siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 105   106   107   108   130   132   133   154   155   158   162   163   168   169   170   204   221   243   246   257  
260   267   268   271   275   331   334   337   380   381   382   383   387   389   393   430   434   435   436   437  
438   449   547   548   549   551   552   553   554   556   559   609   611   631   644   645   646   648   693   717  
744   745   746   751   752   797   800   802   872   873   875   883   887   888   890   893   894   897   920   921  
922   940   944   947   948   951   1018   1019   1040   1041   1042   1043   1064   1079   1080   1084   1085   1139   1140   1141  
1142   1145   1146   1165   1195   1214   1257   1258   1259   1262   1263   1264   1409   1411   1434   1439   1445   1536   1537   1539  
1540   1541   1589   1590   1591   1592   1593   1594   1647   1677   1678   1682   1684   1687   1693   1696   1714   1715   1779   1780  
1786   1789   1790   1791   1796   1815   1816   1817   1826   1833   1834   1835   1838   1840   1909   1913   2036   2037   2045   2050  
2151   2155   2160   2163   2168   2169   2198   2240   2241   2267   2271   2272   2313   2363   2364   2401   2405   2546   2547   2548  
2617   2618   2619   2624   2663   2725   2730   2742   2743   2744   2745   2764   2766   2768   2797   2798   2800   2814   2815   2832  
2836   2841   2855   2858   2876   2877   2880   2881   2882   2883   2884   2885   2886   2889   2891   2910   2943   2944   2945   2946  
2947   2948   2952   2955   2956   2987   3020   3022   3030   3031   3261   3265   3270   3273   3274   3275   3282   3283   3284   3287  
3330   3350   3363   3383   3384   3387   3388   3389   3390   3401   3402   3413   3414   3433   3434   3439   3464   3465   3466   3473  
3475   3476   3484   3517   3523   3524   3525   3528   3534   3535   3614   3615   3616   3617   3621   3650   3665   3666   3668   3669  
3670   3671   3672   3673   3674   3675   3676   3677   3678   3679   3681   3683   3684   3688   3696   3759   3760   3761   3762   3768  
3773   3813   3814   3815   3821   3823   3824   3825   3827   3828   3848   3861   3862   3883   3884   3893   3896   3897   3898   3902  
3903   3904   3905   3916   3917   3922   3932   3933   3934   3935   3940   3954   3955   4026   4032   4048   4049   4051   4052   4072  
4077   4085   4086   4137   4138   4139   4143   4197   4203   4204   4215   4216  
Biltr, Ernai, Sidirect 344   409   986   1997  
Biltr, Rnaxs, Sidirect 261   272   388   390   394   535   557   558   560   798   801   874   941   952   1046   1144   1643   1685   1688   1737  
1738   1795   1820   1836   1839   1841   1912   1914   2046   2161   2162   2164   2274   2397   2402   2625   2656   2662   2664   2765  
2767   2769   2801   2833   2837   2842   2887   2890   2892   2911   3012   3021   3023   3276   3285   3288   3364   3365   3471   3472  
3477   3478   3485   3536   3537   3538   3618   3619   3680   3682   3685   3689   3829   3849   3850   3863   3864   3869   3873   3894  
3936   3937   3941   3976   4073   4190   4198   4205   4217   4218  
Biltr, Sidirect 215   236   241   244   249   305   338   396   403   413   429   463   465   468   474   524   623   660   719   765  
792   795   830   865   895   925   949   966   1055   1065   1066   1089   1111   1147   1224   1284   1340   1413   1544   1598  
1652   1680   1694   1700   1736   1744   1928   1967   1977   1999   2055   2057   2059   2065   2074   2079   2093   2099   2107   2118  
2127   2128   2130   2134   2137   2153   2156   2188   2230   2312   2374   2375   2378   2387   2389   2400   2575   2654   2676   2757  
2759   2788   2792   2799   2816   2835   2843   2976   2998   3032   3042   3046   3049   3093   3095   3096   3106   3125   3133   3142  
3148   3152   3254   3257   3418   3462   3498   3547   3622   3697   3834   3871   3947   3967   3977   3980   4007   4008   4010   4019  
4020   4054   4075   4078   4098   4118   4130   4140   4144   4156   4159   4181   4182   4185   4195   4201   4212  
Biltr, Ernai, Rnaxs, Sidirect 884   2365  
Biltr, Ernai 1062   1339   2124  
Biltr, Ernai, Rnaxs 384  


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GGUGGUGUAGAUAUGAAUG81.37331215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946627GGTGGTGTAGATATGAATGCATTCATATCTACACCACC0.397300.016100.698300.750001.000001.00000


Target Position: 4072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4072ACUGAACUUAUAAUGACUU77.0381749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9734090ACTGAACTTATAATGACTTAAGTCATTATAAGTTCAGT0.100000.055800.569000.750001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940AGGUUCUAGGUAGAUUAAA81.13271242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986958AGGTTCTAGGTAGATTAAATTTAATCTACCTAGAACCT0.372900.014300.844800.750001.000001.00000


Target Position: 2892, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892CAAAUAAAAAAAAAAUAAA92.0871258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942910CAAATAAAAAAAAAATAAATTTATTTTTTTTTTATTTG0.632100.572000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2890-2912GTCAAATAAAAAAAAAATAAAGAUUUAUUUUUUUUUUAUUUGACCAAAUAAAAAAAAAAUAAAGAU-9.7-9.7


Target Position: 2815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815ACUUAAAUAUUGUAAUAUG81.09231250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522833ACTTAAATATTGTAATATGCATATTACAATATTTAAGT0.210200.076200.551700.500001.000001.00000


Target Position: 429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429CAUGUUCGGCAUUUGCAUA90.5573344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
427-449ATCATGTTCGGCATTTGCATAAGUAUGCAAAUGCCGAACAUGAUCAUGUUCGGCAUUUGCAUAAGU20.021.133


Target Position: 2267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2267CCAAGCUGCUAUAGUUCGU74.12862128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862285CCAAGCTGCTATAGTTCGTACGAACTATAGCAGCTTGG0.276600.024300.569000.750001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018AUGAAUGUCAACAACGAAU73.92432165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911036ATGAATGTCAACAACGAATATTCGTTGTTGACATTCAT0.123500.027000.646600.500001.000001.00000


Target Position: 3383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3383UGCCUCCCCUACCUGUUAC55.6183788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123401TGCCTCCCCTACCTGTTACGTAACAGGTAGGGGAGGCA0.240300.256100.672400.500001.000001.00000


Target Position: 3829, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3829CAACACAAAAUUUUUAAAA86.1598713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183847CAACACAAAATTTTTAAAATTTTAAAAATTTTGTGTTG0.294900.303400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3827-3849TCCAACACAAAATTTTTAAAATCUUUUAAAAAUUUUGUGUUGGACAACACAAAAUUUUUAAAAUCU-9.119.3


Target Position: 2168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168AAGAACAAAAUUUAAAAUU70.16972601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882186AAGAACAAAATTTAAAATTAATTTTAAATTTTGTTCTT0.473200.370900.629300.500001.000001.00000


Target Position: 236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236GAAACCAAGAGUAGUAGAU84.8721854

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
234-256TTGAAACCAAGAGTAGTAGATTTAUCUACUACUCUUGGUUUCAAGAAACCAAGAGUAGUAGAUUUU20.118.822


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264UGCAUGGUAAAUUUGUUCA73.39022238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801282TGCATGGTAAATTTGTTCATGAACAAATTTACCATGCA0.409500.051100.629300.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382CCCUUGGAGAAAGACUUUA78.9571521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601400CCCTTGGAGAAAGACTTTATAAAGTCTTTCTCCAAGGG0.275800.045000.956901.000001.000001.00000


Target Position: 3773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3773UCCUAUCUCUGUCUCCCAA81.27321229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4273791TCCTATCTCTGTCTCCCAATTGGGAGACAGAGATAGGA0.336800.076000.724100.750001.000001.00000


Target Position: 3682, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3682CAACAUACAAUUUUUCUUU83.41261008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6763700CAACATACAATTTTTCTTTAAAGAAAAATTGTATGTTG0.203800.216700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3680-3702CTCAACATACAATTTTTCTTTATAAAGAAAAAUUGUAUGUUGAGCAACAUACAAUUUUUCUUUAUU5.514.6


Target Position: 925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925CACAGUAUAUGGAAAAGGU86.5574674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945CTCACAGTATATGGAAAAGGTTCACCUUUUCCAUAUACUGUGAGCACAGUAUAUGGAAAAGGUUCU18.719.022


Target Position: 2885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885UGCUUGUCAAAUAAAAAAA79.1351496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562903TGCTTGTCAAATAAAAAAATTTTTTTATTTGACAAGCA0.861200.112700.853400.750001.000001.00000


Target Position: 3768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3768AGCAAUCCUAUCUCUGUCU73.34392243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8963786AGCAATCCTATCTCTGTCTAGACAGAGATAGGATTGCT0.158600.129400.629300.500001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921UGCUCACAGUAUAUGGAAA90.2735368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929939TGCTCACAGTATATGGAAATTTCCATATACTGTGAGCA0.215200.016900.853400.750000.994601.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401UGAUAGACAAACAAUACAU84.2857920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992419TGATAGACAAACAATACATATGTATTGTTTGTCTATCA0.202900.103400.569000.750001.000001.00000


Target Position: 3947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3947CAAUAAUUACUUAGUAUCA97.48776

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3945-3967AACAATAATTACTTAGTATCATCUGAUACUAAGUAAUUAUUGUUCAAUAAUUACUUAGUAUCAUCU15.8-10.3


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168CCCCUUGUCCCCUGCCCCU58.63553612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529186CCCCTTGTCCCCTGCCCCTAGGGGCAGGGGACAAGGGG0.263300.229000.646600.750001.000001.00000


Target Position: 2976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976CAGCUAAUGCAUCUUUAGU81.86491166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2974-2996AGCAGCTAATGCATCTTTAGTTGACUAAAGAUGCAUUAGCUGCUCAGCUAAUGCAUCUUUAGUUGU11.718.3


Target Position: 2745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2745CCUUCACGUUUGCAGUUGA87.8184554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382763CCTTCACGTTTGCAGTTGATCAACTGCAAACGTGAAGG0.186300.097200.620700.750001.000001.00000


Target Position: 2799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799GACAUAAAAUUUAAAAACU85.8649747

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2797-2819AGGACATAAAATTTAAAAACTTAAGUUUUUAAAUUUUAUGUCCUGACAUAAAAUUUAAAAACUUAU0.06.922


Target Position: 3365, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365CAACAUAUUCCUUCUAUAU93.5955188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083383CAACATATTCCTTCTATATATATAGAAGGAATATGTTG0.213500.050000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3363-3385ACCAACATATTCCTTCTATATGCAUAUAGAAGGAAUAUGUUGGUCAACAUAUUCCUUCUAUAUGCU8.46.7


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880ACUGCUGCUUGUCAAAUAA88.222518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412898ACTGCTGCTTGTCAAATAATTATTTGACAAGCAGCAGT0.153400.055600.672400.750001.000001.00000


Target Position: 4052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052CUCAAGUGUUUUAAAAAUC67.85762841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9654070CTCAAGTGTTTTAAAAATCGATTTTTAAAACACTTGAG0.359600.029500.629300.500001.000001.00000


Target Position: 2074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CAUUACUUGAUGUGAAAAU82.41981115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2072-2094ATCATTACTTGATGTGAAAATGAAUUUUCACAUCAAGUAAUGAUCAUUACUUGAUGUGAAAAUGAU14.94.622


Target Position: 535, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GCUUAUAUAGGUAUCUCAA100.0349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975553GCTTATATAGGTATCTCAATTGAGATACCTATATAAGC0.134900.014800.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
533-555CTGCTTATATAGGTATCTCAACAUUGAGAUACCUAUAUAAGCAGGCUUAUAUAGGUAUCUCAACAU21.4-2.723


Target Position: 3696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696UCUUUAUUUUAAAAAAAAU76.3561859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8493714TCTTTATTTTAAAAAAAATATTTTTTTTAAAATAAAGA0.124700.030900.715500.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GAAAACAUGCCAACACUAU85.5267783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1222-1244AGGAAAACATGCCAACACTATTTAUAGUGUUGGCAUGUUUUCCUGAAAACAUGCCAACACUAUUUU19.05.322


Target Position: 4032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4032GCAUUUUUUCUAACUCGUG72.30212362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9294050GCATTTTTTCTAACTCGTGCACGAGTTAGAAAAAATGC0.233700.176400.560300.750001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546GCCUCCAUAAUUUGGUCAU74.59332074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032564GCCTCCATAATTTGGTCATATGACCAAATTATGGAGGC0.136000.075000.844801.000000.940201.00000


Target Position: 4086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4086GACUUAUAUAAUGUAUUUC75.95241915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7914104GACTTATATAATGTATTTCGAAATACATTATATAAGTC0.149800.074800.646600.500001.000001.00000


Target Position: 4203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4203UUGAUAAAAGUUUUCCAAA76.42461849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8494221TTGATAAAAGTTTTCCAAATTTGGAAAACTTTTATCAA0.204900.052700.646600.500001.000001.00000


Target Position: 3666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3666CACACCCCUCCUCCCUCAA76.4371846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5353684CACACCCCTCCTCCCTCAATTGAGGGAGGAGGGGTGTG0.993700.990300.646600.750001.000001.00000


Target Position: 3537, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3537CCAUUAUUUUGUUUAUUUU87.3908595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3123555CCATTATTTTGTTTATTTTAAAATAAACAAAATAATGG0.356600.155300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3535-3557TCCCATTATTTTGTTTATTTTATAAAAUAAACAAAAUAAUGGGACCAUUAUUUUGUUUAUUUUAUU-9.7-1.8


Target Position: 3276, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276CUUUCUUCGGUUGCAUAAU71.612434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7043294CTTTCTTCGGTTGCATAATATTATGCAACCGAAGAAAG0.459700.100700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3274-3296GTCTTTCTTCGGTTGCATAATCCAUUAUGCAACCGAAGAAAGACCUUUCUUCGGUUGCAUAAUCCU21.114.8


Target Position: 4085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4085UGACUUAUAUAAUGUAUUU85.2529816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8054103TGACTTATATAATGTATTTAAATACATTATATAAGTCA0.135800.059500.724100.750001.000001.00000


Target Position: 4077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4077ACUUAUAAUGACUUAUAUA98.191167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9504095ACTTATAATGACTTATATATATATAAGTCATTATAAGT0.103800.052300.663800.750000.972800.62500


Target Position: 244, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GAGUAGUAGAUUUUGAUGA90.4963348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
242-264AAGAGTAGTAGATTTTGATGAAAUCAUCAAAAUCUACUACUCUUGAGUAGUAGAUUUUGAUGAAAU13.818.822


Target Position: 3275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3275UCUUUCUUCGGUUGCAUAA73.10232267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4573293TCTTTCTTCGGTTGCATAATTATGCAACCGAAGAAAGA0.456100.068700.689700.750001.000001.00000


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042CAGACCACUUACAGUUUUU84.307918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821060CAGACCACTTACAGTTTTTAAAAACTGTAAGTGGTCTG0.249900.047600.784500.750001.000001.00000


Target Position: 4201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4201GAUUGAUAAAAGUUUUCCA92.5708228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4199-4221TTGATTGATAAAAGTTTTCCAAAUGGAAAACUUUUAUCAAUCAAGAUUGAUAAAAGUUUUCCAAAU21.28.7


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593GCCAUGAUCAACAAAUUAA92.6953222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391611GCCATGATCAACAAATTAATTAATTTGTTGATCATGGC0.621100.052300.965501.000001.000001.00000


Target Position: 3617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3617GCGAUCUAUUAUCAUAUUU83.451003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1603635GCGATCTATTATCATATTTAAATATGATAATAGATCGC0.541900.396600.922401.000001.000001.00000


Target Position: 3941, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3941CAAAAACAAUAAUUACUUA100.88741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743959CAAAAACAATAATTACTTATAAGTAATTATTGTTTTTG0.141600.127900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3939-3961AACAAAAACAATAATTACTTAGTUAAGUAAUUAUUGUUUUUGUUCAAAAACAAUAAUUACUUAGUU4.65.6


Target Position: 949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949GUAGAUUAAAAGAUGAAGA87.5971580

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
947-969AGGTAGATTAAAAGATGAAGAAAUCUUCAUCUUUUAAUCUACCUGUAGAUUAAAAGAUGAAGAAAU20.48.422


Target Position: 4212, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4212GUUUUCCAAAUUGAAAAAA73.98662149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4210-4232AAGTTTTCCAAATTGAAAAAAAAUUUUUUCAAUUUGGAAAACUUGUUUUCCAAAUUGAAAAAAAAU7.720.1


Target Position: 3897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897CAGUAAGGCCUUUAAAAAA95.171127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4693915CAGTAAGGCCTTTAAAAAATTTTTTAAAGGCCTTACTG0.738100.140100.784500.750001.000001.00000


Target Position: 4204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4204UGAUAAAAGUUUUCCAAAU80.87031276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6574222TGATAAAAGTTTTCCAAATATTTGGAAAACTTTTATCA0.251800.050400.715500.750001.000001.00000


Target Position: 3618, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3618CGAUCUAUUAUCAUAUUUA104.1416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1803636CGATCTATTATCATATTTATAAATATGATAATAGATCG0.534800.408100.758601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3616-3638TGCGATCTATTATCATATTTATTUAAAUAUGAUAAUAGAUCGCACGAUCUAUUAUCAUAUUUAUUU-1.815.9


Target Position: 3270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270AGUUGUCUUUCUUCGGUUG69.53132665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393288AGTTGTCTTTCTTCGGTTGCAACCGAAGAAAGACAACT0.224900.029400.560300.500001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331GGAAUGACCGUUUCUCAGA87.1786614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
965349GGAATGACCGTTTCTCAGATCTGAGAAACGGTCATTCC0.127100.015100.646600.750001.000001.00000


Target Position: 3685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3685CAUACAAUUUUUCUUUAUU87.6741571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323703CATACAATTTTTCTTTATTAATAAAGAAAAATTGTATG0.155700.164600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3683-3705AACATACAATTTTTCTTTATTTTAAUAAAGAAAAAUUGUAUGUUCAUACAAUUUUUCUUUAUUUUU6.96.7


