776458GTCGAATGTTCTCTATCAGCTGATAGAGAACATTCGAC0.102300.012200.534500.500001.000001.00000


Target Position: 3773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3773UCCUUCCUGCCCCACCCUC41.47564815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493791TCCTTCCTGCCCCACCCTCGAGGGTGGGGCAGGAAGGA0.504600.194000.560300.500001.000001.00000


Target Position: 4820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4820CCAAUGUGUACUUCAUAGU77.08181295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4818-4840TTCCAATGTGTACTTCATAGTGTACUAUGAAGUACACAUUGGAACCAAUGUGUACUUCAUAGUGUU13.418.123


Target Position: 1679, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679CAAGAAUGUAAACUUUUUU83.1393675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471697CAAGAATGTAAACTTTTTTAAAAAAGTTTACATTCTTG0.357700.124100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1677-1699CCCAAGAATGTAAACTTTTTTACAAAAAAGUUUACAUUCUUGGGCAAGAAUGUAAACUUUUUUACU3.212.022


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388CACAAAAGUGAUGAACAUG75.1471563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091406CACAAAAGTGATGAACATGCATGTTCATCACTTTTGTG0.096600.010000.637900.500000.951100.62500


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625GUAAUGUAUUGGCCUUUUA89.9402227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343643GTAATGTATTGGCCTTTTATAAAAGGCCAATACATTAC0.048200.012100.646600.750001.000001.00000


Target Position: 3849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3849CCUCAUCCUGUUUGUUUUA85.0569510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093867CCTCATCCTGTTTGTTTTATAAAACAAACAGGATGAGG0.051800.019900.810301.000001.000001.00000


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837CAGGGUGUCAGAUCACAUG77.18541278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021855CAGGGTGTCAGATCACATGCATGTGATCTGACACCCTG0.205000.003200.629300.500000.956500.87500


Target Position: 2679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679AAUCUGGGCACUUUUAAAA81.9734773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722697AATCTGGGCACTTTTAAAATTTTAAAAGTGCCCAGATT0.183000.019600.508600.500001.000001.00000


Target Position: 2718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718GGGUGAUCUGCUUUUAUCU88.1469316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652736GGGTGATCTGCTTTTATCTAGATAAAAGCAGATCACCC0.044400.002400.767200.750001.000001.00000


Target Position: 4911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4911ACUUUAACUUCCAGAAAUA91.633164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9634929ACTTTAACTTCCAGAAATATATTTCTGGAAGTTAAAGT0.031200.019500.663800.750001.000001.00000


Target Position: 3835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3835CGUGUCUAAAGGUCCCUCA83.2588659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7383853CGTGTCTAAAGGTCCCTCATGAGGGACCTTTAGACACG0.208800.043600.551700.750001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230CUAAAAGUACAAAAAAUUA92.4722136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4863248CTAAAAGTACAAAAAATTATAATTTTTTGTACTTTTAG0.292300.111500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250TACTAAAAGTACAAAAAATTAGCUAAUUUUUUGUACUUUUAGUACUAAAAGUACAAAAAAUUAGCU-12.04.900


Target Position: 4463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4463UUCAGUACAUAAUAAGCUU75.08851572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9424481TTCAGTACATAATAAGCTTAAGCTTATTATGTACTGAA0.608400.076500.534500.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664GCUGACCAACAAUCCCAAG68.9612426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031682GCTGACCAACAATCCCAAGCTTGGGATTGTTGGTCAGC0.462700.065200.715500.750001.000001.00000


Target Position: 4627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4627UCUGAUUGUAGCAAAAGUU73.38191806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8664645TCTGATTGTAGCAAAAGTTAACTTTTGCTACAATCAGA0.044500.031400.577600.750001.000001.00000


Target Position: 2992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2992CUGACAUCCAAAUAGAAGA84.5689554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6883010CTGACATCCAAATAGAAGATCTTCTATTTGGATGTCAG0.202900.114400.560300.500001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415UUGAUGCAGUUUGGAAAUA69.01032417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292433TTGATGCAGTTTGGAAATATATTTCCAAACTGCATCAA0.248600.071300.603400.500001.000001.00000


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635GGUUCCAGAUUUUUUUUAA95.251965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402653GGTTCCAGATTTTTTTTAATTAAAAAAAATCTGGAACC0.325900.004600.819001.000001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658CAACAUGCUGACCAACAAU88.1521315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031676CAACATGCTGACCAACAATATTGTTGGTCAGCATGTTG0.189300.021400.637900.750000.989100.75000


Target Position: 1606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1606UGAUCUCCAACAUCUGUCA82.1298761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301624TGATCTCCAACATCTGTCATGACAGATGTTGGAGATCA0.246100.041400.500000.500000.972800.62500


