siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 209   213   216   217   295   296   380   381   382   383   388   426   427   434   435   468   472   482   498   527  
529   548   557   559   578   579   580   587   588   590   629   662   663   667   707   715   716   717   729   730  
733   879   881   1059   1108   1109   1121   1164   1165   1173   1174   1175   1176   1177   1183   1184   1185   1186   1187   1189  
1218   1219   1240   1267   1269   1273   1274   1275   1276   1277   1279   1305   1306   1312   1317   1318   1325   1326   1327   1519  
1520   1521   1525   1562   1588   1589   1594   1823   1826   1827   1828   1833   1834   1835   1837   1841   1891   1892   1905   1906  
1914   1919   1920   1925   1931   1933   1940   1997   2051   2056   2117   2141   2153   2154   2159   2165   2173   2233   2234   2256  
2283   2284   2285   2304   2309   2312   2322   2400   2401   2403   2405   2415   2453   2454   2455   2460   2464   2466   2474   2511  
2558   2559   2563   2564   2565   2610   2672   2690   2691   2692   2715   2716   2717   2718   2719   2724   2725   2726   2727   2738  
2739   2760   2763   2764   2765   2768   2769   2770   2772   2774   2800   2801   2810   2839   2858   2882   2884   2885   2886   2963  
2964   3043   3044   3046   3047   3060   3061   3062   3065   3067   3153   3154   3158   3159   3160   3227   3232   3280   3294   3301  
3313   3336   3341   3342   3343   3344   3349   3354   3379   3380   3416   3425   3459   3478   3481   3482   3502   3529   3540   3548  
3549   3553   3567   3587   3589   3595   3596   3597   3599   3602   3609   3634   3655   3674   3676   3686   3730   3738   3772   3799  
3800   3905   3906   3912   3968   3969   3972   4013   4014   4049   4050   4051   4075   4077   4087   4125   4126   4137   4196   4252  
4255   4284   4285   4306   4307   4311   4314   4325   4360   4363   4387  
Biltr, Rnaxs, Sidirect 386   389   390   473   474   665   666   708   880   882   1066   1067   1102   1110   1111   1179   1220   1268   1278   1283  
1292   1481   1581   1593   2123   2140   2155   2160   2161   2166   2167   2168   2174   2235   2236   2257   2258   2286   2303   2310  
2311   2313   2319   2402   2404   2446   2456   2461   2465   2467   2486   2487   2512   2651   2771   2773   2775   2797   2888   3066  
3068   3105   3228   3281   3288   3289   3290   3295   3302   3314   3355   3381   3415   3417   3526   3588   3598   3600   3603   3610  
3677   3678   3687   3731   3801   3802   3915   3970   3973   3974   4184   4187   4188   4195   4197   4251   4253   4256   4288   4312  
4315   4326   4364   4388   4389   4391  
Biltr, Sidirect 270   293   309   317   430   487   495   497   499   522   531   538   550   594   599   632   696   697   771   810  
819   823   887   933   981   984   1009   1074   1115   1188   1209   1307   1354   1419   1460   1470   1480   1584   1643   1644  
1715   1719   1725   1759   2000   2002   2125   2130   2132   2133   2145   2180   2181   2193   2247   2249   2262   2323   2338   2369  
2370   2372   2458   2475   2500   2509   2514   2525   2539   2542   2579   2587   2629   2631   2638   2640   2646   2731   2736   2744  
2802   2806   2854   2860   2862   2865   2890   2893   2919   2935   2945   2947   2950   3094   3095   3098   3103   3144   3155   3182  
3192   3209   3218   3221   3242   3259   3265   3266   3268   3279   3305   3345   3362   3364   3366   3423   3426   3483   3511   3518  
3520   3522   3534   3563   3564   3608   3641   3642   3653   3836   3845   3859   3860   3880   3889   3925   3939   3940   3944   3949  
3953   3954   3979   3989   3995   4000   4016   4042   4052   4061   4062   4065   4069   4088   4141   4180   4210   4225   4260   4277  
4292   4298   4300   4303   4309   4339   4348   4351   4355   4361  
Biltr, Ernai 1053   2913   3092   3725   3823   4247  
Biltr, Ernai, Rnaxs 664  
Biltr, Ernai, Sidirect 3768   4279  
Biltr, Ernai, Rnaxs, Sidirect 4138  


Target Position: 3336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3336AGUGUUGGGGUUUGGUUUU67.79822840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3153354AGTGTTGGGGTTTGGTTTTAAAACCAAACCCCAACACT0.492400.165400.706900.750001.000001.00000


Target Position: 3459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459GGGUACCACUGAAUCUGUA97.048681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673477GGGTACCACTGAATCTGTATACAGATTCAGTGGTACCC0.372800.028700.810301.000001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663CGGCACAUAAGGAUUUUAA89.8482357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970681CGGCACATAAGGATTTTAATTAAAATCCTTATGTGCCG0.475200.016700.879301.000001.000001.00000


Target Position: 3062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3062CUUAGAGCUUUUUUUUUUU78.46941561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783080CTTAGAGCTTTTTTTTTTTAAAAAAAAAAAGCTCTAAG0.626900.079100.637900.750001.000001.00000


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905UGAUCUUCCUCUGCUAAAU76.72721796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7353923TGATCTTCCTCTGCTAAATATTTAGCAGAGGAAGATCA0.222000.030800.715500.750001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GCUUGUCAUUUUGUCCAUC71.17652465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824748GCTTGTCATTTTGTCCATCGATGGACAAAATGACAAGC0.250800.035600.672400.750001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216GGGCUGAAGAGAAGAUGGA84.7882802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852234GGGCTGAAGAGAAGATGGATCCATCTTCTCTTCAGCCC0.547000.061800.620700.750001.000001.00000


Target Position: 3182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182CAAAGUACAGGUACUUUGU81.06631217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3180-3202TGCAAAGTACAGGTACTTTGTCTACAAAGUACCUGUACUUUGCACAAAGUACAGGUACUUUGUCUU11.812.932


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285GCCAUAAGCAACAAUUUUC70.99692494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8492303GCCATAAGCAACAATTTTCGAAAATTGTTGCTTATGGC0.186900.023300.827600.750001.000001.00000


Target Position: 2558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558UCAUGUCCUGUGUCAGUUU76.08471887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252576TCATGTCCTGTGTCAGTTTAAACTGACACAGGACATGA0.319900.047400.724100.750000.978300.87500


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269CUAAUGCCCCAGAAGAAAA86.1706672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491287CTAATGCCCCAGAAGAAAATTTTCTTCTGGGGCATTAG0.484800.168500.672400.750001.000001.00000


Target Position: 4255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4255UCAUUCAUAUUACAAUAUU76.28561865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4724273TCATTCATATTACAATATTAATATTGTAATATGAATGA0.240300.089500.715500.750001.000001.00000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046UGAUGACCAAUUUUAACUU77.48851692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483064TGATGACCAATTTTAACTTAAGTTAAAATTGGTCATCA0.337200.146200.586200.750001.000001.00000


Target Position: 4125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4125ACCAUUAAAAUAUGCACUA79.70011385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5784143ACCATTAAAATATGCACTATAGTGCATATTTTAATGGT0.542500.064700.681000.750001.000001.00000


Target Position: 3417, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3417CUCUAAGAUGUUAUAUUUU84.8175799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5413435CTCTAAGATGTTATATTTTAAAATATAACATCTTAGAG0.350200.048500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3415-3437CACTCTAAGATGTTATATTTTTCAAAAUAUAACAUCUUAGAGUGCUCUAAGAUGUUAUAUUUUUCU-8.020.222


Target Position: 664, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664GGCACAUAAGGAUUUUAAA96.484696

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_366419GGCACATAAGGATTTTAAA1/1/0/097.75FMR1NM_002024.41NANANAX:147011482..147011500(+)00FMR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988682GGCACATAAGGATTTTAAATTTAAAATCCTTATGTGCC0.387400.015801.000001.000001.000001.00000


Target Position: 3995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3995GUUCUGUUACAAAAUGUAA92.2297245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3993-4015GTGTTCTGTTACAAAATGTAACTUUACAUUUUGUAACAGAACACGUUCUGUUACAAAAUGUAACUU6.919.223


Target Position: 2565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565CUGUGUCAGUUUAUGUUUU82.9731987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682583CTGTGTCAGTTTATGTTTTAAAACATAAACTGACACAG0.257400.138900.784500.750001.000001.00000


Target Position: 2167, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2167CGUAAUUCUUAUUCCAUAU90.6067323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372185CGTAATTCTTATTCCATATATATGGAATAAGAATTACG0.309600.099400.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2165-2187TCCGTAATTCTTATTCCATATTAAUAUGGAAUAAGAAUUACGGACGUAAUUCUUAUUCCAUAUUAU21.210.032


Target Position: 1480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480GGAUUAUCACCUGAACUAU92.3569234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1478-1500TTGGATTATCACCTGAACTATTTAUAGUUCAGGUGAUAAUCCAAGGAUUAUCACCUGAACUAUUUU20.311.632


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837GGGAGGAAGAGGACAAGGA85.5959721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491855GGGAGGAAGAGGACAAGGATCCTTGTCCTCTTCCTCCC0.773800.634900.620700.750001.000001.00000


Target Position: 4309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4309CAUGAUGUUUUUAAAAUCU83.8785882

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4307-4329GTCATGATGTTTTTAAAATCTTAAGAUUUUAAAAACAUCAUGACCAUGAUGUUUUUAAAAUCUUAU2.120.512


Target Position: 3502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3502GCCUCUGAUGUAUUUUGUG74.39232103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723520GCCTCTGATGTATTTTGTGCACAAAATACATCAGAGGC0.108900.016600.706900.750001.000001.00000


Target Position: 3158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3158UUCCAUGUAUGCAUAAUAA85.8643697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803176TTCCATGTATGCATAATAATTATTATGCATACATGGAA0.337600.069000.637900.500000.989100.87500


Target Position: 4355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4355GUUUAUCUAGAUGUAAAUU81.88511107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4353-4375TTGTTTATCTAGATGTAAATTTTAAUUUACAUCUAGAUAAACAAGUUUAUCUAGAUGUAAAUUUUU6.96.922


Target Position: 4225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4225GAUUCACAUGUUUUCAAAU91.4906271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4223-4245TTGATTCACATGTTTTCAAATGGAUUUGAAAACAUGUGAAUCAAGAUUCACAUGUUUUCAAAUGGU7.720.532


Target Position: 3478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3478CAGAGCCGUAAAAACUGAA87.0211597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893496CAGAGCCGTAAAAACTGAATTCAGTTTTTACGGCTCTG0.387800.032700.612100.750001.000001.00000


Target Position: 3953, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3953GCUUUUAAAAUUUUAAGCU75.91421912

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3951-3973TTGCTTTTAAAATTTTAAGCTAGAGCUUAAAAUUUUAAAAGCAAGCUUUUAAAAUUUUAAGCUAGU13.7-3.821


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304AGAUUUGCACAAAAAGAUA90.3668330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112322AGATTTGCACAAAAAGATATATCTTTTTGTGCAAATCT0.774200.020200.681000.750001.000001.00000


Target Position: 4256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256CAUUCAUAUUACAAUAUUU98.57647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7784274CATTCATATTACAATATTTAAATATTGTAATATGAATG0.195300.092000.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4254-4276TTCATTCATATTACAATATTTGTAAAUAUUGUAAUAUGAAUGAACAUUCAUAUUACAAUAUUUGUU-1.88.722


Target Position: 3686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3686AGUAUUUGAAAACAGAAAU77.05651754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343704AGTATTTGAAAACAGAAATATTTCTGTTTTCAAATACT0.179700.029100.698300.750001.000001.00000


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634AGUAUUGCCAAACAUUAAU75.90181914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6173652AGTATTGCCAAACATTAATATTAATGTTTGGCAATACT0.190100.097000.698300.750001.000001.00000


Target Position: 1268, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268CCUAAUGCCCCAGAAGAAA80.16771338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691286CCTAATGCCCCAGAAGAAATTTCTTCTGGGGCATTAGG0.444400.154200.844801.000000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1266-1288GACCTAATGCCCCAGAAGAAAAAUUUCUUCUGGGGCAUUAGGUCCCUAAUGCCCCAGAAGAAAAAU19.119.722


Target Position: 3483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483CCGUAAAAACUGAAGUUCU82.67441024

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3481-3503AGCCGTAAAAACTGAAGTTCTGCAGAACUUCAGUUUUUACGGCUCCGUAAAAACUGAAGUUCUGCU21.57.123


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056AGAUCGUAACCAGAAGAAA88.675457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422074AGATCGTAACCAGAAGAAATTTCTTCTGGTTACGATCT0.565300.143000.724100.750001.000001.00000


Target Position: 4339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4339CAAAAAUCUGAAGAUUGUU80.92681248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4337-4359TTCAAAAATCTGAAGATTGTTTAAACAAUCUUCAGAUUUUUGAACAAAAAUCUGAAGAUUGUUUAU19.20.422


Target Position: 430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430GUAUUCCAGAGCAAAUGAA88.5193471

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
428-450GTGTATTCCAGAGCAAATGAAAAUUCAUUUGCUCUGGAAUACACGUAUUCCAGAGCAAAUGAAAAU13.821.222


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435CCAGAGCAAAUGAAAAAGA82.77781008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840453CCAGAGCAAATGAAAAAGATCTTTTTCATTTGCTCTGG0.666700.176500.620700.750001.000001.00000


Target Position: 4061, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061CCAACUUUCAAGAACUUGU75.9421906

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4059-4081TACCAACTTTCAAGAACTTGTTTACAAGUUCUUGAAAGUUGGUACCAACUUUCAAGAACUUGUUUU19.210.322


Target Position: 3940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3940CUUACAAAUGAUUGCUUUU79.96261361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3938-3960TCCTTACAAATGATTGCTTTTAAAAAAGCAAUCAUUUGUAAGGACUUACAAAUGAUUGCUUUUAAU18.67.222


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GGCUAAAGGAAGAACAACA94.2429154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611951GGCTAAAGGAAGAACAACATGTTGTTCTTCCTTTAGCC0.243900.094100.793100.750001.000001.00000


Target Position: 3540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3540UCAUUUUACAGUUACUUUU72.07062378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473558TCATTTTACAGTTACTTTTAAAAGTAACTGTAAAATGA0.599800.163500.724100.750001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066CGAAUUUGCUGAAGAUGUA96.3127102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771084CGAATTTGCTGAAGATGTATACATCTTCAGCAAATTCG0.345300.016400.612101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1064-1086CTCGAATTTGCTGAAGATGTAATUACAUCUUCAGCAAAUUCGAGCGAAUUUGCUGAAGAUGUAAUU19.27.422


Target Position: 3265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3265GCAGAAUUGGAAAAGACUA92.5956223

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3263-3285AAGCAGAATTGGAAAAGACTAAGUAGUCUUUUCCAAUUCUGCUUGCAGAAUUGGAAAAGACUAAGU17.712.022


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059GCUUUCUCGAAUUUGCUGA76.57771821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501077GCTTTCTCGAATTTGCTGATCAGCAAATTCGAGAAAGC0.123300.017800.629300.750001.000001.00000


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772UGUCAAACAUUAGUACUUU79.01161480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292790TGTCAAACATTAGTACTTTAAAGTACTAATGTTTGACA0.230700.063600.706900.750001.000001.00000


Target Position: 2738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2738UGGAAACACUAAAUGUUAA88.7518446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572756TGGAAACACTAAATGTTAATTAACATTTAGTGTTTCCA0.131000.027300.810300.750000.962000.75000


Target Position: 3534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534GAAUUUUCAUUUUACAGUU88.6003463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3532-3554TTGAATTTTCATTTTACAGTTACAACUGUAAAAUGAAAAUUCAAGAAUUUUCAUUUUACAGUUACU19.00.412


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256UGCUAAGAAUUUUUUAUUU77.31931721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802274TGCTAAGAATTTTTTATTTAAATAAAAAATTCTTAGCA0.169800.016100.853400.750001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725AGGGAAGAUAAGUUGGAAA87.8714515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7642743AGGGAAGATAAGTTGGAAATTTCCAACTTATCTTCCCT0.287000.139100.844800.750001.000001.00000


Target Position: 4315, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4315GUUUUUAAAAUCUUAUUAA92.3451237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8764333GTTTTTAAAATCTTATTAATTAATAAGATTTTAAAAAC0.331300.141700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4313-4335ATGTTTTTAAAATCTTATTAAAGUUAAUAAGAUUUUAAAAACAUGUUUUUAAAAUCUUAUUAAAGU-2.3-9.121


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165UCCGUAAUUCUUAUUCCAU72.92742276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912183TCCGTAATTCTTATTCCATATGGAATAAGAATTACGGA0.303500.103200.715500.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CUCUGAUAAUGAGAAAUGA89.5316372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
817-839GTCTCTGATAATGAGAAATGAAGUCAUUUCUCAUUAUCAGAGACCUCUGAUAAUGAGAAAUGAAGU12.021.422


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044CCUGAUGACCAAUUUUAAC72.66562311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4173062CCTGATGACCAATTTTAACGTTAAAATTGGTCATCAGG0.265100.111600.698300.750001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461CAUUCUCAGUUUUUCUUAA97.402471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8532479CATTCTCAGTTTTTCTTAATTAAGAAAAACTGAGAATG0.397000.330300.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2459-2481TACATTCTCAGTTTTTCTTAATAUUAAGAAAAACUGAGAAUGUACAUUCUCAGUUUUUCUUAAUAU7.120.422


Target Position: 3687, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3687GUAUUUGAAAACAGAAAUU81.15471208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163705GTATTTGAAAACAGAAATTAATTTCTGTTTTCAAATAC0.174100.025600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3685-3707TAGTATTTGAAAACAGAAATTGGAAUUUCUGUUUUCAAAUACUAGUAUUUGAAAACAGAAAUUGGU12.08.922


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCUGUAGGUUAUAAUAAAG82.00991091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764401CCTGTAGGTTATAATAAAGCTTTATTATAACCTACAGG0.318700.028800.706900.750001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765CAAACCCUGUCAAACAUUA90.1239343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132783CAAACCCTGTCAAACATTATAATGTTTGACAGGGTTTG0.121200.051800.612100.750001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520CGUUUGGAGAGAUUACAAA94.078160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651538CGTTTGGAGAGATTACAAATTTGTAATCTCTCCAAACG0.304000.022500.775901.000001.000001.00000