Target Position: 241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241CAAGAGUAGUAGAUUUUGA95.7564107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
239-261ACCAAGAGTAGTAGATTTTGATGUCAAAAUCUACUACUCUUGGUCAAGAGUAGUAGAUUUUGAUGU7.418.932


Target Position: 3523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3523CACAUAUAUAAAUCCCAUU85.1786826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553541CACATATATAAATCCCATTAATGGGATTTATATATGTG0.102900.027700.784500.750001.000001.00000


Target Position: 3670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3670CCCCUCCUCCCUCAACAUA77.09791739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513688CCCCTCCTCCCTCAACATATATGTTGAGGGAGGAGGGG0.958700.954000.948301.000001.000001.00000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693CAGGCCAUCCUUAUCCGAA86.4628679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774711CAGGCCATCCTTATCCGAATTCGGATAAGGATGGCCTG0.325300.048200.612100.750000.907600.62500


Target Position: 3934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3934CUCCUAACAAAAACAAUAA88.1596525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4473952CTCCTAACAAAAACAATAATTATTGTTTTTGTTAGGAG0.624500.560100.775900.750001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746AGAAGACCCAAACCAGAAA84.2261924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394764AGAAGACCCAAACCAGAAATTTCTGGTTTGGGTCTTCT0.299100.109200.724100.750001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685CAACAAUAAGUUCAACAAU88.1338528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6151703CAACAATAAGTTCAACAATATTGTTGAACTTATTGTTG0.560600.412100.637900.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1683-1705CTCAACAATAAGTTCAACAATTTAUUGUUGAACUUAUUGUUGAGCAACAAUAAGUUCAACAAUUUU20.56.933


Target Position: 3265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3265UCAAAAGUUGUCUUUCUUC62.37673354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533283TCAAAAGTTGTCTTTCTTCGAAGAAAGACAACTTTTGA0.172100.042900.551700.500000.962000.62500


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952ACCACAAAAUAUAUUGACU79.41571453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352970ACCACAAAATATATTGACTAGTCAATATATTTTGTGGT0.572500.089800.646600.500001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548UCUCAACACCCAGUUUAUU68.88762740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961566TCTCAACACCCAGTTTATTAATAAACTGGGTGTTGAGA0.101600.086600.715500.750000.994601.00000


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956CAAAAUAUAUUGACUCAAA100.72142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642974CAAAATATATTGACTCAAATTTGAGTCAATATATTTTG0.463800.382700.646600.750001.000001.00000


Target Position: 3976, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3976GGUUCAUAUUUAAAUUUGU88.0894532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493994GGTTCATATTTAAATTTGTACAAATTTAAATATGAACC0.177100.015900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3974-3996GTGGTTCATATTTAAATTTGTTGACAAAUUUAAAUAUGAACCACGGUUCAUAUUUAAAUUUGUUGU-3.316.1


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780CUCUUACUCAGGCUCCUUC66.63652964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9191798CTCTTACTCAGGCTCCTTCGAAGGAGCCTGAGTAAGAG0.110200.038500.637900.500001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258UGGAAGUGCAUGGUAAAUU68.40372789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511276TGGAAGTGCATGGTAAATTAATTTACCATGCACTTCCA0.236100.021300.836200.750001.000001.00000


Target Position: 3402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3402CCUUACAACCCUCCUCCAA81.38251214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3283420CCTTACAACCCTCCTCCAATTGGAGGAGGGTTGTAAGG0.341200.200900.698301.000001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080AUAAUUCGACAAGAGAAAA79.44011451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851098ATAATTCGACAAGAGAAAATTTTCTCTTGTCGAATTAT0.235700.070400.543100.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884CAAACAAGAAGCUUCAAAU90.5564345

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_388419CAAACAAGAAGCTTCAAAT1/1/0/097.75CUL2NM_003591.21NANANA10:35333533..35333551(-)00CUL2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660902CAAACAAGAAGCTTCAAATATTTGAAGCTTCTTGTTTG0.397600.339700.637900.750000.940200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
882-904TACAAACAAGAAGCTTCAAATTTAUUUGAAGCUUCUUGUUUGUACAAACAAGAAGCUUCAAAUUUU12.210.322


Target Position: 3869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3869CACACAAAUUAUUUCACUU90.4287352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7203887CACACAAATTATTTCACTTAAGTGAAATAATTTGTGTG0.208000.203500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3867-3889ATCACACAAATTATTTCACTTATAAGUGAAAUAAUUUGUGUGAUCACACAAAUUAUUUCACUUAUU19.219.3


Target Position: 249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249GUAGAUUUUGAUGAAACAU81.0961248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
247-269TAGTAGATTTTGATGAAACATGGAUGUUUCAUCAAAAUCUACUAGUAGAUUUUGAUGAAACAUGGU20.56.922


Target Position: 3547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3547GUUUAUUUUAUAUAUAUAU90.3995355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3545-3567TTGTTTATTTTATATATATATATAUAUAUAUAUAAAAUAAACAAGUUUAUUUUAUAUAUAUAUAUU-6.4-9.7


Target Position: 261, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261GAAACAUGGAACAAACUUU89.2249440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555279GAAACATGGAACAAACTTTAAAGTTTGTTCCATGTTTC0.271200.050600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
259-281ATGAAACATGGAACAAACTTTTGAAAGUUUGUUCCAUGUUUCAUGAAACAUGGAACAAACUUUUGU10.312.122


Target Position: 3848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3848UCGGAAUAUUUUAAAGCAA80.34841344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283866TCGGAATATTTTAAAGCAATTGCTTTAAAATATTCCGA0.243800.022700.646600.750001.000001.00000


Target Position: 3142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142CAUUUUGAAUCUUGAAGAU88.4986491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3140-3162AACATTTTGAATCTTGAAGATGTAUCUUCAAGAUUCAAAAUGUUCAUUUUGAAUCUUGAAGAUGUU20.47.4


Target Position: 465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465GAAGAACAAGUACUUGUUA95.6621110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
463-485CAGAAGAACAAGTACTTGTTATGUAACAAGUACUUGUUCUUCUGGAAGAACAAGUACUUGUUAUGU17.819.222


Target Position: 2842, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2842CCUAAUAAUUGUAUCUACA95.5922113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442860CCTAATAATTGTATCTACATGTAGATACAATTATTAGG0.167500.094100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2840-2862AACCTAATAATTGTATCTACATTUGUAGAUACAAUUAUUAGGUUCCUAAUAAUUGUAUCUACAUUU15.8-2.333


Target Position: 2036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036UCAGAUGAAUGAAAAGGAA85.2348819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702054TCAGATGAATGAAAAGGAATTCCTTTTCATTCATCTGA0.231700.041300.551700.750001.000001.00000


Target Position: 2766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2766UGUCUUUUUUUUUUUUUUU68.25792801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2812784TGTCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGACA0.580400.208500.706900.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413GAUUUUUUUGGAAAAUCAU84.7087874

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
411-433AAGATTTTTTTGGAAAATCATGTAUGAUUUUCCAAAAAAAUCUUGAUUUUUUUGGAAAAUCAUGUU7.4-12.021


Target Position: 2835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2835CAGAUAACCUAAUAAUUGU88.7986473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2833-2855GACAGATAACCTAATAATTGTATACAAUUAUUAGGUUAUCUGUCCAGAUAACCUAAUAAUUGUAUU-1.814.532


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107CGCCUCCGCCCACCUUCCU58.9683589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877125CGCCTCCGCCCACCTTCCTAGGAAGGTGGGCGGAGGCG0.892400.080900.577600.750000.902200.75000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284GGUUGCAUAAUCCAUUAAU85.9318734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2363302GGTTGCATAATCCATTAATATTAATGGATTATGCAACC0.453900.243000.844801.000001.000001.00000


Target Position: 2161, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161GCAGUAAAAGAACAAAAUU85.2558815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1682179GCAGTAAAAGAACAAAATTAATTTTGTTCTTTTACTGC0.611800.201500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2159-2181TAGCAGTAAAAGAACAAAATTTAAAUUUUGUUCUUUUACUGCUAGCAGUAAAAGAACAAAAUUUAU5.311.822


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624AGAAAAUGCCUAGAGAUAU82.54271095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372642AGAAAATGCCTAGAGATATATATCTCTAGGCATTTTCT0.154000.117300.681000.750001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CUCCGAGAAAUCAAAAAUG69.43342674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998735CTCCGAGAAATCAAAAATGCATTTTTGATTTCTCGGAG0.095000.020300.655200.500000.956500.62500


Target Position: 2575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575CUGUUUUCUGCUGUUUACA77.95711636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2573-2595CCCTGTTTTCTGCTGTTTACAACUGUAAACAGCAGAAAACAGGGCUGUUUUCUGCUGUUUACAACU14.714.922


Target Position: 1817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817CCAGGAAUUAGAAAAAAGU79.3031471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751835CCAGGAATTAGAAAAAAGTACTTTTTTCTAATTCCTGG0.243300.035500.637900.750001.000001.00000


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889UGUCAAAUAAAAAAAAAAU76.38941855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932907TGTCAAATAAAAAAAAAATATTTTTTTTTTATTTGACA0.689600.124100.698300.750001.000001.00000


Target Position: 2134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134CUUCGUUUUCAUUAAAUAU85.0506836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2132-2154ATCTTCGTTTTCATTAAATATGAAUAUUUAAUGAAAACGAAGAUCUUCGUUUUCAUUAAAUAUGAU-7.515.322


Target Position: 801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801GAACAGUAUAAGAAAAAAU92.1824254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691819GAACAGTATAAGAAAAAATATTTTTTCTTATACTGTTC0.257200.034200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
799-821TTGAACAGTATAAGAAAAAATTCAUUUUUUCUUAUACUGUUCAAGAACAGUAUAAGAAAAAAUUCU0.719.022


Target Position: 751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751ACCCAAACCAGAAAGUAAU74.48412088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419769ACCCAAACCAGAAAGTAATATTACTTTCTGGTTTGGGT0.274500.112100.844800.750001.000001.00000


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827UCCAACACAAAAUUUUUAA71.17782484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4523845TCCAACACAAAATTTTTAATTAAAAATTTTGTGTTGGA0.317900.326700.836200.750001.000001.00000


Target Position: 3475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3475AACCUAAAUACUUUUUUAA86.7029659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533493AACCTAAATACTTTTTTAATTAAAAAAGTATTTAGGTT0.125400.109200.612100.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730CCAUGCUUUUUCUCCCCUU76.21681882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592748CCATGCTTTTTCTCCCCTTAAGGGGAGAAAAAGCATGG0.305600.068500.706901.000001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133GCUUCGUCUUUCACUCCUU84.8559857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238151GCTTCGTCTTTCACTCCTTAAGGAGTGAAAGACGAAGC0.821500.408300.715501.000001.000001.00000


Target Position: 1680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680GAUCUCAACAAUAAGUUCA88.8463465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1678-1700CTGATCTCAACAATAAGTTCAACUGAACUUAUUGUUGAGAUCAGGAUCUCAACAAUAAGUUCAACU14.620.422


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363ACCAACAUAUUCCUUCUAU76.8451776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7233381ACCAACATATTCCTTCTATATAGAAGGAATATGTTGGT0.158800.050500.810300.750001.000001.00000


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884CUGCUUGUCAAAUAAAAAA86.178711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3312902CTGCTTGTCAAATAAAAAATTTTTTATTTGACAAGCAG0.862800.100600.784500.750001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043AGACCACUUACAGUUUUUA85.7251761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691061AGACCACTTACAGTTTTTATAAAAACTGTAAGTGGTCT0.212000.051800.689700.750001.000001.00000


Target Position: 2757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757CAGUUGAUGUGUCUUUUUU86.2534699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2755-2777TGCAGTTGATGTGTCTTTTTTTTAAAAAAGACACAUCAACUGCACAGUUGAUGUGUCUUUUUUUUU5.519.221


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GACAGAGAAUGAAGUGGAA99.296156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531463GACAGAGAATGAAGTGGAATTCCACTTCATTCTCTGTC0.197500.021200.646600.750001.000001.00000


Target Position: 2883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2883GCUGCUUGUCAAAUAAAAA95.174126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3652901GCTGCTTGTCAAATAAAAATTTTTATTTGACAAGCAGC0.864800.088900.853401.000001.000001.00000


Target Position: 2130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130GAAUCUUCGUUUUCAUUAA98.37765

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2128-2150CAGAATCTTCGTTTTCATTAAATUUAAUGAAAACGAAGAUUCUGGAAUCUUCGUUUUCAUUAAAUU8.914.822


Target Position: 3389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3389CCCUACCUGUUACCCUUAC61.99653380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6223407CCCTACCTGTTACCCTTACGTAAGGGTAACAGGTAGGG0.862300.175000.810300.750001.000001.00000


Target Position: 3863, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863GCAAAUCACACAAAUUAUU81.56431196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1783881GCAAATCACACAAATTATTAATAATTTGTGTGATTTGC0.515200.486000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3861-3883AAGCAAATCACACAAATTATTTCAAUAAUUUGUGUGAUUUGCUUGCAAAUCACACAAAUUAUUUCU-10.313.8


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888CAAGAAGCUUCAAAUUUAU90.4486351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792906CAAGAAGCTTCAAATTTATATAAATTTGAAGCTTCTTG0.787900.321800.603400.750001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744GGAGAAGACCCAAACCAGA90.65339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580762GGAGAAGACCCAAACCAGATCTGGTTTGGGTCTTCTCC0.378700.048100.646600.750000.978300.62500


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800ACAUAAAAUUUAAAAACUU82.87541057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942818ACATAAAATTTAAAAACTTAAGTTTTTAAATTTTATGT0.247000.037200.569000.750001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802AACAGUAUAAGAAAAAAUU79.19591485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856820AACAGTATAAGAAAAAATTAATTTTTTCTTATACTGTT0.320300.049600.637900.500001.000001.00000


Target Position: 3477, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477CCUAAAUACUUUUUUAAAA93.2614204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043495CCTAAATACTTTTTTAAAATTTTAAAAAAGTATTTAGG0.135800.104800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3475-3497AACCTAAATACTTTTTTAAAAAAUUUUAAAAAAGUAUUUAGGUUCCUAAAUACUUUUUUAAAAAAU-9.1-2.3


Target Position: 3916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3916UCCACAGUGAUAUUAUUAC64.07973206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623934TCCACAGTGATATTATTACGTAATAATATCACTGTGGA0.101100.018100.689700.500001.000001.00000


Target Position: 3125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125GAUAUAUUGGAUCUAAACA94.5389148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3123-3145TAGATATATTGGATCTAAACATTUGUUUAGAUCCAAUAUAUCUAGAUAUAUUGGAUCUAAACAUUU14.6-8.6


Target Position: 2743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2743CCCCUUCACGUUUGCAGUU70.10222606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232761CCCCTTCACGTTTGCAGTTAACTGCAAACGTGAAGGGG0.193300.090900.844801.000001.000001.00000


Target Position: 3288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288GCAUAAUCCAUUAAUUCUA94.7191144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3823306GCATAATCCATTAATTCTATAGAATTAATGGATTATGC0.737300.332700.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3286-3308TTGCATAATCCATTAATTCTAGCUAGAAUUAAUGGAUUAUGCAAGCAUAAUCCAUUAAUUCUAGCU6.98.7


Target Position: 1912, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912GUGAAGUUAAAAUGAACUA87.334600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381930GTGAAGTTAAAATGAACTATAGTTCATTTTAACTTCAC0.141100.016500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1910-1932AGGTGAAGTTAAAATGAACTATTUAGUUCAUUUUAACUUCACCUGUGAAGUUAAAAUGAACUAUUU19.219.232


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663ACAUUUCUUAAAACUUUAU76.28031873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782681ACATTTCTTAAAACTTTATATAAAGTTTTAAGAAATGT0.174900.065700.663800.750001.000001.00000


Target Position: 2046, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2046GAAAAGGAACUGACAAAAA95.0387129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952064GAAAAGGAACTGACAAAAATTTTTGTCAGTTCCTTTTC0.353500.236600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2044-2066ATGAAAAGGAACTGACAAAAACAUUUUUGUCAGUUCCUUUUCAUGAAAAGGAACUGACAAAAACAU14.918.722


Target Position: 3697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697CUUUAUUUUAAAAAAAAUA85.5118785

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3695-3717TTCTTTATTTTAAAAAAAATAAGUAUUUUUUUUAAAAUAAAGAACUUUAUUUUAAAAAAAAUAAGU-12.0-9.7


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411GUGACAACUUACUGAAGAA100.97938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341429GTGACAACTTACTGAAGAATTCTTCAGTAAGTTGTCAC0.128900.034300.620700.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CUUGGAGAAAGACUUUAUA89.0737446

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1038419CTTGGAGAAAGACTTTATA1/1/0/094.96CUL2NM_003591.21NANANA10:35351935..35351953(-)00CUL2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816402CTTGGAGAAAGACTTTATATATAAAGTCTTTCTCCAAG0.414000.049800.594800.750001.000001.00000


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267UGGAACAAACUUUUGACGA70.2662590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964285TGGAACAAACTTTTGACGATCGTCAAAAGTTTGTTCCA0.100800.034400.551700.500001.000001.00000


Target Position: 2987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987UCUUUAGUUGCGUUUUUAU74.27712105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333005TCTTTAGTTGCGTTTTTATATAAAAACGCAACTAAAGA0.402200.030000.681000.750001.000001.00000


Target Position: 1089, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089CAAGAGAAAAAAAAUGACA88.1543526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1087-1109GACAAGAGAAAAAAAATGACATGUGUCAUUUUUUUUCUCUUGUCCAAGAGAAAAAAAAUGACAUGU14.819.111


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840AGAUGUUUGAAUUAUUUUA91.0758310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041858AGATGTTTGAATTATTTTATAAAATAATTCAAACATCT0.309300.079600.689700.750001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CAGUUUAUUAAAAAGAAUA93.6732187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719576CAGTTTATTAAAAAGAATATATTCTTTTTAATAAACTG0.176500.031500.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
556-578CCCAGTTTATTAAAAAGAATAAAUAUUCUUUUUAAUAAACUGGGCAGUUUAUUAAAAAGAAUAAAU5.34.621


Target Position: 3759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3759CUGGCCUCAAGCAAUCCUA79.74471417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773777CTGGCCTCAAGCAATCCTATAGGATTGCTTGAGGCCAG0.378400.026500.612100.750000.978300.87500


