siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 2421  
Biltr, Rnaxs, Sidirect 471   759   928   960   965   980   1478   1487   1489   1795   1799   1804   1825   1827   1921   1931   1942   2016   2025   2027  
2147   2149   2152   2155   2158   2279   2289   2293   2299   2338   2342   2344   2352   2364   2392   2394   2400   2467   2469   2476  
2477   2490   2504   2505   2517   2531   2544   2556   2560   2575   2576   2579   2583  
Biltr, Rnaxs 12   13   150   151   152   153   154   155   156   157   158   159   160   161   162   166   167   172   173   174  
404   405   442   444   445   446   468   469   470   472   479   519   525   528   530   531   592   634   640   641  
642   643   651   652   653   654   655   656   657   659   660   661   662   663   666   667   669   670   671   673  
674   675   714   717   718   719   756   757   758   765   766   778   798   801   858   879   880   899   900   904  
906   926   927   929   937   938   939   952   959   961   970   973   974   975   977   978   979   981   982   983  
984   988   989   990   991   992   993   994   1004   1005   1006   1011   1012   1013   1014   1015   1016   1017   1018   1025  
1026   1032   1048   1050   1051   1052   1056   1080   1081   1082   1084   1109   1110   1113   1124   1125   1126   1128   1148   1149  
1158   1177   1178   1186   1204   1281   1282   1305   1309   1310   1311   1312   1357   1359   1362   1363   1368   1375   1376   1390  
1391   1392   1394   1395   1409   1413   1416   1417   1436   1437   1438   1439   1460   1461   1462   1464   1465   1466   1467   1468  
1469   1470   1471   1476   1477   1483   1484   1485   1486   1488   1490   1491   1513   1514   1515   1516   1519   1520   1521   1522  
1525   1549   1550   1557   1561   1562   1563   1596   1600   1601   1602   1603   1615   1620   1624   1625   1645   1649   1650   1651  
1654   1718   1719   1720   1721   1722   1725   1726   1727   1750   1751   1752   1758   1759   1760   1761   1762   1763   1764   1765  
1769   1770   1771   1780   1781   1782   1783   1784   1787   1794   1796   1797   1798   1800   1801   1802   1803   1806   1807   1808  
1812   1813   1814   1815   1819   1820   1821   1822   1823   1824   1826   1828   1829   1830   1833   1834   1839   1840   1841   1852  
1869   1871   1872   1873   1874   1876   1877   1878   1879   1880   1881   1886   1887   1888   1889   1890   1891   1892   1895   1896  
1897   1915   1916   1917   1918   1919   1922   1923   1928   1929   1930   1950   1951   1952   1955   1956   1970   1972   1973   1974  
1975   1976   2003   2004   2005   2006   2007   2012   2013   2014   2015   2020   2023   2024   2026   2030   2031   2032   2034   2035  
2039   2044   2045   2048   2049   2050   2124   2128   2133   2134   2135   2136   2137   2139   2140   2141   2142   2143   2144   2145  
2146   2148   2150   2151   2153   2154   2156   2157   2159   2160   2165   2166   2178   2179   2190   2191   2194   2195   2196   2197  
2198   2199   2200   2204   2205   2215   2219   2220   2221   2223   2224   2268   2269   2270   2271   2274   2276   2277   2278   2280  
2281   2282   2283   2284   2285   2286   2287   2288   2291   2292   2298   2300   2326   2330   2331   2332   2333   2334   2335   2336  
2337   2341   2343   2345   2346   2349   2351   2353   2354   2355   2356   2357   2361   2362   2363   2365   2366   2367   2368   2371  
2374   2375   2379   2380   2381   2384   2385   2391   2393   2395   2396   2397   2398   2399   2405   2406   2407   2408   2409   2413  
2420   2427   2431   2432   2433   2434   2439   2446   2447   2457   2462   2463   2464   2465   2468   2471   2473   2474   2475   2478  
2482   2483   2484   2485   2486   2489   2491   2492   2493   2494   2495   2496   2503   2506   2507   2511   2512   2513   2516   2519  
2523   2524   2525   2526   2529   2530   2532   2533   2534   2535   2537   2541   2543   2545   2546   2547   2548   2549   2550   2551  
2552   2553   2554   2555   2564   2569   2570   2571   2572   2573   2574   2577   2578   2580   2581   2582   2584   2585  
Biltr, Ernai 458   1429  
Biltr, Ernai, Rnaxs, Sidirect 940   951   1920   2290   2444   2466   2536  
Biltr, Sidirect 950   954   1159   1472   1481   2386   2390   2455   2497   2514  


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545UAAUAAAUAUACUAUGAAA100.48

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892563TAATAAATATACTATGAAATTTCATAGTATATTTATTA0.583300.467200.534500.500001.000001.00000


Target Position: 2205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205ACAUCCAAAUCUAGCCAGA79.9093522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482223ACATCCAAATCTAGCCAGATCTGGCTAGATTTGGATGT0.082800.075400.482800.500001.000001.00000


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283ACUUCUGGUUGUAUUUCUA90.920886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292301ACTTCTGGTTGTATTTCTATAGAAATACAACCAGAAGT0.139200.011700.534500.750001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922UGAAUUACAGUGAAAUUUU77.123699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881940TGAATTACAGTGAAATTTTAAAATTTCACTGTAATTCA0.585000.063000.724100.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UCUACUCUUGUCAUUUUUA81.9483401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011816TCTACTCTTGTCATTTTTATAAAAATGACAAGAGTAGA0.264800.063400.689700.750001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656GGAGAACUGAAGGAUGACG70.32261100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324674GGAGAACTGAAGGATGACGCGTCATCCTTCAGTTCTCC0.109500.023000.594800.500001.000001.00000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362AUGUUUCUUAAAUGGAAUU68.85961202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642380ATGTTTCTTAAATGGAATTAATTCCATTTAAGAAACAT0.019200.004000.646600.500001.000001.00000


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285UUCUGGUUGUAUUUCUAUA83.4456332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582303TTCTGGTTGTATTTCTATATATAGAAATACAACCAGAA0.161500.013900.629300.500001.000001.00000


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463CAACGUGUAUAGUGCCUAA102.2072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822481CAACGTGTATAGTGCCTAATTAGGCACTATACACGTTG0.019300.001200.612100.750001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446GGAGUUGGAAGCGCGUUAC66.11171389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402464GGAGTTGGAAGCGCGTTACGTAACGCGCTTCCAACTCC0.073500.010800.689700.750001.000001.00000


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564UAAAAAAAAAAGGAUGAAA76.9871704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882582TAAAAAAAAAAGGATGAAATTTCATCCTTTTTTTTTTA0.364300.353600.534500.500001.000001.00000


Target Position: 2511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511AACCUAGAUGUUUAACAAA88.9176134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942529AACCTAGATGTTTAACAAATTTGTTAAACATCTAGGTT0.142400.011000.646600.500001.000001.00000


Target Position: 2393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2393ACAAAUUGAUCAAGAUAUU81.0978458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732411ACAAATTGATCAAGATATTAATATCTTGATCAATTTGT0.017300.005400.698300.750001.000001.00000


Target Position: 2497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497CUUUUAACCAUUUUAACCU71.461022

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2495-2517TCCTTTTAACCATTTTAACCTAGAGGUUAAAAUGGUUAAAAGGACUUUUAACCAUUUUAACCUAGU14.00.022


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952GUAGUCAUUCUUACAAUUG71.96161001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161970GTAGTCATTCTTACAATTGCAATTGTAAGAATGACTAC0.078400.008100.534500.500001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483AUUGUAUGAAAAUCCUUUU72.3684977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782501ATTGTATGAAAATCCTTTTAAAAGGATTTTCATACAAT0.183000.079200.508600.500001.000001.00000


Target Position: 2031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031UGGUGGUACUUUAUUCUUG70.35341095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072049TGGTGGTACTTTATTCTTGCAAGAATAAAGTACCACCA0.164400.041400.698300.500001.000001.00000


Target Position: 2384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2384UUGAAUGUCACAAAUUGAU67.9541267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862402TTGAATGTCACAAATTGATATCAATTTGTGACATTCAA0.195000.017000.465500.500001.000001.00000


Target Position: 1491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1491AUAAAUGCUUAAUAAAAAA86.8887204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901509ATAAATGCTTAATAAAAAATTTTTTATTAAGCATTTAT0.843700.416400.543100.500001.000001.00000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375GGAAUUAUUUUGAAUGUCA96.441325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422393GGAATTATTTTGAATGTCATGACATTCAAAATAATTCC0.059600.007200.646600.750001.000001.00000


Target Position: 2153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153AUCAUGUUAUUUUAUUAUU75.7925784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592171ATCATGTTATTTTATTATTAATAATAAAATAACATGAT0.544300.251700.672400.500001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662CUGAAGGAUGACGACUUUG65.48511433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577680CTGAAGGATGACGACTTTGCAAAGTCGTCATCCTTCAG0.056700.010100.637900.500001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GAAGCAGAAGGUGGGAGAA88.3465146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563661GAAGCAGAAGGTGGGAGAATTCTCCCACCTTCTGCTTC0.019300.004300.500000.750001.000001.00000


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432CCCCAUAUCCAAGUACCAA85.7907243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132450CCCCATATCCAAGTACCAATTGGTACTTGGATATGGGG0.119500.054700.844801.000001.000001.00000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803UCUUGUCAUUUUUAAUAUU77.9286652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1191821TCTTGTCATTTTTAATATTAATATTAAAAATGACAAGA0.642400.101800.715500.750001.000001.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391CCUCCCAUGGCAAUUUUUG61.41671677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981409CCTCCCATGGCAATTTTTGCAAAAATTGCCATGGGAGG0.174200.003100.698300.750001.000001.00000


Target Position: 1362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1362CCCUUAGCUCAUACGGAAU79.2297565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221380CCCTTAGCTCATACGGAATATTCCGTATGAGCTAAGGG0.111300.065300.982801.000000.972800.62500


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780CACAGCAUGUGCCAAGAUU82.8069360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691798CACAGCATGTGCCAAGATTAATCTTGGCACATGCTGTG0.067800.004000.784500.750000.907600.87500


Target Position: 2485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2485UGUAUGAAAAUCCUUUUAA81.3116442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2512503TGTATGAAAATCCTTTTAATTAAAAGGATTTTCATACA0.167500.069200.672400.750001.000001.00000


Target Position: 2006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2006UGUAUUUUCGGGAUUCUUU72.0097999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982024TGTATTTTCGGGATTCTTTAAAGAATCCCGAAAATACA0.075100.012400.706900.750001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UGCUUUUAUCAAGAGAUCU69.22641172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751567TGCTTTTATCAAGAGATCTAGATCTCTTGATAAAAGCA0.081900.002300.629300.500000.967400.75000


Target Position: 2224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224GCCCUUCACUGCCAUGAUA89.8693109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052242GCCCTTCACTGCCATGATATATCATGGCAGTGAAGGGC0.047600.002800.956901.000000.918500.75000


Target Position: 1931, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GUGAAAUUUUGGUGAAUGU80.0765508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001949GTGAAATTTTGGTGAATGTACATTCACCAAAATTTCAC0.040500.041300.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1929-1951CAGTGAAATTTTGGTGAATGTGGACAUUCACCAAAAUUUCACUGGUGAAAUUUUGGUGAAUGUGGU20.57.422


Target Position: 2343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2343UCUCUUUAAGUUUUGAUUA78.2713635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1802361TCTCTTTAAGTTTTGATTATAATCAAAACTTAAAGAGA0.486700.052800.689700.750001.000001.00000


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585UAAAAAAAAAAAAAAAAAA80.6168481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082603TAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTA0.998900.994700.534500.500001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CCAAAAUGCCCAAGAAGAA88.3729144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155489CCAAAATGCCCAAGAAGAATTCTTCTTGGGCATTTTGG0.579300.198700.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
469-491GTCCAAAATGCCCAAGAAGAAGCUUCUUCUUGGGCAUUUUGGACCCAAAAUGCCCAAGAAGAAGCU19.14.222


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769AGGAUGAAGAACACAGCAU79.7345538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621787AGGATGAAGAACACAGCATATGCTGTGTTCTTCATCCT0.152200.046700.689700.750001.000001.00000


Target Position: 1876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1876UUGGGGCUAUUUGUGUGUA70.95051054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881894TTGGGGCTATTTGTGTGTATACACACAAATAGCCCCAA0.407600.007500.465500.500001.000001.00000


Target Position: 2349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349UAAGUUUUGAUUAAUGUUU68.56551225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4302367TAAGTTTTGATTAATGTTTAAACATTAATCAAAACTTA0.292800.024700.534500.500001.000001.00000


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345UCUUUAAGUUUUGAUUAAU74.8094840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742363TCTTTAAGTTTTGATTAATATTAATCAAAACTTAAAGA0.468800.070100.715500.750001.000001.00000


Target Position: 1920, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GCUGAAUUACAGUGAAAUU89.3888118

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2192019GCTGAATTACAGTGAAATT1/1/0/097.75MAP2K1NM_002755.31NANANA8:29886679..29886697(+)|15:66783216..66783234(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381938GCTGAATTACAGTGAAATTAATTTCACTGTAATTCAGC0.174400.037400.844801.000000.934800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1918-1940AGGCTGAATTACAGTGAAATTTTAAUUUCACUGUAAUUCAGCCUGCUGAAUUACAGUGAAAUUUUU14.812.023


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890GUGUAUGCUGAUGAUCAAA90.623195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511908GTGTATGCTGATGATCAAATTTGATCATCAGCATACAC0.094100.038600.793100.750001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124GACUCCAUGGCCAACUCCU76.4423737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631142GACTCCATGGCCAACTCCTAGGAGTTGGCCATGGAGTC0.182500.038800.474100.500000.962000.75000


Target Position: 2156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156AUGUUAUUUUAUUAUUAUU83.1649347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4002174ATGTTATTTTATTATTATTAATAATAATAAAATAACAT0.545400.290400.646600.500001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167GUUGAGAGAGAGAGAGGAA94.816840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572185GTTGAGAGAGAGAGAGGAATTCCTCTCTCTCTCTCAAC0.496200.397200.474100.750001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951GGUAGUCAUUCUUACAAUU93.479357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501969GGTAGTCATTCTTACAATTAATTGTAAGAATGACTACC0.125600.004500.844801.000001.000001.00000


Target Position: 2357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357GAUUAAUGUUUCUUAAAUG87.1419190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932375GATTAATGTTTCTTAAATGCATTTAAGAAACATTAATC0.038400.014300.525900.500001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UAGCAUUGCUGUAAUAAAA88.6593137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311000TAGCATTGCTGTAATAAAATTTTATTACAGCAATGCTA0.651300.013200.672400.500000.978300.62500


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751GCAUUUCACCUGUGACAAA96.235528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181769GCATTTCACCTGTGACAAATTTGTCACAGGTGAAATGC0.034200.002400.853401.000001.000001.00000


Target Position: 2039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039CUUUAUUCUUGCUGGGCAU78.6479603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592057CTTTATTCTTGCTGGGCATATGCCCAGCAAGAATAAAG0.028800.019600.482800.750000.978300.62500


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807GUCAUUUUUAAUAUUACUG68.45621233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751825GTCATTTTTAATATTACTGCAGTAATATTAAAAATGAC0.625400.281400.534500.500001.000001.00000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408UAUUAAAAUGUCGGAUUUA81.087459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712426TATTAAAATGTCGGATTTATAAATCCGACATTTTAATA0.017900.011600.508600.500001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503ACCAUUUUAACCUAGAUGU67.08861319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542521ACCATTTTAACCTAGATGTACATCTAGGTTAAAATGGT0.057200.004300.646600.500001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GGGAUUCUUUGACAUUUGG68.1561253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762033GGGATTCTTTGACATTTGGCCAAATGTCAAAGAATCCC0.242600.083400.646600.500001.000001.00000


Target Position: 2582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582AGCUAAAAAAAAAAAAAAA84.8244285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2432600AGCTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAGCT0.997700.866100.853400.750001.000001.00000