Target Position: 2525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525CGUAUAGAAGUCUUCAUGA93.8958167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2523-2545CTCGTATAGAAGTCTTCATGAAAUCAUGAAGACUUCUAUACGAGCGUAUAGAAGUCUUCAUGAAAU18.115.832


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474UCUUAAUAUAUAGCAUUUA80.70841282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9232492TCTTAATATATAGCATTTATAAATGCTATATATTAAGA0.119100.093100.689700.750001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278CAGAAGAAAAAAAACAUUU80.78761269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761296CAGAAGAAAAAAAACATTTAAATGTTTTTTTTCTTCTG0.571600.311000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1276-1298CCCAGAAGAAAAAAAACATTTAGAAAUGUUUUUUUUCUUCUGGGCAGAAGAAAAAAAACAUUUAGU5.319.111


Target Position: 1115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115GUAAUAGGAAAAAAUGGAA89.2134397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1113-1135AAGTAATAGGAAAAAATGGAAAGUUCCAUUUUUUCCUAUUACUUGUAAUAGGAAAAAAUGGAAAGU20.112.321


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835GGGGGAGGAAGAGGACAAG68.30332787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001853GGGGGAGGAAGAGGACAAGCTTGTCCTCTTCCTCCCCC0.780800.478600.853400.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166CCGUAAUUCUUAUUCCAUA96.590589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4012184CCGTAATTCTTATTCCATATATGGAATAAGAATTACGG0.277000.105100.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2164-2186TTCCGTAATTCTTATTCCATATTUAUGGAAUAAGAAUUACGGAACCGUAAUUCUUAUUCCAUAUUU20.16.932


Target Position: 3290, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3290GUUAACAAAUAACAACUUU80.25981330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803308GTTAACAAATAACAACTTTAAAGTTGTTATTTGTTAAC0.144200.083100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3288-3310CGGTTAACAAATAACAACTTTTTAAAGUUGUUAUUUGUUAACCGGUUAACAAAUAACAACUUUUUU17.87.221


Target Position: 3979, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3979GAAAUCUAUAGAAAGUGUU82.34951060

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3977-3999AAGAAATCTATAGAAAGTGTTCTAACACUUUCUAUAGAUUUCUUGAAAUCUAUAGAAAGUGUUCUU17.86.913


Target Position: 3738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3738GGUUUUAAAAUACUGUAGA87.4089554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163756GGTTTTAAAATACTGTAGATCTACAGTATTTTAAAACC0.354200.085200.629300.750001.000001.00000


Target Position: 3641, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641CCAAACAUUAAUGUUGAUU71.09032478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3639-3661TGCCAAACATTAATGTTGATTTCAAUCAACAUUAAUGUUUGGCACCAAACAUUAAUGUUGAUUUCU20.512.131


Target Position: 3677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3677GGAAUGUAUAGUAUUUGAA98.144557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3743695GGAATGTATAGTATTTGAATTCAAATACTATACATTCC0.314500.076200.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3675-3697TGGGAATGTATAGTATTTGAAAAUUCAAAUACUAUACAUUCCCAGGAAUGUAUAGUAUUUGAAAAU8.916.113


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770CCUGUCAAACAUUAGUACU78.69761526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122788CCTGTCAAACATTAGTACTAGTACTAATGTTTGACAGG0.121600.052100.637900.750001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GUUCAUGAAGAUUCAAUAA93.738171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863314GTTCATGAAGATTCAATAATTATTGAATCTTCATGAAC0.347600.106100.612100.750001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465CUCAGUUUUUCUUAAUAUA93.2186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6102483CTCAGTTTTTCTTAATATATATATTAAGAAAAACTGAG0.340500.282400.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2463-2485TTCTCAGTTTTTCTTAATATATAUAUAUUAAGAAAAACUGAGAACUCAGUUUUUCUUAAUAUAUAU-8.019.211


Target Position: 4069, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4069CAAGAACUUGUUUAAUAAA96.486994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4067-4089TTCAAGAACTTGTTTAATAAAGCUUUAUUAAACAAGUUCUUGAACAAGAACUUGUUUAAUAAAGCU-7.517.722


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886CACUGAAGUUUGAUAAAUA106.0031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532904CACTGAAGTTTGATAAATATATTTATCAAACTTCAGTG0.149700.070800.750000.750001.000001.00000


Target Position: 3192, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192GUACUUUGUCUAAGAAACA89.0254414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3190-3212AGGTACTTTGTCTAAGAAACATTUGUUUCUUAGACAAAGUACCUGUACUUUGUCUAAGAAACAUUU13.311.833


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UCCUGUAGGUUAUAAUAAA90.1522341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791400TCCTGTAGGTTATAATAAATTTATTATAACCTACAGGA0.505300.027100.870700.750001.000001.00000


Target Position: 2173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173UCUUAUUCCAUAUUAGAAA82.13731077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992191TCTTATTCCATATTAGAAATTTCTAATATGGAATAAGA0.139900.098300.724100.750000.956500.62500


Target Position: 3799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3799GGGCAAUAUUCUCUGUACA95.4737116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473817GGGCAATATTCTCTGTACATGTACAGAGAATATTGCCC0.139700.018000.784500.750001.000001.00000


Target Position: 4284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4284ACGUGUAUGUUUUUCAGUU81.17371204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8604302ACGTGTATGTTTTTCAGTTAACTGAAAAACATACACGT0.153800.022700.629300.750001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043GCCUGAUGACCAAUUUUAA96.531492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4793061GCCTGATGACCAATTTTAATTAAAATTGGTCATCAGGC0.236000.118700.965501.000001.000001.00000


Target Position: 3608, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3608CACAAAUAUUAAAAAGUCU85.5775722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3606-3628TTCACAAATATTAAAAAGTCTTTAGACUUUUUAAUAUUUGUGAACACAAAUAUUAAAAAGUCUUUU13.36.911


Target Position: 594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594CAAAAGAUACUUUCCAUAA95.843110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
592-614CACAAAAGATACTTTCCATAAGAUUAUGGAAAGUAUCUUUUGUGCAAAAGAUACUUUCCAUAAGAU21.25.321


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GGUUAGCUAAAGUGAGGAU88.2739491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797486GGTTAGCTAAAGTGAGGATATCCTCACTTTAGCTAACC0.150600.026700.672401.000001.000001.00000


Target Position: 2249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249CAAAUUAUGCUAAGAAUUU83.8689885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2247-2269CACAAATTATGCTAAGAATTTTTAAAUUCUUAGCAUAAUUUGUGCAAAUUAUGCUAAGAAUUUUUU5.3-10.322


Target Position: 3597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3597GCACAUGAUUUCACAAAUA98.584746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1873615GCACATGATTTCACAAATATATTTGTGAAATCATGTGC0.665200.132900.810301.000001.000001.00000


Target Position: 2509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2509CUUCUGUUUUCAAUCUCGU71.34252452

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2507-2529GACTTCTGTTTTCAATCTCGTATACGAGAUUGAAAACAGAAGUCCUUCUGUUUUCAAUCUCGUAUU21.019.232


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GAGGCUAAAGGAAGAACAA94.4556142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911949GAGGCTAAAGGAAGAACAATTGTTCTTCCTTTAGCCTC0.176000.086100.663800.750001.000001.00000


Target Position: 2236, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236CAUGAAAUGAACACAAAUU87.2719567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572254CATGAAATGAACACAAATTAATTTGTGTTCATTTCATG0.177700.107700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2234-2256GGCATGAAATGAACACAAATTATAAUUUGUGUUCAUUUCAUGCCCAUGAAAUGAACACAAAUUAUU12.17.222


Target Position: 4348, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4348GAAGAUUGUUUAUCUAGAU95.4632118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4346-4368CTGAAGATTGTTTATCTAGATGTAUCUAGAUAAACAAUCUUCAGGAAGAUUGUUUAUCUAGAUGUU20.212.013


Target Position: 2161, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161CAUUUCCGUAAUUCUUAUU77.61451677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172179CATTTCCGTAATTCTTATTAATAAGAATTACGGAAATG0.430500.246600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2159-2181ACCATTTCCGTAATTCTTATTCCAAUAAGAAUUACGGAAAUGGUCAUUUCCGUAAUUCUUAUUCCU6.920.732


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403AGUGAUAUUCUUUGUUAAU83.9747872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122421AGTGATATTCTTTGTTAATATTAACAAAGAATATCACT0.361100.032300.698300.750001.000001.00000


Target Position: 2180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180CCAUAUUAGAAAACUUUGU75.4621973

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2178-2200TTCCATATTAGAAAACTTTGTTAACAAAGUUUUCUAAUAUGGAACCAUAUUAGAAAACUUUGUUAU10.30.032


Target Position: 3259, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259GUUUAAGCAGAAUUGGAAA89.6321368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3257-3279ATGTTTAAGCAGAATTGGAAAAGUUUCCAAUUCUGCUUAAACAUGUUUAAGCAGAAUUGGAAAAGU20.113.721


Target Position: 4087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4087AGCGAAAAACUCAACCAAA89.1109404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6784105AGCGAAAAACTCAACCAAATTTGGTTGAGTTTTTCGCT0.169900.063300.853400.750001.000001.00000


Target Position: 1719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719CAAAUGCUUCUGAAACAGA89.1277401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1717-1739ATCAAATGCTTCTGAAACAGAATUCUGUUUCAGAAGCAUUUGAUCAAAUGCUUCUGAAACAGAAUU19.218.522


Target Position: 2130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130CUGCAUAAUUCUGAAGUUA88.9623421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2128-2150AACTGCATAATTCTGAAGTTATAUAACUUCAGAAUUAUGCAGUUCUGCAUAAUUCUGAAGUUAUAU19.221.122


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189UGAAAAUGAGAAAAAUGUU77.80441644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711207TGAAAATGAGAAAAATGTTAACATTTTTCTCATTTTCA0.149800.075900.577600.750001.000001.00000


Target Position: 3678, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3678GAAUGUAUAGUAUUUGAAA103.368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783696GAATGTATAGTATTTGAAATTTCAAATACTATACATTC0.322200.079100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3676-3698GGGAATGTATAGTATTTGAAAACUUUCAAAUACUAUACAUUCCCGAAUGUAUAGUAUUUGAAAACU7.46.712


Target Position: 3915, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3915CUGCUAAAUUGAUGUUGAU87.4171553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293933CTGCTAAATTGATGTTGATATCAACATCAATTTAGCAG0.181200.029500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3913-3935CTCTGCTAAATTGATGTTGATGCAUCAACAUCAAUUUAGCAGAGCUGCUAAAUUGAUGUUGAUGCU20.519.723


Target Position: 3294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3294ACAAAUAACAACUUUUUUU75.53721959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5173312ACAAATAACAACTTTTTTTAAAAAAAGTTGTTATTTGT0.440500.088300.706900.750001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177GAGGAUUGAGGCUGAAAAU87.9106511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471195GAGGATTGAGGCTGAAAATATTTTCAGCCTCAATCCTC0.132200.032500.801700.750001.000001.00000


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676GGGAAUGUAUAGUAUUUGA97.724564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4083694GGGAATGTATAGTATTTGATCAAATACTATACATTCCC0.295000.069800.767200.750001.000001.00000


Target Position: 4279, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279GCUAAACGUGUAUGUUUUU81.55841161

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10427919GCTAAACGTGTATGTTTTT1/1/0/097.75FMR1NM_002024.41NANANAX:147032515..147032533(+)00FMR1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4277-4299GTGCTAAACGTGTATGTTTTTCAAAAAACAUACACGUUUAGCACGCUAAACGUGUAUGUUUUUCAU5.312.023


Target Position: 1053, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053CUAGAAGCUUUCUCGAAUU83.3412942

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1105319CTAGAAGCTTTCTCGAATT1/1/0/0100.00FMR1NM_002024.41NANANAX:147014226..147014244(+)00FMR1(0.002)


Target Position: 4325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4325UCUUAUUAAAGUUUCAAAA79.99261359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7554343TCTTATTAAAGTTTCAAAATTTTGAAACTTTAATAAGA0.210000.111500.724100.750001.000001.00000


Target Position: 4195, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4195GUGAAUUACUAACUUCUAA95.6911113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6324213GTGAATTACTAACTTCTAATTAGAAGTTAGTAATTCAC0.545900.177300.758600.750000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4193-4215ATGTGAATTACTAACTTCTAAAAUUAGAAGUUAGUAAUUCACAUGUGAAUUACUAACUUCUAAAAU18.98.932


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460ACAUUCUCAGUUUUUCUUA81.4991172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8282478ACATTCTCAGTTTTTCTTATAAGAAAAACTGAGAATGT0.392000.346400.672400.750001.000001.00000


Target Position: 4388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4388GCACUUAUGAAAAAGCAAA90.338331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1544406GCACTTATGAAAAAGCAAATTTGCTTTTTCATAAGTGC0.811000.150900.853401.000000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4386-4408TTGCACTTATGAAAAAGCAAAAAUUUGCUUUUUCAUAAGUGCAAGCACUUAUGAAAAAGCAAAAAU18.611.622


Target Position: 2456, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456CAGUACAUUCUCAGUUUUU84.3616837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742474CAGTACATTCTCAGTTTTTAAAAACTGAGAATGTACTG0.664200.293500.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2454-2476ACCAGTACATTCTCAGTTTTTCTAAAAACUGAGAAUGUACUGGUCAGUACAUUCUCAGUUUUUCUU10.319.022


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312CAGCACCCAUUUUUCUCAA87.2767566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741330CAGCACCCATTTTTCTCAATTGAGAAAAATGGGTGCTG0.184200.093900.637900.750001.000001.00000


Target Position: 3511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511GUAUUUUGUGAGUUUGUUU84.4788824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3509-3531ATGTATTTTGTGAGTTTGTTTCTAAACAAACUCACAAAAUACAUGUAUUUUGUGAGUUUGUUUCUU13.3-1.412


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174GGUGAGGAUUGAGGCUGAA90.7844313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621192GGTGAGGATTGAGGCTGAATTCAGCCTCAATCCTCACC0.129300.033500.681001.000001.000001.00000


Target Position: 2323, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2323CCUUAAAAUUUGAAACAUU88.8111436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2321-2343TACCTTAAAATTTGAAACATTGCAAUGUUUCAAAUUUUAAGGUACCUUAAAAUUUGAAACAUUGCU14.8-3.822


Target Position: 4311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4311UGAUGUUUUUAAAAUCUUA91.0768293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7524329TGATGTTTTTAAAATCTTATAAGATTTTAAAAACATCA0.377600.063700.689700.750001.000001.00000


Target Position: 2860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860GACUUGUUUUUGUUUUUGU80.32091324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2858-2880AGGACTTGTTTTTGTTTTTGTTTACAAAAACAAAAACAAGUCCUGACUUGUUUUUGUUUUUGUUUU5.617.811


Target Position: 2319, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319GAUACCUUAAAAUUUGAAA88.7093451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962337GATACCTTAAAATTTGAAATTTCAAATTTTAAGGTATC0.105300.075400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2317-2339AAGATACCTTAAAATTTGAAACAUUUCAAAUUUUAAGGUAUCUUGAUACCUUAAAAUUUGAAACAU7.418.522


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187GCUGAAAAUGAGAAAAAUG79.20931459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401205GCTGAAAATGAGAAAAATGCATTTTTCTCATTTTCAGC0.212200.123000.698300.750001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919CGUAAUCCAAGAGAGGCUA82.35921059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021937CGTAATCCAAGAGAGGCTATAGCCTCTCTTGGATTACG0.196200.065200.603401.000000.929300.87500


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858AGGACUUGUUUUUGUUUUU76.4191847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852876AGGACTTGTTTTTGTTTTTAAAAACAAAAACAAGTCCT0.122700.015800.844800.750001.000001.00000


Target Position: 2771, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CUGUCAAACAUUAGUACUU82.421048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642789CTGTCAAACATTAGTACTTAAGTACTAATGTTTGACAG0.147200.058000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2769-2791CCCTGTCAAACATTAGTACTTTAAAGUACUAAUGUUUGACAGGGCUGUCAAACAUUAGUACUUUAU18.820.533


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692CAGGUAGGAAUAUUAUAUU89.6541365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542710CAGGTAGGAATATTATATTAATATAATATTCCTACCTG0.142900.017600.775900.750001.000001.00000


Target Position: 531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CAACUUACAAUGAAAUUGU80.75561274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
529-551TGCAACTTACAATGAAATTGTCAACAAUUUCAUUGUAAGUUGCACAACUUACAAUGAAAUUGUCAU7.412.922


Target Position: 4050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050GCCUUUAUCUACCAACUUU87.1899577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4584068GCCTTTATCTACCAACTTTAAAGTTGGTAGATAAAGGC0.244700.120001.000001.000001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179GGAUUGAGGCUGAAAAUGA94.5432139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081197GGATTGAGGCTGAAAATGATCATTTTCAGCCTCAATCC0.261500.042600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1177-1199GAGGATTGAGGCTGAAAATGAGAUCAUUUUCAGCCUCAAUCCUCGGAUUGAGGCUGAAAAUGAGAU7.420.421


Target Position: 4288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4288GUAUGUUUUUCAGUUCAAA92.4109231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7244306GTATGTTTTTCAGTTCAAATTTGAACTGAAAAACATAC0.158200.037700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4286-4308GTGTATGTTTTTCAGTTCAAAGTUUUGAACUGAAAAACAUACACGUAUGUUUUUCAGUUCAAAGUU19.26.922


Target Position: 427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427GGUGUAUUCCAGAGCAAAU91.3996275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641445GGTGTATTCCAGAGCAAATATTTGCTCTGGAATACACC0.194600.037500.844801.000001.000001.00000


Target Position: 2760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2760UGUAGCAAACCCUGUCAAA82.4241047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412778TGTAGCAAACCCTGTCAAATTTGACAGGGTTTGCTACA0.114200.020300.706900.750001.000001.00000