Target Position: 3606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606AAUAGACUUAUUUUCCUUU78.90061080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373624AATAGACTTATTTTCCTTTAAAGGAAAATAAGTCTATT0.473100.106900.508600.500001.000001.00000


Target Position: 2977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2977CACUUUUUAACCUUGCUGA82.6216716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952995CACTTTTTAACCTTGCTGATCAGCAAGGTTAAAAAGTG0.152100.111500.569000.500001.000001.00000


Target Position: 2612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612UCAUCUGAAACUACUAACU71.51752071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832630TCATCTGAAACTACTAACTAGTTAGTAGTTTCAGATGA0.081900.002100.517200.500001.000001.00000


Target Position: 4483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4483ACUGAUAAACAGAAUAUUU84.6177553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2944501ACTGATAAACAGAATATTTAAATATTCTGTTTATCAGT0.389300.075000.706900.750000.956500.62500


Target Position: 53, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
53CGUCGCAGCCGAGGGAACA76.6731354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
75271CGTCGCAGCCGAGGGAACATGTTCCCTCGGCTGCGACG0.116100.006900.569000.750000.913000.75000


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316GUGCAUUGACAAAGACUCU81.8437786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7381334GTGCATTGACAAAGACTCTAGAGTCTTTGTCAATGCAC0.066800.009900.569000.500001.000001.00000


Target Position: 3997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3997GGUGAUAUCCAGUGGCACU87.0691381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9064015GGTGATATCCAGTGGCACTAGTGCCACTGGATATCACC0.039200.011600.646600.750001.000001.00000


Target Position: 1956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956UGGAACGAAGGGUACAUCA76.1441422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571974TGGAACGAAGGGTACATCATGATGTACCCTTCGTTCCA0.085000.017500.620700.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921UCAUUGACCUUGUGAAAAA85.7737461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351939TCATTGACCTTGTGAAAAATTTTTCACAAGGTCAATGA0.189300.028300.724100.750001.000001.00000


Target Position: 3054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3054AUAACAAUUAAAGGGCAAA75.47791516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733072ATAACAATTAAAGGGCAAATTTGCCCTTTAATTGTTAT0.243800.216300.543100.500001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381GCACAAACACAAAAGUGAU90.4727203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261399GCACAAACACAAAAGTGATATCACTTTTGTGTTTGTGC0.069300.036200.672401.000000.918500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1379-1401GGGCACAAACACAAAAGTGATGAAUCACUUUUGUGUUUGUGCCCGCACAAACACAAAAGUGAUGAU19.219.322


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663UGCUGACCAACAAUCCCAA81.6855809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311681TGCTGACCAACAATCCCAATTGGGATTGTTGGTCAGCA0.237500.054500.706900.750001.000001.00000


Target Position: 3790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3790UCCCGACCCCAGUCCCCCU55.02164073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343808TCCCGACCCCAGTCCCCCTAGGGGGACTGGGGTCGGGA0.122700.069800.525900.500000.913001.00000


Target Position: 456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456CAGCACAAUCUACGAAGAA90.0553225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
618474CAGCACAATCTACGAAGAATTCTTCGTAGATTGTGCTG0.099500.047700.612100.750000.983700.75000


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378UGGGCACAAACACAAAAGU65.56342838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091396TGGGCACAAACACAAAAGTACTTTTGTGTTTGTGCCCA0.077800.007500.637900.500001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017AUAACGUCAUUAGCAGAAU72.93951868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811035ATAACGTCATTAGCAGAATATTCTGCTAATGACGTTAT0.232500.121600.534500.500001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GAAGGACAUCAGCGGUAAG79.59391005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742111GAAGGACATCAGCGGTAAGCTTACCGCTGATGTCCTTC0.090100.027400.534500.500001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489CAGAGCAGGUAUCUUGAGA87.4379363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946507CAGAGCAGGTATCTTGAGATCTCAAGATACCTGCTCTG0.033900.003400.560300.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926GGACGAGGAGCUGGCUGAC70.95152148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884944GGACGAGGAGCTGGCTGACGTCAGCCAGCTCCTCGTCC0.042400.006900.551700.750001.000001.00000


Target Position: 4486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486GAUAAACAGAAUAUUUAGA91.4469174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4484-4506CTGATAAACAGAATATTTAGAAAUCUAAAUAUUCUGUUUAUCAGGAUAAACAGAAUAUUUAGAAAU-2.36.932