Target Position: 1886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886UUGUGUGUAUGCUGAUGAU80.828472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941904TTGTGTGTATGCTGATGATATCATCAGCATACACACAA0.074100.059200.465500.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GGAGAUCAAACCCGCAAUC67.8241276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457796GGAGATCAAACCCGCAATCGATTGCGGGTTTGATCTCC0.054000.021600.689700.750000.951100.62500


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660AACUGAAGGAUGACGACUU79.7451537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505678AACTGAAGGATGACGACTTAAGTCGTCATCCTTCAGTT0.092700.014900.508600.500001.000001.00000


Target Position: 2005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2005CUGUAUUUUCGGGAUUCUU75.2468810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282023CTGTATTTTCGGGATTCTTAAGAATCCCGAAAATACAG0.065200.005900.646600.750001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669AUGACGACUUUGAGAAGAU80.3166496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566687ATGACGACTTTGAGAAGATATCTTCTCAAAGTCGTCAT0.143800.018500.474100.500001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143GAGAGUGUACAUCAUGUUA99.225412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2152161GAGAGTGTACATCATGTTATAACATGATGTACACTCTC0.279500.038200.775900.750001.000001.00000


Target Position: 1821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1821UACUGUCUUUAUUCUUAUU80.4827491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961839TACTGTCTTTATTCTTATTAATAAGAATAAAGACAGTA0.684000.587000.672400.500001.000001.00000


Target Position: 2147, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2147GUGUACAUCAUGUUAUUUU83.1759343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852165GTGTACATCATGTTATTTTAAAATAACATGATGTACAC0.394300.114400.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2145-2167GAGTGTACATCATGTTATTTTATAAAAUAACAUGAUGUACACUCGUGUACAUCAUGUUAUUUUAUU-0.320.432


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GGAACCAGAUCAUAAGGGA90.478697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496816GGAACCAGATCATAAGGGATCCCTTATGATCTGGTTCC0.053300.018700.500000.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439CCUCCAAAACUGCCCAGUG69.3241165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701457CCTCCAAAACTGCCCAGTGCACTGGGCAGTTTTGGAGG0.018000.007400.551700.750001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520AGAGCAGAUUUGAAGCAAC76.8622714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771538AGAGCAGATTTGAAGCAACGTTGCTTCAAATCTGCTCT0.016900.001200.577600.500000.983700.75000


Target Position: 2514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514CUAGAUGUUUAACAAAUCU82.4746382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2512-2534ACCTAGATGTTTAACAAATCTAAAGAUUUGUUAAACAUCUAGGUCUAGAUGUUUAACAAAUCUAAU14.820.333


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833UCUUAUUACUAUUAUUGUU80.6693480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401851TCTTATTACTATTATTGTTAACAATAATAGTAATAAGA0.572800.444200.577600.750001.000001.00000


Target Position: 980, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980GUUAGCAUUGCUGUAAUAA85.658246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411998GTTAGCATTGCTGTAATAATTATTACAGCAATGCTAAC0.222900.006500.612100.750000.978300.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
978-1000AAGTTAGCATTGCTGTAATAAAAUUAUUACAGCAAUGCUAACUUGUUAGCAUUGCUGUAAUAAAAU8.519.722


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570AAAAAGGAUGAAAGCUAAA83.1658346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062588AAAAAGGATGAAAGCTAAATTTAGCTTTCATCCTTTTT0.845400.357800.500000.500001.000001.00000


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918AGGCUGAAUUACAGUGAAA92.703162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041936AGGCTGAATTACAGTGAAATTTCACTGTAATTCAGCCT0.124700.018300.844800.750000.934800.87500


Target Position: 1727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1727CCAUGCCUGUCUCUGUUCA84.8796281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3601745CCATGCCTGTCTCTGTTCATGAACAGAGACAGGCATGG0.146100.009600.620700.750001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533AAUCUCUUAUUCUAAUAAA92.587865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652551AATCTCTTATTCTAATAAATTTATTAGAATAAGAGATT0.430100.362400.508600.500001.000001.00000


Target Position: 2289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289GGUUGUAUUUCUAUAUUUA106.5171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2882307GGTTGTATTTCTATATTTATAAATATAGAAATACAACC0.134200.072900.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2287-2309CTGGTTGTATTTCTATATTTATTUAAAUAUAGAAAUACAACCAGGGUUGUAUUUCUAUAUUUAUUU-8.014.622


Target Position: 2386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2386GAAUGUCACAAAUUGAUCA96.27127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2384-2406TTGAATGTCACAAATTGATCAAGUGAUCAAUUUGUGACAUUCAAGAAUGUCACAAAUUGAUCAAGU16.220.522


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178CUCCAGGGGACUCAUUACU68.17751252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831196CTCCAGGGGACTCATTACTAGTAATGAGTCCCCTGGAG0.119800.004000.603400.500000.967400.62500


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GGAGCACAUGGAUGGAGGU80.7484476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540922GGAGCACATGGATGGAGGTACCTCCATCCATGTGCTCC0.033200.001900.517200.750001.000001.00000


Target Position: 2447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2447CCAAUGCUGUUGUAAACAA93.397858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5652465CCAATGCTGTTGTAAACAATTGTTTACAACAGCATTGG0.036200.001400.698301.000000.989100.62500


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525ACAAAUCUAAUCUCUUAUU77.4344680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1122543ACAAATCTAATCTCTTATTAATAAGAGATTAGATTTGT0.460800.158700.698300.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801ACCAGAUCAUAAGGGAGCU68.35621242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574819ACCAGATCATAAGGGAGCTAGCTCCCTTATGATCTGGT0.017200.010400.500000.500001.000001.00000


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532UAAUCUCUUAUUCUAAUAA87.9887159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802550TAATCTCTTATTCTAATAATTATTAGAATAAGAGATTA0.438300.373300.500000.500001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437CUCCUCCAAAACUGCCCAG56.67621941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021455CTCCTCCAAAACTGCCCAGCTGGGCAGTTTTGGAGGAG0.438500.024000.525900.500001.000001.00000


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555ACUAUGAAAUAAAAAAAAA88.7991136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1082573ACTATGAAATAAAAAAAAATTTTTTTTTATTTCATAGT0.813900.546000.706900.750001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084GAUCAAGCUCUGUGACUUU91.695871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301102GATCAAGCTCTGTGACTTTAAAGTCACAGAGCTTGATC0.026600.007400.681000.750000.951100.62500


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919GGCUGAAUUACAGUGAAAU86.4898219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811937GGCTGAATTACAGTGAAATATTTCACTGTAATTCAGCC0.140900.027000.991401.000000.934800.75000


Target Position: 2466, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CGUGUAUAGUGCCUAAAAU92.656363

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6246619CGTGTATAGTGCCTAAAAT1/1/0/097.21MAP2K1NM_002755.31NANANANA00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432484CGTGTATAGTGCCTAAAATATTTTAGGCACTATACACG0.026500.001900.767201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2464-2486AACGTGTATAGTGCCTAAAATTGAUUUUAGGCACUAUACACGUUCGUGUAUAGUGCCUAAAAUUGU11.015.832


Target Position: 1649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649GGCGUCUAAGUGUUUGGGA78.8863590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761667GGCGTCTAAGTGTTTGGGATCCCAAACACTTAGACGCC0.016800.004600.629300.750001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673CGACUUUGAGAAGAUCAGU78.8422595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437691CGACTTTGAGAAGATCAGTACTGATCTTCTCAAAGTCG0.076800.004800.586200.750001.000001.00000


Target Position: 1478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478CAAGAUUUUGUGAAUAAAU88.0364157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591496CAAGATTTTGTGAATAAATATTTATTCACAAAATCTTG0.213100.009700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1476-1498TTCAAGATTTTGTGAATAAATGCAUUUAUUCACAAAAUCUUGAACAAGAUUUUGUGAAUAAAUGCU2.15.322


Target Position: 1159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159CUACAUGUCGCCAGAAAGA82.9509352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1157-1179TCCTACATGTCGCCAGAAAGACTUCUUUCUGGCGACAUGUAGGACUACAUGUCGCCAGAAAGACUU16.620.433


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148GGCACAAGGUCCUACAUGU88.4715140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571166GGCACAAGGTCCTACATGTACATGTAGGACCTTGTGCC0.056800.001500.793100.750001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477UCAAGAUUUUGUGAAUAAA83.9676311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631495TCAAGATTTTGTGAATAAATTTATTCACAAAATCTTGA0.233300.022800.724100.750001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GGCUAUUUGUGUGUAUGCU82.534374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981898GGCTATTTGTGTGTATGCTAGCATACACACAAATAGCC0.126400.076900.646600.750001.000001.00000


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409AUUAAAAUGUCGGAUUUAU75.7479789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842427ATTAAAATGTCGGATTTATATAAATCCGACATTTTAAT0.020400.010300.465500.500001.000001.00000


Target Position: 2420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2420GGAUUUAUCUUUCCCCAUA95.485335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1962438GGATTTATCTTTCCCCATATATGGGGAAAGATAAATCC0.221100.056600.827601.000000.972800.62500


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GAAAAGUUAGCAUUGCUGU79.1813568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582993GAAAAGTTAGCATTGCTGTACAGCAATGCTAACTTTTC0.208500.003800.465500.500000.978300.75000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152CGGAGGGACUGGUUGGUUG72.7025958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306170CGGAGGGACTGGTTGGTTGCAACCAACCAGTCCCTCCG0.122900.025600.767200.750001.000001.00000


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154GAGGGACUGGUUGGUUGAG67.97891263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546172GAGGGACTGGTTGGTTGAGCTCAACCAACCAGTCCCTC0.175400.048400.500000.500001.000001.00000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794AGAUUCUACUCUUGUCAUU82.4408383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851812AGATTCTACTCTTGTCATTAATGACAAGAGTAGAATCT0.136100.036500.715500.750000.994600.62500


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326GGAUACUUAGUGGUAUGUC73.9271896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902344GGATACTTAGTGGTATGTCGACATACCACTAAGTATCC0.034300.001100.551700.750000.983700.62500


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CAAGCCCUCCAACAUCCUA85.416257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641066CAAGCCCTCCAACATCCTATAGGATGTTGGAGGGCTTG0.241300.074000.474100.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GUCAGACAUCUGGAGCAUG72.4799969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791222GTCAGACATCTGGAGCATGCATGCTCCAGATGTCTGAC0.089000.003700.663800.500000.913000.75000


Target Position: 1363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363CCUUAGCUCAUACGGAAUG64.52531484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781381CCTTAGCTCATACGGAATGCATTCCGTATGAGCTAAGG0.044300.007000.689700.750001.000001.00000


Target Position: 161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
161UGGUUGGUUGAGAGAGAGA77.65672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519179TGGTTGGTTGAGAGAGAGATCTCTCTCTCAACCAACCA0.747600.123500.620700.500001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CUGAUGAUCAAAACCUGUG67.62951292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371915CTGATGATCAAAACCTGTGCACAGGTTTTGATCATCAG0.035300.011000.491400.500001.000001.00000


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198GCAGUUGACAUCCAAAUCU79.5426548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2662216GCAGTTGACATCCAAATCTAGATTTGGATGTCAACTGC0.415800.057300.629300.750000.956500.62500


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404GGCAGCGCAGCGGGAGGAA73.053946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445422GGCAGCGCAGCGGGAGGAATTCCTCCCGCTGCGCTGCC0.104300.004600.827601.000000.934800.75000


Target Position: 2204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2204GACAUCCAAAUCUAGCCAG69.23241170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132222GACATCCAAATCTAGCCAGCTGGCTAGATTTGGATGTC0.136200.111800.534500.500001.000001.00000


Target Position: 166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166GGUUGAGAGAGAGAGAGGA88.1357155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545184GGTTGAGAGAGAGAGAGGATCCTCTCTCTCTCTCAACC0.498600.339500.482800.750001.000001.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148UGUACAUCAUGUUAUUUUA92.545266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1692166TGTACATCATGTTATTTTATAAAATAACATGATGTACA0.462300.218600.672400.750001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376GGAAUGGACAGCCGACCUC66.87921335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691394GGAATGGACAGCCGACCTCGAGGTCGGCTGTCCATTCC0.018300.001400.560300.750000.929300.75000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CCAGAAGCAGAAGGUGGGA73.3938928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
590658CCAGAAGCAGAAGGTGGGATCCCACCTTCTGCTTCTGG0.013100.002800.474100.750001.000001.00000


Target Position: 1956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956UCAUUCUUACAAUUGCACU68.38111240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531974TCATTCTTACAATTGCACTAGTGCAATTGTAAGAATGA0.102500.035300.517200.500001.000001.00000


Target Position: 2141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141CAGAGAGUGUACAUCAUGU91.667173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142159CAGAGAGTGTACATCATGTACATGATGTACACTCTCTG0.272800.008700.577600.500001.000001.00000


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GACUUCUGGUUGUAUUUCU83.7121319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3422300GACTTCTGGTTGTATTTCTAGAAATACAACCAGAAGTC0.132100.011800.594800.500001.000001.00000


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081GGAGAUCAAGCUCUGUGAC76.1875750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471099GGAGATCAAGCTCTGTGACGTCACAGAGCTTGATCTCC0.035100.001700.551700.750000.967400.62500


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427UCUUUCCCCAUAUCCAAGU54.64992051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852445TCTTTCCCCATATCCAAGTACTTGGATATGGGGAAAGA0.167700.039900.517200.500001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654UGGGAGAACUGAAGGAUGA78.8766591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490672TGGGAGAACTGAAGGATGATCATCCTTCAGTTCTCCCA0.129400.038100.620700.500001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577AUGAAAGCUAAAAAAAAAA78.6308610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652595ATGAAAGCTAAAAAAAAAATTTTTTTTTTAGCTTTCAT0.995800.834700.655200.500001.000001.00000


Target Position: 2553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2553AUACUAUGAAAUAAAAAAA87.6385172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922571ATACTATGAAATAAAAAAATTTTTTTATTTCATAGTAT0.680400.542400.543100.500001.000001.00000


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GAGGGAGAAGCACAAGAUC75.1099820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431033GAGGGAGAAGCACAAGATCGATCTTGTGCTTCTCCCTC0.092800.008800.629300.500001.000001.00000


Target Position: 2355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355UUGAUUAAUGUUUCUUAAA75.7654787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542373TTGATTAATGTTTCTTAAATTTAAGAAACATTAATCAA0.029700.020900.646600.500001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366UUCUUAAAUGGAAUUAUUU71.1291043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852384TTCTTAAATGGAATTATTTAAATAATTCCATTTAAGAA0.014100.002600.672400.500001.000001.00000


Target Position: 2274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274GAUCUGUAGACUUCUGGUU82.9329354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622292GATCTGTAGACTTCTGGTTAACCAGAAGTCTACAGATC0.207200.004100.534500.750001.000001.00000


Target Position: 2379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2379UUAUUUUGAAUGUCACAAA79.8082532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512397TTATTTTGAATGTCACAAATTTGTGACATTCAAAATAA0.147800.016200.534500.500001.000001.00000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973AGGAAAAGUUAGCAUUGCU81.0093464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586991AGGAAAAGTTAGCATTGCTAGCAATGCTAACTTTTCCT0.014000.002000.491400.500000.983700.62500


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048UGCUGGGCAUACUUUCUCU76.8701713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982066TGCTGGGCATACTTTCTCTAGAGAAAGTATGCCCAGCA0.073400.007200.629300.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954GAAUUCCUGAACAAAUUUU81.0207462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
952-974AAGAATTCCTGAACAAATTTTAGAAAAUUUGUUCAGGAAUUCUUGAAUUCCUGAACAAAUUUUAGU-3.318.722


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916CCAGGCUGAAUUACAGUGA78.7365596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591934CCAGGCTGAATTACAGTGATCACTGTAATTCAGCCTGG0.095200.001500.620700.750000.934800.87500


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562AGAUCUGAUGCUGAGGAAG68.92481193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681580AGATCTGATGCTGAGGAAGCTTCCTCAGCATCAGATCT0.028300.003200.586200.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574AGGAUGAAAGCUAAAAAAA86.4247221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1282592AGGATGAAAGCTAAAAAAATTTTTTTAGCTTTCATCCT0.861500.388300.844800.750001.000001.00000