Target Position: 4303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4303CAAAGUCAUGAUGUUUUUA89.9937347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4301-4323TTCAAAGTCATGATGTTTTTAAAUAAAAACAUCAUGACUUUGAACAAAGUCAUGAUGUUUUUAAAU5.619.222


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209GCUAGCAGGGCUGAAGAGA75.82791922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882227GCTAGCAGGGCTGAAGAGATCTCTTCAGCCCTGCTAGC0.126900.021300.629300.750000.978300.87500


Target Position: 4363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4363AGAUGUAAAUUUUUAUUAA99.499938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9714381AGATGTAAATTTTTATTAATTAATAAAAATTTACATCT0.108800.023000.689700.750001.000001.00000


Target Position: 2051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2051GGUAAAGAUCGUAACCAGA92.897206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232069GGTAAAGATCGTAACCAGATCTGGTTACGATCTTTACC0.213800.070700.629300.750001.000001.00000


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173GGGUGAGGAUUGAGGCUGA93.2904183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081191GGGTGAGGATTGAGGCTGATCAGCCTCAATCCTCACCC0.122200.033100.767200.750001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662GCGGCACAUAAGGAUUUUA86.5113636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941680GCGGCACATAAGGATTTTATAAAATCCTTATGTGCCGC0.613900.018400.887901.000001.000001.00000


Target Position: 3295, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295CAAAUAACAACUUUUUUUU80.72261280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143313CAAATAACAACTTTTTTTTAAAAAAAAGTTGTTATTTG0.415700.076000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3293-3315AACAAATAACAACTTTTTTTTCTAAAAAAAAGUUGUUAUUUGUUCAAAUAACAACUUUUUUUUCUU-11.3-0.311


Target Position: 1419, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419GUAUGGUACCAUUUGUUUU85.4663733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1417-1439GGGTATGGTACCATTTGTTTTTGAAAACAAAUGGUACCAUACCCGUAUGGUACCAUUUGUUUUUGU5.621.122


Target Position: 3362, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3362GAGUCUUUUUUUUUUAAGU81.93691101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3360-3382TTGAGTCTTTTTTTTTTAAGTGAACUUAAAAAAAAAAGACUCAAGAGUCUUUUUUUUUUAAGUGAU-3.817.712


Target Position: 3860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860GUUAUAGUGCAAUAUAUUU87.7657523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3858-3880TGGTTATAGTGCAATATATTTTGAAAUAUAUUGCACUAUAACCAGUUAUAGUGCAAUAUAUUUUGU-8.66.332


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GGAGCUAGUUCUAGACCAC83.8176887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691580GGAGCTAGTTCTAGACCACGTGGTCTAGAACTAGCTCC0.502400.021100.577600.750000.994600.62500


Target Position: 473, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473GCUAAAGUGAGGAUGAUAA95.5817114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523491GCTAAAGTGAGGATGATAATTATCATCCTCACTTTAGC0.218900.081600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
471-493TAGCTAAAGTGAGGATGATAAAGUUAUCAUCCUCACUUUAGCUAGCUAAAGUGAGGAUGAUAAAGU17.49.822


Target Position: 3103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103GUGAAAUUUUUCAUAUUUU85.2328755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3101-3123TTGTGAAATTTTTCATATTTTAAAAAAUAUGAAAAAUUUCACAAGUGAAAUUUUUCAUAUUUUAAU-1.87.422


Target Position: 2801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801GCAUGCUUUCCAUAUUUUU81.86911113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722819GCATGCTTTCCATATTTTTAAAAATATGGAAAGCATGC0.231800.045300.853401.000000.956500.62500


Target Position: 3047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047GAUGACCAAUUUUAACUUA94.2693153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6773065GATGACCAATTTTAACTTATAAGTTAAAATTGGTCATC0.212300.137400.646600.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240CCUUCCUUCCAAUAAUUCA85.3257748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511258CCTTCCTTCCAATAATTCATGAATTATTGGAAGGAAGG0.267200.035700.620700.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906AGAUAAUCGUCCACGUAAU87.6277535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231924AGATAATCGTCCACGTAATATTACGTGGACGATTATCT0.222100.025100.715500.750001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880GAGAUUUCAUGAACAGUUU87.5049549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
785898GAGATTTCATGAACAGTTTAAACTGTTCATGAAATCTC0.253200.027500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
878-900TCGAGATTTCATGAACAGTTTATAAACUGUUCAUGAAAUCUCGAGAGAUUUCAUGAACAGUUUAUU17.814.821


Target Position: 3889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889CAGUUUCAAUAAAGUUUGA88.3915480

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3887-3909AGCAGTTTCAATAAAGTTTGATCUCAAACUUUAUUGAAACUGCUCAGUUUCAAUAAAGUUUGAUCU10.319.222


Target Position: 389, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389GGUUAUAAUAAAGAUAUAA100.03231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328407GGTTATAATAAAGATATAATTATATCTTTATTATAACC0.314800.237400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
387-409TAGGTTATAATAAAGATATAAATUUAUAUCUUUAUUAUAACCUAGGUUAUAAUAAAGAUAUAAAUU8.21.422


Target Position: 4300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4300GUUCAAAGUCAUGAUGUUU82.70051016

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4298-4320CAGTTCAAAGTCATGATGTTTTTAAACAUCAUGACUUUGAACUGGUUCAAAGUCAUGAUGUUUUUU20.512.221


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186GGCUGAAAAUGAGAAAAAU91.0435295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741204GGCTGAAAATGAGAAAAATATTTTTCTCATTTTCAGCC0.238700.106200.991401.000001.000001.00000


Target Position: 3880, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3880GUAUGCAAGCAGUUUCAAU87.8689516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3878-3900TTGTATGCAAGCAGTTTCAATAAAUUGAAACUGCUUGCAUACAAGUAUGCAAGCAGUUUCAAUAAU14.921.123


Target Position: 3549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3549AGUUACUUUUCCUUGCAUA88.8309434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8983567AGTTACTTTTCCTTGCATATATGCAAGGAAAAGTAACT0.123800.114800.663800.750001.000001.00000


Target Position: 2370, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370CAGAUUUUAGUUUUAUUUU81.56281159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2368-2390GGCAGATTTTAGTTTTATTTTCTAAAAUAAAACUAAAAUCUGCCCAGAUUUUAGUUUUAUUUUCUU-9.75.322


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559ACGUCUAAGAUCUGUUAAU80.81221267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930577ACGTCTAAGATCTGTTAATATTAACAGATCTTAGACGT0.116200.064900.767200.750001.000001.00000


Target Position: 3595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595CUGCACAUGAUUUCACAAA83.9141877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3393613CTGCACATGATTTCACAAATTTGTGAAATCATGTGCAG0.560000.083800.784500.750001.000001.00000


Target Position: 4051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4051CCUUUAUCUACCAACUUUC71.48222430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7414069CCTTTATCTACCAACTTTCGAAAGTTGGTAGATAAAGG0.242700.119900.672400.750001.000001.00000


Target Position: 3314, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314CUUUUUUUCUUUUGUUUUU72.5982318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773332CTTTTTTTCTTTTGTTTTTAAAAACAAAAGAAAAAAAG0.343400.201900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3312-3334TTCTTTTTTTCTTTTGTTTTTTGAAAAACAAAAGAAAAAAAGAACUUUUUUUCUUUUGUUUUUUGU5.6-11.310


Target Position: 4391, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4391CUUAUGAAAAAGCAAAAAA84.2813842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514409CTTATGAAAAAGCAAAAAATTTTTTGCTTTTTCATAAG0.825900.274100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4389-4411CACTTATGAAAAAGCAAAAAATTUUUUUUGCUUUUUCAUAAGUGCUUAUGAAAAAGCAAAAAAUUU14.18.92


Target Position: 4260, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260CAUAUUACAAUAUUUGUGU78.80231509

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4258-4280TTCATATTACAATATTTGTGTGCACACAAAUAUUGUAAUAUGAACAUAUUACAAUAUUUGUGUGCU12.11.122


Target Position: 3912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912CCUCUGCUAAAUUGAUGUU78.00481619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443930CCTCTGCTAAATTGATGTTAACATCAATTTAGCAGAGG0.197900.029900.698301.000001.000001.00000


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768ACCCUGUCAAACAUUAGUA82.9213994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912786ACCCTGTCAAACATTAGTATACTAATGTTTGACAGGGT0.106800.048700.672400.750001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472AGCUAAAGUGAGGAUGAUA91.4179274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615490AGCTAAAGTGAGGATGATATATCATCCTCACTTTAGCT0.191100.060200.810300.750001.000001.00000


Target Position: 4126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4126CCAUUAAAAUAUGCACUAA96.0926106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7584144CCATTAAAATATGCACTAATTAGTGCATATTTTAATGG0.355300.029100.810301.000001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GUAAUCCAAGAGAGGCUAA86.0201681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191938GTAATCCAAGAGAGGCTAATTAGCCTCTCTTGGATTAC0.189500.055900.646600.750000.929301.00000


Target Position: 2775, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2775CAAACAUUAGUACUUUAUA96.709186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282793CAAACATTAGTACTTTATATATAAAGTACTAATGTTTG0.450400.056300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2773-2795GTCAAACATTAGTACTTTATAGAUAUAAAGUACUAAUGUUUGACCAAACAUUAGUACUUUAUAGAU4.65.332


Target Position: 3599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3599ACAUGAUUUCACAAAUAUU88.326485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573617ACATGATTTCACAAATATTAATATTTGTGAAATCATGT0.469000.113300.698300.750001.000001.00000


Target Position: 2726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726GGGAAGAUAAGUUGGAAAC71.4032443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872744GGGAAGATAAGTTGGAAACGTTTCCAACTTATCTTCCC0.282400.141900.844800.750001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905CAGAUAAUCGUCCACGUAA94.7026135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911923CAGATAATCGTCCACGTAATTACGTGGACGATTATCTG0.124800.035900.750000.750001.000001.00000


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305AGGAAAACAGCACCCAUUU73.33592228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371323AGGAAAACAGCACCCATTTAAATGGGTGCTGTTTTCCT0.158900.069400.844800.750000.918500.62500


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891CGAUCACUCCCGAACAGAU93.6699172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711909CGATCACTCCCGAACAGATATCTGTTCGGGAGTGATCG0.264200.026600.612101.000000.989100.62500


Target Position: 3281, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3281CUAAGAUCGGUUAACAAAU82.07471083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073299CTAAGATCGGTTAACAAATATTTGTTAACCGATCTTAG0.172300.077200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3279-3301GACTAAGATCGGTTAACAAATAAAUUUGUUAACCGAUCUUAGUCCUAAGAUCGGUUAACAAAUAAU7.216.022


Target Position: 2888, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888CUGAAGUUUGAUAAAUAGU75.90081915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702906CTGAAGTTTGATAAATAGTACTATTTATCAAACTTCAG0.111900.036500.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2886-2908CACTGAAGTTTGATAAATAGTGTACUAUUUAUCAAACUUCAGUGCUGAAGUUUGAUAAAUAGUGUU-2.319.223


Target Position: 3416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3416ACUCUAAGAUGUUAUAUUU89.2878393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6393434ACTCTAAGATGTTATATTTAAATATAACATCTTAGAGT0.364100.059700.706900.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GAUAAUGAGAAAUGAAGAA95.0538131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
821-843CTGATAATGAGAAATGAAGAAGCUUCUUCAUUUCUCAUUAUCAGGAUAAUGAGAAAUGAAGAAGCU20.48.722


Target Position: 2739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739GGAAACACUAAAUGUUAAA91.0026296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892757GGAAACACTAAATGTTAAATTTAACATTTAGTGTTTCC0.124900.028700.870701.000000.962000.75000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109GGCAAAGUAAUAGGAAAAA85.0259785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1091127GGCAAAGTAATAGGAAAAATTTTTCCTATTACTTTGCC0.843500.383101.000001.000001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434UCCAGAGCAAAUGAAAAAG55.70073871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942452TCCAGAGCAAATGAAAAAGCTTTTTCATTTGCTCTGGA0.674900.169500.732800.500001.000001.00000


Target Position: 4387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4387UGCACUUAUGAAAAAGCAA81.00731228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8194405TGCACTTATGAAAAAGCAATTGCTTTTTCATAAGTGCA0.806200.091700.706900.750000.929300.62500


Target Position: 1275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1275CCCCAGAAGAAAAAAAACA79.69931386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361293CCCCAGAAGAAAAAAAACATGTTTTTTTTCTTCTGGGG0.838800.354300.784500.750001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594AGAUAAGGAAAAAAGCUAU85.0325784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251612AGATAAGGAAAAAAGCTATATAGCTTTTTTCCTTATCT0.159100.025000.681000.750001.000001.00000


Target Position: 3379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3379GUGAAAUUUAUUGAGGAAA81.03661223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153397GTGAAATTTATTGAGGAAATTTCCTCAATAAATTTCAC0.137000.066400.793100.750001.000001.00000


Target Position: 3802, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802CAAUAUUCUCUGUACAUAU97.370172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043820CAATATTCTCTGTACATATATATGTACAGAGAATATTG0.151700.068600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3800-3822GGCAATATTCTCTGTACATATTAAUAUGUACAGAGAAUAUUGCCCAAUAUUCUCUGUACAUAUUAU15.81.832


Target Position: 270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CUUUCUACAAGGCAUUUGU73.64462194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
268-290CGCTTTCTACAAGGCATTTGTAAACAAAUGCCUUGUAGAAAGCGCUUUCUACAAGGCAUUUGUAAU20.014.622


Target Position: 3228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228GUUUUGUAAACUUUGAAAU78.08391607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183246GTTTTGTAAACTTTGAAATATTTCAAAGTTTACAAAAC0.444800.067300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3226-3248ATGTTTTGTAAACTTTGAAATATAUUUCAAAGUUUACAAAACAUGUUUUGUAAACUUUGAAAUAUU7.77.212


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881AGAUUUCAUGAACAGUUUA89.0999405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
757899AGATTTCATGAACAGTTTATAAACTGTTCATGAAATCT0.398000.029100.689700.750001.000001.00000


Target Position: 3800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3800GGCAAUAUUCUCUGUACAU91.1271291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123818GGCAATATTCTCTGTACATATGTACAGAGAATATTGCC0.143900.025800.844801.000001.000001.00000


Target Position: 2715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715UGCAGAGUUCAGGGAAGAU74.25492119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412733TGCAGAGTTCAGGGAAGATATCTTCCCTGAACTCTGCA0.153900.024000.672400.750001.000001.00000


Target Position: 1644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644GUAGUAGACCUUACAGAAA95.0378132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1642-1664AGGTAGTAGACCTTACAGAAATAUUUCUGUAAGGUCUACUACCUGUAGUAGACCUUACAGAAAUAU20.320.133


Target Position: 696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696CCUUUUCUGUAACUUAUGA86.4193645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
694-716TGCCTTTTCTGTAACTTATGATCUCAUAAGUUACAGAAAAGGCACCUUUUCUGUAACUUAUGAUCU11.610.332


Target Position: 550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550CACAAUUGAACGUCUAAGA85.3729743

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
548-570GTCACAATTGAACGTCTAAGATCUCUUAGACGUUCAAUUGUGACCACAAUUGAACGUCUAAGAUCU18.912.133


Target Position: 1067, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067GAAUUUGCUGAAGAUGUAA92.3639233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731085GAATTTGCTGAAGATGTAATTACATCTTCAGCAAATTC0.335800.016600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1065-1087TCGAATTTGCTGAAGATGTAATAUUACAUCUUCAGCAAAUUCGAGAAUUUGCUGAAGAUGUAAUAU20.314.022


Target Position: 1460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GCUAAUGCCACUGUUCUUU73.60072199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1458-1480TCGCTAATGCCACTGTTCTTTTGAAAGAACAGUGGCAUUAGCGAGCUAAUGCCACUGUUCUUUUGU19.219.732


Target Position: 3772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3772GAAUGACCUUGUAAUGUAA105.6732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733790GAATGACCTTGTAATGTAATTACATTACAAGGTCATTC0.352800.097100.637900.750001.000001.00000


Target Position: 2797, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2797GAAUGCAUGCUUUCCAUAU87.6377534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952815GAATGCATGCTTTCCATATATATGGAAAGCATGCATTC0.144000.062200.629300.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2795-2817AAGAATGCATGCTTTCCATATTTAUAUGGAAAGCAUGCAUUCUUGAAUGCAUGCUUUCCAUAUUUU21.219.932


Target Position: 3587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3587GCAACAAACUGCACAUGAU95.3776120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853605GCAACAAACTGCACATGATATCATGTGCAGTTTGTTGC0.107200.037300.672401.000000.967400.62500


Target Position: 309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309CAAUAACAGUUGCAUUUGA92.7782210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
307-329TTCAATAACAGTTGCATTTGAAAUCAAAUGCAACUGUUAUUGAACAAUAACAGUUGCAUUUGAAAU20.06.933


Target Position: 3596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3596UGCACAUGAUUUCACAAAU79.43561417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2063614TGCACATGATTTCACAAATATTTGTGAAATCATGTGCA0.574400.127100.844800.750001.000001.00000


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285CGUGUAUGUUUUUCAGUUC76.77651787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9104303CGTGTATGTTTTTCAGTTCGAACTGAAAAACATACACG0.189100.024300.603400.750001.000001.00000


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466UCAGUUUUUCUUAAUAUAU76.55491825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272484TCAGTTTTTCTTAATATATATATATTAAGAAAAACTGA0.350000.252400.681000.750001.000001.00000


Target Position: 4138, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4138GCACUAAGUCUCUUUUUUA100.11630

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8413819GCACTAAGTCTCTTTTTTA1/1/0/097.75FMR1NM_002024.41NANANAX:147032374..147032392(+)|13:48480903..48480921(+)00FMR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2624156GCACTAAGTCTCTTTTTTATAAAAAAGAGACTTAGTGC0.492300.104700.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4136-4158ATGCACTAAGTCTCTTTTTTACAUAAAAAAGAGACUUAGUGCAUGCACUAAGUCUCUUUUUUACAU-5.916.432


Target Position: 2262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262GAAUUUUUUAUUUUUUGGU70.78442513

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2260-2282AAGAATTTTTTATTTTTTGGTATACCAAAAAAUAAAAAAUUCUUGAAUUUUUUAUUUUUUGGUAUU11.5-12.011