Target Position: 2657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2657CCUACUUCUGCUAUCUUUG71.85152029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202675CCTACTTCTGCTATCTTTGCAAAGATAGCAGAAGTAGG0.070100.037000.698300.750001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310UAAAGUGUGCAUUGACAAA85.4453479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211328TAAAGTGTGCATTGACAAATTTGTCAATGCACACTTTA0.193900.084500.534500.500001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913UCCUUCUGCCUGUUUCUGU62.16183276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552931TCCTTCTGCCTGTTTCTGTACAGAAACAGGCAGAAGGA0.086900.002500.663800.500001.000001.00000


Target Position: 3958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3958UGGUUGAGCUCAGGGAAUA79.28391034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6713976TGGTTGAGCTCAGGGAATATATTCCCTGAGCTCAACCA0.084700.022500.801700.750001.000001.00000


Target Position: 3096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096UCUGUAUUUAAGAAACUUA84.9327524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233114TCTGTATTTAAGAAACTTATAAGTTTCTTAAATACAGA0.127300.042300.689700.750001.000001.00000


Target Position: 4781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4781UGGUUUAUAAGCUGCUGUC63.35913123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8324799TGGTTTATAAGCTGCTGTCGACAGCAGCTTATAAACCA0.068700.005700.525900.500001.000001.00000


Target Position: 3802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802UCCCCCUGAUCCUGCUAGA67.64692572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993820TCCCCCTGATCCTGCTAGATCTAGCAGGATCAGGGGGA0.026200.014400.646600.500001.000001.00000


Target Position: 3024, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024GCCCUAGGUUUCUUUUUAA93.4825107

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1302419GCCCTAGGTTTCTTTTTAA1/1/0/0100.00STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANA17:40467249..40467267(-)00STAT3(0.002)


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787CCCUCCCGACCCCAGUCCC45.99524677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573805CCCTCCCGACCCCAGTCCCGGGACTGGGGTCGGGAGGG0.101900.072200.500000.500000.913000.75000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931AGGAGCUGGCUGACUGGAA81.6994806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511949AGGAGCTGGCTGACTGGAATTCCAGTCAGCCAGCTCCT0.341400.020700.672400.750001.000001.00000


Target Position: 2734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734UCUAAAUGCAAAUAAGGAU74.17651690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552752TCTAAATGCAAATAAGGATATCCTTATTTGCATTTAGA0.346800.085700.543100.750001.000001.00000


Target Position: 4472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4472UAAUAAGCUUAACUGAUAA91.7947158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9924490TAATAAGCTTAACTGATAATTATCAGTTAAGCTTATTA0.039900.022700.500000.500001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364ACCUGCAGCAAUACCAUUG61.50333365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692382ACCTGCAGCAATACCATTGCAATGGTATTGCTGCAGGT0.105200.032000.706900.500001.000001.00000


Target Position: 2854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854GCAGCUUUUUGUUAUUGUU85.7397463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512872GCAGCTTTTTGTTATTGTTAACAATAACAAAAAGCTGC0.193400.011200.706901.000001.000001.00000


Target Position: 3296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3296GAGGCAGGAGAAUCGCUUG75.35951538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9363314GAGGCAGGAGAATCGCTTGCAAGCGATTCTCCTGCCTC0.043500.005400.663800.500000.983700.75000


Target Position: 2713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2713AAUGUGGGUGAUCUGCUUU74.09451703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512731AATGTGGGTGATCTGCTTTAAAGCAGATCACCCACATT0.033100.003200.508600.500001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676UCCCAAGAAUGUAAACUUU74.5761632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961694TCCCAAGAATGTAAACTTTAAAGTTTACATTCTTGGGA0.193600.125700.870700.750001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677CCCAAGAAUGUAAACUUUU77.16081285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861695CCCAAGAATGTAAACTTTTAAAAGTTTACATTCTTGGG0.373500.134000.991401.000001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CCGUCAACAAAUUAAGAAA92.4021137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1531067CCGTCAACAAATTAAGAAATTTCTTAATTTGTTGACGG0.439600.310000.913801.000001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557CACCAAGGCCUCAAGAUUG74.01651715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931575CACCAAGGCCTCAAGATTGCAATCTTGAGGCCTTGGTG0.039700.002000.646600.500001.000001.00000


Target Position: 4827, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4827GUACUUCAUAGUGUAAAAA88.5433295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4825-4847GTGTACTTCATAGTGTAAAAATTUUUUUACACUAUGAAGUACACGUACUUCAUAGUGUAAAAAUUU7.220.323


Target Position: 2991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991GCUGACAUCCAAAUAGAAG75.34241539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4143009GCTGACATCCAAATAGAAGCTTCTATTTGGATGTCAGC0.191300.106400.715500.750001.000001.00000