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764GACAAAGGAUGAAGAACAC79.3605555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411782GACAAAGGATGAAGAACACGTGTTCTTCATCCTTTGTC0.089900.028500.525900.500001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133AUGAGCAUCAGAGAGUGUA77.2853687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712151ATGAGCATCAGAGAGTGTATACACTCTCTGATGCTCAT0.030600.001300.474100.500001.000001.00000


Target Position: 1472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GAAUUUCAAGAUUUUGUGA89.0002132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1470-1492TGGAATTTCAAGATTTTGTGAATUCACAAAAUCUUGAAAUUCCAGAAUUUCAAGAUUUUGUGAAUU12.27.422


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721UCCUUCCCAUGCCUGUCUC50.88882221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371739TCCTTCCCATGCCTGTCTCGAGACAGGCATGGGAAGGA0.062800.039200.560300.500001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400GAUCAAGAUAUUAAAAUGU84.5165294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692418GATCAAGATATTAAAATGTACATTTTAATATCTTGATC0.211100.007000.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2398-2420TTGATCAAGATATTAAAATGTCGACAUUUUAAUAUCUUGAUCAAGAUCAAGAUAUUAAAAUGUCGU-1.420.422


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CAGUUAACGGGACCAGCUC67.48571298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570549CAGTTAACGGGACCAGCTCGAGCTGGTCCCGTTAACTG0.043200.001500.474100.500001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839UACUAUUAUUGUUCCCCUA85.3174262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971857TACTATTATTGTTCCCCTATAGGGGAACAATAATAGTA0.084800.057000.508600.500001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333UAGUGGUAUGUCUCUUUAA89.493116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722351TAGTGGTATGTCTCTTTAATTAAAGAGACATACCACTA0.046500.014200.637900.500001.000001.00000


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489UGAAAAUCCUUUUAACCAU78.6387606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632507TGAAAATCCTTTTAACCATATGGTTAAAAGGATTTTCA0.126200.095800.569000.750001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615CCUUAACCAGCCCAGCACA82.0199398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861633CCTTAACCAGCCCAGCACATGTGCTGGGCTGGTTAAGG0.016500.001100.637900.750001.000001.00000


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128UGAAAAUGAGCAUCAGAGA81.4269433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532146TGAAAATGAGCATCAGAGATCTCTGATGCTCATTTTCA0.020700.003900.500000.500001.000001.00000


Target Position: 2032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032GGUGGUACUUUAUUCUUGC74.11881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182050GGTGGTACTTTATTCTTGCGCAAGAATAAAGTACCACC0.146100.036600.500000.500001.000001.00000


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030UUGGUGGUACUUUAUUCUU66.42261369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662048TTGGTGGTACTTTATTCTTAAGAATAAAGTACCACCAA0.203500.048900.508600.500001.000001.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438UCCUCCAAAACUGCCCAGU48.93452291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931456TCCTCCAAAACTGCCCAGTACTGGGCAGTTTTGGAGGA0.306700.309400.663800.500001.000001.00000


Target Position: 2271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271GGUGAUCUGUAGACUUCUG83.097351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792289GGTGATCTGTAGACTTCTGCAGAAGTCTACAGATCACC0.016200.002700.569000.750001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CUAAGUGUUUGGGAAGCAA86.7403208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421672CTAAGTGTTTGGGAAGCAATTGCTTCCCAAACACTTAG0.102400.006600.525900.750001.000001.00000


Target Position: 2484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484UUGUAUGAAAAUCCUUUUA72.4125974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722502TTGTATGAAAATCCTTTTATAAAAGGATTTTCATACAA0.170500.072100.612100.500001.000001.00000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492AAAUCCUUUUAACCAUUUU73.9253897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852510AAATCCTTTTAACCATTTTAAAATGGTTAAAAGGATTT0.168000.098300.500000.500001.000001.00000


Target Position: 1827, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827CUUUAUUCUUAUUACUAUU88.1324156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2591845CTTTATTCTTATTACTATTAATAGTAATAAGAATAAAG0.638900.550500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1825-1847GTCTTTATTCTTATTACTATTATAAUAGUAAUAAGAAUAAAGACCUUUAUUCUUAUUACUAUUAUU6.32.121


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005UGACAUAUCUGAGGGAGAA85.8004242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631023TGACATATCTGAGGGAGAATTCTCCCTCAGATATGTCA0.059800.004100.551700.750001.000001.00000


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530UCUAAUCUCUUAUUCUAAU79.8347530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1062548TCTAATCTCTTATTCTAATATTAGAATAAGAGATTAGA0.431800.156000.715500.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AGAAGCAGAAGGUGGGAGA76.0426766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546660AGAAGCAGAAGGTGGGAGATCTCCCACCTTCTGCTTCT0.021500.004700.500000.500001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156GGGACUGGUUGGUUGAGAG81.253447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184174GGGACTGGTTGGTTGAGAGCTCTCAACCAACCAGTCCC0.280200.051900.681000.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889UGUGUAUGCUGAUGAUCAA93.613555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741907TGTGTATGCTGATGATCAATTGATCATCAGCATACACA0.090300.040800.560300.750001.000001.00000


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812UUUUAAUAUUACUGUCUUU77.8951656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931830TTTTAATATTACTGTCTTTAAAGACAGTAATATTAAAA0.751400.548900.500000.500001.000001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516AGAUGUUUAACAAAUCUAA93.734452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2112534AGATGTTTAACAAATCTAATTAGATTTGTTAAACATCT0.353900.039000.689700.750001.000001.00000


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959CCUGAACAAAUUUUAGGAA87.2587186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552977CCTGAACAAATTTTAGGAATTCCTAAAATTTGTTCAGG0.020900.005300.672401.000001.000001.00000


Target Position: 2390, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2390GUCACAAAUUGAUCAAGAU91.084982

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2388-2410ATGTCACAAATTGATCAAGATATAUCUUGAUCAAUUUGUGACAUGUCACAAAUUGAUCAAGAUAUU20.420.532


Target Position: 2290, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2290GUUGUAUUUCUAUAUUUAU90.0416103

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10229019GTTGTATTTCTATATTTAT1/1/0/093.97MAP2K1NM_002755.31NANANA15:66783586..66783604(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162308GTTGTATTTCTATATTTATATAAATATAGAAATACAAC0.147800.077300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2288-2310TGGTTGTATTTCTATATTTATTTAUAAAUAUAGAAAUACAACCAGUUGUAUUUCUAUAUUUAUUUU-8.06.922


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650GCGUCUAAGUGUUUGGGAA94.15746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681668GCGTCTAAGTGTTTGGGAATTCCCAAACACTTAGACGC0.018300.004700.750001.000001.000001.00000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GCCCAGCACACCAACCCAU75.7803786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791642GCCCAGCACACCAACCCATATGGGTTGGTGTGCTGGGC0.142000.034400.844801.000000.951100.62500


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GCGGGCAGCUCAUCGACUC67.72111284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491128GCGGGCAGCTCATCGACTCGAGTCGATGAGCTGCCCGC0.056200.001600.612100.750000.994600.62500


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045UCUUGCUGGGCAUACUUUC55.81988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922063TCTTGCTGGGCATACTTTCGAAAGTATGCCCAGCAAGA0.174200.007400.551700.500000.978300.87500


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530GCAGUUAACGGGACCAGCU77.7294670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500548GCAGTTAACGGGACCAGCTAGCTGGTCCCGTTAACTGC0.263400.003800.500000.750001.000001.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575GGAUGAAAGCUAAAAAAAA101.5143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412593GGATGAAAGCTAAAAAAAATTTTTTTTAGCTTTCATCC0.994400.416700.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2573-2595AAGGATGAAAGCTAAAAAAAAAAUUUUUUUUAGCUUUCAUCCUUGGAUGAAAGCUAAAAAAAAAAU-11.316.312


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557UCAAGAGAUCUGAUGCUGA83.2992339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881575TCAAGAGATCTGATGCTGATCAGCATCAGATCTCTTGA0.102900.019700.500000.500001.000001.00000


Target Position: 2142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142AGAGAGUGUACAUCAUGUU84.2117301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3352160AGAGAGTGTACATCATGTTAACATGATGTACACTCTCT0.267000.014500.577600.750001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UAAAUAUACUAUGAAAUAA91.149180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022566TAAATATACTATGAAATAATTATTTCATAGTATATTTA0.552800.493500.500000.500001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145GAGUGUACAUCAUGUUAUU96.232629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2632163GAGTGTACATCATGTTATTAATAACATGATGTACACTC0.319600.052400.801700.750001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519CCGACGGCUCUGCAGUUAA85.3972259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578537CCGACGGCTCTGCAGTTAATTAACTGCAGAGCCGTCGG0.049400.001200.879301.000001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506AUUUUAACCUAGAUGUUUA91.045985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742524ATTTTAACCTAGATGTTTATAAACATCTAGGTTAAAAT0.035500.005300.474100.500001.000001.00000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563GAUCUGAUGCUGAGGAAGU81.9612399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681581GATCTGATGCTGAGGAAGTACTTCCTCAGCATCAGATC0.019000.002600.474100.500001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534AUCUCUUAUUCUAAUAAAU83.6023324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932552ATCTCTTATTCTAATAAATATTTATTAGAATAAGAGAT0.533500.352700.672400.500001.000001.00000


Target Position: 2507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507UUUUAACCUAGAUGUUUAA78.2143639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892525TTTTAACCTAGATGTTTAATTAAACATCTAGGTTAAAA0.038500.005500.465500.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UGCUGGCGUCUAAGUGUUU71.86841004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641663TGCTGGCGTCTAAGTGTTTAAACACTTAGACGCCAGCA0.147600.001400.853400.750001.000001.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671GACGACUUUGAGAAGAUCA88.99133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438689GACGACTTTGAGAAGATCATGATCTTCTCAAAGTCGTC0.159300.016300.594800.500001.000001.00000


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004CUGACAUAUCUGAGGGAGA85.0886272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891022CTGACATATCTGAGGGAGATCTCCCTCAGATATGTCAG0.054700.003200.560300.500001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981UUAGCAUUGCUGUAAUAAA85.4525256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409999TTAGCATTGCTGTAATAAATTTATTACAGCAATGCTAA0.711000.008100.534500.500000.978300.75000


Target Position: 1722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722CCUUCCCAUGCCUGUCUCU71.90391002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361740CCTTCCCATGCCTGTCTCTAGAGACAGGCATGGGAAGG0.062900.030100.620700.750001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771GAUGAAGAACACAGCAUGU87.0797192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751789GATGAAGAACACAGCATGTACATGCTGTGTTCTTCATC0.021700.004300.474100.500001.000001.00000


Target Position: 2346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346CUUUAAGUUUUGAUUAAUG76.4338739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542364CTTTAAGTTTTGATTAATGCATTAATCAAAACTTAAAG0.368700.044200.482800.500001.000001.00000


Target Position: 1014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1014UGAGGGAGAAGCACAAGAU80.4869489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201032TGAGGGAGAAGCACAAGATATCTTGTGCTTCTCCCTCA0.076000.005800.543100.750001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550GCUUUUAUCAAGAGAUCUG76.0819757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031568GCTTTTATCAAGAGATCTGCAGATCTCTTGATAAAAGC0.061900.002900.569000.750000.967400.87500


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396AAUUGAUCAAGAUAUUAAA94.564342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172414AATTGATCAAGATATTAAATTTAATATCTTGATCAATT0.037600.007700.508600.500001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983AGCAUUGCUGUAAUAAAAG67.69921287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841001AGCATTGCTGTAATAAAAGCTTTTATTACAGCAATGCT0.343200.121900.715500.500001.000001.00000


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834CUUAUUACUAUUAUUGUUC67.43661301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921852CTTATTACTATTATTGTTCGAACAATAATAGTAATAAG0.543200.420000.465500.500001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571AAAAGGAUGAAAGCUAAAA79.8392529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902589AAAAGGATGAAAGCTAAAATTTTAGCTTTCATCCTTTT0.849500.358900.500000.500001.000001.00000


Target Position: 2455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455GUUGUAAACAACGUGUAUA88.5329139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2453-2475CTGTTGTAAACAACGTGTATAGTUAUACACGUUGUUUACAACAGGUUGUAAACAACGUGUAUAGUU21.07.233


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483UUUUGUGAAUAAAUGCUUA81.7556414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981501TTTTGTGAATAAATGCTTATAAGCATTTATTCACAAAA0.462200.101800.465500.500001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282GGAGCUGGAGCUGAUGUUU81.2716445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611300GGAGCTGGAGCTGATGTTTAAACATCAGCTCCAGCTCC0.065900.001400.870701.000000.945700.75000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177ACUCCAGGGGACUCAUUAC69.36581163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831195ACTCCAGGGGACTCATTACGTAATGAGTCCCCTGGAGT0.093500.001200.525900.500000.951100.62500


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CAAAAUGCCCAAGAAGAAG67.89141271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471490CAAAATGCCCAAGAAGAAGCTTCTTCTTGGGCATTTTG0.247100.106900.508600.500001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470UGGAAUUUCAAGAUUUUGU66.5871360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191488TGGAATTTCAAGATTTTGTACAAAATCTTGAAATTCCA0.030100.016600.637900.500001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352GUUUUGAUUAAUGUUUCUU74.3289870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682370GTTTTGATTAATGTTTCTTAAGAAACATTAATCAAAAC0.049700.037600.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2350-2372AAGTTTTGATTAATGTTTCTTAAAAGAAACAUUAAUCAAAACUUGUUUUGAUUAAUGUUUCUUAAU19.27.421


Target Position: 951, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951GAAGAAUUCCUGAACAAAU92.652364

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_895119GAAGAATTCCTGAACAAAT1/1/0/094.96MAP2K1NM_002755.31NANANA8:29885709..29885727(+)|15:66735655..66735673(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
548969GAAGAATTCCTGAACAAATATTTGTTCAGGAATTCTTC0.096900.001700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971TGGAAGAATTCCTGAACAAATTTAUUUGUUCAGGAAUUCUUCCAGAAGAAUUCCUGAACAAAUUUU14.95.322


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491AAAAUCCUUUUAACCAUUU70.04641119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862509AAAATCCTTTTAACCATTTAAATGGTTAAAAGGATTTT0.147500.096400.500000.500001.000001.00000


Target Position: 1820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820UUACUGUCUUUAUUCUUAU76.5345732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321838TTACTGTCTTTATTCTTATATAAGAATAAAGACAGTAA0.697400.596500.491400.500001.000001.00000


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032UCAUGCACAGAGAUGUCAA86.2215228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951050TCATGCACAGAGATGTCAATTGACATCTCTGTGCATGA0.012000.001300.577600.750001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GACUGGUUGGUUGAGAGAG71.24781039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595176GACTGGTTGGTTGAGAGAGCTCTCTCAACCAACCAGTC0.611900.067600.508600.500001.000001.00000


Target Position: 2475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475UGCCUAAAAUUGUAUGAAA89.0257128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2592493TGCCTAAAATTGTATGAAATTTCATACAATTTTAGGCA0.208000.165200.853400.750001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756UGGCCAGAAAGCUAAUUCA81.7843411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553774TGGCCAGAAAGCTAATTCATGAATTAGCTTTCTGGCCA0.298100.001500.620700.500000.902200.75000


Target Position: 2380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380UAUUUUGAAUGUCACAAAU77.8798658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982398TATTTTGAATGTCACAAATATTTGTGACATTCAAAATA0.180500.020000.534500.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488UGAAUAAAUGCUUAAUAAA89.2566121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391506TGAATAAATGCTTAATAAATTTATTAAGCATTTATTCA0.622300.359200.724100.750001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UGUGCUUGGGGCUAUUUGU67.85151274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231889TGTGCTTGGGGCTATTTGTACAAATAGCCCCAAGCACA0.235800.002400.500000.500000.989100.87500


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858GCUUCUAUGGUGCGUUCUA89.825110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537876GCTTCTATGGTGCGTTCTATAGAACGCACCATAGAAGC0.024700.002000.681001.000001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899UGCAUGGAGCACAUGGAUG62.811584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528917TGCATGGAGCACATGGATGCATCCATGTGCTCCATGCA0.082200.002300.698300.500000.913000.62500


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GCGAUGGCGAGAUCAGUAU79.4417552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560897GCGATGGCGAGATCAGTATATACTGATCTCGCCATCGC0.019400.001800.879301.000001.000001.00000