Target Position: 3989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3989GAAAGUGUUCUGUUACAAA101.8114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3987-4009TAGAAAGTGTTCTGTTACAAAATUUUGUAACAGAACACUUUCUAGAAAGUGUUCUGUUACAAAAUU14.717.822


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175GUGAGGAUUGAGGCUGAAA86.2566666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241193GTGAGGATTGAGGCTGAAATTTCAGCCTCAATCCTCAC0.136100.032500.793100.750001.000001.00000


Target Position: 3836, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3836GGAUUUUAUGUUGACAUUU82.9737986

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3834-3856TTGGATTTTATGTTGACATTTGTAAAUGUCAACAUAAAAUCCAAGGAUUUUAUGUUGACAUUUGUU20.52.122


Target Position: 3266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3266CAGAAUUGGAAAAGACUAA90.9939299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3264-3286AGCAGAATTGGAAAAGACTAAGAUUAGUCUUUUCCAAUUCUGCUCAGAAUUGGAAAAGACUAAGAU18.912.023


Target Position: 632, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632GAAGACUUACGGCAAAUGU78.37931574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
630-652CAGAAGACTTACGGCAAATGTGTACAUUUGCCGUAAGUCUUCUGGAAGACUUACGGCAAAUGUGUU20.017.732


Target Position: 3845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3845GUUGACAUUUGUUUGGUUA87.1219587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3843-3865ATGTTGACATTTGTTTGGTTATAUAACCAAACAAAUGUCAACAUGUUGACAUUUGUUUGGUUAUAU18.820.522


Target Position: 386, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386GUAGGUUAUAAUAAAGAUA95.9546108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
724404GTAGGTTATAATAAAGATATATCTTTATTATAACCTAC0.307500.031500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
384-406CTGTAGGTTATAATAAAGATATAUAUCUUUAUUAUAACCUACAGGUAGGUUAUAAUAAAGAUAUAU6.919.832


Target Position: 2174, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174CUUAUUCCAUAUUAGAAAA91.8288262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842192CTTATTCCATATTAGAAAATTTTCTAATATGGAATAAG0.143500.091400.637900.750000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2172-2194TTCTTATTCCATATTAGAAAACTUUUUCUAAUAUGGAAUAAGAACUUAUUCCAUAUUAGAAAACUU7.115.532


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729AGCUUGUCAUUUUGUCCAU78.83451500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773747AGCTTGTCATTTTGTCCATATGGACAAAATGACAAGCT0.252000.038900.698300.750001.000001.00000


Target Position: 4141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141CUAAGUCUCUUUUUUACAA92.8075208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161CACTAAGTCTCTTTTTTACAAAGUUGUAAAAAAGAGACUUAGUGCUAAGUCUCUUUUUUACAAAGU7.218.932


Target Position: 3380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3380UGAAAUUUAUUGAGGAAAA84.0406863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7283398TGAAATTTATTGAGGAAAATTTTCCTCAATAAATTTCA0.157200.072600.724100.750001.000001.00000


Target Position: 599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599GAUACUUUCCAUAAGAUCA95.722112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
597-619AAGATACTTTCCATAAGATCAAGUGAUCUUAUGGAAAGUAUCUUGAUACUUUCCAUAAGAUCAAGU16.04.622


Target Position: 3092, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092CCCCAAGUUUUGUGAAAUU80.14021342

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2309219CCCCAAGTTTTGTGAAATT1/1/0/0100.00FMR1NM_002024.41NANANAX:147031328..147031346(+)00FMR1(0.002)


Target Position: 3279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3279GACUAAGAUCGGUUAACAA102.76210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3277-3299AAGACTAAGATCGGTTAACAAATUUGUUAACCGAUCUUAGUCUUGACUAAGAUCGGUUAACAAAUU14.718.933


Target Position: 2153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153UCCUAUACCAUUUCCGUAA75.79761923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3062171TCCTATACCATTTCCGTAATTACGGAAATGGTATAGGA0.385300.295000.836200.750000.989100.62500


Target Position: 3972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3972AGGAAAAGAAAUCUAUAGA85.3851740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523990AGGAAAAGAAATCTATAGATCTATAGATTTCTTTTCCT0.131700.060700.620700.500001.000001.00000


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719GAGUUCAGGGAAGAUAAGU74.93782038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992737GAGTTCAGGGAAGATAAGTACTTATCTTCCCTGAACTC0.218700.034100.603400.500001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581CACCAAAUCGUACAGAUAA94.5761138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551599CACCAAATCGTACAGATAATTATCTGTACGATTTGGTG0.111500.020000.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1579-1601ACCACCAAATCGTACAGATAAGGUUAUCUGUACGAUUUGGUGGUCACCAAAUCGUACAGAUAAGGU20.318.833


Target Position: 3364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3364GUCUUUUUUUUUUAAGUGA81.35451186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3362-3384GAGTCTTTTTTTTTTAAGTGAAAUCACUUAAAAAAAAAAGACUCGUCUUUUUUUUUUAAGUGAAAU11.85.521


Target Position: 2731, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731GAUAAGUUGGAAACACUAA95.5796115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2729-2751AAGATAAGTTGGAAACACTAAATUUAGUGUUUCCAACUUAUCUUGAUAAGUUGGAAACACUAAAUU19.04.622


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217GGCUGAAGAGAAGAUGGAG78.72941518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520235GGCTGAAGAGAAGATGGAGCTCCATCTTCTCTTCAGCC0.242200.051900.689700.750001.000001.00000


Target Position: 3355, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355GUUUUUUGAGUCUUUUUUU78.55691551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663373GTTTTTTGAGTCTTTTTTTAAAAAAAGACTCAAAAAAC0.109500.065500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3353-3375TTGTTTTTTGAGTCTTTTTTTTTAAAAAAAGACUCAAAAAACAAGUUUUUUGAGUCUUUUUUUUUU-5.9-2.921


Target Position: 2773, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773GUCAAACAUUAGUACUUUA97.971362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832791GTCAAACATTAGTACTTTATAAAGTACTAATGTTTGAC0.228200.064500.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2771-2793CTGTCAAACATTAGTACTTTATAUAAAGUACUAAUGUUUGACAGGUCAAACAUUAGUACUUUAUAU12.920.522


Target Position: 2338, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338CAUUGCUUUUAAAACUACU82.331061

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2336-2358AACATTGCTTTTAAAACTACTTAAGUAGUUUUAAAAGCAAUGUUCAUUGCUUUUAAAACUACUUAU12.918.522


Target Position: 3144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GAUAGGAAGGUCAUUUCCA89.0161416

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164GAGATAGGAAGGTCATTTCCATGUGGAAAUGACCUUCCUAUCUCGAUAGGAAGGUCAUUUCCAUGU20.119.922


Target Position: 3518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3518GUGAGUUUGUUUCUUUGAA88.9899419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3516-3538TTGTGAGTTTGTTTCTTTGAATTUUCAAAGAAACAAACUCACAAGUGAGUUUGUUUCUUUGAAUUU20.419.212


Target Position: 4077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4077UGUUUAAUAAAGCGAAAAA81.86411116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7964095TGTTTAATAAAGCGAAAAATTTTTCGCTTTATTAAACA0.141100.047900.706900.750001.000001.00000


Target Position: 2002, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002CACUAAAACAUUACAGAAU87.2379570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2000-2022CACACTAAAACATTACAGAATACAUUCUGUAAUGUUUUAGUGUGCACUAAAACAUUACAGAAUACU20.34.922


Target Position: 3653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653GUUGAUUUCUAGUUAUUUA98.423349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3651-3673ATGTTGATTTCTAGTTATTTATTUAAAUAACUAGAAAUCAACAUGUUGAUUUCUAGUUAUUUAUUU-0.37.422


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589CGUACAGAUAAGGAAAAAA93.0303196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131607CGTACAGATAAGGAAAAAATTTTTTCCTTATCTGTACG0.268400.104200.775901.000001.000001.00000


Target Position: 2950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950GAAAGAACUAUCUUCAUCU91.2746283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2948-2970AAGAAAGAACTATCTTCATCTGAAGAUGAAGAUAGUUCUUUCUUGAAAGAACUAUCUUCAUCUGAU20.413.322


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318CCAUUUUUCUCAACCUAAC72.21212365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101336CCATTTTTCTCAACCTAACGTTAGGTTGAGAAAAATGG0.196700.020300.698300.750001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525GGAGAGAUUACAAAUUGAU91.33281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031543GGAGAGATTACAAATTGATATCAATTTGTAATCTCTCC0.318500.196600.689701.000001.000001.00000


Target Position: 4196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4196UGAAUUACUAACUUCUAAA88.5991464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2534214TGAATTACTAACTTCTAAATTTAGAAGTTAGTAATTCA0.550400.223000.724100.750000.972800.62500


Target Position: 2718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718AGAGUUCAGGGAAGAUAAG70.50072541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442736AGAGTTCAGGGAAGATAAGCTTATCTTCCCTGAACTCT0.316300.030000.586200.500001.000001.00000


Target Position: 3481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3481AGCCGUAAAAACUGAAGUU77.65131671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113499AGCCGTAAAAACTGAAGTTAACTTCAGTTTTTACGGCT0.137900.038100.706900.750001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CCUCCUGUAGGUUAUAAUA94.338146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984398CCTCCTGTAGGTTATAATATATTATAACCTACAGGAGG0.179300.015900.801701.000000.962000.62500


Target Position: 3068, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068GCUUUUUUUUUUUAAUUUU78.61881538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993086GCTTTTTTTTTTTAATTTTAAAATTAAAAAAAAAAAGC0.582500.520400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3066-3088GAGCTTTTTTTTTTTAATTTTGTAAAAUUAAAAAAAAAAAGCUCGCUUUUUUUUUUUAAUUUUGUU-9.7-5.911


Target Position: 1584, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584CAAAUCGUACAGAUAAGGA85.0047788

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1582-1604ACCAAATCGTACAGATAAGGAAAUCCUUAUCUGUACGAUUUGGUCAAAUCGUACAGAUAAGGAAAU19.915.232


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108AGGCAAAGUAAUAGGAAAA87.5713541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581126AGGCAAAGTAATAGGAAAATTTTCCTATTACTTTGCCT0.831700.248400.844800.750001.000001.00000


Target Position: 708, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708CUUAUGAUCCAGAAAAUUA94.0142163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925726CTTATGATCCAGAAAATTATAATTTTCTGGATCATAAG0.135400.057600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
706-728AACTTATGATCCAGAAAATTATCUAAUUUUCUGGAUCAUAAGUUCUUAUGAUCCAGAAAAUUAUCU0.48.712


Target Position: 3600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600CAUGAUUUCACAAAUAUUA93.6144174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8413618CATGATTTCACAAATATTATAATATTTGTGAAATCATG0.461300.305600.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3598-3620CACATGATTTCACAAATATTAAAUAAUAUUUGUGAAAUCAUGUGCAUGAUUUCACAAAUAUUAAAU-10.37.221


Target Position: 4314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4314UGUUUUUAAAAUCUUAUUA80.16361339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5114332TGTTTTTAAAATCTTATTATAATAAGATTTTAAAAACA0.330000.097000.672400.750001.000001.00000


Target Position: 4075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4075CUUGUUUAAUAAAGCGAAA85.1481766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9344093CTTGTTTAATAAAGCGAAATTTCGCTTTATTAAACAAG0.115700.020800.637900.750001.000001.00000


Target Position: 2716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2716GCAGAGUUCAGGGAAGAUA88.2737492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792734GCAGAGTTCAGGGAAGATATATCTTCCCTGAACTCTGC0.314000.027800.810301.000001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111CAAAGUAAUAGGAAAAAAU89.9234354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531129CAAAGTAATAGGAAAAAATATTTTTTCCTATTACTTTG0.806100.671500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1109-1131GGCAAAGTAATAGGAAAAAATGGAUUUUUUCCUAUUACUUUGCCCAAAGUAAUAGGAAAAAAUGGU0.74.922


Target Position: 3305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305CUUUUUUUUCUUUUUUUCU69.932607

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3303-3325AACTTTTTTTTCTTTTTTTCTTTAGAAAAAAAGAAAAAAAAGUUCUUUUUUUUCUUUUUUUCUUUU0.7-11.300


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381CUCCUGUAGGUUAUAAUAA89.5417371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899399CTCCTGTAGGTTATAATAATTATTATAACCTACAGGAG0.477800.020600.775900.750001.000001.00000


Target Position: 4361, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4361CUAGAUGUAAAUUUUUAUU80.96471236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4359-4381ATCTAGATGTAAATTTTTATTAAAAUAAAAAUUUACAUCUAGAUCUAGAUGUAAAUUUUUAUUAAU-9.720.321


Target Position: 2893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2893GUUUGAUAAAUAGUGUUAU82.69241019

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2891-2913AAGTTTGATAAATAGTGTTATTGAUAACACUAUUUAUCAAACUUGUUUGAUAAAUAGUGUUAUUGU19.08.923


Target Position: 2310, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310GCACAAAAAGAUACCUUAA96.3158101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502328GCACAAAAAGATACCTTAATTAAGGTATCTTTTTGTGC0.207400.114500.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2308-2330TTGCACAAAAAGATACCTTAAAAUUAAGGUAUCUUUUUGUGCAAGCACAAAAAGAUACCUUAAAAU19.812.222


Target Position: 487, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487GAUAAAGGGUGAGUUUUAU87.7788521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
485-507ATGATAAAGGGTGAGTTTTATGTAUAAAACUCACCCUUUAUCAUGAUAAAGGGUGAGUUUUAUGUU4.910.922


Target Position: 2235, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2235GCAUGAAAUGAACACAAAU92.0483255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052253GCATGAAATGAACACAAATATTTGTGTTCATTTCATGC0.193600.048700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2233-2255GGGCATGAAATGAACACAAATTAAUUUGUGUUCAUUUCAUGCCCGCAUGAAAUGAACACAAAUUAU19.313.822


Target Position: 3061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3061ACUUAGAGCUUUUUUUUUU77.67761667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6353079ACTTAGAGCTTTTTTTTTTAAAAAAAAAAGCTCTAAGT0.639600.088200.706900.750001.000001.00000


Target Position: 4014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4014CUGUUACCAUUGGAAAUUU79.18341462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5264032CTGTTACCATTGGAAATTTAAATTTCCAATGGTAACAG0.217100.112700.784500.750001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303CAGAUUUGCACAAAAAGAU82.9257993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422321CAGATTTGCACAAAAAGATATCTTTTTGTGCAAATCTG0.775300.018300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2301-2323TTCAGATTTGCACAAAAAGATACAUCUUUUUGUGCAAAUCUGAACAGAUUUGCACAAAAAGAUACU5.512.022


Target Position: 2168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168GUAAUUCUUAUUCCAUAUU77.68441663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862186GTAATTCTTATTCCATATTAATATGGAATAAGAATTAC0.256700.095900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2166-2188CCGTAATTCTTATTCCATATTAGAAUAUGGAAUAAGAAUUACGGGUAAUUCUUAUUCCAUAUUAGU21.26.932


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317CCCAUUUUUCUCAACCUAA87.0786591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901335CCCATTTTTCTCAACCTAATTAGGTTGAGAAAAATGGG0.192000.021100.956901.000001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GCGUUUGGAGAGAUUACAA94.7706133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971537GCGTTTGGAGAGATTACAATTGTAATCTCTCCAAACGC0.301300.015400.775901.000001.000001.00000


Target Position: 697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697CUUUUCUGUAACUUAUGAU81.87411109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
695-717GCCTTTTCTGTAACTTATGATCCAUCAUAAGUUACAGAAAAGGCCUUUUCUGUAACUUAUGAUCCU13.412.222


Target Position: 1715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715GCAUCAAAUGCUUCUGAAA96.631387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1713-1735AAGCATCAAATGCTTCTGAAACAUUUCAGAAGCAUUUGAUGCUUGCAUCAAAUGCUUCUGAAACAU20.413.822


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629CCAGAAGACUUACGGCAAA88.8798429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890647CCAGAAGACTTACGGCAAATTTGCCGTAAGTCTTCTGG0.124900.034800.844801.000001.000001.00000


Target Position: 2312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312ACAAAAAGAUACCUUAAAA92.7724211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632330ACAAAAAGATACCTTAAAATTTTAAGGTATCTTTTTGT0.205400.094200.706900.750001.000001.00000


Target Position: 3344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3344GGUUUGGUUUUGUUUUUUG74.89172044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3143362GGTTTGGTTTTGTTTTTTGCAAAAAACAAAACCAAACC0.416900.319800.706900.750001.000001.00000


Target Position: 2117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2117GGAGUACCCUAAACUGCAU90.2859336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562135GGAGTACCCTAAACTGCATATGCAGTTTAGGGTACTCC0.131000.060400.715501.000001.000001.00000


Target Position: 317, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317GUUGCAUUUGAAAACAACU79.04071478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
315-337CAGTTGCATTTGAAAACAACTGGAGUUGUUUUCAAAUGCAACUGGUUGCAUUUGAAAACAACUGGU13.320.012


Target Position: 2629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GUGACAUUUGUCAUUUUCA89.9323353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2627-2649ATGTGACATTTGTCATTTTCATTUGAAAAUGACAAAUGUCACAUGUGACAUUUGUCAUUUUCAUUU7.420.522


Target Position: 3345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3345GUUUGGUUUUGUUUUUUGA83.8991879

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3343-3365GGGTTTGGTTTTGTTTTTTGAGTUCAAAAAACAAAACCAAACCCGUUUGGUUUUGUUUUUUGAGUU-2.918.800


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176UGAGGAUUGAGGCUGAAAA83.9068878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791194TGAGGATTGAGGCTGAAAATTTTCAGCCTCAATCCTCA0.144400.031200.724100.750001.000001.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GCAGUGAUAUUCUUUGUUA99.166841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082419GCAGTGATATTCTTTGTTATAACAAAGAATATCACTGC0.148300.020300.819001.000001.000001.00000


Target Position: 495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495GUGAGUUUUAUGUGAUAGA86.4967638

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
493-515GGGTGAGTTTTATGTGATAGAATUCUAUCACAUAAAACUCACCCGUGAGUUUUAUGUGAUAGAAUU20.319.222