Target Position: 1358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358AUCCCGGAAAUUUAACAUU66.46372729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691376ATCCCGGAAATTTAACATTAATGTTAAATTTCCGGGAT0.086900.024400.672400.500001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397CCCCGCACUUUAGAUUCAU72.81261884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072415CCCCGCACTTTAGATTCATATGAATCTAAAGTGCGGGG0.135200.050600.836201.000001.000001.00000


Target Position: 3909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3909GAGUUACAGGUUGGACAUG71.96262011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023927GAGTTACAGGTTGGACATGCATGTCCAACCTGTAACTC0.039700.033300.655200.500001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764AGGAGACAUGCAAGAUCUG72.26641970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783782AGGAGACATGCAAGATCTGCAGATCTTGCATGTCTCCT0.057200.038900.560300.500001.000001.00000


Target Position: 4799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4799CCUGGCCACUGCAUUCAAA89.0869260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6424817CCTGGCCACTGCATTCAAATTTGAATGCAGTGGCCAGG0.120900.011400.844801.000001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300AGCUUAAAAUUAAAGUGUG73.12081840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871318AGCTTAAAATTAAAGTGTGCACACTTTAATTTTAAGCT0.197000.024800.560300.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449UCUCUAUCAGCACAAUCUA83.2713657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728467TCTCTATCAGCACAATCTATAGATTGTGCTGATAGAGA0.266500.058900.551700.750001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264UCAGGUUGCUGGUCAAAUU77.48711247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531282TCAGGTTGCTGGTCAAATTAATTTGACCAGCAACCTGA0.092100.002500.715500.750000.956500.62500


Target Position: 3097, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3097CUGUAUUUAAGAAACUUAA90.466204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3095-3117TTCTGTATTTAAGAAACTTAAGCUUAAGUUUCUUAAAUACAGAACUGUAUUUAAGAAACUUAAGCU4.96.902


Target Position: 4470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4470CAUAAUAAGCUUAACUGAU89.0492262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4468-4490TACATAATAAGCTTAACTGATAAAUCAGUUAAGCUUAUUAUGUACAUAAUAAGCUUAACUGAUAAU20.3-8.032


Target Position: 4696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4696GCCCUGCCCGCUUCCUGUC55.60784019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3944714GCCCTGCCCGCTTCCTGTCGACAGGAAGCGGGCAGGGC0.481200.035200.681000.750001.000001.00000


Target Position: 2587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587ACCCCUCACACAGCCAAAC52.41674299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122605ACCCCTCACACAGCCAAACGTTTGGCTGTGTGAGGGGT0.835700.595100.706900.500000.972800.62500


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149AGCUGAACAACAUGUCAUU82.8669697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392167AGCTGAACAACATGTCATTAATGACATGTTGTTCAGCT0.047600.007700.844800.750001.000001.00000


Target Position: 4370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4370GACCUUCUCUAAGAUGAAC73.89671733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964388GACCTTCTCTAAGATGAACGTTCATCTTAGAGAAGGTC0.045600.007000.672400.500000.951100.62500


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229ACUAAAAGUACAAAAAAUU77.64241230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4053247ACTAAAAGTACAAAAAATTAATTTTTTGTACTTTTAGT0.386400.139900.698300.750001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675AUCCCAAGAAUGUAAACUU76.6751352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571693ATCCCAAGAATGTAAACTTAAGTTTACATTCTTGGGAT0.172700.130600.543100.500001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633GUGGUUCCAGAUUUUUUUU75.08981571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882651GTGGTTCCAGATTTTTTTTAAAAAAAATCTGGAACCAC0.107400.002100.793100.750001.000001.00000


Target Position: 3696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696GACUUGAUCUGCUGUUUCA97.193231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3694-3716TGGACTTGATCTGCTGTTTCAGAUGAAACAGCAGAUCAAGUCCAGACUUGAUCUGCUGUUUCAGAU19.219.222


Target Position: 4702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4702CCCGCUUCCUGUCCACUGC56.58743885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6424720CCCGCTTCCTGTCCACTGCGCAGTGGACAGGAAGCGGG0.418500.206600.637900.500001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CUGGAGGAGUUGCAGCAAA86.0773439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311086CTGGAGGAGTTGCAGCAAATTTGCTGCAACTCCTCCAG0.348800.043800.784500.750001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400CGCACUUUAGAUUCAUUGA86.4558413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612418CGCACTTTAGATTCATTGATCAATGAATCTAAAGTGCG0.087400.030900.698300.750001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146GUGGAGCUGUUUAGAAACU76.95671313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101164GTGGAGCTGTTTAGAAACTAGTTTCTAAACAGCTCCAC0.220200.003100.586200.500001.000001.00000