Target Position: 2050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2050CUGGGCAUACUUUCUCUCU74.0397884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582068CTGGGCATACTTTCTCTCTAGAGAGAAAGTATGCCCAG0.019900.005100.560300.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546AAUAAAUAUACUAUGAAAU84.0521308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052564AATAAATATACTATGAAATATTTCATAGTATATTTATT0.553700.470200.500000.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013CUGAGGGAGAAGCACAAGA79.1064573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071031CTGAGGGAGAAGCACAAGATCTTGTGCTTCTCCCTCAG0.176000.007200.560300.500001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374UGGAAUUAUUUUGAAUGUC59.6821767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342392TGGAATTATTTTGAATGTCGACATTCAAAATAATTCCA0.059200.004100.525900.500001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813UUUAAUAUUACUGUCUUUA73.0994941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831831TTTAATATTACTGTCTTTATAAAGACAGTAATATTAAA0.748900.554000.465500.500001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445CGGAGUUGGAAGCGCGUUA82.4755381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388463CGGAGTTGGAAGCGCGTTATAACGCGCTTCCAACTCCG0.077900.010100.879301.000001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365UUUCUUAAAUGGAAUUAUU74.0009889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982383TTTCTTAAATGGAATTATTAATAATTCCATTTAAGAAA0.011800.002400.491400.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978AAGUUAGCAUUGCUGUAAU83.6899322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566996AAGTTAGCATTGCTGTAATATTACAGCAATGCTAACTT0.220700.004000.629300.500000.978301.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UGGAUUACAUAGUCAACGA83.9339312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501434TGGATTACATAGTCAACGATCGTTGACTATGTAATCCA0.021200.011400.551700.500001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476UUCAAGAUUUUGUGAAUAA81.0199463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431494TTCAAGATTTTGTGAATAATTATTCACAAAATCTTGAA0.225100.018800.637900.500001.000001.00000


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725UCCCAUGCCUGUCUCUGUU67.97471264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541743TCCCATGCCTGTCTCTGTTAACAGAGACAGGCATGGGA0.287200.010200.724100.750001.000001.00000


Target Position: 2544, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544CUAAUAAAUAUACUAUGAA95.588234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072562CTAATAAATATACTATGAATTCATAGTATATTTATTAG0.613800.469300.500000.750000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2542-2564TTCTAATAAATATACTATGAAATUUCAUAGUAUAUUUAUUAGAACUAAUAAAUAUACUAUGAAAUU20.3-7.522


Target Position: 2537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537UCUUAUUCUAAUAAAUAUA86.1017230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2482555TCTTATTCTAATAAATATATATATTTATTAGAATAAGA0.688000.342200.681000.750001.000001.00000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765ACAAAGGAUGAAGAACACA78.5431614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111783ACAAAGGATGAAGAACACATGTGTTCTTCATCCTTTGT0.112200.032400.500000.500001.000001.00000


Target Position: 12, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12CCCCUUCCCCGCCCCUCCC36.86062525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
55330CCCCTTCCCCGCCCCTCCCGGGAGGGGCGGGGAAGGGG0.186800.221100.500000.500001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337GGUAUGUCUCUUUAAGUUU87.0267193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2922355GGTATGTCTCTTTAAGTTTAAACTTAAAGAGACATACC0.192200.018500.853401.000001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974GGAAAAGUUAGCAUUGCUG75.7926783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567992GGAAAAGTTAGCATTGCTGCAGCAATGCTAACTTTTCC0.018500.002600.586200.750000.978300.62500


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082GAGAUCAAGCUCUGUGACU81.0288461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961100GAGATCAAGCTCTGTGACTAGTCACAGAGCTTGATCTC0.037400.017200.603400.500000.978300.62500


Target Position: 965, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965CAAAUUUUAGGAAAAGUUA89.713112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527983CAAATTTTAGGAAAAGTTATAACTTTTCCTAAAATTTG0.028000.002300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
963-985AACAAATTTTAGGAAAAGTTAGCUAACUUUUCCUAAAAUUUGUUCAAAUUUUAGGAAAAGUUAGCU3.2-12.022


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149GCACAAGGUCCUACAUGUC76.9111710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751167GCACAAGGTCCTACATGTCGACATGTAGGACCTTGTGC0.050800.001300.534500.750001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872GUGCUUGGGGCUAUUUGUG64.68781476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831890GTGCTTGGGGCTATTTGTGCACAAATAGCCCCAAGCAC0.258900.003700.500000.500000.989100.75000


Target Position: 2519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2519UGUUUAACAAAUCUAAUCU74.6596851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492537TGTTTAACAAATCTAATCTAGATTAGATTTGTTAAACA0.368200.113700.482800.500001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547AUAAAUAUACUAUGAAAUA90.879588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982565ATAAATATACTATGAAATATATTTCATAGTATATTTAT0.554300.473600.500000.500001.000001.00000


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784GCAUGUGCCAAGAUUCUAC78.4582621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921802GCATGTGCCAAGATTCTACGTAGAATCTTGGCACATGC0.048700.003200.672400.750001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653GUGGGAGAACUGAAGGAUG73.9252898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490671GTGGGAGAACTGAAGGATGCATCCTTCAGTTCTCCCAC0.131700.003200.637900.500001.000001.00000


Target Position: 2531, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531CUAAUCUCUUAUUCUAAUA91.684772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572549CTAATCTCTTATTCTAATATATTAGAATAAGAGATTAG0.426000.382700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2529-2551ATCTAATCTCTTATTCTAATAAAUAUUAGAAUAAGAGAUUAGAUCUAAUCUCUUAUUCUAAUAAAU6.916.022


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670UGACGACUUUGAGAAGAUC68.32181244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471688TGACGACTTTGAGAAGATCGATCTTCTCAAAGTCGTCA0.148200.014600.543100.500000.994600.62500


Target Position: 1942, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942GUGAAUGUGGGUAGUCAUU78.7125598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761960GTGAATGTGGGTAGTCATTAATGACTACCCACATTCAC0.517600.001200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1940-1962TGGTGAATGTGGGTAGTCATTCTAAUGACUACCCACAUUCACCAGUGAAUGUGGGUAGUCAUUCUU20.320.523


Target Position: 2221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2221AGAGCCCUUCACUGCCAUG65.7921412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742239AGAGCCCTTCACTGCCATGCATGGCAGTGAAGGGCTCT0.045900.001300.569000.500000.923900.62500


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521GAGCAGAUUUGAAGCAACU85.9663235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881539GAGCAGATTTGAAGCAACTAGTTGCTTCAAATCTGCTC0.019400.001100.603400.500000.983700.75000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977AAAGUUAGCAUUGCUGUAA80.2158499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
596995AAAGTTAGCATTGCTGTAATTACAGCAATGCTAACTTT0.191100.003600.465500.500000.978301.00000


Target Position: 2556, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556CUAUGAAAUAAAAAAAAAA93.987449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1682574CTATGAAATAAAAAAAAAATTTTTTTTTTATTTCATAG0.511600.262700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2554-2576TACTATGAAATAAAAAAAAAAGGUUUUUUUUUUAUUUCAUAGUACUAUGAAAUAAAAAAAAAAGGU-11.38.901


Target Position: 1830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830UAUUCUUAUUACUAUUAUU88.289148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171848TATTCTTATTACTATTATTAATAATAGTAATAAGAATA0.734000.562100.534500.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390ACCUCCCAUGGCAAUUUUU67.06221324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421408ACCTCCCATGGCAATTTTTAAAAATTGCCATGGGAGGT0.073800.004700.853400.750000.913000.62500


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578UGAAAGCUAAAAAAAAAAA78.2141640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882596TGAAAGCTAAAAAAAAAAATTTTTTTTTTTAGCTTTCA0.995800.838800.724100.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398UUGAUCAAGAUAUUAAAAU66.76241343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4492416TTGATCAAGATATTAAAATATTTTAATATCTTGATCAA0.071700.004500.637900.500001.000001.00000


Target Position: 2191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2191GAACUCAGCAGUUGACAUC74.2515873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422209GAACTCAGCAGTTGACATCGATGTCAACTGCTGAGTTC0.125000.003500.491400.500000.934800.62500


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196CAGCAGUUGACAUCCAAAU82.5815371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3322214CAGCAGTTGACATCCAAATATTTGGATGTCAACTGCTG0.412600.013400.775900.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CCAUUUUAACCUAGAUGUU82.113393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662522CCATTTTAACCTAGATGTTAACATCTAGGTTAAAATGG0.049700.004600.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2502-2524AACCATTTTAACCTAGATGTTTAAACAUCUAGGUUAAAAUGGUUCCAUUUUAACCUAGAUGUUUAU20.3-1.423


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GGAUGACGACUUUGAGAAG84.3663300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331685GGATGACGACTTTGAGAAGCTTCTCAAAGTCGTCATCC0.105800.043900.732800.750001.000001.00000


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014CGGGAUUCUUUGACAUUUG74.9593828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2302032CGGGATTCTTTGACATTTGCAAATGTCAAAGAATCCCG0.273600.033900.767200.750001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469GUCCAAAAUGCCCAAGAAG69.18941175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
367487GTCCAAAATGCCCAAGAAGCTTCTTGGGCATTTTGGAC0.382300.200400.681000.500001.000001.00000


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353UUUUGAUUAAUGUUUCUUA81.2606446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872371TTTTGATTAATGTTTCTTATAAGAAACATTAATCAAAA0.041600.030600.465500.500001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852CCCCUAAGUGGAUUGGCUU75.1006821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721870CCCCTAAGTGGATTGGCTTAAGCCAATCCACTTAGGGG0.089400.001300.853401.000000.956500.75000


Target Position: 1783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1783AGCAUGUGCCAAGAUUCUA82.5295375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721801AGCATGTGCCAAGATTCTATAGAATCTTGGCACATGCT0.051300.004000.681000.750000.940200.62500


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160CUGGUUGGUUGAGAGAGAG68.51211229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576178CTGGTTGGTTGAGAGAGAGCTCTCTCTCAACCAACCAG0.753400.099900.474100.500001.000001.00000


Target Position: 2471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471AUAGUGCCUAAAAUUGUAU74.0039887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872489ATAGTGCCTAAAATTGTATATACAATTTTAGGCACTAT0.242000.014600.500000.500001.000001.00000


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024UGACAUUUGGUGGUACUUU71.6741014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2242042TGACATTTGGTGGTACTTTAAAGTACCACCAAATGTCA0.311900.177500.724100.750001.000001.00000


Target Position: 2276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276UCUGUAGACUUCUGGUUGU70.38981093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702294TCTGTAGACTTCTGGTTGTACAACCAGAAGTCTACAGA0.122200.004000.517200.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332UUAGUGGUAUGUCUCUUUA81.1357457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492350TTAGTGGTATGTCTCTTTATAAAGAGACATACCACTAA0.042900.014000.500000.500001.000001.00000


Target Position: 2551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2551AUAUACUAUGAAAUAAAAA87.3427183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3892569ATATACTATGAAATAAAAATTTTTATTTCATAGTATAT0.636000.525500.543100.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UGUUGGAUUACAUAGUCAA88.446142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831431TGTTGGATTACATAGTCAATTGACTATGTAATCCAACA0.194500.007800.560300.750001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178UGCUUUUCAUGUAGAACUC64.4351490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172196TGCTTTTCATGTAGAACTCGAGTTCTACATGAAAAGCA0.106400.013600.543100.500001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993UAAUAAAAGGCCUGACAUA88.1555153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311011TAATAAAAGGCCTGACATATATGTCAGGCCTTTTATTA0.071400.024200.491400.500001.000001.00000


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409GAGUUGUUGGAUUACAUAG81.2037450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941427GAGTTGTTGGATTACATAGCTATGTAATCCAACAACTC0.355900.001000.637900.500001.000001.00000


Target Position: 1874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874GCUUGGGGCUAUUUGUGUG75.137817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071892GCTTGGGGCTATTTGTGTGCACACAAATAGCCCCAAGC0.337000.006800.560300.750001.000001.00000


Target Position: 1481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481GAUUUUGUGAAUAAAUGCU78.3053632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1479-1501AAGATTTTGTGAATAAATGCTTAAGCAUUUAUUCACAAAAUCUUGAUUUUGUGAAUAAAUGCUUAU15.35.322


Target Position: 1489, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489GAAUAAAUGCUUAAUAAAA101.4055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611507GAATAAATGCTTAATAAAATTTTATTAAGCATTTATTC0.647300.364300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1487-1509GTGAATAAATGCTTAATAAAAAAUUUUAUUAAGCAUUUAUUCACGAAUAAAUGCUUAAUAAAAAAU-7.5-10.311


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128CCAUGGCCAACUCCUUCGU65.61651421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191146CCATGGCCAACTCCTTCGTACGAAGGAGTTGGCCATGG0.068200.002400.569000.750000.962001.00000


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157GGACUGGUUGGUUGAGAGA86.9831198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294175GGACTGGTTGGTTGAGAGATCTCTCAACCAACCAGTCC0.536500.056900.646600.750001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCCAAAAUGCCCAAGAAGA70.79131062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354488TCCAAAATGCCCAAGAAGATCTTCTTGGGCATTTTGGA0.435300.223800.646600.500001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512ACCUAGAUGUUUAACAAAU81.2452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632530ACCTAGATGTTTAACAAATATTTGTTAAACATCTAGGT0.155100.009300.844800.750001.000001.00000


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305GCCAGGUGGAAGGAGAUGC55.17992025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741323GCCAGGTGGAAGGAGATGCGCATCTCCTTCCACCTGGC0.100100.001400.646600.500000.978300.75000


Target Position: 2468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468UGUAUAGUGCCUAAAAUUG67.80311279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5032486TGTATAGTGCCTAAAATTGCAATTTTAGGCACTATACA0.267900.003000.560300.500001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796AUUCUACUCUUGUCAUUUU80.5594484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481814ATTCTACTCTTGTCATTTTAAAATGACAAGAGTAGAAT0.180000.063900.508600.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417GGAUUACAUAGUCAACGAG82.6674368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841435GGATTACATAGTCAACGAGCTCGTTGACTATGTAATCC0.015200.012100.560300.750001.000001.00000


Target Position: 2139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139AUCAGAGAGUGUACAUCAU83.5009328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4382157ATCAGAGAGTGTACATCATATGATGTACACTCTCTGAT0.144100.006900.525900.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991UGUAAUAAAAGGCCUGACA75.5147801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031009TGTAATAAAAGGCCTGACATGTCAGGCCTTTTATTACA0.040300.022800.500000.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CCUACAUGUCGCCAGAAAG75.5461798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701176CCTACATGTCGCCAGAAAGCTTTCTGGCGACATGTAGG0.047900.004300.706900.750000.989100.62500


Target Position: 2140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140UCAGAGAGUGUACAUCAUG68.39821238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3842158TCAGAGAGTGTACATCATGCATGATGTACACTCTCTGA0.264800.007700.569000.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989GCUGUAAUAAAAGGCCUGA78.6374608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801007GCTGTAATAAAAGGCCTGATCAGGCCTTTTATTACAGC0.043300.020200.629300.750001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826UCUUUAUUCUUAUUACUAU84.7282287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461844TCTTTATTCTTATTACTATATAGTAATAAGAATAAAGA0.643000.561400.681000.750001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125ACUCCAUGGCCAACUCCUU73.4583924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081143ACTCCATGGCCAACTCCTTAAGGAGTTGGCCATGGAGT0.126100.006700.569000.750000.962000.75000


Target Position: 1921, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921CUGAAUUACAGUGAAAUUU74.0012888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581939CTGAATTACAGTGAAATTTAAATTTCACTGTAATTCAG0.260900.050300.784500.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1919-1941GGCTGAATTACAGTGAAATTTTGAAAUUUCACUGUAAUUCAGCCCUGAAUUACAGUGAAAUUUUGU7.48.922


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GAGAGCAGAUUUGAAGCAA90.836989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221537GAGAGCAGATTTGAAGCAATTGCTTCAAATCTGCTCTC0.029600.003400.663800.750000.983700.75000


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525GCUCUGCAGUUAACGGGAC67.53441296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591543GCTCTGCAGTTAACGGGACGTCCCGTTAACTGCAGAGC0.331800.001100.534500.750001.000001.00000