Target Position: 1110, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GCAAAGUAAUAGGAAAAAA92.7172214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
751128GCAAAGTAATAGGAAAAAATTTTTTCCTATTACTTTGC0.846000.706300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1108-1130AGGCAAAGTAATAGGAAAAAATGUUUUUUCCUAUUACUUUGCCUGCAAAGUAAUAGGAAAAAAUGU14.311.822


Target Position: 4351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4351GAUUGUUUAUCUAGAUGUA103.1939

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4349-4371AAGATTGTTTATCTAGATGTAAAUACAUCUAGAUAAACAAUCUUGAUUGUUUAUCUAGAUGUAAAU20.35.322


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165AGUUGUGAGGGUGAGGAUU73.18742243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571183AGTTGTGAGGGTGAGGATTAATCCTCACCCTCACAACT0.111400.024300.698300.750001.000001.00000


Target Position: 3520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3520GAGUUUGUUUCUUUGAAUU86.772616

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3518-3540GTGAGTTTGTTTCTTTGAATTTTAAUUCAAAGAAACAAACUCACGAGUUUGUUUCUUUGAAUUUUU7.417.822


Target Position: 665, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665GCACAUAAGGAUUUUAAAA94.5381140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998683GCACATAAGGATTTTAAAATTTTAAAATCCTTATGTGC0.307300.015400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
663-685CGGCACATAAGGATTTTAAAAAGUUUUAAAAUCCUUAUGUGCCGGCACAUAAGGAUUUUAAAAAGU-9.113.522


Target Position: 3060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060AACUUAGAGCUUUUUUUUU75.10952015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283078AACTTAGAGCTTTTTTTTTAAAAAAAAAGCTCTAAGTT0.608200.103000.646600.500001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667ACAUAAGGAUUUUAAAAAG75.39971980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992685ACATAAGGATTTTAAAAAGCTTTTTAAAATCCTTATGT0.188800.022600.569000.500001.000001.00000


Target Position: 3730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3730AGCUGUUUGGUUUUAAAAU77.64781672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553748AGCTGTTTGGTTTTAAAATATTTTAAAACCAAACAGCT0.302300.022900.844800.750001.000001.00000


Target Position: 771, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771CACAUAUGCUGAUUGACAU93.0679195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
769-791AGCACATATGCTGATTGACATGCAUGUCAAUCAGCAUAUGUGCUCACAUAUGCUGAUUGACAUGCU20.513.323


Target Position: 1997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997GUCCACACUAAAACAUUAC66.6032960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652015GTCCACACTAAAACATTACGTAATGTTTTAGTGTGGAC0.391600.091600.637900.500001.000001.00000


Target Position: 3969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3969GCUAGGAAAAGAAAUCUAU87.7734522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873987GCTAGGAAAAGAAATCTATATAGATTTCTTTTCCTAGC0.142700.074300.810301.000001.000001.00000


Target Position: 1209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209CACAAGAAGAGGAAAUUAU86.6178623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1207-1229TCCACAAGAAGAGGAAATTATGCAUAAUUUCCUCUUCUUGUGGACACAAGAAGAGGAAAUUAUGCU2.119.223


Target Position: 538, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538CAAUGAAAUUGUCACAAUU93.7728170

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
536-558TACAATGAAATTGTCACAATTGAAAUUGUGACAAUUUCAUUGUACAAUGAAAUUGUCACAAUUGAU20.57.422


Target Position: 3423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3423GAUGUUAUAUUUUUCUUAA100.88621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3421-3443AAGATGTTATATTTTTCTTAAAAUUAAGAAAAAUAUAACAUCUUGAUGUUAUAUUUUUCUUAAAAU7.16.711


Target Position: 2404, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404GUGAUAUUCUUUGUUAAUU80.5871293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822422GTGATATTCTTTGTTAATTAATTAACAAAGAATATCAC0.373000.050700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2402-2424CAGTGATATTCTTTGTTAATTTGAAUUAACAAAGAAUAUCACUGGUGAUAUUCUUUGUUAAUUUGU6.98.722


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521GUUUGGAGAGAUUACAAAU89.2921392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661539GTTTGGAGAGATTACAAATATTTGTAATCTCTCCAAAC0.279400.033000.637900.750001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CACAUAAGGAUUUUAAAAA91.849261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856684CACATAAGGATTTTAAAAATTTTTAAAATCCTTATGTG0.236800.022800.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
664-686GGCACATAAGGATTTTAAAAAGGUUUUUAAAAUCCUUAUGUGCCCACAUAAGGAUUUUAAAAAGGU-9.111.622


Target Position: 3553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3553ACUUUUCCUUGCAUACAAA89.4813376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873571ACTTTTCCTTGCATACAAATTTGTATGCAAGGAAAAGT0.541100.075800.706900.750001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733UGUCAUUUUGUCCAUCAAU76.58261818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
705751TGTCATTTTGTCCATCAATATTGATGGACAAAATGACA0.161700.045400.698300.750001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580CAACAAACCUGCCACAAAA97.680266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635598CAACAAACCTGCCACAAAATTTTGTGGCAGGTTTGTTG0.473000.200600.646600.750000.983700.62500


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672GUGCCUUUUUUAUAUCUUG74.56672081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622690GTGCCTTTTTTATATCTTGCAAGATATAAAAAAGGCAC0.110200.021200.646600.500001.000001.00000


Target Position: 2638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638GUCAUUUUCAUUAGCAAAA81.4471180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2636-2658TTGTCATTTTCATTAGCAAAAAAUUUUGCUAAUGAAAAUGACAAGUCAUUUUCAUUAGCAAAAAAU19.77.422


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716CCAGAAAAUUAUCAGCUUG76.99431764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501734CCAGAAAATTATCAGCTTGCAAGCTGATAATTTTCTGG0.309100.055100.698300.750001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121GGAAAAAAUGGAAAGCUGA89.1256402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901139GGAAAAAATGGAAAGCTGATCAGCTTTCCATTTTTTCC0.167000.154200.646600.750001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306GGAAAACAGCACCCAUUUU83.9558873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431324GGAAAACAGCACCCATTTTAAAATGGGTGCTGTTTTCC0.153400.073700.870701.000000.983700.62500


Target Position: 2810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810CCAUAUUUUUUUCCUUACA85.1876761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352828CCATATTTTTTTCCTTACATGTAAGGAAAAAAATATGG0.282700.125000.637900.750001.000001.00000


Target Position: 3354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3354UGUUUUUUGAGUCUUUUUU66.56382967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8973372TGTTTTTTGAGTCTTTTTTAAAAAAGACTCAAAAAACA0.124100.070800.706900.750001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CAGAAAAUUAUCAGCUUGU78.81391507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984735CAGAAAATTATCAGCTTGTACAAGCTGATAATTTTCTG0.206000.028400.577600.500001.000001.00000


Target Position: 2854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854GAAUAGGACUUGUUUUUGU86.5432632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2852-2874AAGAATAGGACTTGTTTTTGTTTACAAAAACAAGUCCUAUUCUUGAAUAGGACUUGUUUUUGUUUU5.619.922


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183UGAGGCUGAAAAUGAGAAA79.63791394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041201TGAGGCTGAAAATGAGAAATTTCTCATTTTCAGCCTCA0.285500.094900.724100.750001.000001.00000


Target Position: 4065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4065CUUUCAAGAACUUGUUUAA90.3374332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4063-4085AACTTTCAAGAACTTGTTTAATAUUAAACAAGUUCUUGAAAGUUCUUUCAAGAACUUGUUUAAUAU7.212.222


Target Position: 2155, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155CUAUACCAUUUCCGUAAUU77.43661704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502173CTATACCATTTCCGTAATTAATTACGGAAATGGTATAG0.277700.197400.663800.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2153-2175TCCTATACCATTTCCGTAATTCTAAUUACGGAAAUGGUAUAGGACUAUACCAUUUCCGUAAUUCUU20.621.123


Target Position: 2284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2284GGCCAUAAGCAACAAUUUU83.0371976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942302GGCCATAAGCAACAATTTTAAAATTGTTGCTTATGGCC0.134800.020901.000001.000000.978300.62500


Target Position: 3925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925GAUGUUGAUGCAAUCCUUA94.7439134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3923-3945TTGATGTTGATGCAATCCTTACAUAAGGAUUGCAUCAACAUCAAGAUGUUGAUGCAAUCCUUACAU18.720.532


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727GGAAGAUAAGUUGGAAACA88.3233486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732745GGAAGATAAGTTGGAAACATGTTTCCAACTTATCTTCC0.127300.047200.663800.750001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233GGGCAUGAAAUGAACACAA94.2216155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862251GGGCATGAAATGAACACAATTGTGTTCATTTCATGCCC0.291700.021300.844801.000001.000001.00000


Target Position: 4253, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4253GUUCAUUCAUAUUACAAUA97.60369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9304271GTTCATTCATATTACAATATATTGTAATATGAATGAAC0.194100.026600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4251-4273GAGTTCATTCATATTACAATATTUAUUGUAAUAUGAAUGAACUCGUUCAUUCAUAUUACAAUAUUU6.916.331


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273UGCCCCAGAAGAAAAAAAA74.43882095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001291TGCCCCAGAAGAAAAAAAATTTTTTTTCTTCTGGGGCA0.919900.342100.853400.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769CCCUGUCAAACAUUAGUAC72.02542382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642787CCCTGTCAAACATTAGTACGTACTAATGTTTGACAGGG0.110000.048600.810300.750001.000001.00000


Target Position: 3066, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066GAGCUUUUUUUUUUUAAUU81.85981119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5323084GAGCTTTTTTTTTTTAATTAATTAAAAAAAAAAAGCTC0.588300.102100.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086TAGAGCTTTTTTTTTTTAATTTTAAUUAAAAAAAAAAAGCUCUAGAGCUUUUUUUUUUUAAUUUUU-9.717.011


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925CCAAGAGAGGCUAAAGGAA89.5076374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151943CCAAGAGAGGCTAAAGGAATTCCTTTAGCCTCTCTTGG0.159500.065200.672401.000000.989100.75000


Target Position: 3567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3567ACAAACAAGCAUAUAAAAU77.43681703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873585ACAAACAAGCATATAAAATATTTTATATGCTTGTTTGT0.107000.017300.698300.750001.000001.00000


Target Position: 2247, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2247CACAAAUUAUGCUAAGAAU92.7185213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2245-2267AACACAAATTATGCTAAGAATTTAUUCUUAGCAUAAUUUGUGUUCACAAAUUAUGCUAAGAAUUUU11.75.322


Target Position: 2865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865GUUUUUGUUUUUGUUUUGU66.58452962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2863-2885TTGTTTTTGTTTTTGTTTTGTTGACAAAACAAAAACAAAAACAAGUUUUUGUUUUUGUUUUGUUGU12.25.600


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690GGCAGGUAGGAAUAUUAUA97.082280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9742708GGCAGGTAGGAATATTATATATAATATTCCTACCTGCC0.308000.016500.956901.000001.000001.00000


Target Position: 3341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3341UGGGGUUUGGUUUUGUUUU64.61033173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713359TGGGGTTTGGTTTTGTTTTAAAACAAAACCAAACCCCA0.599900.209800.844800.750001.000001.00000


Target Position: 499, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499GUUUUAUGUGAUAGAAUAU90.1505342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
497-519GAGTTTTATGTGATAGAATATGCAUAUUCUAUCACAUAAAACUCGUUUUAUGUGAUAGAAUAUGCU8.4-1.411


Target Position: 4180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4180CUAACUUGCUUAAAUGUGA85.968687

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4178-4200CGCTAACTTGCTTAAATGTGAATUCACAUUUAAGCAAGUUAGCGCUAACUUGCUUAAAUGUGAAUU12.111.822


Target Position: 2539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539CAUGAAAUGCUAUGUCAUU88.9526422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2537-2559TTCATGAAATGCTATGTCATTTCAAUGACAUAGCAUUUCAUGAACAUGAAAUGCUAUGUCAUUUCU20.57.212


Target Position: 2511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511UCUGUUUUCAAUCUCGUAU68.30662784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362529TCTGTTTTCAATCTCGTATATACGAGATTGAAAACAGA0.115500.038900.681000.750001.000001.00000


Target Position: 2313, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313CAAAAAGAUACCUUAAAAU88.3518482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812331CAAAAAGATACCTTAAAATATTTTAAGGTATCTTTTTG0.159500.087500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2311-2333CACAAAAAGATACCTTAAAATTTAUUUUAAGGUAUCUUUUUGUGCAAAAAGAUACCUUAAAAUUUU-3.85.512


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279AGAAGAAAAAAAACAUUUA89.4257381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081297AGAAGAAAAAAAACATTTATAAATGTTTTTTTTCTTCT0.547800.349400.689700.750001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164GAGUUGUGAGGGUGAGGAU88.5133472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161182GAGTTGTGAGGGTGAGGATATCCTCACCCTCACAACTC0.120300.022100.629300.750001.000001.00000


Target Position: 3522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522GUUUGUUUCUUUGAAUUUU77.60931679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3520-3542GAGTTTGTTTCTTTGAATTTTCAAAAAUUCAAAGAAACAAACUCGUUUGUUUCUUUGAAUUUUCAU7.45.622


Target Position: 2947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947GAAGAAAGAACUAUCUUCA96.605588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2945-2967GAGAAGAAAGAACTATCTTCATCUGAAGAUAGUUCUUUCUUCUCGAAGAAAGAACUAUCUUCAUCU16.010.322


Target Position: 933, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933GUACUCAUGGUGCUAAUAU83.983871

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
931-953TGGTACTCATGGTGCTAATATTCAUAUUAGCACCAUGAGUACCAGUACUCAUGGUGCUAAUAUUCU14.920.323


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160CCAUGUAUGCAUAAUAAUC80.3361322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5573178CCATGTATGCATAATAATCGATTATTATGCATACATGG0.724900.202700.663800.750000.989100.62500


Target Position: 3526, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3526GUUUCUUUGAAUUUUCAUU78.70121523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863544GTTTCTTTGAATTTTCATTAATGAAAATTCAAAGAAAC0.107200.023400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3524-3546TTGTTTCTTTGAATTTTCATTTTAAUGAAAAUUCAAAGAAACAAGUUUCUUUGAAUUUUCAUUUUU7.45.521


Target Position: 2514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514GUUUUCAAUCUCGUAUAGA81.45021178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2512-2534CTGTTTTCAATCTCGTATAGAAGUCUAUACGAGAUUGAAAACAGGUUUUCAAUCUCGUAUAGAAGU13.37.733


Target Position: 2286, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286CCAUAAGCAACAAUUUUCA86.5888627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392304CCATAAGCAACAATTTTCATGAAAATTGTTGCTTATGG0.205500.046500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2284-2306GGCCATAAGCAACAATTTTCAGAUGAAAAUUGUUGCUUAUGGCCCCAUAAGCAACAAUUUUCAGAU0.419.732


Target Position: 2402, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402CAGUGAUAUUCUUUGUUAA103.6256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292420CAGTGATATTCTTTGTTAATTAACAAAGAATATCACTG0.188800.024700.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2400-2422AGCAGTGATATTCTTTGTTAATTUUAACAAAGAAUAUCACUGCUCAGUGAUAUUCUUUGUUAAUUU7.220.322


Target Position: 3548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548CAGUUACUUUUCCUUGCAU86.7709617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213566CAGTTACTTTTCCTTGCATATGCAAGGAAAAGTAACTG0.136300.126000.629300.750001.000001.00000


Target Position: 2640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640CAUUUUCAUUAGCAAAAAA95.4656117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2638-2660GTCATTTTCATTAGCAAAAAAAGUUUUUUGCUAAUGAAAAUGACCAUUUUCAUUAGCAAAAAAAGU14.17.422


Target Position: 3954, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3954CUUUUAAAAUUUUAAGCUA90.646321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3952-3974TGCTTTTAAAATTTTAAGCTAGGUAGCUUAAAAUUUUAAAAGCACUUUUAAAAUUUUAAGCUAGGU18.3-9.121


Target Position: 3588, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3588CAACAAACUGCACAUGAUU86.2791664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173606CAACAAACTGCACATGATTAATCATGTGCAGTTTGTTG0.170500.045800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3586-3608GGCAACAAACTGCACATGATTTCAAUCAUGUGCAGUUUGUUGCCCAACAAACUGCACAUGAUUUCU20.513.322


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588CUGCCACAAAAGAUACUUU82.9197995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568606CTGCCACAAAAGATACTTTAAAGTATCTTTTGTGGCAG0.204400.149300.784500.750001.000001.00000


Target Position: 1481, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481GAUUAUCACCUGAACUAUU92.929204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221499GATTATCACCTGAACTATTAATAGTTCAGGTGATAATC0.242500.041700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1479-1501TGGATTATCACCTGAACTATTTAAAUAGUUCAGGUGAUAAUCCAGAUUAUCACCUGAACUAUUUAU14.58.722


Target Position: 3949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3949GAUUGCUUUUAAAAUUUUA93.372180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3947-3969ATGATTGCTTTTAAAATTTTAAGUAAAAUUUUAAAAGCAAUCAUGAUUGCUUUUAAAAUUUUAAGU-12.018.521


Target Position: 2257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257GCUAAGAAUUUUUUAUUUU84.6487811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922275GCTAAGAATTTTTTATTTTAAAATAAAAAATTCTTAGC0.141900.110900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2255-2277ATGCTAAGAATTTTTTATTTTTTAAAAUAAAAAAUUCUUAGCAUGCUAAGAAUUUUUUAUUUUUUU-9.711.722


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276CCCAGAAGAAAAAAAACAU81.85721120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441294CCCAGAAGAAAAAAAACATATGTTTTTTTTCTTCTGGG0.756200.363400.836201.000001.000001.00000


Target Position: 2140, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140CUGAAGUUAUAUUUCCUAU87.7416526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932158CTGAAGTTATATTTCCTATATAGGAAATATAACTTCAG0.328300.053100.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2138-2160TTCTGAAGTTATATTTCCTATACAUAGGAAAUAUAACUUCAGAACUGAAGUUAUAUUUCCUAUACU19.919.222