Target Position: 2399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399CCGCACUUUAGAUUCAUUG65.70462818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412417CCGCACTTTAGATTCATTGCAATGAATCTAAAGTGCGG0.092900.028900.767200.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CACAAUCUACGAAGAAUCA89.8711230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655477CACAATCTACGAAGAATCATGATTCTTCGTAGATTGTG0.114500.052900.569000.500000.994601.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
457-479AGCACAATCTACGAAGAATCAAGUGAUUCUUCGUAGAUUGUGCUCACAAUCUACGAAGAAUCAAGU14.819.233


Target Position: 101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
101CGGCUUGGCGCUGUCUCUC61.06883419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867119CGGCTTGGCGCTGTCTCTCGAGAGACAGCGCCAAGCCG0.120300.003900.603400.750000.945700.75000


Target Position: 4308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4308GAGUUUCUGUGGAAUUCUG80.6883894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9834326GAGTTTCTGTGGAATTCTGCAGAATTCCACAGAAACTC0.028500.003000.525900.500001.000001.00000


Target Position: 1844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1844UCAGAUCACAUGGGCUAAA74.08411704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031862TCAGATCACATGGGCTAAATTTAGCCCATGTGATCTGA0.053100.015700.724100.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CCAAGAAUGUAAACUUUUU86.3021424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691696CCAAGAATGTAAACTTTTTAAAAAGTTTACATTCTTGG0.390100.128000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1676-1698TCCCAAGAATGTAAACTTTTTTAAAAAAGUUUACAUUCUUGGGACCAAGAAUGUAAACUUUUUUAU3.212.022


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680AAGAAUGUAAACUUUUUUA85.2655496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301698AAGAATGTAAACTTTTTTATAAAAAAGTTTACATTCTT0.360900.124800.603400.500001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150GCUGAACAACAUGUCAUUU83.3429650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442168GCTGAACAACATGTCATTTAAATGACATGTTGTTCAGC0.047100.020200.853401.000001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047ACCCGUCAACAAAUUAAGA77.73051216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941065ACCCGTCAACAAATTAAGATCTTAATTTGTTGACGGGT0.527000.307700.629300.500001.000001.00000


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603UGGUGAUCUCCAACAUCUG70.97152142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751621TGGTGATCTCCAACATCTGCAGATGTTGGAGATCACCA0.209100.011400.560300.500000.956500.62500


Target Position: 731, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CUUUGAUUUCAACUAUAAA95.270963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527749CTTTGATTTCAACTATAAATTTATAGTTGAAATCAAAG0.731400.020500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
729-751GACTTTGATTTCAACTATAAAACUUUAUAGUUGAAAUCAAAGUCCUUUGAUUUCAACUAUAAAACU6.37.422


Target Position: 4661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4661CCCUGUUGUGGCCCAUUAA85.9903447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254679CCCTGTTGTGGCCCATTAATTAATGGGCCACAACAGGG0.646300.007800.956901.000000.956500.75000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GAGUGCAGGAUCUAGAACA93.0847117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735697GAGTGCAGGATCTAGAACATGTTCTAGATCCTGCACTC0.281700.051000.603400.500001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906UCUGGCUGGACAAUAUCAU69.17662392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671924TCTGGCTGGACAATATCATATGATATTGTCCAGCCAGA0.180600.068000.569000.750001.000001.00000


Target Position: 4810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4810CAUUCAAAUUCCAAUGUGU87.6214348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4808-4830TGCATTCAAATTCCAATGTGTACACACAUUGGAAUUUGAAUGCACAUUCAAAUUCCAAUGUGUACU18.17.432


Target Position: 4524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4524CCAUUGGGUUUAAAUCAUA93.3078111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4484542CCATTGGGTTTAAATCATATATGATTTAAACCCAATGG0.664800.027000.801701.000001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505CCUGAUUGUGACUGAGGAG75.22881553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411523CCTGATTGTGACTGAGGAGCTCCTCAGTCACAATCAGG0.034700.002900.534500.750001.000001.00000


Target Position: 3843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3843AAGGUCCCUCAUCCUGUUU65.57012837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673861AAGGTCCCTCATCCTGTTTAAACAGGATGAGGGACCTT0.079800.009000.637900.500000.940200.62500


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433UGCAGAAUUCAAACACUUG69.65882328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881451TGCAGAATTCAAACACTTGCAAGTGTTTGAATTCTGCA0.071900.033800.706900.500001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228UACUAAAAGUACAAAAAAU84.9532521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513246TACTAAAAGTACAAAAAATATTTTTTGTACTTTTAGTA0.789300.307400.672400.500001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363GACCUGCAGCAAUACCAUU84.8248534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442381GACCTGCAGCAATACCATTAATGGTATTGCTGCAGGTC0.121800.040900.810300.750001.000001.00000