Target Position: 2579, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579GAAAGCUAAAAAAAAAAAA86.6674211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1582597GAAAGCTAAAAAAAAAAAATTTTTTTTTTTTAGCTTTC0.996000.846000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2577-2599ATGAAAGCTAAAAAAAAAAAAAAUUUUUUUUUUUUAGCUUUCAUGAAAGCUAAAAAAAAAAAAAAU-11.318.301


Target Position: 2004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2004CCUGUAUUUUCGGGAUUCU74.3458867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002022CCTGTATTTTCGGGATTCTAGAATCCCGAAAATACAGG0.043700.003000.620700.750001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891UGUAUGCUGAUGAUCAAAA83.852315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691909TGTATGCTGATGATCAAAATTTTGATCATCAGCATACA0.086200.033900.706900.750001.000001.00000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634UCUUACCCAGAAGCAGAAG51.69342197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351652TCTTACCCAGAAGCAGAAGCTTCTGCTTCTGGGTAAGA0.426100.023500.586200.500000.962000.87500


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UGUUCAGUCUGGAAUUUCA90.0359104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871479TGTTCAGTCTGGAATTTCATGAAATTCCAGACTGAACA0.182500.001100.482800.500001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829UUAUUCUUAUUACUAUUAU75.2364813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341847TTATTCTTATTACTATTATATAATAGTAATAAGAATAA0.656700.561200.491400.500001.000001.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016AGGGAGAAGCACAAGAUCA87.8231165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131034AGGGAGAAGCACAAGATCATGATCTTGTGCTTCTCCCT0.287700.020000.620700.500001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465CAGUCUGGAAUUUCAAGAU86.2829226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971483CAGTCTGGAATTTCAAGATATCTTGAAATTCCAGACTG0.096000.007200.603400.750001.000001.00000


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802CUCUUGUCAUUUUUAAUAU84.7936286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171820CTCTTGTCATTTTTAATATATATTAAAAATGACAAGAG0.629500.091900.767200.750001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759CCUGUGACAAAGGAUGAAG67.77691281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951777CCTGTGACAAAGGATGAAGCTTCATCCTTTGTCACAGG0.116800.007300.706900.750001.000001.00000


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535UCUCUUAUUCUAAUAAAUA87.3441182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612553TCTCTTATTCTAATAAATATATTTATTAGAATAAGAGA0.692400.348700.681000.750001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018GGAGAAGCACAAGAUCAUG79.2056567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621036GGAGAAGCACAAGATCATGCATGATCTTGTGCTTCTCC0.051200.016400.715500.750001.000001.00000


Target Position: 2554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554UACUAUGAAAUAAAAAAAA81.6344421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4212572TACTATGAAATAAAAAAAATTTTTTTTATTTCATAGTA0.696000.545300.681000.500001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UGUGUGUAUGCUGAUGAUC60.9311710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241905TGTGTGTATGCTGATGATCGATCATCAGCATACACACA0.077800.046500.525900.500001.000001.00000


Target Position: 2476, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2476GCCUAAAAUUGUAUGAAAA97.648118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2082494GCCTAAAATTGTATGAAAATTTTCATACAATTTTAGGC0.208100.152901.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2474-2496GTGCCTAAAATTGTATGAAAATCUUUUCAUACAAUUUUAGGCACGCCUAAAAUUGUAUGAAAAUCU8.911.022


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549AAAUAUACUAUGAAAUAAA95.988132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892567AAATATACTATGAAATAAATTTATTTCATAGTATATTT0.574400.496100.500000.500001.000001.00000


Target Position: 2270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2270UGGUGAUCUGUAGACUUCU73.9137899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792288TGGTGATCTGTAGACTTCTAGAAGTCTACAGATCACCA0.018800.001500.620700.500001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012UCUGAGGGAGAAGCACAAG57.57591886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311030TCTGAGGGAGAAGCACAAGCTTGTGCTTCTCCCTCAGA0.169900.007700.586200.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881GCUAUUUGUGUGUAUGCUG74.9377831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581899GCTATTTGTGTGTATGCTGCAGCATACACACAAATAGC0.125800.068000.569000.750001.000001.00000


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281AGACUUCUGGUUGUAUUUC63.01081566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4452299AGACTTCTGGTTGTATTTCGAAATACAACCAGAAGTCT0.154600.007400.551700.500001.000001.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490GAAAAUCCUUUUAACCAUU84.4326298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942508GAAAATCCTTTTAACCATTAATGGTTAAAAGGATTTTC0.130400.095800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2488-2510ATGAAAATCCTTTTAACCATTTTAAUGGUUAAAAGGAUUUUCAUGAAAAUCCUUUUAACCAUUUUU20.014.222


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494AUCCUUUUAACCAUUUUAA77.6565671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4732512ATCCTTTTAACCATTTTAATTAAAATGGTTAAAAGGAT0.193500.108200.646600.500001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970GCACUGCUGUUCCUGCUCC66.8151340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911988GCACTGCTGTTCCTGCTCCGGAGCAGGAACAGCAGTGC0.081000.007900.482800.500000.978300.87500


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UGCUGAUGAUCAAAACCUG73.2516937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451913TGCTGATGATCAAAACCTGCAGGTTTTGATCATCAGCA0.057700.020000.569000.500001.000001.00000


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367UCUUAAAUGGAAUUAUUUU75.9628772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292385TCTTAAATGGAATTATTTTAAAATAATTCCATTTAAGA0.026600.002400.724100.750001.000001.00000


Target Position: 1819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819AUUACUGUCUUUAUUCUUA87.1862188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611837ATTACTGTCTTTATTCTTATAAGAATAAAGACAGTAAT0.696700.581000.474100.500001.000001.00000


Target Position: 2330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330ACUUAGUGGUAUGUCUCUU77.7538668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282348ACTTAGTGGTATGTCTCTTAAGAGACATACCACTAAGT0.027500.014500.569000.750001.000001.00000


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151ACAUCAUGUUAUUUUAUUA98.107814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1632169ACATCATGTTATTTTATTATAATAAAATAACATGATGT0.510600.223600.672400.750001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371AAAUGGAAUUAUUUUGAAU86.3836224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712389AAATGGAATTATTTTGAATATTCAAAATAATTCCATTT0.050100.004200.491400.500001.000001.00000


Target Position: 2473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2473AGUGCCUAAAAUUGUAUGA76.7691721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462491AGTGCCTAAAATTGTATGATCATACAATTTTAGGCACT0.219800.017100.482800.500001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466AGUCUGGAAUUUCAAGAUU78.8663593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841484AGTCTGGAATTTCAAGATTAATCTTGAAATTCCAGACT0.041200.007600.698300.750001.000001.00000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331CUUAGUGGUAUGUCUCUUU81.8946403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4972349CTTAGTGGTATGTCTCTTTAAAGAGACATACCACTAAG0.037200.013800.637900.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719GUGUUCAAGGUCUCCCACA82.1155392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366737GTGTTCAAGGTCTCCCACATGTGGGAGACCTTGAACAC0.086900.021800.586200.500000.923900.87500


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760CUGUGACAAAGGAUGAAGA87.5219177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991778CTGTGACAAAGGATGAAGATCTTCATCCTTTGTCACAG0.127800.014500.560300.500001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044UUCUUGCUGGGCAUACUUU65.81481411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642062TTCTTGCTGGGCATACTTTAAAGTATGCCCAGCAAGAA0.202400.007800.672400.500000.978301.00000


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223AGCCCUUCACUGCCAUGAU76.3067745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4952241AGCCCTTCACTGCCATGATATCATGGCAGTGAAGGGCT0.096100.003100.672400.750000.918500.62500


Target Position: 1429, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429CAACGAGCCUCCUCCAAAA95.969833

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1142919CAACGAGCCTCCTCCAAAA1/1/0/0100.00MAP2K1NM_002755.31NANANA8:29886189..29886207(+)00MAP2K1(0.002)


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026ACAAGAUCAUGCACAGAGA89.2317123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891044ACAAGATCATGCACAGAGATCTCTGTGCATGATCTTGT0.013500.005500.482800.500000.994600.62500


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394CCCAUGGCAAUUUUUGAGU62.99451569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821412CCCATGGCAATTTTTGAGTACTCAAAAATTGCCATGGG0.066600.003600.784500.750001.000001.00000


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603CUCCACCAUCGGCCUUAAC57.86221869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941621CTCCACCATCGGCCTTAACGTTAAGGCCGATGGTGGAG0.098800.008700.663800.500000.962001.00000


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651CGUCUAAGUGUUUGGGAAG73.971893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591669CGTCTAAGTGTTTGGGAAGCTTCCCAAACACTTAGACG0.019700.006600.637900.750001.000001.00000


Target Position: 2300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2300UAUAUUUAUUUUCAGUAUA85.3152263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822318TATATTTATTTTCAGTATATATACTGAAAATAAATATA0.186500.038200.500000.500001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025CACAAGAUCAUGCACAGAG76.0111770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501043CACAAGATCATGCACAGAGCTCTGTGCATGATCTTGTG0.088700.004400.482800.500000.962000.62500


Target Position: 1975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975GCUGUUCCUGCUCCAUGAC67.00351325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251993GCTGTTCCTGCTCCATGACGTCATGGAGCAGGAACAGC0.104400.019800.534500.750001.000001.00000


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309GGUGGAAGGAGAUGCGGCU77.8889657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011327GGTGGAAGGAGATGCGGCTAGCCGCATCTCCTTCCACC0.071500.006000.500000.750001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972ACUGCUGUUCCUGCUCCAU70.1331112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881990ACTGCTGTTCCTGCTCCATATGGAGCAGGAACAGCAGT0.118400.034900.551700.750000.978300.87500


Target Position: 2421, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2421GAUUUAUCUUUCCCCAUAU90.83690

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5242119GATTTATCTTTCCCCATAT1/1/0/097.21MAP2K1NM_002755.31NANANA8:29887183..29887201(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2422439GATTTATCTTTCCCCATATATATGGGGAAAGATAAATC0.229000.070500.637900.750001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714GUGUGGUGUUCAAGGUCUC72.4994966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583732GTGTGGTGTTCAAGGTCTCGAGACCTTGAACACCACAC0.122900.001400.482800.500001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828UUUAUUCUUAUUACUAUUA75.8169782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931846TTTATTCTTATTACTATTATAATAGTAATAAGAATAAA0.642700.551900.465500.500001.000001.00000


Target Position: 2025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025GACAUUUGGUGGUACUUUA97.477719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1742043GACATTTGGTGGTACTTTATAAAGTACCACCAAATGTC0.386000.182800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2023-2045TTGACATTTGGTGGTACTTTATTUAAAGUACCACCAAAUGUCAAGACAUUUGGUGGUACUUUAUUU12.912.122


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219CCAGAGCCCUUCACUGCCA81.4697430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562237CCAGAGCCCTTCACTGCCATGGCAGTGAAGGGCTCTGG0.044700.001500.500000.750000.923900.62500


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600CUGCUCCACCAUCGGCCUU62.79471588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381618CTGCTCCACCATCGGCCTTAAGGCCGATGGTGGAGCAG0.100300.012100.646600.750000.962000.87500


Target Position: 2158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158GUUAUUUUAUUAUUAUUAU89.2958120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3102176GTTATTTTATTATTATTATATAATAATAATAAAATAAC0.375500.223200.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2156-2178ATGTTATTTTATTATTATTATTTAUAAUAAUAAUAAAAUAACAUGUUAUUUUAUUAUUAUUAUUUU-8.0-9.700


Target Position: 1799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799CUACUCUUGUCAUUUUUAA89.3547119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901817CTACTCTTGTCATTTTTAATTAAAAATGACAAGAGTAG0.286700.068300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1797-1819TTCTACTCTTGTCATTTTTAATAUUAAAAAUGACAAGAGUAGAACUACUCUUGUCAUUUUUAAUAU-9.718.922


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770GGAUGAAGAACACAGCAUG83.2615340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951788GGATGAAGAACACAGCATGCATGCTGTGTTCTTCATCC0.037500.009100.715500.750001.000001.00000


Target Position: 2288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2288UGGUUGUAUUUCUAUAUUU82.6905367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3052306TGGTTGTATTTCTATATTTAAATATAGAAATACAACCA0.123300.040800.844800.750001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596GGCUCUGCUCCACCAUCGG62.91191574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361614GGCTCTGCTCCACCATCGGCCGATGGTGGAGCAGAGCC0.024500.004100.586200.500000.934800.62500


Target Position: 2477, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2477CCUAAAAUUGUAUGAAAAU84.48295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2012495CCTAAAATTGTATGAAAATATTTTCATACAATTTTAGG0.213300.154500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2475-2497TGCCTAAAATTGTATGAAAATCCAUUUUCAUACAAUUUUAGGCACCUAAAAUUGUAUGAAAAUCCU7.4-4.322


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541AUUCUAAUAAAUAUACUAU85.8927238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812559ATTCTAATAAATATACTATATAGTATATTTATTAGAAT0.675000.324900.465500.500000.972800.62500


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013UCGGGAUUCUUUGACAUUU68.60721222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2262031TCGGGATTCTTTGACATTTAAATGTCAAAGAATCCCGA0.388900.036900.793100.750001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592GCUAGAGCUUGAUGAGCAG80.1847502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538610GCTAGAGCTTGATGAGCAGCTGCTCATCAAGCTCTAGC0.091600.002000.569000.750000.934800.75000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312GGAAGGAGAUGCGGCUGAG76.0721760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121330GGAAGGAGATGCGGCTGAGCTCAGCCGCATCTCCTTCC0.071400.028000.560300.750001.000001.00000


Target Position: 1825, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1825GUCUUUAUUCUUAUUACUA93.935451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131843GTCTTTATTCTTATTACTATAGTAATAAGAATAAAGAC0.639500.554300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1823-1845CTGTCTTTATTCTTATTACTATTUAGUAAUAAGAAUAAAGACAGGUCUUUAUUCUUAUUACUAUUU6.36.920


Target Position: 2399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399UGAUCAAGAUAUUAAAAUG81.3482440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562417TGATCAAGATATTAAAATGCATTTTAATATCTTGATCA0.209400.005100.569000.500001.000001.00000


Target Position: 2385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2385UGAAUGUCACAAAUUGAUC65.3941437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3942403TGAATGTCACAAATTGATCGATCAATTTGTGACATTCA0.195700.016100.543100.500001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405AGAUAUUAAAAUGUCGGAU76.9847705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982423AGATATTAAAATGTCGGATATCCGACATTTTAATATCT0.032200.001000.543100.750001.000001.00000


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928ACAGUGAAAUUUUGGUGAA85.1332269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101946ACAGTGAAATTTTGGTGAATTCACCAAAATTTCACTGT0.086900.022200.534500.750001.000001.00000


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719CCUCCUUCCCAUGCCUGUC58.67451828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391737CCTCCTTCCCATGCCTGTCGACAGGCATGGGAAGGAGG0.073000.042000.525900.750001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661ACUGAAGGAUGACGACUUU79.5651546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439679ACTGAAGGATGACGACTTTAAAGTCGTCATCCTTCAGT0.061100.007700.706900.750001.000001.00000


Target Position: 13, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13CCCUUCCCCGCCCCUCCCC32.00712552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51031CCCTTCCCCGCCCCTCCCCGGGGAGGGGCGGGGAAGGG0.205800.208400.500000.500001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155CAUGUUAUUUUAUUAUUAU94.213844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932173CATGTTATTTTATTATTATATAATAATAAAATAACATG0.593600.261800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2153-2175ATCATGTTATTTTATTATTATTAAUAAUAAUAAAAUAACAUGAUCAUGUUAUUUUAUUAUUAUUAU-8.06.711


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113GGCAGCUCAUCGACUCCAU84.8602283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351131GGCAGCTCATCGACTCCATATGGAGTCGATGAGCTGCC0.024400.006100.844801.000000.913000.62500


Target Position: 759, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759CCAGAAAGCUAAUUCAUCU89.0633127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455777CCAGAAAGCTAATTCATCTAGATGAATTAGCTTTCTGG0.201600.004300.620700.750000.983700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
757-779GGCCAGAAAGCTAATTCATCTGGAGAUGAAUUAGCUUUCUGGCCCCAGAAAGCUAAUUCAUCUGGU16.216.632