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449GAGAGUUUUGGAGUCAGAA92.3328242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874467GAGAGTTTTGGAGTCAGAATTCTGACTCCAAAACTCTC0.171700.020200.637900.750001.000001.00000


Target Position: 272, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272CAAACUUUUGACGACAAUA89.9793386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807290CAAACTTTTGACGACAATATATTGTCGTCAAAAGTTTG0.139700.057500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
270-292AACAAACTTTTGACGACAATAAAUAUUGUCGUCAAAAGUUUGUUCAAACUUUUGACGACAAUAAAU21.13.222


Target Position: 3434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3434AGAGUCACUCUCAUCAAUC72.37282354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793452AGAGTCACTCTCATCAATCGATTGATGAGAGTGACTCT0.276100.032400.543100.500000.940200.62500


Target Position: 4198, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4198GUUGAUUGAUAAAAGUUUU83.79970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9324216GTTGATTGATAAAAGTTTTAAAACTTTTATCAATCAAC0.108000.054600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4196-4218TTGTTGATTGATAAAAGTTTTCCAAAACUUUUAUCAAUCAACAAGUUGAUUGAUAAAAGUUUUCCU3.213.8


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040AGCAGACCACUUACAGUUU79.2911473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271058AGCAGACCACTTACAGTTTAAACTGTAAGTGGTCTGCT0.211400.017100.853400.750001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559AGUUUAUUAAAAAGAAUAA90.385357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708577AGTTTATTAAAAAGAATAATTATTCTTTTTAATAAACT0.179100.032500.672400.750001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841GAUGUUUGAAUUAUUUUAU85.952731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331859GATGTTTGAATTATTTTATATAAAATAATTCAAACATC0.329100.054300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1839-1861CAGATGTTTGAATTATTTTATAGAUAAAAUAAUUCAAACAUCUGGAUGUUUGAAUUAUUUUAUAGU-7.512.121


Target Position: 2059, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2059CAAAAACAAUCAAAUCAUU88.3812502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2057-2079GACAAAAACAATCAAATCATTACAAUGAUUUGAUUGUUUUUGUCCAAAAACAAUCAAAUCAUUACU7.25.622


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644AGGAGAGCUAGCAUUGGAU81.9241155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
976662AGGAGAGCTAGCATTGGATATCCAATGCTAGCTCTCCT0.099000.036200.663800.750001.000001.00000


Target Position: 4098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4098GUAUUUCUCAUUUUACCUU80.70081299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4096-4118ATGTATTTCTCATTTTACCTTTCAAGGUAAAAUGAGAAAUACAUGUAUUUCUCAUUUUACCUUUCU18.66.9


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151AUGAACUUUAGCAGUAAAA76.75791797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972169ATGAACTTTAGCAGTAAAATTTTACTGCTAAAGTTCAT0.149500.098100.655200.500000.994601.00000


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679CCUCAACAUACAAUUUUUC69.7962636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4053697CCTCAACATACAATTTTTCGAAAAATTGTATGTTGAGG0.524400.517500.672400.750001.000001.00000


Target Position: 3871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3871CACAAAUUAUUUCACUUAU87.3609598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3869-3891CACACAAATTATTTCACTTATAAAUAAGUGAAAUAAUUUGUGUGCACAAAUUAUUUCACUUAUAAU20.35.3


Target Position: 2744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2744CCCUUCACGUUUGCAGUUG57.78213667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6582762CCCTTCACGTTTGCAGTTGCAACTGCAAACGTGAAGGG0.192100.097100.844800.750001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815CCCCAGGAAUUAGAAAAAA82.40951116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781833CCCCAGGAATTAGAAAAAATTTTTTCTAATTCCTGGGG0.244800.026500.991401.000001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GCUCACAGUAUAUGGAAAA89.0574448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
895940GCTCACAGTATATGGAAAATTTTCCATATACTGTGAGC0.255400.018800.853401.000000.994600.87500


Target Position: 2274, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274GCUAUAGUUCGUAUCAUGA92.4574234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032292GCTATAGTTCGTATCATGATCATGATACGAACTATAGC0.165100.081800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2272-2294CTGCTATAGTTCGTATCATGAAAUCAUGAUACGAACUAUAGCAGGCUAUAGUUCGUAUCAUGAAAU14.911.233


Target Position: 2656, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656CAUUAUGACAUUUCUUAAA93.1644210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612674CATTATGACATTTCTTAAATTTAAGAAATGTCATAATG0.501000.015500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2654-2676GTCATTATGACATTTCTTAAAACUUUAAGAAAUGUCAUAAUGACCAUUAUGACAUUUCUUAAAACU7.18.722


Target Position: 3815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3815CCACUGCAUCCAUCCAACA86.1813710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6353833CCACTGCATCCATCCAACATGTTGGATGGATGCAGTGG0.785300.147600.637900.750001.000001.00000


Target Position: 798, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GUUGAACAGUAUAAGAAAA96.148899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
712816GTTGAACAGTATAAGAAAATTTTCTTATACTGTTCAAC0.327300.032000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
796-818ATGTTGAACAGTATAAGAAAAAAUUUUCUUAUACUGUUCAACAUGUUGAACAGUAUAAGAAAAAAU7.120.522


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393AGACUUUAUACAGAAACUA86.4362682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971411AGACTTTATACAGAAACTATAGTTTCTGTATAAAGTCT0.325700.164400.551700.750001.000001.00000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648GAGCUAGCAUUGGAUAUGU83.36971014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
896666GAGCTAGCATTGGATATGTACATATCCAATGCTAGCTC0.120600.018700.603400.500001.000001.00000


Target Position: 560, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GUUUAUUAAAAAGAAUAAA86.0358724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
648578GTTTATTAAAAAGAATAAATTTATTCTTTTTAATAAAC0.185200.042700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
558-580CAGTTTATTAAAAAGAATAAATTUUUAUUCUUUUUAAUAAACUGGUUUAUUAAAAAGAAUAAAUUU6.9-7.522


Target Position: 2837, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2837GAUAACCUAAUAAUUGUAU83.6586987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312855GATAACCTAATAATTGTATATACAATTATTAGGTTATC0.129400.071400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2835-2857CAGATAACCTAATAATTGTATCTAUACAAUUAUUAGGUUAUCUGGAUAACCUAAUAAUUGUAUCUU6.918.522


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590GAAGCCAUGAUCAACAAAU85.2222820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451608GAAGCCATGATCAACAAATATTTGTTGATCATGGCTTC0.549700.016200.663800.750001.000001.00000


Target Position: 3528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528AUAUAAAUCCCAUUAUUUU82.83381066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813546ATATAAATCCCATTATTTTAAAATAATGGGATTTATAT0.263000.064900.543100.500001.000001.00000


Target Position: 3095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095GCAUAAAGAAUGCUUUAUU87.1327618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3093-3115CAGCATAAAGAATGCTTTATTTTAAUAAAGCAUUCUUUAUGCUGGCAUAAAGAAUGCUUUAUUUUU13.63.5


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875AGAGUAUUACAAACAAGAA95.6365112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
965893AGAGTATTACAAACAAGAATTCTTGTTTGTAATACTCT0.463900.216400.551700.750001.000001.00000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886GCUUGUCAAAUAAAAAAAA90.257370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2632904GCTTGTCAAATAAAAAAAATTTTTTTTATTTGACAAGC0.871400.124700.853401.000001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826AGAAAAAAGUGUACAGAUG76.35281860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181844AGAAAAAAGTGTACAGATGCATCTGTACACTTTTTTCT0.154800.036600.569000.500001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764UGUGUCUUUUUUUUUUUUU65.79043044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782782TGTGTCTTTTTTTTTTTTTAAAAAAAAAAAAAGACACA0.612500.014600.706900.750001.000001.00000


Target Position: 2876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2876UGAUACUGCUGCUUGUCAA89.8121394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522894TGATACTGCTGCTTGTCAATTGACAAGCAGCAGTATCA0.103600.022000.577600.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046CCACUUACAGUUUUUACAU84.1508931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301064CCACTTACAGTTTTTACATATGTAAAAACTGTAAGTGG0.268900.103800.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1044-1066GACCACTTACAGTTTTTACATGCAUGUAAAAACUGUAAGUGGUCCCACUUACAGUUUUUACAUGCU7.219.021


Target Position: 4182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4182CUUGUUUUGAUAACUUGUU72.30042363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4180-4202CCCTTGTTTTGATAACTTGTTGAAACAAGUUAUCAAAACAAGGGCUUGUUUUGAUAACUUGUUGAU17.85.6


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687ACAAUAAGUUCAACAAUUU82.55161092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521705ACAATAAGTTCAACAATTTAAATTGTTGAACTTATTGT0.582900.405900.706900.750001.000001.00000


Target Position: 4073, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4073CUGAACUUAUAAUGACUUA90.1993373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6094091CTGAACTTATAATGACTTATAAGTCATTATAAGTTCAG0.195800.054500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4071-4093TACTGAACTTATAATGACTTATAUAAGUCAUUAUAAGUUCAGUACUGAACUUAUAAUGACUUAUAU19.219.2


Target Position: 2910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2910AGAAAUAGAAUGCCUUUUU75.93361917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312928AGAAATAGAATGCCTTTTTAAAAAGGCATTCTATTTCT0.108000.055500.724100.750001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920CUGCUCACAGUAUAUGGAA86.9113641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936938CTGCTCACAGTATATGGAATTCCATATACTGTGAGCAG0.216900.016600.612100.750000.989100.62500


Target Position: 2079, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079CUUGAUGUGAAAAUGAUUA86.3983684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2077-2099TACTTGATGTGAAAATGATTAACUAAUCAUUUUCACAUCAAGUACUUGAUGUGAAAAUGAUUAACU7.220.522


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337ACCGUUUCUCAGAUAUCUA87.3082602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971355ACCGTTTCTCAGATATCTATAGATATCTGAGAAACGGT0.100100.043200.681000.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GUUCAUGUUGAACAGUAUA90.7527332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
790-812TTGTTCATGTTGAACAGTATAAGUAUACUGUUCAACAUGAACAAGUUCAUGUUGAACAGUAUAAGU19.020.532


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204AGAUUUCAACACUACACUU87.1156619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845222AGATTTCAACACTACACTTAAGTGTAGTGTTGAAATCT0.201500.152200.586200.750001.000001.00000


Target Position: 1144, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144CUGGUUUACCUCAUAUGAU84.9573844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021162CTGGTTTACCTCATATGATATCATATGAGGTAAACCAG0.186500.038600.603400.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1142-1164CACTGGTTTACCTCATATGATTCAUCAUAUGAGGUAAACCAGUGCUGGUUUACCUCAUAUGAUUCU14.920.023


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591AAGCCAUGAUCAACAAAUU83.6912983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351609AAGCCATGATCAACAAATTAATTTGTTGATCATGGCTT0.565800.020200.629300.500001.000001.00000


Target Position: 2843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843CUAAUAAUUGUAUCUACAU88.3726504

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2841-2863ACCTAATAATTGTATCTACATTAAUGUAGAUACAAUUAUUAGGUCUAAUAAUUGUAUCUACAUUAU20.3-8.022


Target Position: 3614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3614ACUGCGAUCUAUUAUCAUA95.35119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813632ACTGCGATCTATTATCATATATGATAATAGATCGCAGT0.524400.019600.663800.750001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645GGAGAGCUAGCAUUGGAUA94.9468133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
945663GGAGAGCTAGCATTGGATATATCCAATGCTAGCTCTCC0.105200.032400.827601.000001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890AGAAGCUUCAAAUUUAUUA85.324803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543908AGAAGCTTCAAATTTATTATAATAAATTTGAAGCTTCT0.770200.319100.689700.750001.000001.00000


Target Position: 3030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030UCCUAUUUAAAUCCUACAU69.06262719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6613048TCCTATTTAAATCCTACATATGTAGGATTTAAATAGGA0.181000.125900.715500.750001.000001.00000


Target Position: 1111, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111CAAAUAUGUACGUCUUACU85.6492775

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1109-1131GGCAAATATGTACGTCTTACTCCAGUAAGACGUACAUAUUUGCCCAAAUAUGUACGUCUUACUCCU21.4-1.833


Target Position: 4138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4138GGCAAACCAUAUAAUAUUG81.13171243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6694156GGCAAACCATATAATATTGCAATATTATATGGTTTGCC0.433000.036200.853400.750001.000001.00000


Target Position: 986, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986CCUACAUCCAAGUUCAUAU88.9747453

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_498619CCTACATCCAAGTTCATAT1/1/0/097.75CUL2NM_003591.21NANANA10:35327948..35327966(-)00CUL2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
984-1006TACCTACATCCAAGTTCATATACAUAUGAACUUGGAUGUAGGUACCUACAUCCAAGUUCAUAUACU16.120.322


Target Position: 2312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312GCACAAUGCCCUUAUUCAA95.3332120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2310-2332CGGCACAATGCCCTTATTCAAGAUUGAAUAAGGGCAUUGUGCCGGCACAAUGCCCUUAUUCAAGAU8.918.132


Target Position: 2765, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765GUGUCUUUUUUUUUUUUUU78.11981617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212783GTGTCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGACAC0.589800.223200.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2763-2785ATGTGTCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGACACAUGUGUCUUUUUUUUUUUUUUUAU-11.319.200


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCUCAACAAUAAGUUCAAC63.98113219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881700TCTCAACAATAAGTTCAACGTTGAACTTATTGTTGAGA0.476900.232200.577600.500000.940200.62500


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380ACCCCUUGGAGAAAGACUU67.77892850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584398ACCCCTTGGAGAAAGACTTAAGTCTTTCTCCAAGGGGT0.262200.046700.715500.750000.945700.62500


Target Position: 2241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2241GUUGAUGAGGACCGGAAAA82.94611048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942259GTTGATGAGGACCGGAAAATTTTCCGGTCCTCATCAAC0.095800.023200.646600.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941GGUUCUAGGUAGAUUAAAA107.4844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910959GGTTCTAGGTAGATTAAAATTTTAATCTACCTAGAACC0.629700.017800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
939-961AAGGTTCTAGGTAGATTAAAAGAUUUUAAUCUACCUAGAACCUUGGUUCUAGGUAGAUUAAAAGAU2.118.922


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031CCUAUUUAAAUCCUACAUG70.56872556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583049CCTATTTAAATCCTACATGCATGTAGGATTTAAATAGG0.181600.113300.689700.750001.000001.00000


Target Position: 3684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3684ACAUACAAUUUUUCUUUAU79.42941452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6993702ACATACAATTTTTCTTTATATAAAGAAAAATTGTATGT0.166500.180200.663800.750001.000001.00000


Target Position: 3414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3414CCUCCAACAGUUUAGAUAC75.83621932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903432CCTCCAACAGTTTAGATACGTATCTAAACTGTTGGAGG0.138900.052100.663800.750000.923900.62500


Target Position: 3439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3439CACUCUCAUCAAUCACAGA94.3373161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823457CACTCTCATCAATCACAGATCTGTGATTGATGAGAGTG0.350100.070900.569000.500001.000001.00000


Target Position: 4019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4019GGUUUAUUCAAUUGCAUUU84.4032905

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4017-4039TTGGTTTATTCAATTGCATTTTTAAAUGCAAUUGAAUAAACCAAGGUUUAUUCAAUUGCAUUUUUU20.0-0.3


Target Position: 1914, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914GAAGUUAAAAUGAACUAUU88.3637506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911932GAAGTTAAAATGAACTATTAATAGTTCATTTTAACTTC0.116500.034700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1912-1934GTGAAGTTAAAATGAACTATTTGAAUAGUUCAUUUUAACUUCACGAAGUUAAAAUGAACUAUUUGU14.54.921


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552AACACCCAGUUUAUUAAAA81.29441223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946570AACACCCAGTTTATTAAAATTTTAATAAACTGGGTGTT0.118000.075500.646600.500001.000001.00000


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079UAUAAUUCGACAAGAGAAA78.14241613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881097TATAATTCGACAAGAGAAATTTCTCTTGTCGAATTATA0.166500.065900.543100.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108GCCUCCGCCCACCUUCCUC56.56743731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483126GCCTCCGCCCACCTTCCTCGAGGAAGGTGGGCGGAGGC0.864500.063200.689700.750000.989100.75000


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696UCAACAAUUUUAUCAAAAA86.1353716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561714TCAACAATTTTATCAAAAATTTTTGATAAAATTGTTGA0.742900.605100.724100.750001.000001.00000


Target Position: 3049, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3049GAAAAAUGUCUAGAUUAUU87.727566

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3047-3069ATGAAAAATGTCTAGATTATTGTAAUAAUCUAGACAUUUUUCAUGAAAAAUGUCUAGAUUAUUGUU6.6-3.3


Target Position: 1541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1541GCUGGCAAAACGUUUAAUU76.81211785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271559GCTGGCAAAACGTTTAATTAATTAAACGTTTTGCCAGC0.157800.046500.844801.000001.000001.00000


Target Position: 3917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3917CCACAGUGAUAUUAUUACU89.3456433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403935CCACAGTGATATTATTACTAGTAATAATATCACTGTGG0.109000.016300.637900.750001.000001.00000


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903GGCCUUUAAAAAAUCCACA83.43671005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4683921GGCCTTTAAAAAATCCACATGTGGATTTTTTAAAGGCC0.313000.248700.793100.750001.000001.00000


Target Position: 895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CUUCAAAUUUAUUACAAGA90.3817358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
893-915AGCTTCAAATTTATTACAAGAATUCUUGUAAUAAAUUUGAAGCUCUUCAAAUUUAUUACAAGAAUU11.87.431


Target Position: 1340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340CCUUACGUCAGUUGUAAAU77.24921715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1338-1360GCCCTTACGTCAGTTGTAAATTAAUUUACAACUGACGUAAGGGCCCUUACGUCAGUUGUAAAUUAU7.219.622


Target Position: 4159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4159CAUUCACUGUCAAAAAGCA93.1122212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4157-4179TACATTCACTGTCAAAAAGCAAAUGCUUUUUGACAGUGAAUGUACAUUCACUGUCAAAAAGCAAAU12.319.2


Target Position: 3621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621UCUAUUAUCAUAUUUAUUG65.86593034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8493639TCTATTATCATATTTATTGCAATAAATATGATAATAGA0.455600.322600.577600.500001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243AGAGUAGUAGAUUUUGAUG76.0561901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958261AGAGTAGTAGATTTTGATGCATCAAAATCTACTACTCT0.226600.015600.569000.500001.000001.00000