Target Position: 2686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2686GCACUUUUAAAAAUAGAGA84.6832548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412704GCACTTTTAAAAATAGAGATCTCTATTTTTAAAAGTGC0.594500.062100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2684-2706GGGCACTTTTAAAAATAGAGAAAUCUCUAUUUUUAAAAGUGCCCGCACUUUUAAAAAUAGAGAAAU11.610.322


Target Position: 2468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468GUUUGAGUCCCUCACCUUU81.7834795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992486GTTTGAGTCCCTCACCTTTAAAGGTGAGGGACTCAAAC0.086700.003300.646600.750000.918500.87500


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GGAUAACGUCAUUAGCAGA97.869623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231033GGATAACGTCATTAGCAGATCTGCTAATGACGTTATCC0.214700.116900.646600.750001.000001.00000


Target Position: 2666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2666GCUAUCUUUGAGCAAUCUG69.56372338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582684GCTATCTTTGAGCAATCTGCAGATTGCTCAAAGATAGC0.062400.011600.569000.750001.000001.00000


Target Position: 4623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4623UAACUCUGAUUGUAGCAAA86.872391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7874641TAACTCTGATTGTAGCAAATTTGCTACAATCAGAGTTA0.340600.039200.534500.500001.000001.00000


Target Position: 4462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4462CUUCAGUACAUAAUAAGCU75.74241468

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4460-4482CTCTTCAGTACATAATAAGCTTAAGCUUAUUAUGUACUGAAGAGCUUCAGUACAUAAUAAGCUUAU13.620.332


Target Position: 2850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CUCAGCAGCUUUUUGUUAU78.73131099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522868CTCAGCAGCTTTTTGTTATATAACAAAAAGCTGCTGAG0.650000.002500.767200.750001.000001.00000


Target Position: 4466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4466AGUACAUAAUAAGCUUAAC73.25331824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9714484AGTACATAATAAGCTTAACGTTAAGCTTATTATGTACT0.048300.035600.560300.500001.000001.00000


Target Position: 4818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4818UUCCAAUGUGUACUUCAUA78.69571106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9294836TTCCAATGTGTACTTCATATATGAAGTACACATTGGAA0.036000.003600.629300.500001.000001.00000


Target Position: 1666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666UGACCAACAAUCCCAAGAA83.9999587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411684TGACCAACAATCCCAAGAATTCTTGGGATTGTTGGTCA0.453900.076700.551700.750001.000001.00000


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407UAGAUUCAUUGAUGCAGUU76.46841384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292425TAGATTCATTGATGCAGTTAACTGCATCAATGAATCTA0.260500.007300.525900.500001.000001.00000


Target Position: 3850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3850CUCAUCCUGUUUGUUUUAG59.44413608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243868CTCATCCTGTTTGTTTTAGCTAAAACAAACAGGATGAG0.036900.008100.637900.500001.000001.00000


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171UGAAAUCAUCAUGGGCUAU71.41982086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132189TGAAATCATCATGGGCTATATAGCCCATGATGATTTCA0.277200.168100.681000.750001.000001.00000


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215CAGGAUGGCCCAAUGGAAU78.62911110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710233CAGGATGGCCCAATGGAATATTCCATTGGGCCATCCTG0.202600.008600.775900.750000.967400.62500


Target Position: 4898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4898UAUUGCUGUAUCUACUUUA85.6053470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8694916TATTGCTGTATCTACTTTATAAAGTAGATACAGCAATA0.118900.072900.508600.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037UCAACUUCAGACCCGUCAA76.79181334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471055TCAACTTCAGACCCGTCAATTGACGGGTCTGAAGTTGA0.293100.069800.577600.750001.000001.00000


Target Position: 3907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3907GAGAGUUACAGGUUGGACA91.9254152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043925GAGAGTTACAGGTTGGACATGTCCAACCTGTAACTCTC0.052700.036400.603400.500001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GAUGGAGUACGUGCAGAAA94.457182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793917GATGGAGTACGTGCAGAAATTTCTGCACGTACTCCATC0.054700.011000.681000.750001.000001.00000


Target Position: 4192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4192GCUAGCUCGCCUCUCCUGU68.74772449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454210GCTAGCTCGCCTCTCCTGTACAGGAGAGGCGAGCTAGC0.034100.011900.646600.750000.983700.75000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408AGAUUCAUUGAUGCAGUUU73.23181826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7262426AGATTCATTGATGCAGTTTAAACTGCATCAATGAATCT0.093200.007800.724100.750001.000001.00000