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655GGGAGAACUGAAGGAUGAC74.3339869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309673GGGAGAACTGAAGGATGACGTCATCCTTCAGTTCTCCC0.121200.023900.672400.750001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436CCUCCUCCAAAACUGCCCA74.0528883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241454CCTCCTCCAAAACTGCCCATGGGCAGTTTTGGAGGAGG0.550500.022400.500000.750001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186GACUCAUUACUCUGUGCAG83.1705345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871204GACTCATTACTCTGTGCAGCTGCACAGAGTAATGAGTC0.013900.002700.534500.500001.000001.00000


Target Position: 172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172GAGAGAGAGAGGAAGGGAA94.878639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
421190GAGAGAGAGAGGAAGGGAATTCCCTTCCTCTCTCTCTC0.067200.053000.637900.750001.000001.00000


Target Position: 1726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1726CCCAUGCCUGUCUCUGUUC63.01431565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861744CCCATGCCTGTCTCTGTTCGAACAGAGACAGGCATGGG0.079100.008200.819000.750001.000001.00000


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137GCAUCAGAGAGUGUACAUC76.2105748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4012155GCATCAGAGAGTGTACATCGATGTACACTCTCTGATGC0.075300.007100.672400.750001.000001.00000


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495UCCUUUUAACCAUUUUAAC58.24681850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662513TCCTTTTAACCATTTTAACGTTAAAATGGTTAAAAGGA0.209300.113600.724100.500001.000001.00000


Target Position: 1823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823CUGUCUUUAUUCUUAUUAC79.7815535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121841CTGTCTTTATTCTTATTACGTAATAAGAATAAAGACAG0.655400.563000.603400.500001.000001.00000


Target Position: 2160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160UAUUUUAUUAUUAUUAUUU80.4933488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972178TATTTTATTATTATTATTTAAATAATAATAATAAAATA0.191200.137500.543100.500001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758ACCUGUGACAAAGGAUGAA79.0891574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241776ACCTGTGACAAAGGATGAATTCATCCTTTGTCACAGGT0.115200.002400.681000.750000.989100.62500


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GUGUUCAGUCUGGAAUUUC66.98071330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931478GTGTTCAGTCTGGAATTTCGAAATTCCAGACTGAACAC0.184800.001000.620700.500001.000001.00000


Target Position: 2576, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576GAUGAAAGCUAAAAAAAAA101.4364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1712594GATGAAAGCTAAAAAAAAATTTTTTTTTAGCTTTCATC0.995000.472500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2574-2596AGGATGAAAGCTAAAAAAAAAAAUUUUUUUUUAGCUUUCAUCCUGAUGAAAGCUAAAAAAAAAAAU-11.312.011


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026ACAUUUGGUGGUACUUUAU78.6256611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1942044ACATTTGGTGGTACTTTATATAAAGTACCACCAAATGT0.405600.155100.663800.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GGUUGGUUGAGAGAGAGAG74.1878880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400180GGTTGGTTGAGAGAGAGAGCTCTCTCTCTCAACCAACC0.727600.151500.543100.750001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572AAAGGAUGAAAGCUAAAAA89.9154105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042590AAAGGATGAAAGCTAAAAATTTTTAGCTTTCATCCTTT0.848900.359900.500000.500001.000001.00000


Target Position: 1782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1782CAGCAUGUGCCAAGAUUCU79.6507541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621800CAGCATGTGCCAAGATTCTAGAATCTTGGCACATGCTG0.056800.004600.560300.500000.907600.62500


Target Position: 1822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822ACUGUCUUUAUUCUUAUUA78.0173649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661840ACTGTCTTTATTCTTATTATAATAAGAATAAAGACAGT0.652000.567700.672400.750001.000001.00000


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334AGUGGUAUGUCUCUUUAAG76.4235741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092352AGTGGTATGTCTCTTTAAGCTTAAAGAGACATACCACT0.116600.015100.569000.500001.000001.00000


Target Position: 2016, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016GGAUUCUUUGACAUUUGGU78.8496594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562034GGATTCTTTGACATTTGGTACCAAATGTCAAAGAATCC0.257600.205600.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2014-2036CGGGATTCTTTGACATTTGGTGGACCAAAUGUCAAAGAAUCCCGGGAUUCUUUGACAUUUGGUGGU17.714.822


Target Position: 2467, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467GUGUAUAGUGCCUAAAAUU89.1143125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342485GTGTATAGTGCCTAAAATTAATTTTAGGCACTATACAC0.317400.002100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2465-2487ACGTGTATAGTGCCTAAAATTGTAAUUUUAGGCACUAUACACGUGUGUAUAGUGCCUAAAAUUGUU-4.313.132


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641CAGAAGCAGAAGGUGGGAG63.88061515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582659CAGAAGCAGAAGGTGGGAGCTCCCACCTTCTGCTTCTG0.015600.003400.474100.500001.000001.00000


Target Position: 2552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552UAUACUAUGAAAUAAAAAA87.5028178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412570TATACTATGAAATAAAAAATTTTTTATTTCATAGTATA0.682900.542700.543100.500001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GCUGAUGAUCAAAACCUGU80.5724483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261914GCTGATGATCAAAACCTGTACAGGTTTTGATCATCAGC0.065300.018200.646600.750001.000001.00000


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361AAUGUUUCUUAAAUGGAAU79.0725577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942379AATGTTTCTTAAATGGAATATTCCATTTAAGAAACATT0.063200.009400.500000.500001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988UGCUGUAAUAAAAGGCCUG60.71031719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541006TGCTGTAATAAAAGGCCTGCAGGCCTTTTATTACAGCA0.055200.018600.569000.500001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465ACGUGUAUAGUGCCUAAAA87.9567161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452483ACGTGTATAGTGCCTAAAATTTTAGGCACTATACACGT0.023800.001800.775900.750001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080GGGAGAUCAAGCUCUGUGA91.129281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791098GGGAGATCAAGCTCTGTGATCACAGAGCTTGATCTCCC0.058200.001200.767200.750000.967400.75000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392CUCCCAUGGCAAUUUUUGA80.4862490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801410CTCCCATGGCAATTTTTGATCAAAAATTGCCATGGGAG0.159800.003600.586200.500001.000001.00000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992GUAAUAAAAGGCCUGACAU83.8612314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771010GTAATAAAAGGCCTGACATATGTCAGGCCTTTTATTAC0.044400.024000.525900.750001.000001.00000


Target Position: 2462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2462ACAACGUGUAUAGUGCCUA79.2952558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482480ACAACGTGTATAGTGCCTATAGGCACTATACACGTTGT0.021400.001700.534500.750001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135GAGCAUCAGAGAGUGUACA88.1694152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752153GAGCATCAGAGAGTGTACATGTACACTCTCTGATGCTC0.109500.003800.603400.500001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444CCGGAGUUGGAAGCGCGUU63.39481546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569462CCGGAGTTGGAAGCGCGTTAACGCGCTTCCAACTCCGG0.160400.001300.767201.000001.000001.00000


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351AGUUUUGAUUAAUGUUUCU79.1268570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702369AGTTTTGATTAATGTTTCTAGAAACATTAATCAAAACT0.059800.045500.482800.500001.000001.00000


Target Position: 2381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381AUUUUGAAUGUCACAAAUU74.8254839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902399ATTTTGAATGTCACAAATTAATTTGTGACATTCAAAAT0.150300.030000.500000.500001.000001.00000


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199CAGUUGACAUCCAAAUCUA100.7347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982217CAGTTGACATCCAAATCTATAGATTTGGATGTCAACTG0.379400.077400.612100.750000.956500.75000


Target Position: 1929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1929CAGUGAAAUUUUGGUGAAU84.8568284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601947CAGTGAAATTTTGGTGAATATTCACCAAAATTTCACTG0.052600.007600.775900.750001.000001.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174GAGAGAGAGGAAGGGAAUC68.42761235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585192GAGAGAGAGGAAGGGAATCGATTCCCTTCCTCTCTCTC0.032300.023400.629300.500001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017GGGAGAAGCACAAGAUCAU90.118102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061035GGGAGAAGCACAAGATCATATGATCTTGTGCTTCTCCC0.073100.019100.836201.000001.000001.00000


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824UGUCUUUAUUCUUAUUACU77.8562660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641842TGTCTTTATTCTTATTACTAGTAATAAGAATAAAGACA0.643500.553000.500000.500001.000001.00000


Target Position: 2444, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2444GUACCAAUGCUGUUGUAAA97.827816

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3244419GTACCAATGCTGTTGTAAA1/1/0/097.75MAP2K1NM_002755.31NANANA15:66783740..66783758(+)00MAP2K1(0.002)&WASF3(0.007)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422462GTACCAATGCTGTTGTAAATTTACAACAGCATTGGTAC0.021800.004300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2442-2464AAGTACCAATGCTGTTGTAAACAUUUACAACAGCAUUGGUACUUGUACCAAUGCUGUUGUAAACAU14.720.013


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457UGUAAACAACGUGUAUAGU70.08441115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582475TGTAAACAACGTGTATAGTACTATACACGTTGTTTACA0.041100.012100.500000.500001.000001.00000


Target Position: 1781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781ACAGCAUGUGCCAAGAUUC69.87061128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691799ACAGCATGTGCCAAGATTCGAATCTTGGCACATGCTGT0.065200.005500.534500.500000.907600.75000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878GGGGCUAUUUGUGUGUAUG75.902776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671896GGGGCTATTTGTGTGTATGCATACACACAAATAGCCCC0.191300.004100.836200.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923GAAUUACAGUGAAAUUUUG82.9183356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401941GAATTACAGTGAAATTTTGCAAAATTTCACTGTAATTC0.337800.022500.525900.500001.000001.00000


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146AGUGUACAUCAUGUUAUUU81.818410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2782164AGTGTACATCATGTTATTTAAATAACATGATGTACACT0.331000.062900.706900.750001.000001.00000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006GACAUAUCUGAGGGAGAAG73.9612895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941024GACATATCTGAGGGAGAAGCTTCTCCCTCAGATATGTC0.041100.012500.681000.500001.000001.00000


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561GAGAUCUGAUGCUGAGGAA96.627124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611579GAGATCTGATGCTGAGGAATTCCTCAGCATCAGATCTC0.089700.015300.637900.750001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486UGUGAAUAAAUGCUUAAUA84.8857280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2111504TGTGAATAAATGCTTAATATATTAAGCATTTATTCACA0.450900.096400.663800.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UGGUAUGUCUCUUUAAGUU81.2947444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2972354TGGTATGTCTCTTTAAGTTAACTTAAAGAGACATACCA0.199800.018000.698300.750001.000001.00000


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287CUGGUUGUAUUUCUAUAUU81.8329408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832305CTGGTTGTATTTCTATATTAATATAGAAATACAACCAG0.163200.020300.775900.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GCCCUCCAACAUCCUAGUC60.84831716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861069GCCCTCCAACATCCTAGTCGACTAGGATGTTGGAGGGC0.240900.070500.681000.750000.978300.62500


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286UCUGGUUGUAUUUCUAUAU75.6135796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3102304TCTGGTTGTATTTCTATATATATAGAAATACAACCAGA0.161200.015800.681000.750001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464UCAGUCUGGAAUUUCAAGA69.46991156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231482TCAGTCTGGAATTTCAAGATCTTGAAATTCCAGACTGA0.135100.008400.500000.500001.000001.00000


Target Position: 939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939UGAAGAAAGCUGGAAGAAU76.9926703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374957TGAAGAAAGCTGGAAGAATATTCTTCCAGCTTTCTTCA0.083700.023700.715500.750001.000001.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659GAACUGAAGGAUGACGACU79.4076554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578677GAACTGAAGGATGACGACTAGTCGTCATCCTTCAGTTC0.095500.023400.465500.500001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620ACCAGCCCAGCACACCAAC52.93162145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511638ACCAGCCCAGCACACCAACGTTGGTGTGCTGGGCTGGT0.137400.001500.706900.500001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464AACGUGUAUAGUGCCUAAA78.1702642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622482AACGTGTATAGTGCCTAAATTTAGGCACTATACACGTT0.022800.001400.646600.500001.000001.00000


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474GUGCCUAAAAUUGUAUGAA85.8045241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822492GTGCCTAAAATTGTATGAATTCATACAATTTTAGGCAC0.211900.019900.620700.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166AUUAUUAUUAUUUGCUUUU68.3911239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472184ATTATTATTATTTGCTTTTAAAAGCAAATAATAATAAT0.117000.085600.508600.500001.000001.00000


Target Position: 2550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2550AAUAUACUAUGAAAUAAAA96.831323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672568AATATACTATGAAATAAAATTTTATTTCATAGTATATT0.583800.501900.508600.500001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915GCCAGGCUGAAUUACAGUG69.1711176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951933GCCAGGCTGAATTACAGTGCACTGTAATTCAGCCTGGC0.082700.001000.706900.750000.934800.75000


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929GAUCAAGUCCUGAAGAAAG82.5565372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487947GATCAAGTCCTGAAGAAAGCTTTCTTCAGGACTTGATC0.189600.003300.543100.500001.000001.00000


Target Position: 2392, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2392CACAAAUUGAUCAAGAUAU86.7066209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812410CACAAATTGATCAAGATATATATCTTGATCAATTTGTG0.015800.004700.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2390-2412GTCACAAATTGATCAAGATATTAAUAUCUUGAUCAAUUUGUGACCACAAAUUGAUCAAGAUAUUAU13.45.332


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652GGUGGGAGAACUGAAGGAU81.8473407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542670GGTGGGAGAACTGAAGGATATCCTTCAGTTCTCCCACC0.142200.001900.672401.000001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961UGAACAAAUUUUAGGAAAA85.4841253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543979TGAACAAATTTTAGGAAAATTTTCCTAAAATTTGTTCA0.021800.011800.724100.750001.000001.00000


Target Position: 2157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157UGUUAUUUUAUUAUUAUUA85.3795260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1622175TGTTATTTTATTATTATTATAATAATAATAAAATAACA0.540700.314300.672400.750001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150UACAUCAUGUUAUUUUAUU73.2336938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772168TACATCATGTTATTTTATTAATAAAATAACATGATGTA0.497400.219000.672400.500001.000001.00000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840ACUAUUAUUGUUCCCCUAA81.2349449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561858ACTATTATTGTTCCCCTAATTAGGGGAACAATAATAGT0.054400.039600.672400.750001.000001.00000


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513CCUAGAUGUUUAACAAAUC77.1536697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582531CCTAGATGTTTAACAAATCGATTTGTTAAACATCTAGG0.172800.009700.663800.750001.000001.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GAGGCCCCUUAGCUCAUAC71.86791005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541375GAGGCCCCTTAGCTCATACGTATGAGCTAAGGGGCCTC0.096200.001500.629300.500000.918500.87500


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153GGAGGGACUGGUUGGUUGA85.5842251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280171GGAGGGACTGGTTGGTTGATCAACCAACCAGTCCCTCC0.141200.027200.646600.750001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516AGAGAGAGCAGAUUUGAAG74.9533830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941534AGAGAGAGCAGATTTGAAGCTTCAAATCTGCTCTCTCT0.045600.003100.586200.500001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496CCUUUUAACCAUUUUAACC66.14321387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632514CCTTTTAACCATTTTAACCGGTTAAAATGGTTAAAAGG0.231300.118700.491400.500001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787UGUGCCAAGAUUCUACUCU66.95941331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811805TGTGCCAAGATTCTACTCTAGAGTAGAATCTTGGCACA0.071300.001200.482800.500001.000001.00000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523UAACAAAUCUAAUCUCUUA94.208745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372541TAACAAATCTAATCTCTTATAAGAGATTAGATTTGTTA0.533800.185100.500000.500001.000001.00000


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GGGUAGUCAUUCUUACAAU96.896922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391968GGGTAGTCATTCTTACAATATTGTAAGAATGACTACCC0.267900.002000.982801.000001.000001.00000