Target Position: 2946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2946AGGUUGACCACAAAAUAUA88.83467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862964AGGTTGACCACAAAATATATATATTTTGTGGTCAACCT0.409900.034700.801700.750001.000001.00000


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797UGUUGAACAGUAUAAGAAA92.3102245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715815TGTTGAACAGTATAAGAAATTTCTTATACTGTTCAACA0.348300.031800.706900.750001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944UCUAGGUAGAUUAAAAGAU74.27822103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975962TCTAGGTAGATTAAAAGATATCTTTTAATCTACCTAGA0.362400.086800.543100.750001.000001.00000


Target Position: 3761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3761GGCCUCAAGCAAUCCUAUC68.49762778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853779GGCCTCAAGCAATCCTATCGATAGGATTGCTTGAGGCC0.524600.059300.819000.750000.978300.62500


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409CUGUGACAACUUACUGAAG76.12591891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741427CTGTGACAACTTACTGAAGCTTCAGTAAGTTGTCACAG0.099500.016600.646600.500001.000001.00000


Target Position: 524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524CUAUAUGGACUGCUUAUAU90.3531362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
522-544GACTATATGGACTGCTTATATAGAUAUAAGCAGUCCAUAUAGUCCUAUAUGGACUGCUUAUAUAGU14.914.022


Target Position: 2625, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625GAAAAUGCCUAGAGAUAUU91.6342280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882643GAAAATGCCTAGAGATATTAATATCTCTAGGCATTTTC0.139200.110900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2623-2645AAGAAAATGCCTAGAGATATTTCAAUAUCUCUAGGCAUUUUCUUGAAAAUGCCUAGAGAUAUUUCU15.914.032


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246GUAGUAGAUUUUGAUGAAA91.9802266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742264GTAGTAGATTTTGATGAAATTTCATCAAAATCTACTAC0.227500.029400.681000.750001.000001.00000


Target Position: 3932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932UACUCCUAACAAAAACAAU75.09922017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073950TACTCCTAACAAAAACAATATTGTTTTTGTTAGGAGTA0.827600.467300.672400.500001.000001.00000


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944UCAGGUUGACCACAAAAUA82.62961087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062962TCAGGTTGACCACAAAATATATTTTGTGGTCAACCTGA0.155900.018100.681000.750001.000001.00000


Target Position: 872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872AGGAGAGUAUUACAAACAA94.9868131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734890AGGAGAGTATTACAAACAATTGTTTGTAATACTCTCCT0.750600.029900.698300.750001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381CCCCUUGGAGAAAGACUUU74.11852131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597399CCCCTTGGAGAAAGACTTTAAAGTCTTTCTCCAAGGGG0.269800.045300.991401.000000.978300.62500


Target Position: 2065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065CAAUCAAAUCAUUACUUGA97.955871

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2063-2085AACAATCAAATCATTACTTGATGUCAAGUAAUGAUUUGAUUGUUCAAUCAAAUCAUUACUUGAUGU11.87.432


Target Position: 2156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156CUUUAGCAGUAAAAGAACA87.4582587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2154-2176AACTTTAGCAGTAAAAGAACAAAUGUUCUUUUACUGCUAAAGUUCUUUAGCAGUAAAAGAACAAAU13.319.733


Target Position: 3133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3133GGAUCUAAACAUUUUGAAU94.8826139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3131-3153TTGGATCTAAACATTTTGAATCTAUUCAAAAUGUUUAGAUCCAAGGAUCUAAACAUUUUGAAUCUU7.716.0


Target Position: 4190, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4190GAUAACUUGUUGAUUGAUA94.9427134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894208GATAACTTGTTGATTGATATATCAATCAACAAGTTATC0.430700.025400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4188-4210TTGATAACTTGTTGATTGATAAAUAUCAAUCAACAAGUUAUCAAGAUAACUUGUUGAUUGAUAAAU16.24.6


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947AGGUAGAUUAAAAGAUGAA91.1938302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433965AGGTAGATTAAAAGATGAATTCATCTTTTAATCTACCT0.265700.133900.672400.750001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592AGCCAUGAUCAACAAAUUA88.3183509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821610AGCCATGATCAACAAATTATAATTTGTTGATCATGGCT0.625800.025900.819000.750001.000001.00000


Target Position: 830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830GUUUUAUCAGGAAAUUUUU80.62121310

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
828-850AAGTTTTATCAGGAAATTTTTGAAAAAAUUUCCUGAUAAAACUUGUUUUAUCAGGAAAUUUUUGAU-12.02.122


Target Position: 2188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188CUACAUCAAUGCAGAAAGA89.5417416

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2186-2208TACTACATCAATGCAGAAAGACAUCUUUCUGCAUUGAUGUAGUACUACAUCAAUGCAGAAAGACAU16.621.532


Target Position: 2833, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833GACAGAUAACCUAAUAAUU92.4965232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382851GACAGATAACCTAATAATTAATTATTAGGTTATCTGTC0.609000.098500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2831-2853ATGACAGATAACCTAATAATTGTAAUUAUUAGGUUAUCUGUCAUGACAGAUAACCUAAUAAUUGUU-8.020.332


Target Position: 305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305GUUGGAAUACGUCGAAAGA85.2583814

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
303-325ATGTTGGAATACGTCGAAAGAGCUCUUUCGACGUAUUCCAACAUGUUGGAAUACGUCGAAAGAGCU21.020.133


Target Position: 3485, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3485CUUUUUUAAAAAAGAAAAU73.40222236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6963503CTTTTTTAAAAAAGAAAATATTTTCTTTTTTAAAAAAG0.206200.086000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3483-3505TACTTTTTTAAAAAAGAAAATTGAUUUUCUUUUUUAAAAAAGUACUUUUUUAAAAAAGAAAAUUGU5.5-9.1


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154GGCUGCCUCCCCCUCCCCU61.79583395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496172GGCTGCCTCCCCCTCCCCTAGGGGAGGGGGAGGCAGCC0.812600.552900.655200.750000.956500.62500


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165AGGAGCUGCAAAACCACAU72.5662331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721183AGGAGCTGCAAAACCACATATGTGGTTTTGCAGCTCCT0.120600.024200.689700.750001.000001.00000


Target Position: 2160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160AGCAGUAAAAGAACAAAAU79.39291458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772178AGCAGTAAAAGAACAAAATATTTTGTTCTTTTACTGCT0.595700.122700.844800.750001.000001.00000


Target Position: 3850, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3850GGAAUAUUUUAAAGCAAAU90.1791374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4863868GGAATATTTTAAAGCAAATATTTGCTTTAAAATATTCC0.387000.062200.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3848-3870TCGGAATATTTTAAAGCAAATCAAUUUGCUUUAAAAUAUUCCGAGGAAUAUUUUAAAGCAAAUCAU18.61.8


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430AUGUUCGGCAUUUGCAUAA72.82462305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983448ATGTTCGGCATTTGCATAATTATGCAAATGCCGAACAT0.109300.014400.620700.500000.994601.00000


Target Position: 2797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2797AGGACAUAAAAUUUAAAAA89.6604402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302815AGGACATAAAATTTAAAAATTTTTAAATTTTATGTCCT0.243600.016900.844800.750001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397GUUCUGAUAGACAAACAAU89.6049410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282415GTTCTGATAGACAAACAATATTGTTTGTCTATCAGAAC0.233900.030800.637900.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2395-2417AAGTTCTGATAGACAAACAATACAUUGUUUGUCUAUCAGAACUUGUUCUGAUAGACAAACAAUACU12.220.422


Target Position: 549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549CUCAACACCCAGUUUAUUA86.6566665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997567CTCAACACCCAGTTTATTATAATAAACTGGGTGTTGAG0.095400.094900.775900.750000.994600.87500


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835UGUACAGAUGUUUGAAUUA86.7209658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6841853TGTACAGATGTTTGAATTATAATTCAAACATCTGTACA0.177300.081000.672400.750001.000001.00000


Target Position: 1147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147GUUUACCUCAUAUGAUUCA82.77661074

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1145-1167TGGTTTACCTCATATGATTCAGGUGAAUCAUAUGAGGUAAACCAGUUUACCUCAUAUGAUUCAGGU16.218.632


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141CCACUGGUUUACCUCAUAU87.6972569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811159CCACTGGTTTACCTCATATATATGAGGTAAACCAGTGG0.174500.049100.801701.000000.983701.00000


Target Position: 660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GAUAUGUGGAGGAAAUUGA89.5829412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
658-680TGGATATGTGGAGGAAATTGATGUCAAUUUCCUCCACAUAUCCAGAUAUGUGGAGGAAAUUGAUGU7.413.333


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548CUCCAUAAUUUGGUCAUUU77.99441632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842566CTCCATAATTTGGTCATTTAAATGACCAAATTATGGAG0.139800.080600.810300.750000.940200.75000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725GGGUACCAUGCUUUUUCUC68.04932820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4052743GGGTACCATGCTTTTTCTCGAGAAAAAGCATGGTACCC0.281700.097700.681000.750001.000001.00000


Target Position: 1738, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738GAAUUAGUUUUCAAAUAUA104.86311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041756GAATTAGTTTTCAAATATATATATTTGAAAACTAATTC0.143400.024200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1736-1758GGGAATTAGTTTTCAAATATATGUAUAUUUGAAAACUAAUUCCCGAAUUAGUUUUCAAAUAUAUGU-1.84.622


Target Position: 3683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3683AACAUACAAUUUUUCUUUA87.6464576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213701AACATACAATTTTTCTTTATAAAGAAAAATTGTATGTT0.180700.196800.612100.500001.000001.00000


Target Position: 3390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3390CCUACCUGUUACCCUUACA84.1608930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6453408CCTACCTGTTACCCTTACATGTAAGGGTAACAGGTAGG0.845000.163800.637900.750001.000001.00000


Target Position: 169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169CCCUUGUCCCCUGCCCCUU58.14073646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425187CCCTTGTCCCCTGCCCCTTAAGGGGCAGGGGACAAGGG0.271200.232000.853401.000001.000001.00000


Target Position: 4156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4156GUACAUUCACUGUCAAAAA95.572116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4154-4176TTGTACATTCACTGTCAAAAAGCUUUUUGACAGUGAAUGUACAAGUACAUUCACUGUCAAAAAGCU14.916.1


Target Position: 3525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3525CAUAUAUAAAUCCCAUUAU88.2906514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7653543CATATATAAATCCCATTATATAATGGGATTTATATATG0.221900.041500.612100.750001.000001.00000


Target Position: 2162, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162CAGUAAAAGAACAAAAUUU88.2592515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172180CAGTAAAAGAACAAAATTTAAATTTTGTTCTTTTACTG0.598700.211600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2160-2182AGCAGTAAAAGAACAAAATTTAAAAAUUUUGUUCUUUUACUGCUCAGUAAAAGAACAAAAUUUAAU-3.34.922


Target Position: 3152, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3152CUUGAAGAUGUAAUUCCAU83.07341043

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3150-3172ATCTTGAAGATGTAATTCCATCAAUGGAAUUACAUCUUCAAGAUCUUGAAGAUGUAAUUCCAUCAU20.120.4


Target Position: 3883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3883CACUUAUAAUACUUCAGUA105.3128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713901CACTTATAATACTTCAGTATACTGAAGTATTATAAGTG0.190900.089600.612100.750001.000001.00000


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537GAAUGCUGGCAAAACGUUU81.24271231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411555GAATGCTGGCAAAACGTTTAAACGTTTTGCCAGCATTC0.312000.039800.672400.750001.000001.00000


Target Position: 4026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4026UCAAUUGCAUUUUUUCUAA80.18431369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5354044TCAATTGCATTTTTTCTAATTAGAAAAAATGCAATTGA0.366500.052800.689700.750001.000001.00000


Target Position: 3680, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3680CUCAACAUACAAUUUUUCU74.21622115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093698CTCAACATACAATTTTTCTAGAAAAATTGTATGTTGAG0.489700.481900.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3678-3700CCCTCAACATACAATTTTTCTTTAGAAAAAUUGUAUGUUGAGGGCUCAACAUACAAUUUUUCUUUU0.420.5


Target Position: 2365, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CCAGUAUCAGCAUGAUUAA95.2569122

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6236519CCAGTATCAGCATGATTAA1/1/0/097.75CUL2NM_003591.21NANANA10:35299321..35299339(-)00CUL2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3942383CCAGTATCAGCATGATTAATTAATCATGCTGATACTGG0.290600.081300.810301.000000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2363-2385TCCCAGTATCAGCATGATTAAGAUUAAUCAUGCUGAUACUGGGACCAGUAUCAGCAUGAUUAAGAU8.720.322


Target Position: 4010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4010CUUACAAUUGGUUUAUUCA88.99450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4008-4030GTCTTACAATTGGTTTATTCAATUGAAUAAACCAAUUGUAAGACCUUACAAUUGGUUUAUUCAAUU2.16.9


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CAUUUGCAUAAGAGAGUUU83.38821011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921456CATTTGCATAAGAGAGTTTAAACTCTCTTATGCAAATG0.110800.017500.655200.750001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146GGUUUACCUCAUAUGAUUC80.47441330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331164GGTTTACCTCATATGATTCGAATCATATGAGGTAAACC0.233000.022100.681000.750001.000001.00000


Target Position: 3401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401CCCUUACAACCCUCCUCCA81.22161234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5763419CCCTTACAACCCTCCTCCATGGAGGAGGGTTGTAAGGG0.437500.297300.646600.750001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GCCUCCCCCUCCCCUUGUC53.94273880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727176GCCTCCCCCTCCCCTTGTCGACAAGGGGAGGGGGAGGC0.762600.582700.681000.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145UGGUUUACCUCAUAUGAUU80.52161326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7111163TGGTTTACCTCATATGATTAATCATATGAGGTAAACCA0.243600.032100.836200.750000.983700.75000


Target Position: 2153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153GAACUUUAGCAGUAAAAGA94.1197172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2151-2173ATGAACTTTAGCAGTAAAAGAACUCUUUUACUGCUAAAGUUCAUGAACUUUAGCAGUAAAAGAACU4.94.922


Target Position: 2118, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2118GAUAUUGAUGCAGAAUCUU82.48861107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2116-2138AAGATATTGATGCAGAATCTTCGAAGAUUCUGCAUCAAUAUCUUGAUAUUGAUGCAGAAUCUUCGU19.18.732


Target Position: 3384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3384GCCUCCCCUACCUGUUACC55.45663798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453402GCCTCCCCTACCTGTTACCGGTAACAGGTAGGGGAGGC0.229000.242200.646600.500001.000001.00000


Target Position: 3498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498GAAAAUUGUACAUUGUACU83.7012981

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3496-3518AAGAAAATTGTACATTGTACTGGAGUACAAUGUACAAUUUUCUUGAAAAUUGUACAUUGUACUGGU14.6-3.3


Target Position: 468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GAACAAGUACUUGUUAUGU81.89681159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
466-488AAGAACAAGTACTTGTTATGTATACAUAACAAGUACUUGUUCUUGAACAAGUACUUGUUAUGUAUU13.517.822


Target Position: 3935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3935UCCUAACAAAAACAAUAAU71.72682422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5093953TCCTAACAAAAACAATAATATTATTGTTTTTGTTAGGA0.596400.548900.862100.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951AGAUUAAAAGAUGAAGAAA90.7089336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
743969AGATTAAAAGATGAAGAAATTTCTTCATCTTTTAATCT0.152400.133700.724100.750001.000001.00000


Target Position: 3673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3673CUCCUCCCUCAACAUACAA81.10621247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853691CTCCTCCCTCAACATACAATTGTATGTTGAGGGAGGAG0.875900.875200.663800.750001.000001.00000


Target Position: 1820, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820GGAAUUAGAAAAAAGUGUA94.9221136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731838GGAATTAGAAAAAAGTGTATACACTTTTTTCTAATTCC0.297700.065800.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1818-1840CAGGAATTAGAAAAAAGTGTACAUACACUUUUUUCUAAUUCCUGGGAAUUAGAAAAAAGUGUACAU17.86.921


Target Position: 2128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128CAGAAUCUUCGUUUUCAUU84.0575941

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2126-2148TGCAGAATCTTCGTTTTCATTAAAAUGAAAACGAAGAUUCUGCACAGAAUCUUCGUUUUCAUUAAU7.419.122


Target Position: 3894, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3894CUUCAGUAAGGCCUUUAAA86.0891718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6463912CTTCAGTAAGGCCTTTAAATTTAAAGGCCTTACTGAAG0.746600.125200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3892-3914TACTTCAGTAAGGCCTTTAAAAAUUUAAAGGCCUUACUGAAGUACUUCAGUAAGGCCUUUAAAAAU11.020.3


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139GUCCACUGGUUUACCUCAU76.40241851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871157GTCCACTGGTTTACCTCATATGAGGTAAACCAGTGGAC0.139200.056700.663800.750000.983701.00000


Target Position: 4195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4195CUUGUUGAUUGAUAAAAGU78.5041573

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4193-4215AACTTGTTGATTGATAAAAGTTTACUUUUAUCAAUCAACAAGUUCUUGUUGAUUGAUAAAAGUUUU-4.320.5


Target Position: 3364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3364CCAACAUAUUCCUUCUAUA101.16835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943382CCAACATATTCCTTCTATATATAGAAGGAATATGTTGG0.167400.052000.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3362-3384TACCAACATATTCCTTCTATATGUAUAGAAGGAAUAUGUUGGUACCAACAUAUUCCUUCUAUAUGU11.613.5


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619GUCAAAGAAAAUGCCUAGA74.48892085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382637GTCAAAGAAAATGCCTAGATCTAGGCATTTTCTTTGAC0.232100.128700.594800.500001.000001.00000


Target Position: 4051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4051UCUCAAGUGUUUUAAAAAU76.43611848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7694069TCTCAAGTGTTTTAAAAATATTTTTAAAACACTTGAGA0.303400.027600.715500.750001.000001.00000


Target Position: 3677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3677UCCCUCAACAUACAAUUUU62.12843366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5363695TCCCTCAACATACAATTTTAAAATTGTATGTTGAGGGA0.629300.626900.870700.750001.000001.00000


Target Position: 2998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998GUUUUUAUCUGAAUGGUUU83.12781036

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2996-3018GCGTTTTTATCTGAATGGTTTAAAAACCAUUCAGAUAAAAACGCGUUUUUAUCUGAAUGGUUUAAU18.8-9.7