Target Position: 3342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3342GGGGUUUGGUUUUGUUUUU77.34561715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1353360GGGGTTTGGTTTTGTTTTTAAAAACAAAACCAAACCCC0.505700.255400.991401.000001.000001.00000


Target Position: 3973, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3973GGAAAAGAAAUCUAUAGAA100.84922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163991GGAAAAGAAATCTATAGAATTCTATAGATTTCTTTTCC0.136900.069800.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3971-3993TAGGAAAAGAAATCTATAGAAAGUUCUAUAGAUUUCUUUUCCUAGGAAAAGAAAUCUAUAGAAAGU13.014.811


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764GCAAACCCUGUCAAACAUU77.68291664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562782GCAAACCCTGTCAAACATTAATGTTTGACAGGGTTTGC0.111500.047300.844801.000001.000001.00000


Target Position: 293, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293GAUGUUCAUGAAGAUUCAA92.4335229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
291-313AGGATGTTCATGAAGATTCAATAUUGAAUCUUCAUGAACAUCCUGAUGUUCAUGAAGAUUCAAUAU20.420.522


Target Position: 3155, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155CAUUUCCAUGUAUGCAUAA89.9225355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3153-3175GTCATTTCCATGTATGCATAATAUUAUGCAUACAUGGAAAUGACCAUUUCCAUGUAUGCAUAAUAU21.120.122


Target Position: 4088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4088GCGAAAAACUCAACCAAAU84.9174791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4086-4108AAGCGAAAAACTCAACCAAATGGAUUUGGUUGAGUUUUUCGCUUGCGAAAAACUCAACCAAAUGGU18.87.722


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559CAUGUCCUGUGUCAGUUUA89.3011391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422577CATGTCCTGTGTCAGTTTATAAACTGACACAGGACATG0.329700.066600.620700.750000.978301.00000


Target Position: 2885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885GCACUGAAGUUUGAUAAAU84.6741810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6302903GCACTGAAGTTTGATAAATATTTATCAAACTTCAGTGC0.185900.060600.844801.000001.000001.00000


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327UCAACCUAACAGUACAAAA83.0882968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461345TCAACCTAACAGTACAAAATTTTGTACTGTTAGGTTGA0.390900.099500.724100.750001.000001.00000


Target Position: 4292, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4292GUUUUUCAGUUCAAAGUCA88.2828489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4290-4312ATGTTTTTCAGTTCAAAGTCATGUGACUUUGAACUGAAAAACAUGUUUUUCAGUUCAAAGUCAUGU19.27.721


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498AGUUUUAUGUGAUAGAAUA97.187376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940516AGTTTTATGTGATAGAATATATTCTATCACATAAAACT0.173800.018500.663800.750001.000001.00000


Target Position: 3610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610CAAAUAUUAAAAAGUCUUU82.40621052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473628CAAATATTAAAAAGTCTTTAAAGACTTTTTAATATTTG0.206400.132600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3608-3630CACAAATATTAAAAAGTCTTTTAAAAGACUUUUUAAUAUUUGUGCAAAUAUUAAAAAGUCUUUUAU17.7-10.322


Target Position: 1292, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292CAUUUAGAUAUAAAGGAAA94.3064148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831310CATTTAGATATAAAGGAAATTTCCTTTATATCTAAATG0.125900.099200.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1290-1312AACATTTAGATATAAAGGAAAACUUUCCUUUAUAUCUAAAUGUUCAUUUAGAUAUAAAGGAAAACU18.76.922


Target Position: 3280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280ACUAAGAUCGGUUAACAAA87.5017550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803298ACTAAGATCGGTTAACAAATTTGTTAACCGATCTTAGT0.151900.027700.706900.750001.000001.00000


Target Position: 2160, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160CCAUUUCCGUAAUUCUUAU85.8521698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1822178CCATTTCCGTAATTCTTATATAAGAATTACGGAAATGG0.426600.240500.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2158-2180TACCATTTCCGTAATTCTTATTCAUAAGAAUUACGGAAAUGGUACCAUUUCCGUAAUUCUUAUUCU6.920.132


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065AGAGCUUUUUUUUUUUAAU80.25061331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5953083AGAGCTTTTTTTTTTTAATATTAAAAAAAAAAAGCTCT0.597700.094100.715500.750001.000001.00000


Target Position: 3944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3944CAAAUGAUUGCUUUUAAAA91.3364280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3942-3964TACAAATGATTGCTTTTAAAATTUUUUAAAAGCAAUCAUUUGUACAAAUGAUUGCUUUUAAAAUUU-9.17.222


Target Position: 2369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369GCAGAUUUUAGUUUUAUUU82.40941050

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2367-2389GGGCAGATTTTAGTTTTATTTTCAAAUAAAACUAAAAUCUGCCCGCAGAUUUUAGUUUUAUUUUCU-9.712.022


Target Position: 3529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3529UCUUUGAAUUUUCAUUUUA79.62041399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883547TCTTTGAATTTTCATTTTATAAAATGAAAATTCAAAGA0.142400.040300.689700.750001.000001.00000


Target Position: 3153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153GUCAUUUCCAUGUAUGCAU79.1231469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423171GTCATTTCCATGTATGCATATGCATACATGGAAATGAC0.226600.030100.663800.750000.989100.75000


Target Position: 3823, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3823GCGACAACAGAUUGGAUUU82.87571000

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7382319GCGACAACAGATTGGATTT1/1/0/097.75FMR1NM_002024.41NANANAX:147032059..147032077(+)00FMR1(0.002)


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548GUCACAAUUGAACGUCUAA91.2068287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809566GTCACAATTGAACGTCTAATTAGACGTTCAATTGTGAC0.285800.060600.784500.750001.000001.00000


Target Position: 3159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3159UCCAUGUAUGCAUAAUAAU74.66822074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3553177TCCATGTATGCATAATAATATTATTATGCATACATGGA0.733200.155100.862100.750000.989100.75000


Target Position: 2467, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467CAGUUUUUCUUAAUAUAUA99.910133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7022485CAGTTTTTCTTAATATATATATATATTAAGAAAAACTG0.277700.242400.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2465-2487CTCAGTTTTTCTTAATATATAGCUAUAUAUUAAGAAAAACUGAGCAGUUUUUCUUAAUAUAUAGCU-8.63.222


Target Position: 2651, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651GCAAAAAAAGUUGUAUGAU82.07861082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162669GCAAAAAAAGTTGTATGATATCATACAACTTTTTTTGC0.190700.153200.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2649-2671TAGCAAAAAAAGTTGTATGATCTAUCAUACAACUUUUUUUGCUAGCAAAAAAAGUUGUAUGAUCUU21.5-2.922


Target Position: 2774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2774UCAAACAUUAGUACUUUAU70.52852539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432792TCAAACATTAGTACTTTATATAAAGTACTAATGTTTGA0.283500.069300.681000.750001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325UCUCAACCUAACAGUACAA82.73511009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731343TCTCAACCTAACAGTACAATTGTACTGTTAGGTTGAGA0.226100.120400.577600.750001.000001.00000


Target Position: 1009, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009CACAUUUCAUAUUUAUGGA89.6565364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1007-1029TGCACATTTCATATTTATGGAGAUCCAUAAAUAUGAAAUGUGCACACAUUUCAUAUUUAUGGAGAU12.814.821


Target Position: 3974, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3974GAAAAGAAAUCUAUAGAAA101.81313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853992GAAAAGAAATCTATAGAAATTTCTATAGATTTCTTTTC0.168000.055000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3972-3994AGGAAAAGAAATCTATAGAAAGTUUUCUAUAGAUUUCUUUUCCUGAAAAGAAAUCUAUAGAAAGUU8.45.521


Target Position: 2258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258CUAAGAAUUUUUUAUUUUU84.6912808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262276CTAAGAATTTTTTATTTTTAAAAATAAAAAATTCTTAG0.135900.102800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2256-2278TGCTAAGAATTTTTTATTTTTTGAAAAAUAAAAAAUUCUUAGCACUAAGAAUUUUUUAUUUUUUGU-9.76.911


Target Position: 2475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475CUUAAUAUAUAGCAUUUAU91.3844276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2473-2495TTCTTAATATATAGCATTTATGGAUAAAUGCUAUAUAUUAAGAACUUAAUAUAUAGCAUUUAUGGU15.3-8.022


Target Position: 4052, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052CUUUAUCUACCAACUUUCA85.6017716

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4050-4072GCCTTTATCTACCAACTTTCAAGUGAAAGUUGGUAGAUAAAGGCCUUUAUCUACCAACUUUCAAGU13.36.932


Target Position: 4049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049AGCCUUUAUCUACCAACUU74.44842092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484067AGCCTTTATCTACCAACTTAAGTTGGTAGATAAAGGCT0.241000.049700.715500.750001.000001.00000


Target Position: 2234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2234GGCAUGAAAUGAACACAAA98.024560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122252GGCATGAAATGAACACAAATTTGTGTTCATTTCATGCC0.276400.040101.000001.000001.000001.00000


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564CCUGUGUCAGUUUAUGUUU79.24921451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702582CCTGTGTCAGTTTATGTTTAAACATAAACTGACACAGG0.293500.148500.844801.000000.978300.62500


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267ACCUAAUGCCCCAGAAGAA85.0458781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751285ACCTAATGCCCCAGAAGAATTCTTCTGGGGCATTAGGT0.413100.129800.681000.750000.967400.62500


Target Position: 2141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141UGAAGUUAUAUUUCCUAUA85.7234705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4332159TGAAGTTATATTTCCTATATATAGGAAATATAACTTCA0.325000.086400.681000.750001.000001.00000


Target Position: 4184, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4184CUUGCUUAAAUGUGAAUUA87.1697578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674202CTTGCTTAAATGTGAATTATAATTCACATTTAAGCAAG0.157200.016900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4182-4204AACTTGCTTAAATGTGAATTACTUAAUUCACAUUUAAGCAAGUUCUUGCUUAAAUGUGAAUUACUU14.819.721


Target Position: 1354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GGUGUUAGUGGCUUCAUCA96.776483

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1352-1374AGGGTGTTAGTGGCTTCATCAGTUGAUGAAGCCACUAACACCCUGGUGUUAGUGGCUUCAUCAGUU20.419.022


Target Position: 4062, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4062CAACUUUCAAGAACUUGUU80.16261340

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4060-4082ACCAACTTTCAAGAACTTGTTTAAACAAGUUCUUGAAAGUUGGUCAACUUUCAAGAACUUGUUUAU17.813.331


Target Position: 2458, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458GUACAUUCUCAGUUUUUCU84.4496829

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2456-2478CAGTACATTCTCAGTTTTTCTTAAGAAAAACUGAGAAUGUACUGGUACAUUCUCAGUUUUUCUUAU8.716.121


Target Position: 3970, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3970CUAGGAAAAGAAAUCUAUA97.322474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693988CTAGGAAAAGAAATCTATATATAGATTTCTTTTCCTAG0.127700.062900.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3968-3990AGCTAGGAAAAGAAATCTATAGAUAUAGAUUUCUUUUCCUAGCUCUAGGAAAAGAAAUCUAUAGAU6.619.922


Target Position: 4389, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4389CACUUAUGAAAAAGCAAAA90.5866324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6554407CACTTATGAAAAAGCAAAATTTTGCTTTTTCATAAGTG0.814100.172900.793100.750000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4387-4409TGCACTTATGAAAAAGCAAAAAAUUUUGCUUUUUCAUAAGUGCACACUUAUGAAAAAGCAAAAAAU18.611.622


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185AGGCUGAAAAUGAGAAAAA85.4243738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081203AGGCTGAAAATGAGAAAAATTTTTCTCATTTTCAGCCT0.244400.088300.844800.750001.000001.00000


Target Position: 810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810CUAAGUUGUCUCUGAUAAU89.2557395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
808-830CACTAAGTTGTCTCTGATAATGAAUUAUCAGAGACAACUUAGUGCUAAGUUGUCUCUGAUAAUGAU13.411.823


Target Position: 984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984CUAUUGAUCUAGAUGAAGA95.3141124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
982-1004TGCTATTGATCTAGATGAAGATAUCUUCAUCUAGAUCAAUAGCACUAUUGAUCUAGAUGAAGAUAU20.48.723


Target Position: 2862, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2862CUUGUUUUUGUUUUUGUUU70.49882542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2860-2882GACTTGTTTTTGTTTTTGTTTTGAAACAAAAACAAAAACAAGUCCUUGUUUUUGUUUUUGUUUUGU5.65.610


Target Position: 4277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4277GUGCUAAACGUGUAUGUUU85.0801775

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4275-4297GTGTGCTAAACGTGTATGTTTTTAAACAUACACGUUUAGCACACGUGCUAAACGUGUAUGUUUUUU14.619.733


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455CCAGUACAUUCUCAGUUUU84.782805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672473CCAGTACATTCTCAGTTTTAAAACTGAGAATGTACTGG0.758700.352800.844801.000001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563UCCUGUGUCAGUUUAUGUU73.01992265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2542581TCCTGTGTCAGTTTATGTTAACATAAACTGACACAGGA0.501800.152400.724100.750000.978300.75000


Target Position: 1940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940GGAAGAACAACAGAUGGAU86.1825670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901958GGAAGAACAACAGATGGATATCCATCTGTTGTTCTTCC0.106900.077400.689701.000001.000001.00000


Target Position: 2145, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145GUUAUAUUUCCUAUACCAU88.2763490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2143-2165AAGTTATATTTCCTATACCATTTAUGGUAUAGGAAAUAUAACUUGUUAUAUUUCCUAUACCAUUUU21.1-8.022


Target Position: 3859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3859GGUUAUAGUGCAAUAUAUU95.3608122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3857-3879TTGGTTATAGTGCAATATATTTTAAUAUAUUGCACUAUAACCAAGGUUAUAGUGCAAUAUAUUUUU-8.66.332


Target Position: 2882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882GUUGCACUGAAGUUUGAUA92.1448247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052900GTTGCACTGAAGTTTGATATATCAAACTTCAGTGCAAC0.312300.026400.603400.750001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GAAAUUAUGCCACCAAAUU81.73811131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981238GAAATTATGCCACCAAATTAATTTGGTGGCATAATTTC0.104900.053400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1218-1240AGGAAATTATGCCACCAAATTCCAAUUUGGUGGCAUAAUUUCCUGAAAUUAUGCCACCAAAUUCCU18.8-10.322


Target Position: 3564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3564CAUACAAACAAGCAUAUAA99.972232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3562-3584TGCATACAAACAAGCATATAAAAUUAUAUGCUUGUUUGUAUGCACAUACAAACAAGCAUAUAAAAU16.56.922


Target Position: 4298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4298CAGUUCAAAGUCAUGAUGU79.38741426

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4296-4318TTCAGTTCAAAGTCATGATGTTTACAUCAUGACUUUGAACUGAACAGUUCAAAGUCAUGAUGUUUU19.419.232


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400AGCAGUGAUAUUCUUUGUU75.01232028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552418AGCAGTGATATTCTTTGTTAACAAAGAATATCACTGCT0.138400.017600.706900.750001.000001.00000


Target Position: 2311, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311CACAAAAAGAUACCUUAAA88.1131500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4802329CACAAAAAGATACCTTAAATTTAAGGTATCTTTTTGTG0.235500.097100.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2309-2331TGCACAAAAAGATACCTTAAAATUUUAAGGUAUCUUUUUGUGCACACAAAAAGAUACCUUAAAAUU18.65.611


Target Position: 522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522CAUGUGAUGCAACUUACAA95.3347123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
520-542AGCATGTGATGCAACTTACAATGUUGUAAGUUGCAUCACAUGCUCAUGUGAUGCAACUUACAAUGU19.020.522


Target Position: 1759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759CAGUGAUUGGUCAUUAGCU87.1274585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1757-1779CTCAGTGATTGGTCATTAGCTCCAGCUAAUGACCAAUCACUGAGCAGUGAUUGGUCAUUAGCUCCU19.719.223


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707ACUUAUGAUCCAGAAAAUU75.35081987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761725ACTTATGATCCAGAAAATTAATTTTCTGGATCATAAGT0.147900.049000.698300.750001.000001.00000


Target Position: 4326, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4326CUUAUUAAAGUUUCAAAAA85.6379714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9834344CTTATTAAAGTTTCAAAAATTTTTGAAACTTTAATAAG0.107700.078000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4324-4346ATCTTATTAAAGTTTCAAAAATCUUUUUGAAACUUUAAUAAGAUCUUAUUAAAGUUUCAAAAAUCU7.7-7.522


Target Position: 3598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598CACAUGAUUUCACAAAUAU89.3493388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6303616CACATGATTTCACAAATATATATTTGTGAAATCATGTG0.521800.106600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3596-3618TGCACATGATTTCACAAATATTAAUAUUUGUGAAAUCAUGUGCACACAUGAUUUCACAAAUAUUAU6.920.512


Target Position: 2125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2125CUAAACUGCAUAAUUCUGA78.81611503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2123-2145CCCTAAACTGCATAATTCTGAAGUCAGAAUUAUGCAGUUUAGGGCUAAACUGCAUAAUUCUGAAGU12.011.832


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833GAGGGGGAGGAAGAGGACA77.82041638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811851GAGGGGGAGGAAGAGGACATGTCCTCTTCCTCCCCCTC0.774400.329400.603400.500001.000001.00000


Target Position: 2123, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123CCCUAAACUGCAUAAUUCU81.86221117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352141CCCTAAACTGCATAATTCTAGAATTATGCAGTTTAGGG0.213700.063200.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2121-2143TACCCTAAACTGCATAATTCTGAAGAAUUAUGCAGUUUAGGGUACCCUAAACUGCAUAAUUCUGAU1.818.632


Target Position: 4306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4306AGUCAUGAUGUUUUUAAAA88.9271426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8034324AGTCATGATGTTTTTAAAATTTTAAAAACATCATGACT0.139200.035100.706900.750001.000001.00000


Target Position: 4252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4252AGUUCAUUCAUAUUACAAU88.4872473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7954270AGTTCATTCATATTACAATATTGTAATATGAATGAACT0.176900.026900.698300.750001.000001.00000