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406GAUAUUAAAAUGUCGGAUU82.7215366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322424GATATTAAAATGTCGGATTAATCCGACATTTTAATATC0.026400.003100.672400.750001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801ACUCUUGUCAUUUUUAAUA82.7343364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911819ACTCTTGTCATTTTTAATATATTAAAAATGACAAGAGT0.630400.083200.663800.750001.000001.00000


Target Position: 2581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581AAGCUAAAAAAAAAAAAAA83.2008342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962599AAGCTAAAAAAAAAAAAAATTTTTTTTTTTTTTAGCTT0.997000.853400.637900.500001.000001.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877UGGGGCUAUUUGUGUGUAU74.2921872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661895TGGGGCTATTTGTGTGTATATACACACAAATAGCCCCA0.395900.009000.801700.750001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528CUGCAGUUAACGGGACCAG59.84671759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497546CTGCAGTTAACGGGACCAGCTGGTCCCGTTAACTGCAG0.351900.015700.500000.500001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984GCAUUGCUGUAAUAAAAGG72.065995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601002GCATTGCTGTAATAAAAGGCCTTTTATTACAGCAATGC0.308800.103100.508600.500001.000001.00000


Target Position: 2584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584CUAAAAAAAAAAAAAAAAA83.9124313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1602602CTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAG0.998600.993700.672400.750001.000001.00000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023UUGACAUUUGGUGGUACUU62.17041632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692041TTGACATTTGGTGGTACTTAAGTACCACCAAATGTCAA0.283800.161300.508600.500001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938CUGAAGAAAGCUGGAAGAA80.8122473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342956CTGAAGAAAGCTGGAAGAATTCTTCCAGCTTTCTTCAG0.097400.043900.612100.750001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GUAUUUUCGGGAUUCUUUG68.60761221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4952025GTATTTTCGGGATTCTTTGCAAAGAATCCCGAAAATAC0.216600.015300.534500.500001.000001.00000


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395CCAUGGCAAUUUUUGAGUU82.242387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201413CCATGGCAATTTTTGAGTTAACTCAAAAATTGCCATGG0.049500.002400.698301.000001.000001.00000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151CCGGAGGGACUGGUUGGUU68.11041258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364169CCGGAGGGACTGGTTGGTTAACCAACCAGTCCCTCCGG0.110900.009200.767201.000001.000001.00000


Target Position: 1763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1763UGACAAAGGAUGAAGAACA84.468296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581781TGACAAAGGATGAAGAACATGTTCTTCATCCTTTGTCA0.071800.023700.517200.500001.000001.00000


Target Position: 2154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154UCAUGUUAUUUUAUUAUUA89.2442122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1242172TCATGTTATTTTATTATTATAATAATAAAATAACATGA0.594800.266800.689700.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050AGCCCUCCAACAUCCUAGU66.33841375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281068AGCCCTCCAACATCCTAGTACTAGGATGTTGGAGGGCT0.229500.069200.646600.500000.983700.62500


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CUGUAAUAAAAGGCCUGAC65.17491449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851008CTGTAATAAAAGGCCTGACGTCAGGCCTTTTATTACAG0.032300.020100.465500.500001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159ACUGGUUGGUUGAGAGAGA81.5568426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561177ACTGGTTGGTTGAGAGAGATCTCTCTCAACCAACCAGT0.780500.088700.482800.500001.000001.00000


Target Position: 2149, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149GUACAUCAUGUUAUUUUAU86.8346206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2442167GTACATCATGTTATTTTATATAAAATAACATGATGTAC0.497300.218800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2147-2169GTGTACATCATGTTATTTTATTAAUAAAAUAACAUGAUGUACACGUACAUCAUGUUAUUUUAUUAU-7.521.512


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GCAGAGAGAGCAGAUUUGA86.0689232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971532GCAGAGAGAGCAGATTTGATCAAATCTGCTCTCTCTGC0.063300.003100.629300.750001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651AGGUGGGAGAACUGAAGGA79.9978513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584669AGGTGGGAGAACTGAAGGATCCTTCAGTTCTCCCACCT0.160200.001200.474100.500001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974UGCUGUUCCUGCUCCAUGA81.6641417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081992TGCTGTTCCTGCTCCATGATCATGGAGCAGGAACAGCA0.076100.020400.629300.500000.978300.75000


Target Position: 2342, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2342GUCUCUUUAAGUUUUGAUU79.2104566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2072360GTCTCTTTAAGTTTTGATTAATCAAAACTTAAAGAGAC0.404700.058300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2340-2362ATGTCTCTTTAAGTTTTGATTAAAAUCAAAACUUAAAGAGACAUGUCUCUUUAAGUUUUGAUUAAU7.419.132


Target Position: 2469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2469GUAUAGUGCCUAAAAUUGU81.4571431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622487GTATAGTGCCTAAAATTGTACAATTTTAGGCACTATAC0.281100.004600.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2467-2489GTGTATAGTGCCTAAAATTGTATACAAUUUUAGGCACUAUACACGUAUAGUGCCUAAAAUUGUAUU-3.313.123


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CUAUUAUUGUUCCCCUAAG74.2292874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911859CTATTATTGTTCCCCTAAGCTTAGGGGAACAATAATAG0.039600.029100.534500.500001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CUGAACAAAUUUUAGGAAA83.71320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547978CTGAACAAATTTTAGGAAATTTCCTAAAATTTGTTCAG0.021500.008700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
958-980TCCTGAACAAATTTTAGGAAAAGUUUCCUAAAAUUUGUUCAGGACUGAACAAAUUUUAGGAAAAGU19.920.522


Target Position: 2291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2291UUGUAUUUCUAUAUUUAUU76.9175709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3732309TTGTATTTCTATATTTATTAATAAATATAGAAATACAA0.169900.088000.637900.500001.000001.00000


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917CAGGCUGAAUUACAGUGAA94.603841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221935CAGGCTGAATTACAGTGAATTCACTGTAATTCAGCCTG0.109200.002400.612100.750000.934801.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052CCCUCCAACAUCCUAGUCA79.9837515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801070CCCTCCAACATCCTAGTCATGACTAGGATGTTGGAGGG0.247800.075800.767200.750000.972800.62500


Target Position: 2394, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394CAAAUUGAUCAAGAUAUUA92.89460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572412CAAATTGATCAAGATATTATAATATCTTGATCAATTTG0.020000.006100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2392-2414CACAAATTGATCAAGATATTAAAUAAUAUCUUGAUCAAUUUGUGCAAAUUGAUCAAGAUAUUAAAU6.67.422


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806UGUCAUUUUUAAUAUUACU78.6451605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691824TGTCATTTTTAATATTACTAGTAATATTAAAAATGACA0.644000.261800.500000.500001.000001.00000


Target Position: 2395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395AAAUUGAUCAAGAUAUUAA95.204637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792413AAATTGATCAAGATATTAATTAATATCTTGATCAATTT0.022400.006900.465500.500001.000001.00000


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035GGUACUUUAUUCUUGCUGG74.4675860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982053GGTACTTTATTCTTGCTGGCCAGCAAGAATAAAGTACC0.036800.024500.508600.500001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814UUAAUAUUACUGUCUUUAU77.8065664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361832TTAATATTACTGTCTTTATATAAAGACAGTAATATTAA0.756600.553400.491400.500001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468UCUGGAAUUUCAAGAUUUU75.9646771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201486TCTGGAATTTCAAGATTTTAAAATCTTGAAATTCCAGA0.030000.008800.724100.750001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442CCCCGGAGUUGGAAGCGCG61.19291692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552460CCCCGGAGTTGGAAGCGCGCGCGCTTCCAACTCCGGGG0.157100.001500.569000.500000.923900.62500


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159UUAUUUUAUUAUUAUUAUU81.7665413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272177TTATTTTATTATTATTATTAATAATAATAATAAAATAA0.279200.180700.525900.500001.000001.00000


Target Position: 2560, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560GAAAUAAAAAAAAAAGGAU84.9332279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392578GAAATAAAAAAAAAAGGATATCCTTTTTTTTTTATTTC0.391500.264400.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2558-2580ATGAAATAAAAAAAAAAGGATGAAUCCUUUUUUUUUUAUUUCAUGAAAUAAAAAAAAAAGGAUGAU18.7-9.711


Target Position: 1804, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804CUUGUCAUUUUUAAUAUUA87.931163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071822CTTGTCATTTTTAATATTATAATATTAAAAATGACAAG0.638200.119200.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1802-1824CTCTTGTCATTTTTAATATTACTUAAUAUUAAAAAUGACAAGAGCUUGUCAUUUUUAAUAUUACUU-8.020.521


Target Position: 2269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269GUGGUGAUCUGUAGACUUC75.941774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922287GTGGTGATCTGTAGACTTCGAAGTCTACAGATCACCAC0.020000.001000.620700.500001.000001.00000


Target Position: 2536, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536CUCUUAUUCUAAUAAAUAU93.691953

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7253619CTCTTATTCTAATAAATAT1/1/0/096.22MAP2K1NM_002755.31NANANA15:66783832..66783850(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2352554CTCTTATTCTAATAAATATATATTTATTAGAATAAGAG0.689400.347100.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2534-2556ATCTCTTATTCTAATAAATATACAUAUUUAUUAGAAUAAGAGAUCUCUUAUUCUAAUAAAUAUACU-8.06.921


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434CCAUAUCCAAGUACCAAUG71.28731035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4252452CCATATCCAAGTACCAATGCATTGGTACTTGGATATGG0.065500.028000.689700.750001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525AGAUUUGAAGCAACUCAUG70.98341051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721543AGATTTGAAGCAACTCATGCATGAGTTGCTTCAAATCT0.017600.004800.569000.500000.994600.75000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GCAGCGCAGCGGGAGGAAG62.60491602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511423GCAGCGCAGCGGGAGGAAGCTTCCTCCCGCTGCGCTGC0.272600.002700.715500.750000.978300.75000


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298UCUAUAUUUAUUUUCAGUA81.9498400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022316TCTATATTTATTTTCAGTATACTGAAAATAAATATAGA0.282800.054600.543100.750001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CUCCAUGGCCAACUCCUUC62.3191620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5291144CTCCATGGCCAACTCCTTCGAAGGAGTTGGCCATGGAG0.151700.002300.637900.500000.962000.87500


Target Position: 150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
150GCCGGAGGGACUGGUUGGU59.60941772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384168GCCGGAGGGACTGGTTGGTACCAACCAGTCCCTCCGGC0.081100.008200.646600.750001.000001.00000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124GCUAUGAAAAUGAGCAUCA87.6658169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542142GCTATGAAAATGAGCATCATGATGCTCATTTTCATAGC0.020600.005700.629300.750001.000001.00000


Target Position: 2391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2391UCACAAAUUGAUCAAGAUA85.41258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922409TCACAAATTGATCAAGATATATCTTGATCAATTTGTGA0.012600.004200.681000.750001.000001.00000


Target Position: 2580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2580AAAGCUAAAAAAAAAAAAA83.3477335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882598AAAGCTAAAAAAAAAAAAATTTTTTTTTTTTTAGCTTT0.996600.851500.500000.500001.000001.00000


Target Position: 950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GGAAGAAUUCCUGAACAAA97.23520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
948-970CTGGAAGAATTCCTGAACAAATTUUUGUUCAGGAAUUCUUCCAGGGAAGAAUUCCUGAACAAAUUU20.514.822


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CCCAGCACACCAACCCAUG61.86751652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591643CCCAGCACACCAACCCATGCATGGGTTGGTGTGCTGGG0.053200.020800.836200.750000.951100.62500


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515CAGAGAGAGCAGAUUUGAA101.2286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131533CAGAGAGAGCAGATTTGAATTCAAATCTGCTCTCTCTG0.092400.002600.612100.750001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752CAUUUCACCUGUGACAAAG72.1856988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961770CATTTCACCTGTGACAAAGCTTTGTCACAGGTGAAATG0.023900.003600.517200.500001.000001.00000


Target Position: 2280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280UAGACUUCUGGUUGUAUUU73.5992913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3732298TAGACTTCTGGTTGTATTTAAATACAACCAGAAGTCTA0.084300.014600.672400.500001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310GUGGAAGGAGAUGCGGCUG59.86611757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921328GTGGAAGGAGATGCGGCTGCAGCCGCATCTCCTTCCAC0.071100.006500.508600.500001.000001.00000


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994AAUAAAAGGCCUGACAUAU78.5815613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801012AATAAAAGGCCTGACATATATATGTCAGGCCTTTTATT0.065100.022800.465500.500001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880CGAUGGCGAGAUCAGUAUC76.5095734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580898CGATGGCGAGATCAGTATCGATACTGATCTCGCCATCG0.021200.001200.612100.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952AAGAAUUCCUGAACAAAUU78.5062616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563970AAGAATTCCTGAACAAATTAATTTGTTCAGGAATTCTT0.108700.001400.629300.500001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GUAUGCUGAUGAUCAAAAC78.1627643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111910GTATGCTGATGATCAAAACGTTTTGATCATCAGCATAC0.082600.020800.534500.500001.000001.00000


Target Position: 2344, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344CUCUUUAAGUUUUGAUUAA89.8696108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1542362CTCTTTAAGTTTTGATTAATTAATCAAAACTTAAAGAG0.458900.070500.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2342-2364GTCTCTTTAAGTTTTGATTAATGUUAAUCAAAACUUAAAGAGACCUCUUUAAGUUUUGAUUAAUGU8.97.132


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657GAGAACUGAAGGAUGACGA84.6858289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457675GAGAACTGAAGGATGACGATCGTCATCCTTCAGTTCTC0.427900.023700.517200.500001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194CUCAGCAGUUGACAUCCAA89.0087131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3962212CTCAGCAGTTGACATCCAATTGGATGTCAACTGCTGAG0.252100.007300.663800.750001.000001.00000


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601UGCUCCACCAUCGGCCUUA66.70621351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371619TGCTCCACCATCGGCCTTATAAGGCCGATGGTGGAGCA0.100600.015500.819000.750000.962001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750UGCAUUUCACCUGUGACAA75.6754792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851768TGCATTTCACCTGTGACAATTGTCACAGGTGAAATGCA0.028200.001200.706900.750001.000001.00000


Target Position: 928, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928GGAUCAAGUCCUGAAGAAA99.917110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435946GGATCAAGTCCTGAAGAAATTTCTTCAGGACTTGATCC0.308600.004900.870701.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
926-948CTGGATCAAGTCCTGAAGAAAGCUUUCUUCAGGACUUGAUCCAGGGAUCAAGUCCUGAAGAAAGCU20.420.422


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375CGGAAUGGACAGCCGACCU73.6209910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771393CGGAATGGACAGCCGACCTAGGTCGGCTGTCCATTCCG0.016500.001500.569000.750000.929300.75000


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195UCAGCAGUUGACAUCCAAA87.418181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3722213TCAGCAGTTGACATCCAAATTTGGATGTCAACTGCTGA0.667100.008700.724100.750001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879GGGCUAUUUGUGUGUAUGC70.49831088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451897GGGCTATTTGTGTGTATGCGCATACACACAAATAGCCC0.150100.092700.637900.500001.000001.00000


Target Position: 2152, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152CAUCAUGUUAUUUUAUUAU88.1495154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942170CATCATGTTATTTTATTATATAATAAAATAACATGATG0.537500.244500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2150-2172TACATCATGTTATTTTATTATTAAUAAUAAAAUAACAUGAUGUACAUCAUGUUAUUUUAUUAUUAU-7.520.522


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GGCCAGAAAGCUAAUUCAU85.0618273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597775GGCCAGAAAGCTAATTCATATGAATTAGCTTTCTGGCC0.114700.001000.844801.000000.902200.62500


Target Position: 2364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364GUUUCUUAAAUGGAAUUAU79.9382520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5882382GTTTCTTAAATGGAATTATATAATTCCATTTAAGAAAC0.013600.002500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2362-2384ATGTTTCTTAAATGGAATTATTTAUAAUUCCAUUUAAGAAACAUGUUUCUUAAAUGGAAUUAUUUU15.57.122


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800UACUCUUGUCAUUUUUAAU80.1522505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221818TACTCTTGTCATTTTTAATATTAAAAATGACAAGAGTA0.337500.076100.672400.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573AAGGAUGAAAGCUAAAAAA86.5846215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382591AAGGATGAAAGCTAAAAAATTTTTTAGCTTTCATCCTT0.849400.370000.637900.500001.000001.00000