Target Position: 2655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CUCCUACUUCUGCUAUCUU81.5858815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222673CTCCTACTTCTGCTATCTTAAGATAGCAGAAGTAGGAG0.069500.067900.672400.750001.000001.00000


Target Position: 4859, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4859GAGGUUUUUUGUCUUUUUU81.0665862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3174877GAGGTTTTTTGTCTTTTTTAAAAAAGACAAAAAACCTC0.796100.172200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4857-4879GTGAGGTTTTTTGTCTTTTTTTTAAAAAAGACAAAAAACCUCACGAGGUUUUUUGUCUUUUUUUUU5.517.321


Target Position: 4714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4714CCACUGCCCCCUCCCCAUC53.69864184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5644732CCACTGCCCCCTCCCCATCGATGGGGAGGGGGCAGTGG0.483800.243600.663800.750001.000001.00000


Target Position: 4893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4893UGGUAUAUUGCUGUAUCUA85.0061518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6384911TGGTATATTGCTGTATCTATAGATACAGCAATATACCA0.094300.059600.672400.750001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920AUCAUUGACCUUGUGAAAA74.14171696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841938ATCATTGACCTTGTGAAAATTTTCACAAGGTCAATGAT0.188300.025800.681000.500001.000001.00000


Target Position: 4268, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4268CGGAUUUGGCAACUCAAAA87.7454337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8134286CGGATTTGGCAACTCAAAATTTTGAGTTGCCAAATCCG0.191100.005200.913801.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4266-4288GCCGGATTTGGCAACTCAAAACCUUUUGAGUUGCCAAAUCCGGCCGGAUUUGGCAACUCAAAACCU19.220.133


Target Position: 2678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2678CAAUCUGGGCACUUUUAAA97.196530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302696CAATCTGGGCACTTTTAAATTTAAAAGTGCCCAGATTG0.179800.019100.646600.750001.000001.00000


Target Position: 2964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964ACUCCUGGCAUUGCACUUU66.35652740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212982ACTCCTGGCATTGCACTTTAAAGTGCAATGCCAGGAGT0.361300.005000.706900.750001.000001.00000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037CUGCUAAGAUUCAGUGAAA95.268864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7642055CTGCTAAGATTCAGTGAAATTTCACTGAATCTTAGCAG0.061000.006600.784500.750000.972800.62500


Target Position: 2915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2915CUUCUGCCUGUUUCUGUAA83.7606605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432933CTTCTGCCTGTTTCTGTAATTACAGAAACAGGCAGAAG0.172200.002600.603400.750001.000001.00000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091GAGAAGGACAUCAGCGGUA88.5186296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282109GAGAAGGACATCAGCGGTATACCGCTGATGTCCTTCTC0.068900.027600.629300.750001.000001.00000


Target Position: 3783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3783CCCACCCUCCCGACCCCAG51.16274383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6113801CCCACCCTCCCGACCCCAGCTGGGGTCGGGAGGGTGGG0.101300.094200.706900.750000.962000.62500


Target Position: 3895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3895AGAAGAGGGGGAGAGAGUU74.46081654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6503913AGAAGAGGGGGAGAGAGTTAACTCTCTCCCCCTCTTCT0.455800.099000.577600.750001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GGAGCAGAGAUGUGGGAAU86.3707419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661478GGAGCAGAGATGTGGGAATATTCCCACATCTCTGCTCC0.091400.002400.862101.000001.000001.00000


Target Position: 2796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2796CUAGAGGGAGAAAAAGGAA87.7122340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832814CTAGAGGGAGAAAAAGGAATTCCTTTTTCTCCCTCTAG0.130600.083100.500000.750001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CCUGCAGCAAUACCAUUGA79.923973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172383CCTGCAGCAATACCATTGATCAATGGTATTGCTGCAGG0.100400.026700.620700.750001.000001.00000


Target Position: 3583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3583AGCAUUUUAGACUUUUUUU75.86061456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5713601AGCATTTTAGACTTTTTTTAAAAAAAGTCTAAAATGCT0.114500.029600.853400.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765GGAGACAUGCAAGAUCUGA87.5479355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815783GGAGACATGCAAGATCTGATCAGATCTTGCATGTCTCC0.051400.034600.646600.750001.000001.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GCACUUUAGAUUCAUUGAU81.816791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212419GCACTTTAGATTCATTGATATCAATGAATCTAAAGTGC0.050700.030000.672401.000001.000001.00000


Target Position: 2000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000GCGGGCCAUCUUGAGCACU65.7562812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222018GCGGGCCATCTTGAGCACTAGTGCTCAAGATGGCCCGC0.062900.003000.715500.750000.951100.87500