Target Position: 2964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964CAUCUGAGAGAGGCUAAAA92.949200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312982CATCTGAGAGAGGCTAAAATTTTAGCCTCTCTCAGATG0.234100.019100.655200.750001.000001.00000


Target Position: 1307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307GAAAACAGCACCCAUUUUU77.30351722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1305-1327AGGAAAACAGCACCCATTTTTCTAAAAAUGGGUGCUGUUUUCCUGAAAACAGCACCCAUUUUUCUU11.310.311


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578CCCAACAAACCUGCCACAA73.912164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149596CCCAACAAACCTGCCACAATTGTGGCAGGTTTGTTGGG0.485200.254000.844801.000000.983700.87500


Target Position: 1593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CAGAUAAGGAAAAAAGCUA91.8223263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751611CAGATAAGGAAAAAAGCTATAGCTTTTTTCCTTATCTG0.173200.026700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613TACAGATAAGGAAAAAAGCTATGUAGCUUUUUUCCUUAUCUGUACAGAUAAGGAAAAAAGCUAUGU17.011.622


Target Position: 3098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098GUUUUGUGAAAUUUUUCAU78.96921485

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3096-3118AAGTTTTGTGAAATTTTTCATATAUGAAAAAUUUCACAAAACUUGUUUUGUGAAAUUUUUCAUAUU7.712.222


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415UGUUAAUUUGGACCAUUUU72.86342289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182433TGTTAATTTGGACCATTTTAAAATGGTCCAAATTAACA0.138000.020000.706900.750001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CGAGAUUUCAUGAACAGUU86.3916652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833897CGAGATTTCATGAACAGTTAACTGTTCATGAAATCTCG0.228600.024600.646601.000001.000001.00000


Target Position: 1725, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725CUUCUGAAACAGAAUCUGA89.0232415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1723-1745TGCTTCTGAAACAGAATCTGACCUCAGAUUCUGUUUCAGAAGCACUUCUGAAACAGAAUCUGACCU20.420.422


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464UCUCAGUUUUUCUUAAUAU80.43471310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922482TCTCAGTTTTTCTTAATATATATTAAGAAAAACTGAGA0.358700.294800.681000.750001.000001.00000


Target Position: 4188, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4188CUUAAAUGUGAAUUACUAA95.8837109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9194206CTTAAATGTGAATTACTAATTAGTAATTCACATTTAAG0.247600.109700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4186-4208TGCTTAAATGTGAATTACTAACTUUAGUAAUUCACAUUUAAGCACUUAAAUGUGAAUUACUAACUU6.3-1.423


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274GCCCCAGAAGAAAAAAAAC69.13492701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411292GCCCCAGAAGAAAAAAAACGTTTTTTTTCTTCTGGGGC0.812000.278100.853400.750001.000001.00000


Target Position: 2935, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935GUAUAGACAGGAGAAGAAA92.632218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2933-2955CTGTATAGACAGGAGAAGAAAGAUUUCUUCUCCUGUCUAUACAGGUAUAGACAGGAGAAGAAAGAU19.115.823


Target Position: 4307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4307GUCAUGAUGUUUUUAAAAU83.513924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8364325GTCATGATGTTTTTAAAATATTTTAAAAACATCATGAC0.202700.033200.810300.750001.000001.00000


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CUGGGAAUGUAUAGUAUUU87.729529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803692CTGGGAATGTATAGTATTTAAATACTATACATTCCCAG0.225300.065300.784500.750001.000001.00000


Target Position: 4247, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4247GUUGGAGUUCAUUCAUAUU87.3653559

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9424719GTTGGAGTTCATTCATATT1/1/0/097.75FMR1NM_002024.41NANANAX:147032483..147032501(+)00FMR1(0.002)


Target Position: 2736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GUUGGAAACACUAAAUGUU83.5899912

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2734-2756AAGTTGGAAACACTAAATGTTAAAACAUUUAGUGUUUCCAACUUGUUGGAAACACUAAAUGUUAAU6.920.122


Target Position: 3415, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3415CACUCUAAGAUGUUAUAUU91.6751267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7233433CACTCTAAGATGTTATATTAATATAACATCTTAGAGTG0.359400.071400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3413-3435TTCACTCTAAGATGTTATATTTTAAUAUAACAUCUUAGAGUGAACACUCUAAGAUGUUAUAUUUUU1.118.932


Target Position: 4042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4042GGAAGUUAGCCUUUAUCUA98.251154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4040-4062TAGGAAGTTAGCCTTTATCTACCUAGAUAAAGGCUAACUUCCUAGGAAGUUAGCCUUUAUCUACCU6.914.612


Target Position: 981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CUGCUAUUGAUCUAGAUGA86.7986612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
979-1001CACTGCTATTGATCTAGATGAAGUCAUCUAGAUCAAUAGCAGUGCUGCUAUUGAUCUAGAUGAAGU17.819.733


Target Position: 4360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4360UCUAGAUGUAAAUUUUUAU79.05791477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9504378TCTAGATGTAAATTTTTATATAAAAATTTACATCTAGA0.112500.018600.681000.750001.000001.00000


Target Position: 3218, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218CAGGUUAAAUGUUUUGUAA96.2688104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3216-3238AGCAGGTTAAATGTTTTGTAAACUUACAAAACAUUUAACCUGCUCAGGUUAAAUGUUUUGUAAACU7.218.632


Target Position: 2132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2132GCAUAAUUCUGAAGUUAUA101.37717

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2130-2152CTGCATAATTCTGAAGTTATATTUAUAACUUCAGAAUUAUGCAGGCAUAAUUCUGAAGUUAUAUUU4.6-1.832


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914GUCCACGUAAUCCAAGAGA74.75962058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341932GTCCACGTAATCCAAGAGATCTCTTGGATTACGTGGAC0.137300.079400.594800.500001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GAUCACUCCCGAACAGAUA91.3582279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101910GATCACTCCCGAACAGATATATCTGTTCGGGAGTGATC0.293500.104200.637900.750000.989100.75000


Target Position: 2919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2919GAUGUGUAAUUUUUCUGUA97.710665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2917-2939GAGATGTGTAATTTTTCTGTATAUACAGAAAAAUUACACAUCUCGAUGUGUAAUUUUUCUGUAUAU19.220.422


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610ACCCUGAAAUGUGUGUGAU74.69642070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802628ACCCTGAAATGTGTGTGATATCACACACATTTCAGGGT0.108300.030700.672400.750001.000001.00000


Target Position: 3725, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CUGUAAGCUGUUUGGUUUU75.48461969

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5372519CTGTAAGCTGTTTGGTTTT1/1/0/097.75FMR1NM_002024.41NANANAX:147031961..147031979(+)00FMR1(0.002)


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283UGGCCAUAAGCAACAAUUU73.51862206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992301TGGCCATAAGCAACAATTTAAATTGTTGCTTATGGCCA0.151700.026600.844800.750000.978300.75000


Target Position: 2454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454ACCAGUACAUUCUCAGUUU80.84991262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132472ACCAGTACATTCTCAGTTTAAACTGAGAATGTACTGGT0.758000.341400.853400.750001.000001.00000


Target Position: 2890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890GAAGUUUGAUAAAUAGUGU87.5544543

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2888-2910CTGAAGTTTGATAAATAGTGTTAACACUAUUUAUCAAACUUCAGGAAGUUUGAUAAAUAGUGUUAU11.610.333


Target Position: 4013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013ACUGUUACCAUUGGAAAUU65.80043048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6654031ACTGTTACCATTGGAAATTAATTTCCAATGGTAACAGT0.191700.110400.698300.750001.000001.00000


Target Position: 2646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646CAUUAGCAAAAAAAGUUGU74.79472053

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2644-2666TTCATTAGCAAAAAAAGTTGTATACAACUUUUUUUGCUAAUGAACAUUAGCAAAAAAAGUUGUAUU10.319.722


Target Position: 2154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154CCUAUACCAUUUCCGUAAU79.92041365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3542172CCTATACCATTTCCGTAATATTACGGAAATGGTATAGG0.303200.220700.836201.000000.989100.75000


Target Position: 390, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390GUUAUAAUAAAGAUAUAAA99.695837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651408GTTATAATAAAGATATAAATTTATATCTTTATTATAAC0.301400.229000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
388-410AGGTTATAATAAAGATATAAATGUUUAUAUCUUUAUUAUAACCUGUUAUAAUAAAGAUAUAAAUGU3.5-8.021


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834AGGGGGAGGAAGAGGACAA81.24621197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661852AGGGGGAGGAAGAGGACAATTGTCCTCTTCCTCCCCCT0.772900.467600.698300.750001.000001.00000


Target Position: 3095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095CAAGUUUUGUGAAAUUUUU83.1998960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3093-3115CCCAAGTTTTGTGAAATTTTTCAAAAAAUUUCACAAAACUUGGGCAAGUUUUGUGAAAUUUUUCAU-12.03.221


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587CCUGCCACAAAAGAUACUU70.93622499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482605CCTGCCACAAAAGATACTTAAGTATCTTTTGTGGCAGG0.235200.157400.706901.000001.000001.00000


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388AGGUUAUAAUAAAGAUAUA99.730735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797406AGGTTATAATAAAGATATATATATCTTTATTATAACCT0.324200.079600.801700.750001.000001.00000


Target Position: 4016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4016GUUACCAUUGGAAAUUUCA81.84971122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4014-4036CTGTTACCATTGGAAATTTCACGUGAAAUUUCCAAUGGUAACAGGUUACCAUUGGAAAUUUCACGU0.420.032


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527GAUGCAACUUACAAUGAAA104.8934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484545GATGCAACTTACAATGAAATTTCATTGTAAGTTGCATC0.269400.104900.681000.750001.000001.00000


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159ACCAUUUCCGUAAUUCUUA78.17221596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3892177ACCATTTCCGTAATTCTTATAAGAATTACGGAAATGGT0.397200.236400.819000.750001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529UGCAACUUACAAUGAAAUU69.2742687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632547TGCAACTTACAATGAAATTAATTTCATTGTAAGTTGCA0.185400.122200.844800.750001.000001.00000


Target Position: 4312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4312GAUGUUUUUAAAAUCUUAU85.8506699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7524330GATGTTTTTAAAATCTTATATAAGATTTTAAAAACATC0.369500.067500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4310-4332ATGATGTTTTTAAAATCTTATTAAUAAGAUUUUAAAAACAUCAUGAUGUUUUUAAAAUCUUAUUAU6.95.321


Target Position: 1074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074CUGAAGAUGUAAUACAAGU81.79081128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1072-1094TGCTGAAGATGTAATACAAGTTCACUUGUAUUACAUCUUCAGCACUGAAGAUGUAAUACAAGUUCU11.620.432


Target Position: 3381, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3381GAAAUUUAUUGAGGAAAAA90.4642328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6823399GAAATTTATTGAGGAAAAATTTTTCCTCAATAAATTTC0.168900.079300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3379-3401GTGAAATTTATTGAGGAAAAATAUUUUUCCUCAAUAAAUUUCACGAAAUUUAUUGAGGAAAAAUAU18.7-9.712


Target Position: 2945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945GAGAAGAAAGAACUAUCUU87.9674508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2943-2965AGGAGAAGAAAGAACTATCTTCAAAGAUAGUUCUUUCUUCUCCUGAGAAGAAAGAACUAUCUUCAU18.919.122


Target Position: 2322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322ACCUUAAAAUUUGAAACAU75.35711986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772340ACCTTAAAATTTGAAACATATGTTTCAAATTTTAAGGT0.108400.075400.698300.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GCCACAAAAGAUACUUUCC67.35962887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982608GCCACAAAAGATACTTTCCGGAAAGTATCTTTTGTGGC0.121700.077800.629300.500000.994600.62500


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405UGAUAUUCUUUGUUAAUUU83.4451933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942423TGATATTCTTTGTTAATTTAAATTAACAAAGAATATCA0.407400.101900.724100.750001.000001.00000


Target Position: 2963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963UCAUCUGAGAGAGGCUAAA76.70431801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282981TCATCTGAGAGAGGCTAAATTTAGCCTCTCTCAGATGA0.202400.019300.724100.750001.000001.00000


Target Position: 3609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3609ACAAAUAUUAAAAAGUCUU74.95472035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973627ACAAATATTAAAAAGTCTTAAGACTTTTTAATATTTGT0.228300.137500.569000.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102CUUAGUAGGCAAAGUAAUA92.1716246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411120CTTAGTAGGCAAAGTAATATATTACTTTGCCTACTAAG0.757800.073400.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1100-1122AACTTAGTAGGCAAAGTAATAGGUAUUACUUUGCCUACUAAGUUCUUAGUAGGCAAAGUAAUAGGU4.611.322


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589AACAAACUGCACAUGAUUU79.71851381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003607AACAAACTGCACATGATTTAAATCATGTGCAGTTTGTT0.180300.054300.646600.500001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283GAAAAAAAACAUUUAGAUA99.42539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8151301GAAAAAAAACATTTAGATATATCTAAATGTTTTTTTTC0.534600.506800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1281-1303AAGAAAAAAAACATTTAGATATAUAUCUAAAUGUUUUUUUUCUUGAAAAAAAACAUUUAGAUAUAU6.9-11.312


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800UGCAUGCUUUCCAUAUUUU74.3092113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662818TGCATGCTTTCCATATTTTAAAATATGGAAAGCATGCA0.167600.048400.853400.750000.956500.75000


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588UCGUACAGAUAAGGAAAAA77.90241631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621606TCGTACAGATAAGGAAAAATTTTTCCTTATCTGTACGA0.257800.077500.793100.750001.000001.00000


Target Position: 2631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2631GACAUUUGUCAUUUUCAUU86.615624

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2629-2651GTGACATTTGTCATTTTCATTAGAAUGAAAAUGACAAAUGUCACGACAUUUGUCAUUUUCAUUAGU7.412.122


Target Position: 4197, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4197GAAUUACUAACUUCUAAAA98.24355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5084215GAATTACTAACTTCTAAAATTTTAGAAGTTAGTAATTC0.866600.232800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4195-4217GTGAATTACTAACTTCTAAAACTUUUUAGAAGUUAGUAAUUCACGAAUUACUAACUUCUAAAACUU7.14.622


Target Position: 2446, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446GAUCAUUCACCAGUACAUU86.3964650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5992464GATCATTCACCAGTACATTAATGTACTGGTGAATGATC0.385400.045800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2444-2466GTGATCATTCACCAGTACATTCTAAUGUACUGGUGAAUGAUCACGAUCAUUCACCAGUACAUUCUU19.016.232


Target Position: 2587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587CCACUUUUCCAGUAUUUUA93.3437182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2585-2607GTCCACTTTTCCAGTATTTTAGTUAAAAUACUGGAAAAGUGGACCCACUUUUCCAGUAUUUUAGUU-0.310.323


Target Position: 2133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133CAUAAUUCUGAAGUUAUAU85.5356726

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2131-2153TGCATAATTCTGAAGTTATATTTAUAUAACUUCAGAAUUAUGCACAUAAUUCUGAAGUUAUAUUUU6.31.832


Target Position: 3731, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731GCUGUUUGGUUUUAAAAUA91.2205284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343749GCTGTTTGGTTTTAAAATATATTTTAAAACCAAACAGC0.282100.024400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3729-3751AAGCTGTTTGGTTTTAAAATACTUAUUUUAAAACCAAACAGCUUGCUGUUUGGUUUUAAAAUACUU-9.716.723


Target Position: 1643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643GGUAGUAGACCUUACAGAA104.1845

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1641-1663GAGGTAGTAGACCTTACAGAAATUUCUGUAAGGUCUACUACCUCGGUAGUAGACCUUACAGAAAUU20.318.833


Target Position: 3105, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105GAAAUUUUUCAUAUUUUAA95.1099128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943123GAAATTTTTCATATTTTAATTAAAATATGAAAAATTTC0.141600.039200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3103-3125GTGAAATTTTTCATATTTTAATTUUAAAAUAUGAAAAAUUUCACGAAAUUUUUCAUAUUUUAAUUU-7.5-12.011


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826CGGCGUGGAGGGGGAGGAA76.8241783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261844CGGCGTGGAGGGGGAGGAATTCCTCCCCCTCCACGCCG0.513800.051400.741401.000001.000001.00000


Target Position: 2487, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2487CAUUUAUGGUAAUCAUAUU94.3072147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762505CATTTATGGTAATCATATTAATATGATTACCATAAATG0.189500.048200.646600.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2485-2507AGCATTTATGGTAATCATATTAGAAUAUGAUUACCAUAAAUGCUCAUUUAUGGUAAUCAUAUUAGU8.5-1.822


Target Position: 2802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802CAUGCUUUCCAUAUUUUUU83.4644928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2800-2822TGCATGCTTTCCATATTTTTTTCAAAAAAUAUGGAAAGCAUGCACAUGCUUUCCAUAUUUUUUUCU-9.718.521


Target Position: 2542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542GAAAUGCUAUGUCAUUUCA93.5039177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2540-2562ATGAAATGCTATGTCATTTCATGUGAAAUGACAUAGCAUUUCAUGAAAUGCUAUGUCAUUUCAUGU16.318.522


Target Position: 2839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2839GUUAGGCAGUAUAAAGAAU87.3438562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322857GTTAGGCAGTATAAAGAATATTCTTTATACTGCCTAAC0.115900.044600.637900.750001.000001.00000


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453CACCAGUACAUUCUCAGUU80.55031297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722471CACCAGTACATTCTCAGTTAACTGAGAATGTACTGGTG0.761200.143300.646600.750001.000001.00000


Target Position: 4251, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4251GAGUUCAUUCAUAUUACAA98.385550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894269GAGTTCATTCATATTACAATTGTAATATGAATGAACTC0.176800.015700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4249-4271TGGAGTTCATTCATATTACAATAUUGUAAUAUGAAUGAACUCCAGAGUUCAUUCAUAUUACAAUAU8.519.232


Target Position: 3232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232UGUAAACUUUGAAAUAUAU84.3195841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023250TGTAAACTTTGAAATATATATATATTTCAAAGTTTACA0.304700.139300.663800.750001.000001.00000


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218AGGAAAUUAUGCCACCAAA90.0891345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441236AGGAAATTATGCCACCAAATTTGGTGGCATAATTTCCT0.261300.023700.844800.750001.000001.00000