Target Position: 2378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378GAUUAAGAAGUGUAUUGAA103.11325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2376-2398ATGATTAAGAAGTGTATTGAAGTUUCAAUACACUUCUUAAUCAUGAUUAAGAAGUGUAUUGAAGUU16.16.933


Target Position: 4217, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4217CCAAAUUGAAAAAAAAAAA84.3323912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1284235CCAAATTGAAAAAAAAAAATTTTTTTTTTTCAATTTGG0.624500.251200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4215-4237TTCCAAATTGAAAAAAAAAAAAAUUUUUUUUUUUCAAUUUGGAACCAAAUUGAAAAAAAAAAAAAU-11.34.21


Target Position: 3824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3824CCAUCCAACACAAAAUUUU77.62931675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3013842CCATCCAACACAAAATTTTAAAATTTTGTGTTGGATGG0.367400.292700.844801.000001.000001.00000


Target Position: 3884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3884ACUUAUAAUACUUCAGUAA90.3132367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7293902ACTTATAATACTTCAGTAATTACTGAAGTATTATAAGT0.157600.076600.672400.750001.000001.00000


Target Position: 4007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4007GGUCUUACAAUUGGUUUAU79.3231466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4005-4027TGGGTCTTACAATTGGTTTATTCAUAAACCAAUUGUAAGACCCAGGUCUUACAAUUGGUUUAUUCU20.021.4


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676CUCCCUCAACAUACAAUUU79.66981426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7253694CTCCCTCAACATACAATTTAAATTGTATGTTGAGGGAG0.680400.678400.810300.750001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887ACAAGAAGCUUCAAAUUUA94.3307162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591905ACAAGAAGCTTCAAATTTATAAATTTGAAGCTTCTTGT0.599800.325900.672400.750001.000001.00000


Target Position: 3020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3020UCACUUGUACUCCUAUUUA84.0272944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343038TCACTTGTACTCCTATTTATAAATAGGAGTACAAGTGA0.663600.353800.689700.750001.000001.00000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913UGAAGUUAAAAUGAACUAU75.18632006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621931TGAAGTTAAAATGAACTATATAGTTCATTTTAACTTCA0.122400.035300.681000.750001.000001.00000


Target Position: 2767, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2767GUCUUUUUUUUUUUUUUUA83.11011039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3312785GTCTTTTTTTTTTTTTTTATAAAAAAAAAAAAAAAGAC0.574400.194400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2765-2787GTGTCTTTTTTTTTTTTTTTAATUAAAAAAAAAAAAAAAGACACGUCUUUUUUUUUUUUUUUAAUU-11.35.500


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257UUGGAAGUGCAUGGUAAAU63.91943222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111275TTGGAAGTGCATGGTAAATATTTACCATGCACTTCCAA0.228400.019200.637900.500001.000001.00000


Target Position: 3967, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3967CUAAUAUGUGGUUCAUAUU85.8074752

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3965-3987ATCTAATATGTGGTTCATATTTAAAUAUGAACCACAUAUUAGAUCUAAUAUGUGGUUCAUAUUUAU8.70.0


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260UGAAACAUGGAACAAACUU69.26582694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846278TGAAACATGGAACAAACTTAAGTTTGTTCCATGTTTCA0.222000.053300.586200.750001.000001.00000


Target Position: 2891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891UCAAAUAAAAAAAAAAUAA79.02241509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3302909TCAAATAAAAAAAAAATAATTATTTTTTTTTTATTTGA0.640000.600200.689700.750001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GCCUUCGAGCAACCAGCAA78.88251531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971213GCCTTCGAGCAACCAGCAATTGCTGGTTGCTCGAAGGC0.520900.172100.853401.000000.945700.75000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045UGAAAAGGAACUGACAAAA78.63061558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102063TGAAAAGGAACTGACAAAATTTTGTCAGTTCCTTTTCA0.348700.234900.724100.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765GUAAUCCAUGGGGUUAUUA81.36191216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
763-785AAGTAATCCATGGGGTTATTAACUAAUAACCCCAUGGAUUACUUGUAAUCCAUGGGGUUAUUAACU13.921.223


Target Position: 3535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3535UCCCAUUAUUUUGUUUAUU64.81943138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7363553TCCCATTATTTTGTTTATTAATAAACAAAATAATGGGA0.455800.162300.862100.750001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405AGACAAACAAUACAUAGAA93.1852208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602423AGACAAACAATACATAGAATTCTATGTATTGTTTGTCT0.102400.059600.551700.750001.000001.00000


Target Position: 2792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792CUUAAAGGACAUAAAAUUU82.851060

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2790-2812ATCTTAAAGGACATAAAATTTAAAAAUUUUAUGUCCUUUAAGAUCUUAAAGGACAUAAAAUUUAAU-9.711.022


Target Position: 3823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3823UCCAUCCAACACAAAAUUU65.85093035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2513841TCCATCCAACACAAAATTTAAATTTTGTGTTGGATGGA0.430900.342300.870700.750001.000001.00000


Target Position: 1928, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928CUAUUUGGGCAAACCAUAU80.47551329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1926-1948AACTATTTGGGCAAACCATATGTAUAUGGUUUGCCCAAAUAGUUCUAUUUGGGCAAACCAUAUGUU20.012.822


Target Position: 3254, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254GAGCUUUUCAUUCAAAAGU74.01732145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3252-3274GAGAGCTTTTCATTCAAAAGTTGACUUUUGAAUGAAAAGCUCUCGAGCUUUUCAUUCAAAAGUUGU12.217.0


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041GCAGACCACUUACAGUUUU79.76291413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321059GCAGACCACTTACAGTTTTAAAACTGTAAGTGGTCTGC0.250600.040800.853401.000001.000001.00000


Target Position: 3902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902AGGCCUUUAAAAAAUCCAC62.91453309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553920AGGCCTTTAAAAAATCCACGTGGATTTTTTAAAGGCCT0.781800.645100.551700.500001.000001.00000


Target Position: 2271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271GCUGCUAUAGUUCGUAUCA88.6419485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162289GCTGCTATAGTTCGTATCATGATACGAACTATAGCAGC0.287600.051000.629300.750001.000001.00000


Target Position: 3622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622CUAUUAUCAUAUUUAUUGU87.4843585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3620-3642ATCTATTATCATATTTATTGTCTACAAUAAAUAUGAUAAUAGAUCUAUUAUCAUAUUUAUUGUCUU-1.43.5


Target Position: 2662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662GACAUUUCUUAAAACUUUA94.4942153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472680GACATTTCTTAAAACTTTATAAAGTTTTAAGAAATGTC0.185200.050700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2660-2682ATGACATTTCTTAAAACTTTATTUAAAGUUUUAAGAAAUGUCAUGACAUUUCUUAAAACUUUAUUU3.214.822


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106CCGCCUCCGCCCACCUUCC50.29974013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980124CCGCCTCCGCCCACCTTCCGGAAGGTGGGCGGAGGCGG0.833800.049600.543100.500000.902200.75000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037CAGAUGAAUGAAAAGGAAC72.72462315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782055CAGATGAATGAAAAGGAACGTTCCTTTTCATTCATCTG0.252100.040400.637900.500001.000001.00000


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198GCAGAAAGACACACCACAA101.13936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3882216GCAGAAAGACACACCACAATTGTGGTGTGTCTTTCTGC0.293300.237000.706901.000001.000001.00000


Target Position: 2664, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664CAUUUCUUAAAACUUUAUU76.33341865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152682CATTTCTTAAAACTTTATTAATAAAGTTTTAAGAAATG0.159800.090800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2662-2684GACATTTCTTAAAACTTTATTAAAAUAAAGUUUUAAGAAAUGUCCAUUUCUUAAAACUUUAUUAAU4.65.321


Target Position: 2313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313CACAAUGCCCUUAUUCAAG71.52122446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202331CACAATGCCCTTATTCAAGCTTGAATAAGGGCATTGTG0.307100.044700.655200.500001.000001.00000


Target Position: 3148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148GAAUCUUGAAGAUGUAAUU90.216372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3146-3168TTGAATCTTGAAGATGTAATTCCAAUUACAUCUUCAAGAUUCAAGAAUCUUGAAGAUGUAAUUCCU6.712.0


Target Position: 409, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CUAAGAUUUUUUUGGAAAA88.2484516

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_940919CTAAGATTTTTTTGGAAAA1/1/0/096.22CUL2NM_003591.21NANANA10:35351910..35351928(-)00CUL2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
407-429AACTAAGATTTTTTTGGAAAATCUUUUCCAAAAAAAUCUUAGUUCUAAGAUUUUUUUGGAAAAUCU20.16.921


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263GUGCAUGGUAAAUUUGUUC67.58072876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701281GTGCATGGTAAATTTGTTCGAACAAATTTACCATGCAC0.407500.043000.620700.500001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816CCCAGGAAUUAGAAAAAAG76.45161843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221834CCCAGGAATTAGAAAAAAGCTTTTTTCTAATTCCTGGG0.231100.031300.853400.750001.000001.00000


Target Position: 3012, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3012GGUUUAAUUCACUUGUACU92.1111257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5333030GGTTTAATTCACTTGTACTAGTACAAGTGAATTAAACC0.542300.091100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3010-3032ATGGTTTAATTCACTTGTACTCCAGUACAAGUGAAUUAAACCAUGGUUUAAUUCACUUGUACUCCU19.0-0.3


Target Position: 3821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3821CAUCCAUCCAACACAAAAU87.9669542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5253839CATCCATCCAACACAAAATATTTTGTGTTGGATGGATG0.917500.609500.646600.750001.000001.00000


Target Position: 3933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3933ACUCCUAACAAAAACAAUA86.2029705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4593951ACTCCTAACAAAAACAATATATTGTTTTTGTTAGGAGT0.708800.636000.663800.750001.000001.00000


Target Position: 4078, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4078CUUAUAAUGACUUAUAUAA95.9775104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4076-4098AACTTATAATGACTTATATAATGUUAUAUAAGUCAUUAUAAGUUCUUAUAAUGACUUAUAUAAUGU-5.9-8.0


Target Position: 4215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4215UUCCAAAUUGAAAAAAAAA75.04252025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9514233TTCCAAATTGAAAAAAAAATTTTTTTTTCAATTTGGAA0.401500.257600.672400.500001.000001.00000


Target Position: 623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GAAUGAACCACUUAUGGAA99.903151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
621-643ATGAATGAACCACTTATGGAAATUUCCAUAAGUGGUUCAUUCAUGAAUGAACCACUUAUGGAAAUU21.214.822


Target Position: 3671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3671CCCUCCUCCCUCAACAUAC66.27982999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4103689CCCTCCTCCCTCAACATACGTATGTTGAGGGAGGAGGG0.942600.935300.810300.750001.000001.00000


Target Position: 3825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3825CAUCCAACACAAAAUUUUU87.2858604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923843CATCCAACACAAAATTTTTAAAAATTTTGTGTTGGATG0.341400.279000.655200.750001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436GGCAUUUGCAUAAGAGAGU74.24792108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846454GGCATTTGCATAAGAGAGTACTCTCTTATGCAAATGCC0.157700.021600.793100.750000.994600.75000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169AGAACAAAAUUUAAAAUUA94.3589159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822187AGAACAAAATTTAAAATTATAATTTTAAATTTTGTTCT0.483600.385700.689700.750001.000001.00000


Target Position: 4181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4181CCUUGUUUUGAUAACUUGU77.62561676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4179-4201ACCCTTGTTTTGATAACTTGTTGACAAGUUAUCAAAACAAGGGUCCUUGUUUUGAUAACUUGUUGU11.810.3


Target Position: 3471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3471GCAUAACCUAAAUACUUUU87.0052628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873489GCATAACCTAAATACTTTTAAAAGTATTTAGGTTATGC0.167500.025600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3469-3491ATGCATAACCTAAATACTTTTTTAAAAGUAUUUAGGUUAUGCAUGCAUAACCUAAAUACUUUUUUU4.620.0


Target Position: 2742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2742UCCCCUUCACGUUUGCAGU60.25743504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902760TCCCCTTCACGTTTGCAGTACTGCAAACGTGAAGGGGA0.194600.076700.663800.500001.000001.00000


Target Position: 215, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215CUACACUUGCACAAUGUCU77.61441680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
213-235CACTACACTTGCACAATGTCTTTAGACAUUGUGCAAGUGUAGUGCUACACUUGCACAAUGUCUUUU20.519.032


Target Position: 1737, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737GGAAUUAGUUUUCAAAUAU92.4045239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411755GGAATTAGTTTTCAAATATATATTTGAAAACTAATTCC0.135200.016300.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1735-1757TGGGAATTAGTTTTCAAATATATAUAUUUGAAAACUAAUUCCCAGGAAUUAGUUUUCAAAUAUAUU8.96.922


Target Position: 1062, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062CAUGCAGAAUGUCAUAAUA101.39534

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7106219CATGCAGAATGTCATAATA1/1/0/097.21CUL2NM_003591.21NANANANA00CUL2(0.002)


Target Position: 2374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374GCAUGAUUAAGAAGUGUAU90.3631361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394CAGCATGATTAAGAAGTGTATTGAUACACUUCUUAAUCAUGCUGGCAUGAUUAAGAAGUGUAUUGU19.013.633


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221UUGCACAAUGUCUUUGAAA74.92382036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991239TTGCACAATGTCTTTGAAATTTCAAAGACATTGTGCAA0.099000.069600.646600.500001.000001.00000


Target Position: 865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865CUGAAACAGGAGAGUAUUA91.1561304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
863-885GACTGAAACAGGAGAGTATTACAUAAUACUCUCCUGUUUCAGUCCUGAAACAGGAGAGUAUUACAU14.520.523


Target Position: 3466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3466GCAAUGCAUAACCUAAAUA91.1201307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563484GCAATGCATAACCTAAATATATTTAGGTTATGCATTGC0.476700.050600.810301.000001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536AGAAUGCUGGCAAAACGUU73.69192200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621554AGAATGCTGGCAAAACGTTAACGTTTTGCCAGCATTCT0.292700.029400.577600.750001.000001.00000


Target Position: 3980, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3980CAUAUUUAAAUUUGUUGUU77.23061720

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3978-4000TTCATATTTAAATTTGTTGTTTTAACAACAAAUUUAAAUAUGAACAUAUUUAAAUUUGUUGUUUUU19.3-8.0


Target Position: 2816, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816CUUAAAUAUUGUAAUAUGA91.6202282

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2814-2836AACTTAAATATTGTAATATGACAUCAUAUUACAAUAUUUAAGUUCUUAAAUAUUGUAAUAUGACAU0.0-7.522


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881CUGCUGCUUGUCAAAUAAA88.4718493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6642899CTGCTGCTTGTCAAATAAATTTATTTGACAAGCAGCAG0.180500.066400.784500.750001.000001.00000


Target Position: 547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
547AUCUCAACACCCAGUUUAU79.90431400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939565ATCTCAACACCCAGTTTATATAAACTGGGTGTTGAGAT0.108400.016300.637900.500000.994600.87500


Target Position: 4205, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4205GAUAAAAGUUUUCCAAAUU86.5412676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5284223GATAAAAGTTTTCCAAATTAATTTGGAAAACTTTTATC0.242500.053600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4203-4225TTGATAAAAGTTTTCCAAATTGAAAUUUGGAAAACUUUUAUCAAGAUAAAAGUUUUCCAAAUUGAU20.1-4.3


Target Position: 3940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3940ACAAAAACAAUAAUUACUU75.99281909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833958ACAAAAACAATAATTACTTAAGTAATTATTGTTTTTGT0.159700.147600.569000.750001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890GUCAAAUAAAAAAAAAAUA86.3338691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312908GTCAAATAAAAAAAAAATATATTTTTTTTTTATTTGAC0.665000.233900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2888-2910TTGTCAAATAAAAAAAAAATAAAUAUUUUUUUUUUAUUUGACAAGUCAAAUAAAAAAAAAAUAAAU-12.08.9


Target Position: 3472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472CAUAACCUAAAUACUUUUU76.48461832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443490CATAACCTAAATACTTTTTAAAAAGTATTTAGGTTATG0.151200.043100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3470-3492TGCATAACCTAAATACTTTTTTAAAAAAGUAUUUAGGUUAUGCACAUAACCUAAAUACUUUUUUAU4.918.5


Target Position: 4049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049UGUCUCAAGUGUUUUAAAA84.301919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7564067TGTCTCAAGTGTTTTAAAATTTTAAAACACTTGAGACA0.269700.028400.706900.750001.000001.00000


Target Position: 2124, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124GAUGCAGAAUCUUCGUUUU88.3785503

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1212419GATGCAGAATCTTCGTTTT1/1/0/0100.00CUL2NM_003591.21NANANA10:35302701..35302719(-)00CUL2(0.002)


Target Position: 3669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3669ACCCCUCCUCCCUCAACAU71.1172495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5893687ACCCCTCCTCCCTCAACATATGTTGAGGGAGGAGGGGT0.987700.986300.698300.750001.000001.00000


Target Position: 3896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3896UCAGUAAGGCCUUUAAAAA83.24751018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2383914TCAGTAAGGCCTTTAAAAATTTTTAAAGGCCTTACTGA0.754100.136200.724100.750001.000001.00000


Target Position: 3688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3688ACAAUUUUUCUUUAUUUUA82.20681137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543706ACAATTTTTCTTTATTTTATAAAATAAAGAAAAATTGT0.123900.121800.672400.750001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155GCUGCCUCCCCCUCCCCUU64.16493190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
243173GCTGCCTCCCCCTCCCCTTAAGGGGAGGGGGAGGCAGC0.864600.567000.715501.000001.000001.00000


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274GUCUUUCUUCGGUUGCAUA89.6256407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503292GTCTTTCTTCGGTTGCATATATGCAACCGAAGAAAGAC0.252600.057300.775900.750001.000001.00000


Target Position: 1700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700CAAUUUUAUCAAAAACCAA94.647147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1698-1720AACAATTTTATCAAAAACCAAGAUUGGUUUUUGAUAAAAUUGUUCAAUUUUAUCAAAAACCAAGAU18.8-9.721


Target Position: 3893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3893ACUUCAGUAAGGCCUUUAA84.7465872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5213911ACTTCAGTAAGGCCTTTAATTAAAGGCCTTACTGAAGT0.596100.119200.672400.750001.000001.00000