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155UUUAGAAACUUAAUGAAAA83.3791647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631173TTTAGAAACTTAATGAAAATTTTCATTAAGTTTCTAAA0.162900.105900.500000.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350CUCAGAGGAUCCCGGAAAU77.77821210

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9135019CTCAGAGGATCCCGGAAAT1/1/0/097.21STAT3NM_139276.2+NM_213662.1+NM_003150.31+1+1NANANANA00STAT3(0.002)


Target Position: 3039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3039UUAAAUUAAGAAAUAAUAA81.7924792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9943057TTAAATTAAGAAATAATAATTATTATTTCTTAATTTAA0.275900.145300.500000.500001.000001.00000


Target Position: 2358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2358CCAACGACCUGCAGCAAUA92.3794139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782376CCAACGACCTGCAGCAATATATTGCTGCAGGTCGTTGG0.112400.097000.801701.000001.000001.00000


Target Position: 3471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3471CAGGCUGGUAAUUUAUAUA95.763156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853489CAGGCTGGTAATTTATATATATATAAATTACCAGCCTG0.611200.014800.741400.750001.000001.00000


Target Position: 2163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2163UCAUUUGCUGAAAUCAUCA79.06351064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752181TCATTTGCTGAAATCATCATGATGATTTCAGCAAATGA0.414900.003000.500000.500000.983700.62500


Target Position: 4797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4797GUCCUGGCCACUGCAUUCA72.49121934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7474815GTCCTGGCCACTGCATTCATGAATGCAGTGGCCAGGAC0.070200.011500.594800.500001.000001.00000


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800AGGGAGAAAAAGGAAAUGU67.90952546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992818AGGGAGAAAAAGGAAATGTACATTTCCTTTTTCTCCCT0.045400.038200.637900.500001.000001.00000


Target Position: 3917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3917GGUUGGACAUGAUGCACAC83.5402631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423935GGTTGGACATGATGCACACGTGTGCATCATGTCCAACC0.113000.007300.560300.750001.000001.00000


Target Position: 3092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092CCUUUCUGUAUUUAAGAAA85.5799473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3090-3112AGCCTTTCTGTATTTAAGAAACTUUUCUUAAAUACAGAAAGGCUCCUUUCUGUAUUUAAGAAACUU7.116.602


Target Position: 4342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4342UAGCUGGUCUCUGAAUUAA82.6755710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7074360TAGCTGGTCTCTGAATTAATTAATTCAGAGACCAGCTA0.257000.112100.637900.500001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GAGUUGCAGCAAAAAGUUU83.938589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591092GAGTTGCAGCAAAAAGTTTAAACTTTTTGCTGCAACTC0.062400.040100.810300.750001.000001.00000


Target Position: 4275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4275GGCAACUCAAAACCACCUU71.15872119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5144293GGCAACTCAAAACCACCTTAAGGTGGTTTTGAGTTGCC0.130500.047500.862101.000000.934800.62500


Target Position: 4923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4923AGAAAUAAACGUUAUAUAG79.27651035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254941AGAAATAAACGTTATATAGCTATATAACGTTTATTTCT0.492200.036900.551700.500001.000001.00000


Target Position: 2642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642GAUUUUUUUUAAUCUCCUA96.267545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702660GATTTTTTTTAATCTCCTATAGGAGATTAAAAAAAATC0.340200.130400.508600.750001.000001.00000


Target Position: 3956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3956UCUGGUUGAGCUCAGGGAA75.07141574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333974TCTGGTTGAGCTCAGGGAATTCCCTGAGCTCAACCAGA0.035600.017800.551700.750000.907600.62500


Target Position: 2735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735CUAAAUGCAAAUAAGGAUG65.48042852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242753CTAAATGCAAATAAGGATGCATCCTTATTTGCATTTAG0.318200.116900.517200.500001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396UGAUGAACAUGGAAGAAUC77.30051265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821414TGATGAACATGGAAGAATCGATTCTTCCATGTTCATCA0.028600.014000.543100.500001.000001.00000


Target Position: 2722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722GAUCUGCUUUUAUCUAAAU90.6999192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562740GATCTGCTTTTATCTAAATATTTAGATAAAAGCAGATC0.051100.002500.672400.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846AGAUCACAUGGGCUAAAUU85.664467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6991864AGATCACATGGGCTAAATTAATTTAGCCCATGTGATCT0.075800.024900.715500.750001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799CAGUGACCAGGCAGAAGAU90.5803196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993817CAGTGACCAGGCAGAAGATATCTTCTGCCTGGTCACTG0.027400.003600.603400.750001.000001.00000