Target Position: 2193, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2193CUUUGUUAGGCCAAAGACA83.8874881

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2191-2213AACTTTGTTAGGCCAAAGACAAAUGUCUUUGGCCUAACAAAGUUCUUUGUUAGGCCAAAGACAAAU19.27.232


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763AGCAAACCCUGUCAAACAU79.52291409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142781AGCAAACCCTGTCAAACATATGTTTGACAGGGTTTGCT0.120700.036300.698300.750001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882GAUUUCAUGAACAGUUUAU85.1826762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975900GATTTCATGAACAGTTTATATAAACTGTTCATGAAATC0.134000.016500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
880-902GAGATTTCATGAACAGTTTATCGAUAAACUGUUCAUGAAAUCUCGAUUUCAUGAACAGUUUAUCGU11.87.222


Target Position: 2579, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579GUUUUGGUCCACUUUUCCA81.78081129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2577-2599ATGTTTTGGTCCACTTTTCCAGTUGGAAAAGUGGACCAAAACAUGUUUUGGUCCACUUUUCCAGUU18.718.832


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579CCAACAAACCUGCCACAAA91.1749288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84597CCAACAAACCTGCCACAAATTTGTGGCAGGTTTGTTGG0.622400.263200.844801.000000.983700.75000


Target Position: 3302, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3302CAACUUUUUUUUCUUUUUU77.53191686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053320CAACTTTTTTTTCTTTTTTAAAAAAGAAAAAAAAGTTG0.431500.325500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3300-3322AACAACTTTTTTTTCTTTTTTTCAAAAAAGAAAAAAAAGUUGUUCAACUUUUUUUUCUUUUUUUCU5.53.210


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827GGCGUGGAGGGGGAGGAAG57.4673753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201845GGCGTGGAGGGGGAGGAAGCTTCCTCCCCCTCCACGCC0.529000.068500.862100.750001.000001.00000


Target Position: 4364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4364GAUGUAAAUUUUUAUUAAA101.36418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434382GATGTAAATTTTTATTAAATTTAATAAAAATTTACATC0.114100.065700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4362-4384TAGATGTAAATTTTTATTAAAAAUUUAAUAAAAAUUUACAUCUAGAUGUAAAUUUUUAUUAAAAAU-7.56.922


Target Position: 2486, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2486GCAUUUAUGGUAAUCAUAU90.0145346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442504GCATTTATGGTAATCATATATATGATTACCATAAATGC0.152800.047500.810301.000000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2484-2506TAGCATTTATGGTAATCATATTAAUAUGAUUACCAUAAAUGCUAGCAUUUAUGGUAAUCAUAUUAU8.7-1.823


Target Position: 3289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289GGUUAACAAAUAACAACUU86.1698673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713307GGTTAACAAATAACAACTTAAGTTGTTATTTGTTAACC0.145400.072100.715501.000000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3287-3309TCGGTTAACAAATAACAACTTTTAAGUUGUUAUUUGUUAACCGAGGUUAACAAAUAACAACUUUUU17.814.732


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309UGCACAAAAAGAUACCUUA85.0822774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042327TGCACAAAAAGATACCTTATAAGGTATCTTTTTGTGCA0.771600.755200.819000.750000.951100.62500


Target Position: 3603, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3603GAUUUCACAAAUAUUAAAA91.9873257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293621GATTTCACAAATATTAAAATTTTAATATTTGTGAAATC0.287300.236000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3601-3623ATGATTTCACAAATATTAAAAAGUUUUAAUAUUUGUGAAAUCAUGAUUUCACAAAUAUUAAAAAGU-7.514.821


Target Position: 2500, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500CAUAUUAGACUUCUGUUUU84.8979794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2498-2520ATCATATTAGACTTCTGTTTTCAAAAACAGAAGUCUAAUAUGAUCAUAUUAGACUUCUGUUUUCAU19.2-2.723


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841GGAAGAGGACAAGGAGGAA92.3291238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821859GGAAGAGGACAAGGAGGAATTCCTCCTTGTCCTCTTCC0.857300.687000.698301.000001.000001.00000


Target Position: 3768, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3768GGUAGAAUGACCUUGUAAU93.1955187

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6376819GGTAGAATGACCTTGTAAT1/1/0/097.75FMR1NM_002024.41NANANAX:147032004..147032022(+)00FMR1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3766-3788AAGGTAGAATGACCTTGTAATGTAUUACAAGGUCAUUCUACCUUGGUAGAAUGACCUUGUAAUGUU11.814.533


Target Position: 3425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425UGUUAUAUUUUUCUUAAAA87.1287584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803443TGTTATATTTTTCTTAAAATTTTAAGAAAAATATAACA0.126600.037500.706900.750001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326CUCAACCUAACAGUACAAA77.71661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501344CTCAACCTAACAGTACAAATTTGTACTGTTAGGTTGAG0.218300.115300.810300.750001.000001.00000


Target Position: 3939, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3939CCUUACAAAUGAUUGCUUU82.18021076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3937-3959ATCCTTACAAATGATTGCTTTTAAAAGCAAUCAUUUGUAAGGAUCCUUACAAAUGAUUGCUUUUAU18.511.832


Target Position: 2372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372GAUUUUAGUUUUAUUUUCU87.0052598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2370-2392CAGATTTTAGTTTTATTTTCTAAAGAAAAUAAAACUAAAAUCUGGAUUUUAGUUUUAUUUUCUAAU2.1-4.321


Target Position: 4137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4137UGCACUAAGUCUCUUUUUU74.10632135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7444155TGCACTAAGTCTCTTTTTTAAAAAAGAGACTTAGTGCA0.193700.115800.853400.750001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295UGUUCAUGAAGAUUCAAUA90.8312307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688313TGTTCATGAAGATTCAATATATTGAATCTTCATGAACA0.265400.055300.663800.750001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828GCGUGGAGGGGGAGGAAGA78.97041484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721846GCGTGGAGGGGGAGGAAGATCTTCCTCCCCCTCCACGC0.593800.095300.698300.750001.000001.00000


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213GCAGGGCUGAAGAGAAGAU83.6194907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
676231GCAGGGCTGAAGAGAAGATATCTTCTCTTCAGCCCTGC0.564200.034700.672401.000001.000001.00000


Target Position: 3482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3482GCCGUAAAAACUGAAGUUC62.5353366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853500GCCGTAAAAACTGAAGTTCGAACTTCAGTTTTTACGGC0.125700.042000.827600.750001.000001.00000


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884UGCACUGAAGUUUGAUAAA81.46791174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432902TGCACTGAAGTTTGATAAATTTATCAAACTTCAGTGCA0.312500.054300.853400.750001.000001.00000


Target Position: 3343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3343GGGUUUGGUUUUGUUUUUU76.71691799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1153361GGGTTTGGTTTTGTTTTTTAAAAAACAAAACCAAACCC0.546200.328300.991401.000001.000001.00000


Target Position: 2744, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2744CACUAAAUGUUAAAGAUGU85.2207757

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2742-2764AACACTAAATGTTAAAGATGTAGACAUCUUUAACAUUUAGUGUUCACUAAAUGUUAAAGAUGUAGU12.04.622


Target Position: 426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
426AGGUGUAUUCCAGAGCAAA88.4187477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
892444AGGTGTATTCCAGAGCAAATTTGCTCTGGAATACACCT0.181300.020900.844800.750000.989100.75000


Target Position: 3366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366CUUUUUUUUUUAAGUGAAA82.9841984

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3364-3386GTCTTTTTTTTTTAAGTGAAATTUUUCACUUAAAAAAAAAAGACCUUUUUUUUUUAAGUGAAAUUU19.2-11.310


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GAGGCUGAAAAUGAGAAAA87.3313563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381202GAGGCTGAAAATGAGAAAATTTTCTCATTTTCAGCCTC0.255900.083600.810300.750001.000001.00000


Target Position: 3221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221GUUAAAUGUUUUGUAAACU77.09261751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3219-3241AGGTTAAATGTTTTGTAAACTTTAGUUUACAAAACAUUUAACCUGUUAAAUGUUUUGUAAACUUUU14.7-1.422


Target Position: 3067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3067AGCUUUUUUUUUUUAAUUU74.67262073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753085AGCTTTTTTTTTTTAATTTAAATTAAAAAAAAAAAGCT0.580500.479000.853400.750001.000001.00000


Target Position: 3209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209CAUUGGAAGCAGGUUAAAU85.5176727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3207-3229AACATTGGAAGCAGGTTAAATGTAUUUAACCUGCUUCCAAUGUUCAUUGGAAGCAGGUUAAAUGUU14.020.132


Target Position: 1470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470CUGUUCUUUUGGAUUAUCA86.4093648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1468-1490CACTGTTCTTTTGGATTATCACCUGAUAAUCCAAAAGAACAGUGCUGUUCUUUUGGAUUAUCACCU11.619.222


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724CAGGGAAGAUAAGUUGGAA95.3768121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8802742CAGGGAAGATAAGTTGGAATTCCAACTTATCTTCCCTG0.310200.111600.612100.750001.000001.00000


Target Position: 4000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4000GUUACAAAAUGUAACUGUU88.6286462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3998-4020CTGTTACAAAATGTAACTGTTACAACAGUUACAUUUUGUAACAGGUUACAAAAUGUAACUGUUACU19.07.222


Target Position: 3288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288CGGUUAACAAAUAACAACU82.9727988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8273306CGGTTAACAAATAACAACTAGTTGTTATTTGTTAACCG0.148700.073400.706900.750000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3286-3308ATCGGTTAACAAATAACAACTTTAGUUGUUAUUUGUUAACCGAUCGGUUAACAAAUAACAACUUUU14.721.133


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277CCAGAAGAAAAAAAACAUU81.11691210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1021295CCAGAAGAAAAAAAACATTAATGTTTTTTTTCTTCTGG0.612900.289100.836201.000001.000001.00000


Target Position: 3563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3563GCAUACAAACAAGCAUAUA90.7932311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3561-3583TTGCATACAAACAAGCATATAAAUAUAUGCUUGUUUGUAUGCAAGCAUACAAACAAGCAUAUAAAU19.713.522


Target Position: 3906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906GAUCUUCCUCUGCUAAAUU86.5911626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6293924GATCTTCCTCTGCTAAATTAATTTAGCAGAGGAAGATC0.233400.038200.672400.750001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154UCAUUUCCAUGUAUGCAUA85.5737724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7363172TCATTTCCATGTATGCATATATGCATACATGGAAATGA0.241200.038100.681000.750000.989100.62500


Target Position: 3426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3426GUUAUAUUUUUCUUAAAAA95.7611111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3424-3446ATGTTATATTTTTCTTAAAAAGTUUUUUAAGAAAAAUAUAACAUGUUAUAUUUUUCUUAAAAAGUU-3.8-8.012


Target Position: 3602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602UGAUUUCACAAAUAUUAAA86.5046637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133620TGATTTCACAAATATTAAATTTAATATTTGTGAAATCA0.445200.285700.724100.750001.000001.00000


Target Position: 2717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717CAGAGUUCAGGGAAGAUAA96.485295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652735CAGAGTTCAGGGAAGATAATTATCTTCCCTGAACTCTG0.344300.028700.750000.750001.000001.00000


Target Position: 3349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3349GGUUUUGUUUUUUGAGUCU81.01061227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063367GGTTTTGTTTTTTGAGTCTAGACTCAAAAAACAAAACC0.345600.274300.629300.750001.000001.00000


Target Position: 3313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313UCUUUUUUUCUUUUGUUUU64.93583135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613331TCTTTTTTTCTTTTGTTTTAAAACAAAAGAAAAAAAGA0.346300.175100.724100.750001.000001.00000


Target Position: 3242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242GAAAUAUAUGGUCUAAUGU85.8823695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3240-3262TTGAAATATATGGTCTAATGTTTACAUUAGACCAUAUAUUUCAAGAAAUAUAUGGUCUAAUGUUUU13.4-8.022


Target Position: 2691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2691GCAGGUAGGAAUAUUAUAU92.0831252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152709GCAGGTAGGAATATTATATATATAATATTCCTACCTGC0.214300.025700.810301.000001.000001.00000


Target Position: 887, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887CAUGAACAGUUUAUCGUAA97.646567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
885-907TTCATGAACAGTTTATCGTAAGAUUACGAUAAACUGUUCAUGAACAUGAACAGUUUAUCGUAAGAU17.720.523


Target Position: 1188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CUGAAAAUGAGAAAAAUGU74.7952052

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1186-1208GGCTGAAAATGAGAAAAATGTTCACAUUUUUCUCAUUUUCAGCCCUGAAAAUGAGAAAAAUGUUCU-3.37.412


Target Position: 3968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3968AGCUAGGAAAAGAAAUCUA88.7471447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633986AGCTAGGAAAAGAAATCTATAGATTTCTTTTCCTAGCT0.147300.083300.681000.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181CAUAUUAGAAAACUUUGUU82.25791068

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2179-2201TCCATATTAGAAAACTTTGTTAGAACAAAGUUUUCUAAUAUGGACAUAUUAGAAAACUUUGUUAGU17.8-2.722


Target Position: 497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497GAGUUUUAUGUGAUAGAAU92.6137221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
495-517GTGAGTTTTATGTGATAGAATATAUUCUAUCACAUAAAACUCACGAGUUUUAUGUGAUAGAAUAUU16.04.922


Target Position: 2512, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512CUGUUUUCAAUCUCGUAUA86.3645657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812530CTGTTTTCAATCTCGTATATATACGAGATTGAAAACAG0.107900.034700.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2510-2532TTCTGTTTTCAATCTCGTATAGAUAUACGAGAUUGAAAACAGAACUGUUUUCAAUCUCGUAUAGAU20.914.933


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557GAACGUCUAAGAUCUGUUA96.765884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933575GAACGTCTAAGATCTGTTATAACAGATCTTAGACGTTC0.115900.067100.637900.750001.000001.00000


Target Position: 2913, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913GAGAGAGAUGUGUAAUUUU94.4382143

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4291319GAGAGAGATGTGTAATTTT1/1/0/097.75FMR1NM_002024.41NANANAX:147031149..147031167(+)00FMR1(0.002)


Target Position: 3801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801GCAAUAUUCUCUGUACAUA97.135778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7703819GCAATATTCTCTGTACATATATGTACAGAGAATATTGC0.145700.069400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3799-3821GGGCAATATTCTCTGTACATATTUAUGUACAGAGAAUAUUGCCCGCAAUAUUCUCUGUACAUAUUU20.4-1.822


Target Position: 3268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268GAAUUGGAAAAGACUAAGA89.4096382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3266-3288CAGAATTGGAAAAGACTAAGATCUCUUAGUCUUUUCCAAUUCUGGAAUUGGAAAAGACUAAGAUCU18.920.122


Target Position: 4187, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4187GCUUAAAUGUGAAUUACUA101.05320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5194205GCTTAAATGTGAATTACTATAGTAATTCACATTTAAGC0.219900.101900.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4185-4207TTGCTTAAATGTGAATTACTAACUAGUAAUUCACAUUUAAGCAAGCUUAAAUGUGAAUUACUAACU4.6-4.322


Target Position: 3655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655UGAUUUCUAGUUAUUUAUU77.77171648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033673TGATTTCTAGTTATTTATTAATAAATAACTAGAAATCA0.868500.026500.715500.750001.000001.00000


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715UCCAGAAAAUUAUCAGCUU74.01092150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
664733TCCAGAAAATTATCAGCTTAAGCTGATAATTTTCTGGA0.345400.055900.732800.750001.000001.00000


Target Position: 3227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227UGUUUUGUAAACUUUGAAA81.96971098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793245TGTTTTGTAAACTTTGAAATTTCAAAGTTTACAAAACA0.398900.044600.706900.750001.000001.00000


Target Position: 3094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094CCAAGUUUUGUGAAAUUUU80.67591287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3092-3114CCCCAAGTTTTGTGAAATTTTTCAAAAUUUCACAAAACUUGGGGCCAAGUUUUGUGAAAUUUUUCU0.410.320


Target Position: 1823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823CGGCGGCGUGGAGGGGGAG52.08434027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271841CGGCGGCGTGGAGGGGGAGCTCCCCCTCCACGCCGCCG0.297600.020000.603400.750001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482AGGAUGAUAAAGGGUGAGU65.91563031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888500AGGATGATAAAGGGTGAGTACTCACCCTTTATCATCCT0.131300.096400.637900.500001.000001.00000


Target Position: 2806, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2806CUUUCCAUAUUUUUUUCCU70.39352550

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2804-2826TGCTTTCCATATTTTTTTCCTTAAGGAAAAAAAUAUGGAAAGCACUUUCCAUAUUUUUUUCCUUAU14.320.121


Target Position: 4210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4210CUAAAACUGUACUUUGAUU86.4605640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4208-4230TTCTAAAACTGTACTTTGATTCAAAUCAAAGUACAGUUUUAGAACUAAAACUGUACUUUGAUUCAU12.04.922


Target Position: 474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CUAAAGUGAGGAUGAUAAA92.1105250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505492CTAAAGTGAGGATGATAAATTTATCATCCTCACTTTAG0.570500.103800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
472-494AGCTAAAGTGAGGATGATAAAGGUUUAUCAUCCUCACUUUAGCUCUAAAGUGAGGAUGAUAAAGGU8.711.822


Target Position: 2000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000CACACUAAAACAUUACAGA89.33389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1998-2020TCCACACTAAAACATTACAGAATUCUGUAAUGUUUUAGUGUGGACACACUAAAACAUUACAGAAUU11.619.022


Target Position: 3301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301ACAACUUUUUUUUCUUUUU71.93812388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3233319ACAACTTTTTTTTCTTTTTAAAAAGAAAAAAAAGTTGT0.435900.163100.706900.750001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219GGAAAUUAUGCCACCAAAU85.4322737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231237GGAAATTATGCCACCAAATATTTGGTGGCATAATTTCC0.136300.071100.862101.000001.000001.00000


Target Position: 3642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642CAAACAUUAAUGUUGAUUU86.3025662

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3640-3662GCCAAACATTAATGTTGATTTCTAAAUCAACAUUAAUGUUUGGCCAAACAUUAAUGUUGAUUUCUU14.85.332