Target Position: 4020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4020GUUUAUUCAAUUGCAUUUU70.73912535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4018-4040TGGTTTATTCAATTGCATTTTTTAAAAUGCAAUUGAAUAAACCAGUUUAUUCAAUUGCAUUUUUUU20.02.1


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387GGAGAAAGACUUUAUACAG87.485584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841405GGAGAAAGACTTTATACAGCTGTATAAAGTCTTTCTCC0.309900.160000.586200.750001.000001.00000


Target Position: 1688, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688CAAUAAGUUCAACAAUUUU88.3332507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541706CAATAAGTTCAACAATTTTAAAATTGTTGAACTTATTG0.673200.404300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1686-1708AACAATAAGTTCAACAATTTTATAAAAUUGUUGAACUUAUUGUUCAAUAAGUUCAACAAUUUUAUU5.34.622


Target Position: 394, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394GACUUUAUACAGAAACUAA104.77212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358412GACTTTATACAGAAACTAATTAGTTTCTGTATAAAGTC0.316500.172100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
392-414AAGACTTTATACAGAAACTAAGAUUAGUUUCUGUAUAAAGUCUUGACUUUAUACAGAAACUAAGAU14.64.622


Target Position: 390, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390GAAAGACUUUAUACAGAAA103.14824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384408GAAAGACTTTATACAGAAATTTCTGTATAAAGTCTTTC0.472300.176600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
388-410GAGAAAGACTTTATACAGAAACTUUUCUGUAUAAAGUCUUUCUCGAAAGACUUUAUACAGAAACUU20.317.702


Target Position: 3862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862AGCAAAUCACACAAAUUAU85.8743745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633880AGCAAATCACACAAATTATATAATTTGTGTGATTTGCT0.524000.489700.810300.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CUGAUCUCAACAAUAAGUU74.39272092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461696CTGATCTCAACAATAAGTTAACTTATTGTTGAGATCAG0.481500.054700.637900.750000.940200.75000


Target Position: 2093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GAUUAACCAUGAUUCAGAA104.46514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2091-2113ATGATTAACCATGATTCAGAAAAUUCUGAAUCAUGGUUAAUCAUGAUUAACCAUGAUUCAGAAAAU20.413.932


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955ACAAAAUAUAUUGACUCAA82.36331122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342973ACAAAATATATTGACTCAATTGAGTCAATATATTTTGT0.468000.387900.560300.750001.000001.00000


Target Position: 463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463CAGAAGAACAAGUACUUGU82.5941091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
461-483GTCAGAAGAACAAGTACTTGTTAACAAGUACUUGUUCUUCUGACCAGAAGAACAAGUACUUGUUAU19.019.121


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947GGUUGACCACAAAAUAUAU96.536693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832965GGTTGACCACAAAATATATATATATTTTGTGGTCAACC0.663800.034900.810301.000001.000001.00000


Target Position: 2877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2877GAUACUGCUGCUUGUCAAA94.3422160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282895GATACTGCTGCTTGTCAAATTTGACAAGCAGCAGTATC0.109200.028300.681000.750001.000001.00000


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904GCCUUUAAAAAAUCCACAG68.9392736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5113922GCCTTTAAAAAATCCACAGCTGTGGATTTTTTAAAGGC0.234900.183000.715500.750001.000001.00000


Target Position: 474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474GUACUUGUUAUGUAUCAUA96.1375100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
472-494AAGTACTTGTTATGTATCATAGGUAUGAUACAUAACAAGUACUUGUACUUGUUAUGUAUCAUAGGU16.019.023


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858ACAUUAAAAUGACAAACAU85.8371748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572876ACATTAAAATGACAAACATATGTTTGTCATTTTAATGT0.169100.152500.551700.750001.000001.00000


Target Position: 1977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977GUUCUUCUUGCCUUUAACA84.8079866

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1975-1997CAGTTCTTCTTGCCTTTAACAACUGUUAAAGGCAAGAAGAACUGGUUCUUCUUGCCUUUAACAACU4.919.122


Target Position: 3387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3387UCCCCUACCUGUUACCCUU68.89232739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003405TCCCCTACCTGTTACCCTTAAGGGTAACAGGTAGGGGA0.236900.201500.732800.750001.000001.00000


Target Position: 1694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694GUUCAACAAUUUUAUCAAA94.895138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1692-1714AAGTTCAACAATTTTATCAAAAAUUUGAUAAAAUUGUUGAACUUGUUCAACAAUUUUAUCAAAAAU8.920.522


Target Position: 3954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3954UACUUAGUAUCAUCUAAUA93.3598198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983972TACTTAGTATCATCTAATATATTAGATGATACTAAGTA0.121900.042400.637900.500000.983700.62500


Target Position: 4144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4144CCAUAUAAUAUUGUACAUU84.3865908

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4142-4164AACCATATAATATTGTACATTCAAAUGUACAAUAUUAUAUGGUUCCAUAUAAUAUUGUACAUUCAU20.40.0


Target Position: 3760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760UGGCCUCAAGCAAUCCUAU74.09632135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6663778TGGCCTCAAGCAATCCTATATAGGATTGCTTGAGGCCA0.438300.036400.801700.750000.978300.75000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841ACCUAAUAAUUGUAUCUAC78.19741609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712859ACCTAATAATTGTATCTACGTAGATACAATTATTAGGT0.155100.088000.672400.500001.000001.00000


Target Position: 2107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107CAGAAAAGGAAGAUAUUGA91.9401268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2105-2127TTCAGAAAAGGAAGATATTGATGUCAAUAUCUUCCUUUUCUGAACAGAAAAGGAAGAUAUUGAUGU8.710.320


Target Position: 4130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4130GAAAUAAUGGCAAACCAUA95.2816121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4128-4150AGGAAATAATGGCAAACCATATAUAUGGUUUGCCAUUAUUUCCUGAAAUAAUGGCAAACCAUAUAU18.8-10.3


Target Position: 3032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032CUAUUUAAAUCCUACAUGA93.6771186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3030-3052TCCTATTTAAATCCTACATGAAAUCAUGUAGGAUUUAAAUAGGACUAUUUAAAUCCUACAUGAAAU17.9-7.5


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170CCUUGUCCCCUGCCCCUUG59.95843522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539188CCTTGTCCCCTGCCCCTTGCAAGGGGCAGGGGACAAGG0.225000.181900.698300.750001.000001.00000


Target Position: 2400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400CUGAUAGACAAACAAUACA86.6358666

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2398-2420TTCTGATAGACAAACAATACATAUGUAUUGUUUGUCUAUCAGAACUGAUAGACAAACAAUACAUAU14.621.422


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909CAGGUGAAGUUAAAAUGAA96.198598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421927CAGGTGAAGTTAAAATGAATTCATTTTAACTTCACCTG0.273000.016300.612100.750001.000001.00000


Target Position: 388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388GAGAAAGACUUUAUACAGA96.67290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981406GAGAAAGACTTTATACAGATCTGTATAAAGTCTTTCTC0.405600.170900.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
386-408TGGAGAAAGACTTTATACAGAAAUCUGUAUAAAGUCUUUCUCCAGAGAAAGACUUUAUACAGAAAU13.119.122


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618CGUCAAAGAAAAUGCCUAG77.20421725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042636CGTCAAAGAAAATGCCTAGCTAGGCATTTTCTTTGACG0.233600.119700.603400.750001.000001.00000


Target Position: 3042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042CCUACAUGAAAAAUGUCUA92.1961251

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3040-3062ATCCTACATGAAAAATGTCTAGAUAGACAUUUUUCAUGUAGGAUCCUACAUGAAAAAUGUCUAGAU19.217.9


Target Position: 2127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127GCAGAAUCUUCGUUUUCAU90.7973330

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2125-2147ATGCAGAATCTTCGTTTTCATTAAUGAAAACGAAGAUUCUGCAUGCAGAAUCUUCGUUUUCAUUAU14.920.422


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943AUCAGGUUGACCACAAAAU71.30142469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862961ATCAGGTTGACCACAAAATATTTTGTGGTCAACCTGAT0.115600.014800.672400.500001.000001.00000


Target Position: 105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
105GCCGCCUCCGCCCACCUUC50.82273997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729123GCCGCCTCCGCCCACCTTCGAAGGTGGGCGGAGGCGGC0.799800.030800.827600.750000.902200.87500


Target Position: 2272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2272CUGCUAUAGUUCGUAUCAU84.8993849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7262290CTGCTATAGTTCGTATCATATGATACGAACTATAGCAG0.318700.060800.629300.750001.000001.00000


Target Position: 2164, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164GUAAAAGAACAAAAUUUAA93.27203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302182GTAAAAGAACAAAATTTAATTAAATTTTGTTCTTTTAC0.648200.314500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2162-2184CAGTAAAAGAACAAAATTTAAAAUUAAAUUUUGUUCUUUUACUGGUAAAAGAACAAAAUUUAAAAU-9.77.121


Target Position: 3418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3418CAACAGUUUAGAUACUAGA91.949267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3416-3438TCCAACAGTTTAGATACTAGAGTUCUAGUAUCUAAACUGUUGGACAACAGUUUAGAUACUAGAGUU11.217.8


Target Position: 3473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473AUAACCUAAAUACUUUUUU65.7823045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843491ATAACCTAAATACTTTTTTAAAAAAGTATTTAGGTTAT0.140500.102200.543100.500001.000001.00000


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617GCGUCAAAGAAAAUGCCUA90.5617343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392635GCGTCAAAGAAAATGCCTATAGGCATTTTCTTTGACGC0.263500.124100.750001.000001.000001.00000


Target Position: 1539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1539AUGCUGGCAAAACGUUUAA71.39572459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101557ATGCTGGCAAAACGTTTAATTAAACGTTTTGCCAGCAT0.329900.068700.620700.500001.000001.00000


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCUUGGAGAAAGACUUUAU86.67661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593401CCTTGGAGAAAGACTTTATATAAAGTCTTTCTCCAAGG0.282400.045800.801701.000001.000001.00000


Target Position: 1836, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1836GUACAGAUGUUUGAAUUAU85.9977728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281854GTACAGATGTTTGAATTATATAATTCAAACATCTGTAC0.194200.086900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1834-1856GTGTACAGATGTTTGAATTATTTAUAAUUCAAACAUCUGUACACGUACAGAUGUUUGAAUUAUUUU8.920.322


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779CCUCUUACUCAGGCUCCUU76.53491825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391797CCTCTTACTCAGGCTCCTTAAGGAGCCTGAGTAAGAGG0.106800.033000.706901.000000.940200.62500


Target Position: 4054, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4054CAAGUGUUUUAAAAAUCUA95.9501105

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4052-4074CTCAAGTGTTTTAAAAATCTACTUAGAUUUUUAAAACACUUGAGCAAGUGUUUUAAAAAUCUACUU5.317.8


Target Position: 3873, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3873CAAAUUAUUUCACUUAUAA98.126369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723891CAAATTATTTCACTTATAATTATAAGTGAAATAATTTG0.246400.160000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3871-3893CACAAATTATTTCACTTATAATAUUAUAAGUGAAAUAAUUUGUGCAAAUUAUUUCACUUAUAAUAU6.3-10.3


Target Position: 1540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540UGCUGGCAAAACGUUUAAU67.65932867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521558TGCTGGCAAAACGTTTAATATTAAACGTTTTGCCAGCA0.321400.126100.844800.750001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435CGGCAUUUGCAUAAGAGAG74.88942041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794453CGGCATTTGCATAAGAGAGCTCTCTTATGCAAATGCCG0.249500.028800.603400.750000.994600.75000


Target Position: 2057, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057GACAAAAACAAUCAAAUCA89.992384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2055-2077CTGACAAAAACAATCAAATCATTUGAUUUGAUUGUUUUUGUCAGGACAAAAACAAUCAAAUCAUUU16.35.612


Target Position: 2887, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887CUUGUCAAAUAAAAAAAAA86.3709687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322905CTTGTCAAATAAAAAAAAATTTTTTTTTATTTGACAAG0.871300.143300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2885-2907TGCTTGTCAAATAAAAAAAAAATUUUUUUUUUAUUUGACAAGCACUUGUCAAAUAAAAAAAAAAUU-11.320.511


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611UGGUGUAGAUAUGAAUGAA92.8986220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721629TGGTGTAGATATGAATGAATTCATTCATATCTACACCA0.159200.044700.672400.750001.000001.00000


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464UAGCAAUGCAUAACCUAAA82.75641075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993482TAGCAATGCATAACCTAAATTTAGGTTATGCATTGCTA0.284900.044000.672400.500000.972800.62500


Target Position: 3093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093CAGCAUAAAGAAUGCUUUA93.352200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3091-3113TTCAGCATAAAGAATGCTTTATTUAAAGCAUUCUUUAUGCUGAACAGCAUAAAGAAUGCUUUAUUU18.519.7


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334AUGACCGUUUCUCAGAUAU72.42122348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864352ATGACCGTTTCTCAGATATATATCTGAGAAACGGTCAT0.121900.031000.612100.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413GACAACUUACUGAAGAAGU77.78341654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1411-1433GTGACAACTTACTGAAGAAGTCAACUUCUUCAGUAAGUUGUCACGACAACUUACUGAAGAAGUCAU19.117.823


Target Position: 3922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922GUGAUAUUAUUACUCCUAA97.430478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183940GTGATATTATTACTCCTAATTAGGAGTAATAATATCAC0.451700.031600.758600.750001.000001.00000


Target Position: 4139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4139GCAAACCAUAUAAUAUUGU74.08422136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5694157GCAAACCATATAATATTGTACAATATTATATGGTTTGC0.464800.051300.646600.750001.000001.00000


Target Position: 4143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4143ACCAUAUAAUAUUGUACAU84.1486932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5084161ACCATATAATATTGTACATATGTACAATATTATATGGT0.444800.084900.698300.750001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551CAACACCCAGUUUAUUAAA88.0621534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980569CAACACCCAGTTTATTAAATTTAATAAACTGGGTGTTG0.098000.081500.646600.750000.994600.62500


Target Position: 2945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945CAGGUUGACCACAAAAUAU89.4262428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322963CAGGTTGACCACAAAATATATATTTTGTGGTCAACCTG0.164900.030100.741400.750001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437GCAUUUGCAUAAGAGAGUU82.84481062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933455GCATTTGCATAAGAGAGTTAACTCTCTTATGCAAATGC0.121700.016800.706901.000001.000001.00000


Target Position: 3484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484ACUUUUUUAAAAAAGAAAA78.29961600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6013502ACTTTTTTAAAAAAGAAAATTTTCTTTTTTAAAAAAGT0.197600.078600.706900.750000.994600.62500


Target Position: 3282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3282UCGGUUGCAUAAUCCAUUA79.51091444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2563300TCGGTTGCATAATCCATTATAATGGATTATGCAACCGA0.422100.208800.758600.750001.000001.00000


Target Position: 3665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3665CCACACCCCUCCUCCCUCA77.68041669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403683CCACACCCCTCCTCCCTCATGAGGGAGGAGGGGTGTGG0.994300.990300.620700.750001.000001.00000


Target Position: 1214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214CCUUACUCAGGAAAACAUG69.58432663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771232CCTTACTCAGGAAAACATGCATGTTTTCCTGAGTAAGG0.259700.014600.689700.750000.929300.62500


Target Position: 2676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676CUUUAUUAAAAGAAUGAGU75.3551990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2674-2696AACTTTATTAAAAGAATGAGTGAACUCAUUCUUUUAAUAAAGUUCUUUAUUAAAAGAAUGAGUGAU20.4-7.522


Target Position: 3615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3615CUGCGAUCUAUUAUCAUAU86.6601664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173633CTGCGATCTATTATCATATATATGATAATAGATCGCAG0.539900.031700.741400.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769CUUUUUUUUUUUUUUUAAU74.90272038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052787CTTTTTTTTTTTTTTTAATATTAAAAAAAAAAAAAAAG0.602200.165700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789GTCTTTTTTTTTTTTTTTAATGTAUUAAAAAAAAAAAAAAAGACCUUUUUUUUUUUUUUUAAUGUU-9.1-11.300


Target Position: 2801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801CAUAAAAUUUAAAAACUUA99.259957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362819CATAAAATTTAAAAACTTATAAGTTTTTAAATTTTATG0.235700.072000.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2799-2821GACATAAAATTTAAAAACTTAAAUAAGUUUUUAAAUUUUAUGUCCAUAAAAUUUAAAAACUUAAAU3.2-10.322


Target Position: 4118, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4118CUUCCAAAAGAGGAAAUAA89.7233396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4116-4138TTCTTCCAAAAGAGGAAATAATGUUAUUUCCUCUUUUGGAAGAACUUCCAAAAGAGGAAAUAAUGU15.520.1


Target Position: 2855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855UCUACAUUAAAAUGACAAA82.98781046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212873TCTACATTAAAATGACAAATTTGTCATTTTAATGTAGA0.194200.154500.724100.750001.000001.00000


Target Position: 966, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966GAAAUUCGAUGUCGAAAAU85.7663758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
964-986AAGAAATTCGATGTCGAAAATACAUUUUCGACAUCGAAUUUCUUGAAAUUCGAUGUCGAAAAUACU16.87.422


Target Position: 2654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2654GUCAUUAUGACAUUUCUUA89.4133430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2652-2674ATGTCATTATGACATTTCTTAAAUAAGAAAUGUCAUAAUGACAUGUCAUUAUGACAUUUCUUAAAU5.38.721


Target Position: 3534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534AUCCCAUUAUUUUGUUUAU76.31181869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673552ATCCCATTATTTTGTTTATATAAACAAAATAATGGGAT0.481800.184000.637900.500001.000001.00000


Target Position: 396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396CUUUAUACAGAAACUAAGA86.5701672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
394-416GACTTTATACAGAAACTAAGATTUCUUAGUUUCUGUAUAAAGUCCUUUAUACAGAAACUAAGAUUU9.81.422


Target Position: 3257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257CUUUUCAUUCAAAAGUUGU70.17292600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3255-3277AGCTTTTCATTCAAAAGTTGTCTACAACUUUUGAAUGAAAAGCUCUUUUCAUUCAAAAGUUGUCUU10.37.4


Target Position: 3834, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3834CAAAAUUUUUAAAAUCGGA81.92391156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3832-3854CACAAAATTTTTAAAATCGGAATUCCGAUUUUAAAAAUUUUGUGCAAAAUUUUUAAAAUCGGAAUU20.7-12.0


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684UCAACAAUAAGUUCAACAA84.011947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751702TCAACAATAAGTTCAACAATTGTTGAACTTATTGTTGA0.546100.426300.577600.750000.989100.75000


Target Position: 275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275ACUUUUGACGACAAUAAAA86.7481656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684293ACTTTTGACGACAATAAAATTTTATTGTCGTCAAAAGT0.172300.036700.706900.750001.000001.00000


Target Position: 3478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3478CUAAAUACUUUUUUAAAAA91.5641285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333496CTAAATACTTTTTTAAAAATTTTTAAAAAAGTATTTAG0.129000.095300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3476-3498ACCTAAATACTTTTTTAAAAAAGUUUUUAAAAAAGUAUUUAGGUCUAAAUACUUUUUUAAAAAAGU-9.11.4


Target Position: 403, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403CAGAAACUAAGAUUUUUUU82.84291063

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
401-423TACAGAAACTAAGATTTTTTTGGAAAAAAAUCUUAGUUUCUGUACAGAAACUAAGAUUUUUUUGGU-12.017.722


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389AGAAAGACUUUAUACAGAA96.531294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
968407AGAAAGACTTTATACAGAATTCTGTATAAAGTCTTTCT0.413900.172200.551700.750001.000001.00000


Target Position: 1789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789AGGCUCCUUCAUCUACGUU73.30092249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851807AGGCTCCTTCATCTACGTTAACGTAGATGAAGGAGCCT0.187800.014300.698300.750001.000001.00000


Target Position: 2230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2230CUAGAAGUGCAGUUGAUGA90.262369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2228-2250GACTAGAAGTGCAGTTGATGAGGUCAUCAACUGCACUUCUAGUCCUAGAAGUGCAGUUGAUGAGGU20.518.922


Target Position: 3849, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3849CGGAAUAUUUUAAAGCAAA93.0989213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583867CGGAATATTTTAAAGCAAATTTGCTTTAAAATATTCCG0.363000.037400.913801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3847-3869ATCGGAATATTTTAAAGCAAATCUUUGCUUUAAAAUAUUCCGAUCGGAAUAUUUUAAAGCAAAUCU18.615.4


Target Position: 3285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285GUUGCAUAAUCCAUUAAUU88.9364456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6643303GTTGCATAATCCATTAATTAATTAATGGATTATGCAAC0.556000.246000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3283-3305CGGTTGCATAATCCATTAATTCTAAUUAAUGGAUUAUGCAACCGGUUGCAUAAUCCAUUAAUUCUU-1.821.1


Target Position: 3616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3616UGCGAUCUAUUAUCAUAUU79.36861463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7043634TGCGATCTATTATCATATTAATATGATAATAGATCGCA0.542500.372900.844800.750001.000001.00000


Target Position: 3672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3672CCUCCUCCCUCAACAUACA87.4557588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083690CCTCCTCCCTCAACATACATGTATGTTGAGGGAGGAGG0.922500.913000.637900.750001.000001.00000


Target Position: 1714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714ACCAAGACACAGUAAUAGA85.4015795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771732ACCAAGACACAGTAATAGATCTATTACTGTGTCTTGGT0.157000.074900.629300.500001.000001.00000


Target Position: 3388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3388CCCCUACCUGUUACCCUUA81.84971168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3483406CCCCTACCTGTTACCCTTATAAGGGTAACAGGTAGGGG0.325300.187500.956901.000001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155ACUUUAGCAGUAAAAGAAC66.75882949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212173ACTTTAGCAGTAAAAGAACGTTCTTTTACTGCTAAAGT0.294500.109700.560300.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594CCAUGAUCAACAAAUUAAA94.8957137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671612CCATGATCAACAAATTAAATTTAATTTGTTGATCATGG0.588700.066400.844801.000001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677GCUGAUCUCAACAAUAAGU80.7591294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371695GCTGATCTCAACAATAAGTACTTATTGTTGAGATCAGC0.491000.029700.646600.750000.940200.62500


Target Position: 3937, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3937CUAACAAAAACAAUAAUUA92.0448260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403955CTAACAAAAACAATAATTATAATTATTGTTTTTGTTAG0.523000.524800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3935-3957TCCTAACAAAAACAATAATTACTUAAUUAUUGUUUUUGUUAGGACUAACAAAAACAAUAAUUACUU-10.37.2


Target Position: 2911, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2911GAAAUAGAAUGCCUUUUUU87.7697561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542929GAAATAGAATGCCTTTTTTAAAAAAGGCATTCTATTTC0.103300.048600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2909-2931AAGAAATAGAATGCCTTTTTTATAAAAAAGGCAUUCUAUUUCUUGAAAUAGAAUGCCUUUUUUAUU9.56.9


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894GCUUCAAAUUUAUUACAAG84.8389859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706912GCTTCAAATTTATTACAAGCTTGTAATAAATTTGAAGC0.443600.272900.715500.750001.000001.00000


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768UCUUUUUUUUUUUUUUUAA75.03462027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782786TCTTTTTTTTTTTTTTTAATTAAAAAAAAAAAAAAAGA0.574400.177000.689700.750001.000001.00000


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861AAGCAAAUCACACAAAUUA87.4122592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883879AAGCAAATCACACAAATTATAATTTGTGTGATTTGCTT0.533100.497700.603400.500001.000001.00000


Target Position: 1339, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339CCCUUACGUCAGUUGUAAA94.7905143

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5133919CCCTTACGTCAGTTGTAAA1/1/0/097.75CUL2NM_003591.21NANANA10:35321403..35321421(-)00CUL2(0.002)


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786CUCAGGCUCCUUCAUCUAC67.21932914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9231804CTCAGGCTCCTTCATCTACGTAGATGAAGGAGCCTGAG0.292300.031700.629300.500001.000001.00000


Target Position: 3046, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046CAUGAAAAAUGUCUAGAUU91.1114308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3044-3066TACATGAAAAATGTCTAGATTATAAUCUAGACAUUUUUCAUGUACAUGAAAAAUGUCUAGAUUAUU20.27.4


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CACUGGUUUACCUCAUAUG76.91951768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031160CACTGGTTTACCTCATATGCATATGAGGTAAACCAGTG0.114000.040500.637900.500000.983701.00000


Target Position: 4216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4216UCCAAAUUGAAAAAAAAAA72.60912326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2414234TCCAAATTGAAAAAAAAAATTTTTTTTTTCAATTTGGA0.445200.245500.870700.750001.000001.00000


Target Position: 3681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3681UCAACAUACAAUUUUUCUU72.48772339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433699TCAACATACAATTTTTCTTAAGAAAAATTGTATGTTGA0.268100.281000.586200.750001.000001.00000


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715CCAAGACACAGUAAUAGAU89.4729423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8361733CCAAGACACAGTAATAGATATCTATTACTGTGTCTTGG0.128700.058200.663801.000001.000001.00000


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064UGCAGAAUGUCAUAAUAUA94.7003146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721082TGCAGAATGTCATAATATATATATTATGACATTCTGCA0.338600.014900.810300.750001.000001.00000


Target Position: 3517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3517GGGUGCCACAUAUAUAAAU86.6674662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973535GGGTGCCACATATATAAATATTTATATATGTGGCACCC0.649400.663900.982801.000001.000001.00000


Target Position: 2798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798GGACAUAAAAUUUAAAAAC76.78191792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452816GGACATAAAATTTAAAAACGTTTTTAAATTTTATGTCC0.237600.021600.724100.750001.000001.00000


Target Position: 4197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4197UGUUGAUUGAUAAAAGUUU76.10881893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8904215TGTTGATTGATAAAAGTTTAAACTTTTATCAATCAACA0.117100.059400.706900.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952GAUUAAAAGAUGAAGAAAU91.5578286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
990970GATTAAAAGATGAAGAAATATTTCTTCATCTTTTAATC0.096300.078800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
950-972TAGATTAAAAGATGAAGAAATTCAUUUCUUCAUCUUUUAAUCUAGAUUAAAAGAUGAAGAAAUUCU14.8-9.711


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948GGUAGAUUAAAAGAUGAAG76.79531789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675966GGTAGATTAAAAGATGAAGCTTCATCTTTTAATCTACC0.176400.119600.715500.750001.000001.00000


Target Position: 3678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3678CCCUCAACAUACAAUUUUU88.9897451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1553696CCCTCAACATACAATTTTTAAAAATTGTATGTTGAGGG0.547600.543100.991401.000001.000001.00000


Target Position: 1999, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1999GUGAAACUGUCAGUUAUAA92.2574249

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1997-2019CAGTGAAACTGTCAGTTATAAAGUUAUAACUGACAGUUUCACUGGUGAAACUGUCAGUUAUAAAGU6.319.222


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363UCCCAGUAUCAGCAUGAUU71.90172406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372381TCCCAGTATCAGCATGATTAATCATGCTGATACTGGGA0.225700.040000.862100.750000.989100.62500


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162CCCCCUCCCCUUGUCCCCU52.44593941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520180CCCCCTCCCCTTGTCCCCTAGGGGACAAGGGGAGGGGG0.700600.656000.646600.750001.000001.00000


Target Position: 1997, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997CAGUGAAACUGUCAGUUAU96.1189101

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8199719CAGTGAAACTGTCAGTTAT1/1/0/097.21CUL2NM_003591.21NANANA10:35305219..35305237(-)00CUL2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1995-2017AACAGTGAAACTGTCAGTTATAAAUAACUGACAGUUUCACUGUUCAGUGAAACUGUCAGUUAUAAU20.319.222


Target Position: 2055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055CUGACAAAAACAAUCAAAU81.95811153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2053-2075AACTGACAAAAACAATCAAATCAAUUUGAUUGUUUUUGUCAGUUCUGACAAAAACAAUCAAAUCAU7.420.522


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547CCUCCAUAAUUUGGUCAUU78.6391557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832565CCTCCATAATTTGGTCATTAATGACCAAATTATGGAGG0.139900.075100.836201.000000.940200.87500


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905CCUUUAAAAAAUCCACAGU73.2762252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6593923CCTTTAAAAAATCCACAGTACTGTGGATTTTTTAAAGG0.224700.176700.637900.750001.000001.00000


Target Position: 3433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3433UAGAGUCACUCUCAUCAAU82.17481138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993451TAGAGTCACTCTCATCAATATTGATGAGAGTGACTCTA0.141000.020000.663800.500000.902200.62500


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893AGCUUCAAAUUUAUUACAA86.929640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255911AGCTTCAAATTTATTACAATTGTAATAAATTTGAAGCT0.470500.270600.706900.750001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693AGUUCAACAAUUUUAUCAA92.1307256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9231711AGTTCAACAATTTTATCAATTGATAAAATTGTTGAACT0.702100.436500.560300.750001.000001.00000


Target Position: 344, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344CUCAGAUAUCUAUGCUUUA93.4422193

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_234419CTCAGATATCTATGCTTTA1/1/0/097.75CUL2NM_003591.21NANANANA00CUL2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
342-364TTCTCAGATATCTATGCTTTATGUAAAGCAUAGAUAUCUGAGAACUCAGAUAUCUAUGCUUUAUGU18.521.423


Target Position: 4008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4008GUCUUACAAUUGGUUUAUU81.24261232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4006-4028GGGTCTTACAATTGGTTTATTCAAAUAAACCAAUUGUAAGACCCGUCUUACAAUUGGUUUAUUCAU13.920.3


Target Position: 1065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1065GCAGAAUGUCAUAAUAUAA104.13817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1063-1085ATGCAGAATGTCATAATATAATTUUAUAUUAUGACAUUCUGCAUGCAGAAUGUCAUAAUAUAAUUU-5.918.123


Target Position: 2759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2759GUUGAUGUGUCUUUUUUUU80.60631311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2757-2779CAGTTGATGTGTCTTTTTTTTTTAAAAAAAAGACACAUCAACUGGUUGAUGUGUCUUUUUUUUUUU-11.320.511


Target Position: 2050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2050AGGAACUGACAAAAACAAU79.18891487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242068AGGAACTGACAAAAACAATATTGTTTTTGTCAGTTCCT0.340000.124300.836200.750001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130GGGGCUUCGUCUUUCACUC72.32172361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707148GGGGCTTCGTCTTTCACTCGAGTGAAAGACGAAGCCCC0.696900.032600.681000.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439AGGGAUGACAGAGAAUGAA84.8717855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911457AGGGATGACAGAGAATGAATTCATTCTCTGTCATCCCT0.284500.019000.672400.750001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833AGUGUACAGAUGUUUGAAU83.42881006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451851AGTGTACAGATGTTTGAATATTCAAACATCTGTACACT0.150900.051200.698300.750001.000001.00000


Target Position: 3330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3330GUGGCCUUCCCUGAGUCUU66.39932987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183348GTGGCCTTCCCTGAGTCTTAAGACTCAGGGAAGGCCAC0.110500.048000.655200.750000.929300.75000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259GGAAGUGCAUGGUAAAUUU93.3448201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091277GGAAGTGCATGGTAAATTTAAATTTACCATGCACTTCC0.206500.017900.870701.000001.000001.00000


Target Position: 3762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3762GCCUCAAGCAAUCCUAUCU80.00951387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323780GCCTCAAGCAATCCTATCTAGATAGGATTGCTTGAGGC0.516000.099000.775900.750001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084UUCGACAAGAGAAAAAAAA69.24272698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531102TTCGACAAGAGAAAAAAAATTTTTTTTCTCTTGTCGAA0.376100.105600.672400.500001.000001.00000


Target Position: 3977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3977GUUCAUAUUUAAAUUUGUU85.7323760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3975-3997TGGTTCATATTTAAATTTGTTGTAACAAAUUUAAAUAUGAACCAGUUCAUAUUUAAAUUUGUUGUU5.38.7


Target Position: 1839, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CAGAUGUUUGAAUUAUUUU84.4451901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441857CAGATGTTTGAATTATTTTAAAATAATTCAAACATCTG0.302800.075800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1837-1859TACAGATGTTTGAATTATTTTATAAAAUAAUUCAAACAUCUGUACAGAUGUUUGAAUUAUUUUAUU-10.319.222


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268GGAACAAACUUUUGACGAC80.91511272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999286GGAACAAACTTTTGACGACGTCGTCAAAAGTTTGTTCC0.094800.047400.551700.750001.000001.00000


Target Position: 3814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3814GCCACUGCAUCCAUCCAAC73.50242222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2423832GCCACTGCATCCATCCAACGTTGGATGGATGCAGTGGC0.716900.133700.853400.750001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796UUCAUCUACGUUUGCAAUU57.54863681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711814TTCATCTACGTTTGCAATTAATTGCAAACGTAGATGAA0.102500.054300.663800.500001.000001.00000


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834GUGUACAGAUGUUUGAAUU86.0002727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011852GTGTACAGATGTTTGAATTAATTCAAACATCTGTACAC0.165900.080700.784500.750001.000001.00000


Target Position: 2375, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375CAUGAUUAAGAAGUGUAUU82.37911119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2373-2395AGCATGATTAAGAAGTGTATTGAAAUACACUUCUUAAUCAUGCUCAUGAUUAAGAAGUGUAUUGAU19.08.722


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674UCCUCCCUCAACAUACAAU70.21912595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3963692TCCTCCCTCAACATACAATATTGTATGTTGAGGGAGGA0.857300.855600.862100.750001.000001.00000


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262AGUGCAUGGUAAAUUUGUU84.7081875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321280AGTGCATGGTAAATTTGTTAACAAATTTACCATGCACT0.248100.031200.560300.750001.000001.00000


Target Position: 3828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828CCAACACAAAAUUUUUAAA88.7238480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3693846CCAACACAAAATTTTTAAATTTAAAAATTTTGTGTTGG0.307100.317000.844801.000001.000001.00000


Target Position: 719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719CCGAGAAAUCAAAAAUGAU88.0627533

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
717-739CTCCGAGAAATCAAAAATGATCGAUCAUUUUUGAUUUCUCGGAGCCGAGAAAUCAAAAAUGAUCGU7.421.033


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434UCGGCAUUUGCAUAAGAGA74.24382110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884452TCGGCATTTGCATAAGAGATCTCTTATGCAAATGCCGA0.288400.031400.569000.500000.994600.87500


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873GGAGAGUAUUACAAACAAG89.0334449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788891GGAGAGTATTACAAACAAGCTTGTTTGTAATACTCTCC0.494700.025500.732800.750001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554CACCCAGUUUAUUAAAAAG80.16741371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989572CACCCAGTTTATTAAAAAGCTTTTTAATAAACTGGGTG0.138600.059700.655200.500001.000001.00000


Target Position: 2137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137CGUUUUCAUUAAAUAUGAA98.947162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2135-2157TTCGTTTTCATTAAATATGAACTUUCAUAUUUAAUGAAAACGAACGUUUUCAUUAAAUAUGAACUU8.714.921


Target Position: 3476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476ACCUAAAUACUUUUUUAAA88.0614535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8613494ACCTAAATACTTTTTTAAATTTAAAAAAGTATTTAGGT0.122600.102300.853400.750001.000001.00000


Target Position: 2402, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402GAUAGACAAACAAUACAUA101.47933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272420GATAGACAAACAATACATATATGTATTGTTTGTCTATC0.202400.101400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2400-2422CTGATAGACAAACAATACATAGAUAUGUAUUGUUUGUCUAUCAGGAUAGACAAACAAUACAUAGAU6.720.332


Target Position: 2814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2814AACUUAAAUAUUGUAAUAU80.27751352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192832AACTTAAATATTGTAATATATATTACAATATTTAAGTT0.205600.078100.603400.500001.000001.00000


Target Position: 4140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4140CAAACCAUAUAAUAUUGUA99.093459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4138-4160GGCAAACCATATAATATTGTACAUACAAUAUUAUAUGGUUUGCCCAAACCAUAUAAUAUUGUACAU6.718.8


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273UGUCUUUCUUCGGUUGCAU70.64362545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673291TGTCTTTCTTCGGTTGCATATGCAACCGAAGAAAGACA0.248600.049400.551700.750001.000001.00000


Target Position: 1055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055GUUUUUACAUGCAGAAUGU81.28311226

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1053-1075CAGTTTTTACATGCAGAATGTCAACAUUCUGCAUGUAAAAACUGGUUUUUACAUGCAGAAUGUCAU18.10.022


Target Position: 2389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389GUAUUGAAGUUCUGAUAGA93.477192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2387-2409GTGTATTGAAGTTCTGATAGACAUCUAUCAGAACUUCAAUACACGUAUUGAAGUUCUGAUAGACAU17.88.922


Target Position: 1795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795CUUCAUCUACGUUUGCAAU81.57791191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401813CTTCATCTACGTTTGCAATATTGCAAACGTAGATGAAG0.106700.057400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1793-1815TCCTTCATCTACGTTTGCAATTCAUUGCAAACGUAGAUGAAGGACUUCAUCUACGUUUGCAAUUCU20.020.423


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800UGAACAGUAUAAGAAAAAA88.4925492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662818TGAACAGTATAAGAAAAAATTTTTTCTTATACTGTTCA0.304400.036700.724100.750001.000001.00000


Target Position: 1598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GAUCAACAAAUUAAAGCAA93.0905214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1596-1618ATGATCAACAAATTAAAGCAAGCUUGCUUUAAUUUGUUGAUCAUGAUCAACAAAUUAAAGCAAGCU19.720.522


Target Position: 4185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4185GUUUUGAUAACUUGUUGAU80.6731301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4183-4205TTGTTTTGATAACTTGTTGATTGAUCAACAAGUUAUCAAAACAAGUUUUGAUAACUUGUUGAUUGU20.57.4


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019UGAAUGUCAACAACGAAUG60.81933461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851037TGAATGTCAACAACGAATGCATTCGTTGTTGACATTCA0.096800.014500.569000.500001.000001.00000


Target Position: 3524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3524ACAUAUAUAAAUCCCAUUA87.8077556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6823542ACATATATAAATCCCATTATAATGGGATTTATATATGT0.197400.034900.672400.750001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589AGAAGCCAUGAUCAACAAA86.0737719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671607AGAAGCCATGATCAACAAATTTGTTGATCATGGCTTCT0.509400.015000.724100.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284CUUAUCAACACUGUUUUGA71.43662457

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1282-1304AGCTTATCAACACTGTTTTGAATUCAAAACAGUGUUGAUAAGCUCUUAUCAACACUGUUUUGAAUU12.28.922


Target Position: 3536, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3536CCCAUUAUUUUGUUUAUUU81.99191150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2373554CCCATTATTTTGTTTATTTAAATAAACAAAATAATGGG0.453600.209000.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3534-3556ATCCCATTATTTTGTTTATTTTAAAAUAAACAAAAUAAUGGGAUCCCAUUAUUUUGUUUAUUUUAU-0.312.6


Target Position: 3936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936CCUAACAAAAACAAUAAUU77.73931659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1513954CCTAACAAAAACAATAATTAATTATTGTTTTTGTTAGG0.556600.554200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3934-3956CTCCTAACAAAAACAATAATTACAAUUAUUGUUUUUGUUAGGAGCCUAACAAAAACAAUAAUUACU-1.811.8


Target Position: 3022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022ACUUGUACUCCUAUUUAAA91.8451272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2783040ACTTGTACTCCTATTTAAATTTAAATAGGAGTACAAGT0.402000.195900.706900.750001.000001.00000


Target Position: 3261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261UCAUUCAAAAGUUGUCUUU66.64742963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473279TCATTCAAAAGTTGTCTTTAAAGACAACTTTTGAATGA0.105200.028000.724100.750001.000001.00000


Target Position: 4048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4048GUGUCUCAAGUGUUUUAAA94.2937163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8134066GTGTCTCAAGTGTTTTAAATTTAAAACACTTGAGACAC0.133700.025100.793100.750001.000001.00000


Target Position: 1744, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744GUUUUCAAAUAUAUGUUCU80.02451385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1742-1764TAGTTTTCAAATATATGTTCTACAGAACAUAUAUUUGAAAACUAGUUUUCAAAUAUAUGUUCUACU16.17.722


Target Position: 3106, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106GCUUUAUUUUUAUGGAUUA93.9076176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3104-3126ATGCTTTATTTTTATGGATTAGAUAAUCCAUAAAAAUAAAGCAUGCUUUAUUUUUAUGGAUUAGAU20.1-4.3


Target Position: 3538, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538CAUUAUUUUGUUUAUUUUA92.3329241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463556CATTATTTTGTTTATTTTATAAAATAAACAAAATAATG0.195700.068400.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3536-3558CCCATTATTTTGTTTATTTTATAUAAAAUAAACAAAAUAAUGGGCAUUAUUUUGUUUAUUUUAUAU-9.7-10.3


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GGCUUCGUCUUUCACUCCU74.67212067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569150GGCTTCGTCTTTCACTCCTAGGAGTGAAAGACGAAGCC0.821500.407000.655200.750001.000001.00000


Target Position: 1544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544GGCAAAACGUUUAAUUCAU85.8035753

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1542-1564CTGGCAAAACGTTTAATTCATGGAUGAAUUAAACGUUUUGCCAGGGCAAAACGUUUAAUUCAUGGU8.921.123


Target Position: 3021, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3021CACUUGUACUCCUAUUUAA100.90439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2433039CACTTGTACTCCTATTTAATTAAATAGGAGTACAAGTG0.444600.222100.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3019-3041TTCACTTGTACTCCTATTTAAATUUAAAUAGGAGUACAAGUGAACACUUGUACUCCUAUUUAAAUU-2.319.0


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271ACAAACUUUUGACGACAAU72.80622307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675289ACAAACTTTTGACGACAATATTGTCGTCAAAAGTTTGT0.185700.064900.698300.750001.000001.00000


Target Position: 2099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099CCAUGAUUCAGAAAAGGAA94.2048168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2097-2119AACCATGATTCAGAAAAGGAAGAUUCCUUUUCUGAAUCAUGGUUCCAUGAUUCAGAAAAGGAAGAU18.713.622


Target Position: 3619, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3619GAUCUAUUAUCAUAUUUAU101.10937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6213637GATCTATTATCATATTTATATAAATATGATAATAGATC0.646300.440900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3617-3639GCGATCTATTATCATATTTATTGAUAAAUAUGAUAAUAGAUCGCGAUCUAUUAUCAUAUUUAUUGU-8.06.6


Target Position: 2788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2788GUAUCUUAAAGGACAUAAA96.379395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2786-2808ATGTATCTTAAAGGACATAAAATUUUAUGUCCUUUAAGAUACAUGUAUCUUAAAGGACAUAAAAUU16.18.432


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553ACACCCAGUUUAUUAAAAA87.7153567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806571ACACCCAGTTTATTAAAAATTTTTAATAAACTGGGTGT0.135800.067100.706900.750001.000001.00000


Target Position: 1790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790GGCUCCUUCAUCUACGUUU80.12231377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061808GGCTCCTTCATCTACGTTTAAACGTAGATGAAGGAGCC0.164200.098801.000001.000001.000001.00000


Target Position: 3955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3955ACUUAGUAUCAUCUAAUAU87.4667586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933973ACTTAGTATCATCTAATATATATTAGATGATACTAAGT0.115700.045100.663800.750000.983700.62500


Target Position: 874, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874GAGAGUAUUACAAACAAGA92.3626240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876892GAGAGTATTACAAACAAGATCTTGTTTGTAATACTCTC0.487000.081200.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
872-894AGGAGAGTATTACAAACAAGAAGUCUUGUUUGUAAUACUCUCCUGAGAGUAUUACAAACAAGAAGU10.318.932


Target Position: 3023, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3023CUUGUACUCCUAUUUAAAU85.3185805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7203041CTTGTACTCCTATTTAAATATTTAAATAGGAGTACAAG0.383900.195500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3021-3043CACTTGTACTCCTATTTAAATCCAUUUAAAUAGGAGUACAAGUGCUUGUACUCCUAUUUAAAUCCU-9.719.0


Target Position: 3462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462CUUAGCAAUGCAUAACCUA87.1918610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3460-3482TGCTTAGCAATGCATAACCTAAAUAGGUUAUGCAUUGCUAAGCACUUAGCAAUGCAUAACCUAAAU18.519.7


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745GAGAAGACCCAAACCAGAA93.7903179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651763GAGAAGACCCAAACCAGAATTCTGGTTTGGGTCTTCTC0.409800.144000.637900.750001.000001.00000


Target Position: 3283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3283CGGUUGCAUAAUCCAUUAA89.0597447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2493301CGGTTGCATAATCCATTAATTAATGGATTATGCAACCG0.436900.229400.879301.000001.000001.00000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883ACAAACAAGAAGCUUCAAA79.47371448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341901ACAAACAAGAAGCTTCAAATTTGAAGCTTCTTGTTTGT0.426800.327900.706900.750000.940200.75000


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647CAUCGGAUGUAUACAGAUA101.68431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841665CATCGGATGTATACAGATATATCTGTATACATCCGATG0.170200.041100.612100.750001.000001.00000


Target Position: 1643, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643GCUACAUCGGAUGUAUACA88.9226458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711661GCTACATCGGATGTATACATGTATACATCCGATGTAGC0.141800.050300.646600.750000.940200.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1641-1663AAGCTACATCGGATGTATACAGAUGUAUACAUCCGAUGUAGCUUGCUACAUCGGAUGUAUACAGAU15.820.333


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646GAGAGCUAGCAUUGGAUAU85.6916765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888664GAGAGCTAGCATTGGATATATATCCAATGCTAGCTCTC0.117200.028600.767200.750001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897UCAAAUUUAUUACAAGAAU74.12332129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695915TCAAATTTATTACAAGAATATTCTTGTAATAAATTTGA0.392500.361500.715500.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338CCGUUUCUCAGAUAUCUAU86.2448700

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
336-358GACCGTTTCTCAGATATCTATGCAUAGAUAUCUGAGAAACGGUCCCGUUUCUCAGAUAUCUAUGCU8.219.722


Target Position: 2240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2240AGUUGAUGAGGACCGGAAA86.7494654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842258AGTTGATGAGGACCGGAAATTTCCGGTCCTCATCAACT0.096800.021200.706900.750001.000001.00000


Target Position: 3413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413UCCUCCAACAGUUUAGAUA77.30971705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403431TCCTCCAACAGTTTAGATATATCTAAACTGTTGGAGGA0.153500.053600.827600.750000.923900.62500


Target Position: 3864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3864CAAAUCACACAAAUUAUUU82.84751061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983882CAAATCACACAAATTATTTAAATAATTTGTGTGATTTG0.509300.482200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3862-3884AGCAAATCACACAAATTATTTCAAAAUAAUUUGUGUGAUUUGCUCAAAUCACACAAAUUAUUUCAU-10.314.8


Target Position: 3689, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689CAAUUUUUCUUUAUUUUAA94.3786158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023707CAATTTTTCTTTATTTTAATTAAAATAAAGAAAAATTG0.114100.107900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3687-3709TACAATTTTTCTTTATTTTAAAAUUAAAAUAAAGAAAAAUUGUACAAUUUUUCUUUAUUUUAAAAU-7.5-12.0


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838ACAGAUGUUUGAAUUAUUU81.66161183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931856ACAGATGTTTGAATTATTTAAATAATTCAAACATCTGT0.305300.075300.706900.750001.000001.00000


Target Position: 2163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2163AGUAAAAGAACAAAAUUUA89.6461403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632181AGTAAAAGAACAAAATTTATAAATTTTGTTCTTTTACT0.629700.242500.672400.750001.000001.00000


Target Position: 4075, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4075GAACUUAUAAUGACUUAUA99.868552

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4073-4095CTGAACTTATAATGACTTATATAUAUAAGUCAUUAUAAGUUCAGGAACUUAUAAUGACUUAUAUAU14.54.6


Target Position: 1736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GGGAAUUAGUUUUCAAAUA94.5385149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1734-1756TTGGGAATTAGTTTTCAAATATAUAUUUGAAAACUAAUUCCCAAGGGAAUUAGUUUUCAAAUAUAU7.415.522


Target Position: 2836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836AGAUAACCUAAUAAUUGUA94.4616155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822854AGATAACCTAATAATTGTATACAATTATTAGGTTATCT0.127600.069800.543100.750001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434GCGAAAGGGAUGACAGAGA82.8251067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981452GCGAAAGGGATGACAGAGATCTCTGTCATCCCTTTCGC0.114900.059900.698300.750001.000001.00000


Target Position: 1652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652GAUGUAUACAGAUAUGAGU88.0978531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1650-1672CGGATGTATACAGATATGAGTGTACUCAUAUCUGUAUACAUCCGGAUGUAUACAGAUAUGAGUGUU13.38.232


Target Position: 1066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066CAGAAUGUCAUAAUAUAAU89.1205442

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1064-1086TGCAGAATGTCATAATATAATTCAUUAUAUUAUGACAUUCUGCACAGAAUGUCAUAAUAUAAUUCU-8.019.222


Target Position: 2882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882UGCUGCUUGUCAAAUAAAA82.2521134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182900TGCTGCTTGTCAAATAAAATTTTATTTGACAAGCAGCA0.337600.077400.853400.750001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085UCGACAAGAGAAAAAAAAU76.04941902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271103TCGACAAGAGAAAAAAAATATTTTTTTTCTCTTGTCGA0.341300.115300.784500.750001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CCCAGUAUCAGCAUGAUUA92.4399236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082382CCCAGTATCAGCATGATTATAATCATGCTGATACTGGG0.235200.088300.956901.000000.989100.75000


Target Position: 3096, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096CAUAAAGAAUGCUUUAUUU91.4954287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3094-3116AGCATAAAGAATGCTTTATTTTTAAAUAAAGCAUUCUUUAUGCUCAUAAAGAAUGCUUUAUUUUUU-4.36.9


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813AGCCACUGCAUCCAUCCAA78.89491530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6303831AGCCACTGCATCCATCCAATTGGATGGATGCAGTGGCT0.667500.121000.706900.750000.978300.75000


Target Position: 3350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350GGAAAUCUAUGAUACCAAC83.937957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693368GGAAATCTATGATACCAACGTTGGTATCATAGATTTCC0.100400.065600.724100.750001.000001.00000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791GCUCCUUCAUCUACGUUUG73.73692191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6271809GCTCCTTCATCTACGTTTGCAAACGTAGATGAAGGAGC0.191600.104400.706900.750001.000001.00000


Target Position: 795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795CAUGUUGAACAGUAUAAGA94.2728164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815TTCATGTTGAACAGTATAAGAAAUCUUAUACUGUUCAACAUGAACAUGUUGAACAGUAUAAGAAAU6.320.532


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832UGACAGAUAACCUAAUAAU84.5908882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3022850TGACAGATAACCTAATAATATTATTAGGTTATCTGTCA0.542200.108600.715500.750001.000001.00000


Target Position: 752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
752CCCAAACCAGAAAGUAAUC64.94133130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387770CCCAAACCAGAAAGTAATCGATTACTTTCTGGTTTGGG0.293400.141500.810300.750001.000001.00000


Target Position: 4218, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4218CAAAUUGAAAAAAAAAAAA85.4861789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5284236CAAATTGAAAAAAAAAAAATTTTTTTTTTTTCAATTTG0.942500.290300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4216-4238TCCAAATTGAAAAAAAAAAAAAAUUUUUUUUUUUUCAAUUUGGACAAAUUGAAAAAAAAAAAAAAU-11.37.40


Target Position: 2387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387GUGUAUUGAAGUUCUGAUA91.8676270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2385-2407AAGTGTATTGAAGTTCTGATAGAUAUCAGAACUUCAAUACACUUGUGUAUUGAAGUUCUGAUAGAU20.413.522


Target Position: 557, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557CCAGUUUAUUAAAAAGAAU86.1316717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
690575CCAGTTTATTAAAAAGAATATTCTTTTTAATAAACTGG0.168300.036200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
555-577ACCCAGTTTATTAAAAAGAATAAAUUCUUUUUAAUAAACUGGGUCCAGUUUAUUAAAAAGAAUAAU5.511.811


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898AGUAAGGCCUUUAAAAAAU78.55171569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143916AGTAAGGCCTTTAAAAAATATTTTTTAAAGGCCTTACT0.738900.154600.698300.750001.000001.00000


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948GUUGACCACAAAAUAUAUU77.51111693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6032966GTTGACCACAAAATATATTAATATATTTTGTGGTCAAC0.628400.046500.637900.750001.000001.00000


Target Position: 3650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3650CCAUCACCACCACCACCAC71.19712480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693668CCATCACCACCACCACCACGTGGTGGTGGTGGTGATGG0.993100.976900.551700.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287UGCAUAAUCCAUUAAUUCU76.64251814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603305TGCATAATCCATTAATTCTAGAATTAATGGATTATGCA0.752400.321900.629300.500001.000001.00000


Target Position: 3668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3668CACCCCUCCUCCCUCAACA79.24951478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433686CACCCCTCCTCCCTCAACATGTTGAGGGAGGAGGGGTG0.989500.988200.586200.500001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163CCCCUCCCCUUGUCCCCUG51.20693983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426181CCCCTCCCCTTGTCCCCTGCAGGGGACAAGGGGAGGGG0.270500.224000.706900.750001.000001.00000


Target Position: 4137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4137UGGCAAACCAUAUAAUAUU77.75771658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7144155TGGCAAACCATATAATATTAATATTATATGGTTTGCCA0.469300.031800.836200.750000.962000.62500


Target Position: 3465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3465AGCAAUGCAUAACCUAAAU78.52891570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903483AGCAATGCATAACCTAAATATTTAGGTTATGCATTGCT0.495000.044800.844800.750001.000001.00000


Target Position: 3675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675CCUCCCUCAACAUACAAUU75.88151926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933693CCTCCCTCAACATACAATTAATTGTATGTTGAGGGAGG0.840700.839200.836201.000001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257UGAUGAAACAUGGAACAAA88.0239537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953275TGATGAAACATGGAACAAATTTGTTCCATGTTTCATCA0.103400.059500.724100.750001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CACUUAUGGAAAUAGGAGA87.0234626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925649CACTTATGGAAATAGGAGATCTCCTATTTCCATAAGTG0.336800.017500.569000.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967CCAAAUGGCAGUUCUUCUU75.75291946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1965-1987TACCAAATGGCAGTTCTTCTTGCAAGAAGAACUGCCAUUUGGUACCAAAUGGCAGUUCUUCUUGCU19.117.722


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140UCCACUGGUUUACCUCAUA78.1841610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541158TCCACTGGTTTACCTCATATATGAGGTAAACCAGTGGA0.182300.053000.827600.750000.983701.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556CCCAGUUUAUUAAAAAGAA90.8583325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691574CCCAGTTTATTAAAAAGAATTCTTTTTAATAAACTGGG0.167800.046100.819001.000001.000001.00000