Target Position: 2027, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027CAUUUGGUGGUACUUUAUU79.8009533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2162045CATTTGGTGGTACTTTATTAATAAAGTACCACCAAATG0.392500.143500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2025-2047GACATTTGGTGGTACTTTATTCTAAUAAAGUACCACCAAAUGUCCAUUUGGUGGUACUUUAUUCUU4.618.822


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602GCUCCACCAUCGGCCUUAA86.9957196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991620GCTCCACCATCGGCCTTAATTAAGGCCGATGGTGGAGC0.134000.017800.819001.000000.962001.00000


Target Position: 1359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359GGCCCCUUAGCUCAUACGG55.86361984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521377GGCCCCTTAGCTCATACGGCCGTATGAGCTAAGGGGCC0.082500.002100.586200.500000.918500.62500


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144AGAGUGUACAUCAUGUUAU85.6912244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2552162AGAGTGTACATCATGTTATATAACATGATGTACACTCT0.311200.044200.681000.750001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220CAGAGCCCUUCACUGCCAU77.4062681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602238CAGAGCCCTTCACTGCCATATGGCAGTGAAGGGCTCTG0.086100.001400.629300.750000.923900.62500


Target Position: 1762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1762GUGACAAAGGAUGAAGAAC69.62191148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311780GTGACAAAGGATGAAGAACGTTCTTCATCCTTTGTCAC0.064500.019700.646600.500001.000001.00000


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292UGUAUUUCUAUAUUUAUUU75.3098809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932310TGTATTTCTATATTTATTTAAATAAATATAGAAATACA0.202200.091100.706900.750001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717UGGUGUUCAAGGUCUCCCA77.9813650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495735TGGTGTTCAAGGTCTCCCATGGGAGACCTTGAACACCA0.064600.011100.500000.500000.923900.75000


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467GUCUGGAAUUUCAAGAUUU86.6273213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091485GTCTGGAATTTCAAGATTTAAATCTTGAAATTCCAGAC0.033400.008900.819000.750001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368CUUAAAUGGAAUUAUUUUG68.56461226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382386CTTAAATGGAATTATTTTGCAAAATAATTCCATTTAAG0.031100.002100.491400.500001.000001.00000


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524AACAAAUCUAAUCUCUUAU79.285559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3882542AACAAATCTAATCTCTTATATAAGAGATTAGATTTGTT0.488400.165300.603400.500001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277CUGUAGACUUCUGGUUGUA87.4728179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222295CTGTAGACTTCTGGTTGTATACAACCAGAAGTCTACAG0.099900.005700.603400.750001.000001.00000


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930AGUGAAAUUUUGGUGAAUG70.33821099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851948AGTGAAATTTTGGTGAATGCATTCACCAAAATTTCACT0.041100.037600.551700.500001.000001.00000


Target Position: 2341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341UGUCUCUUUAAGUUUUGAU73.1314940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442359TGTCTCTTTAAGTTTTGATATCAAAACTTAAAGAGACA0.146400.028100.525900.750001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397AUUGAUCAAGAUAUUAAAA85.6088249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252415ATTGATCAAGATATTAAAATTTTAATATCTTGATCAAT0.031100.004400.508600.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979AGUUAGCAUUGCUGUAAUA95.324536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441997AGTTAGCATTGCTGTAATATATTACAGCAATGCTAACT0.216800.004700.663800.750000.978301.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GCAUGGAGCACAUGGAUGG68.42361236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463918GCATGGAGCACATGGATGGCCATCCATGTGCTCCATGC0.082600.005100.508600.500000.929300.62500


Target Position: 2284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2284CUUCUGGUUGUAUUUCUAU82.0344397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3362302CTTCTGGTTGTATTTCTATATAGAAATACAACCAGAAG0.131700.012300.594800.750001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363UGUUUCUUAAAUGGAAUUA71.33921033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802381TGTTTCTTAAATGGAATTATAATTCCATTTAAGAAACA0.015800.002700.672400.750001.000001.00000


Target Position: 2293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293GUAUUUCUAUAUUUAUUUU90.500996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2812311GTATTTCTATATTTATTTTAAAATAAATATAGAAATAC0.328000.083600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2291-2313TTGTATTTCTATATTTATTTTCAAAAAUAAAUAUAGAAAUACAAGUAUUUCUAUAUUUAUUUUCAU-9.76.922


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268UGUGGUGAUCUGUAGACUU81.1463455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892286TGTGGTGATCTGTAGACTTAAGTCTACAGATCACCACA0.024300.001100.569000.750001.000001.00000


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446ACCAAUGCUGUUGUAAACA72.131992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5312464ACCAATGCTGTTGTAAACATGTTTACAACAGCATTGGT0.033600.002200.646600.500001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413AAAUGUCGGAUUUAUCUUU78.4738618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282431AAATGTCGGATTTATCTTTAAAGATAAATCCGACATTT0.273200.005100.500000.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299CUAUAUUUAUUUUCAGUAU89.1832124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702317CTATATTTATTTTCAGTATATACTGAAAATAAATATAG0.287200.058600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2297-2319TTCTATATTTATTTTCAGTATACAUACUGAAAAUAAAUAUAGAACUAUAUUUAUUUUCAGUAUACU20.3-8.022


Target Position: 2338, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338GUAUGUCUCUUUAAGUUUU87.2935185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912356GTATGTCTCTTTAAGTTTTAAAACTTAAAGAGACATAC0.173500.018600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2336-2358TGGTATGTCTCTTTAAGTTTTGAAAAACUUAAAGAGACAUACCAGUAUGUCUCUUUAAGUUUUGAU4.920.322


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278UGUAGACUUCUGGUUGUAU78.462620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3822296TGTAGACTTCTGGTTGTATATACAACCAGAAGTCTACA0.107400.007800.663800.750001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200AGUUGACAUCCAAAUCUAG80.2698497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602218AGTTGACATCCAAATCTAGCTAGATTTGGATGTCAACT0.326800.073100.534500.500000.956500.87500


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569AAAAAAGGAUGAAAGCUAA91.243578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952587AAAAAAGGATGAAAGCTAATTAGCTTTCATCCTTTTTT0.841100.356900.465500.500001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155AGGGACUGGUUGGUUGAGA72.2427981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381173AGGGACTGGTTGGTTGAGATCTCAACCAACCAGTCCCT0.268000.048200.620700.500001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CGCAGAGAGAGCAGAUUUG75.3253808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051531CGCAGAGAGAGCAGATTTGCAAATCTGCTCTCTCTGCG0.034100.005200.775900.750000.945700.75000


Target Position: 2012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2012UUCGGGAUUCUUUGACAUU66.05451394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3862030TTCGGGATTCTTTGACATTAATGTCAAAGAATCCCGAA0.407700.030400.663800.500001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815UAAUAUUACUGUCUUUAUU81.9242402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371833TAATATTACTGTCTTTATTAATAAAGACAGTAATATTA0.801200.553800.525900.500001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136AGCAUCAGAGAGUGUACAU81.6546419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642154AGCATCAGAGAGTGTACATATGTACACTCTCTGATGCT0.076400.004100.698300.750001.000001.00000


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761UGUGACAAAGGAUGAAGAA82.5018380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301779TGTGACAAAGGATGAAGAATTCTTCATCCTTTGTCACA0.143000.022100.534500.750001.000001.00000


Target Position: 2020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020UCUUUGACAUUUGGUGGUA73.5224917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3932038TCTTTGACATTTGGTGGTATACCACCAAATGTCAAAGA0.237800.162900.543100.750001.000001.00000


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354UUUGAUUAAUGUUUCUUAA81.5692425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912372TTTGATTAATGTTTCTTAATTAAGAAACATTAATCAAA0.033400.025000.465500.500001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433CCCAUAUCCAAGUACCAAU82.5079377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3682451CCCATATCCAAGTACCAATATTGGTACTTGGATATGGG0.086300.038900.982801.000001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173AGAGAGAGAGGAAGGGAAU79.8275531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396191AGAGAGAGAGGAAGGGAATATTCCCTTCCTCTCTCTCT0.075600.035100.715500.750001.000001.00000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GGUCCAAAAUGCCCAAGAA97.773617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147486GGTCCAAAATGCCCAAGAATTCTTGGGCATTTTGGACC0.387300.208000.681001.000001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GUUCAGUCUGGAAUUUCAA89.7607111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731480GTTCAGTCTGGAATTTCAATTGAAATTCCAGACTGAAC0.096600.001300.500000.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431UCCCCAUAUCCAAGUACCA74.0392885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532449TCCCCATATCCAAGTACCATGGTACTTGGATATGGGGA0.185500.097900.525900.500001.000001.00000


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134UGAGCAUCAGAGAGUGUAC72.3895976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882152TGAGCATCAGAGAGTGTACGTACACTCTCTGATGCTCA0.077300.003300.543100.500001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869UUUGUGCUUGGGGCUAUUU56.68161940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961887TTTGTGCTTGGGGCTATTTAAATAGCCCCAAGCACAAA0.012400.001000.500000.500000.989101.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493AAUCCUUUUAACCAUUUUA83.337336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712511AATCCTTTTAACCATTTTATAAAATGGTTAAAAGGATT0.177400.102400.474100.500001.000001.00000


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165UAUUAUUAUUAUUUGCUUU79.9598518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672183TATTATTATTATTTGCTTTAAAGCAAATAATAATAATA0.121100.096100.543100.500001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281AGGAGCUGGAGCUGAUGUU73.9698894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321299AGGAGCTGGAGCTGATGTTAACATCAGCTCCAGCTCCT0.134500.002100.698300.750000.945700.87500


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808UCAUUUUUAAUAUUACUGU68.47951231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541826TCATTTTTAATATTACTGTACAGTAATATTAAAAATGA0.631400.323100.517200.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458GCGUUACCCGGGUCCAAAA85.6209248

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_945819GCGTTACCCGGGTCCAAAA1/1/0/093.97MAP2K1NM_002755.31NANANA15:66679668..66679686(+)00MAP2K1(0.002)


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CCUGAAGAAAGCUGGAAGA81.5027427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376955CCTGAAGAAAGCTGGAAGATCTTCCAGCTTTCTTCAGG0.082900.039900.620700.750001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795GAUUCUACUCUUGUCAUUU87.5546176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611813GATTCTACTCTTGTCATTTAAATGACAAGAGTAGAATC0.153100.052100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1793-1815AAGATTCTACTCTTGTCATTTTTAAAUGACAAGAGUAGAAUCUUGAUUCUACUCUUGUCAUUUUUU20.514.522


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368GCUCAUACGGAAUGGACAG72.8389953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521386GCTCATACGGAATGGACAGCTGTCCATTCCGTATGAGC0.055800.011700.569000.750001.000001.00000


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407AUAUUAAAAUGUCGGAUUU76.5473731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492425ATATTAAAATGTCGGATTTAAATCCGACATTTTAATAT0.021400.013900.543100.500001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973CUGCUGUUCCUGCUCCAUG67.35651307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841991CTGCTGTTCCTGCTCCATGCATGGAGCAGGAACAGCAG0.091800.040600.629300.500000.978300.75000


Target Position: 940, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940GAAGAAAGCUGGAAGAAUU94.442843

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_494019GAAGAAAGCTGGAAGAATT1/1/0/097.21MAP2K1NM_002755.31NANANA15:66735644..66735662(+)00MAP2K1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511958GAAGAAAGCTGGAAGAATTAATTCTTCCAGCTTTCTTC0.032400.010000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
938-960CTGAAGAAAGCTGGAAGAATTCCAAUUCUUCCAGCUUUCUUCAGGAAGAAAGCUGGAAGAAUUCCU14.810.322


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758GCCAGAAAGCUAAUUCAUC74.1061882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496776GCCAGAAAGCTAATTCATCGATGAATTAGCTTTCTGGC0.256600.003100.819000.750000.945700.62500


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056CCAACAUCCUAGUCAACUC79.0027584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281074CCAACATCCTAGTCAACTCGAGTTGACTAGGATGTTGG0.073200.022100.534500.750000.972800.75000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888GUGUGUAUGCUGAUGAUCA96.388926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301906GTGTGTATGCTGATGATCATGATCATCAGCATACACAC0.086000.042900.569000.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469CUGGAAUUUCAAGAUUUUG66.34241373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631487CTGGAATTTCAAGATTTTGCAAAATCTTGAAATTCCAG0.087000.008900.637900.500001.000001.00000


Target Position: 2478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2478CUAAAAUUGUAUGAAAAUC69.56241151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402496CTAAAATTGTATGAAAATCGATTTTCATACAATTTTAG0.224200.145100.491400.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CUGGAUCAAGUCCUGAAGA79.7935534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591944CTGGATCAAGTCCTGAAGATCTTCAGGACTTGATCCAG0.012700.002800.560300.500000.913000.75000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471GGAAUUUCAAGAUUUUGUG73.4738921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231489GGAATTTCAAGATTTTGTGCACAAAATCTTGAAATTCC0.028900.017800.577600.750001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311UGGAAGGAGAUGCGGCUGA65.28541442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741329TGGAAGGAGATGCGGCTGATCAGCCGCATCTCCTTCCA0.074200.028600.620700.500001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179GCUUUUCAUGUAGAACUCA85.9423237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122197GCTTTTCATGTAGAACTCATGAGTTCTACATGAAAAGC0.120000.015500.629300.750001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109AGCGGGCAGCUCAUCGACU70.97661052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411127AGCGGGCAGCTCATCGACTAGTCGATGAGCTGCCCGCT0.107000.001900.646600.500000.940200.62500


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482AAUUGUAUGAAAAUCCUUU79.8757526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622500AATTGTATGAAAATCCTTTAAAGGATTTTCATACAATT0.245000.097500.508600.500001.000001.00000


Target Position: 2486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2486GUAUGAAAAUCCUUUUAAC83.1743344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892504GTATGAAAATCCTTTTAACGTTAAAAGGATTTTCATAC0.167300.069600.534500.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666AGGAUGACGACUUUGAGAA85.2169265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433684AGGATGACGACTTTGAGAATTCTCAAAGTCGTCATCCT0.063400.043000.672400.750001.000001.00000


Target Position: 1490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1490AAUAAAUGCUUAAUAAAAA92.530767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641508AATAAATGCTTAATAAAAATTTTTATTAAGCATTTATT0.836900.375600.508600.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011AUCUGAGGGAGAAGCACAA81.8259409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861029ATCTGAGGGAGAAGCACAATTGTGCTTCTCCCTCAGAT0.075700.009500.534500.500001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906AGCACAUGGAUGGAGGUUC59.68471766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593924AGCACATGGATGGAGGTTCGAACCTCCATCCATGTGCT0.012600.002900.681000.500001.000001.00000


Target Position: 2190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2190AGAACUCAGCAGUUGACAU86.6214214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4912208AGAACTCAGCAGTTGACATATGTCAACTGCTGAGTTCT0.067900.003200.569000.750000.934800.75000


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479CCCAAGAAGAAGCCGACGC49.7332261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581497CCCAAGAAGAAGCCGACGCGCGTCGGCTTCTTCTTGGG0.093900.086700.569000.500000.923900.75000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663UGAAGGAUGACGACUUUGA78.3346630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508681TGAAGGATGACGACTTTGATCAAAGTCGTCATCCTTCA0.068700.037100.500000.500001.000001.00000


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873UGCUUGGGGCUAUUUGUGU63.30351551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701891TGCTTGGGGCTATTTGTGTACACAAATAGCCCCAAGCA0.277900.006900.646600.500000.989100.75000


Target Position: 1487, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487GUGAAUAAAUGCUUAAUAA100.0559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761505GTGAATAAATGCTTAATAATTATTAAGCATTTATTCAC0.448800.356000.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1485-1507TTGTGAATAAATGCTTAATAAAAUUAUUAAGCAUUUAUUCACAAGUGAAUAAAUGCUUAAUAAAAU-2.38.921


Target Position: 2049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2049GCUGGGCAUACUUUCUCUC68.88291198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442067GCTGGGCATACTTTCTCTCGAGAGAAAGTATGCCCAGC0.021800.006400.543100.750001.000001.00000


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003GCCUGUAUUUUCGGGAUUC66.03851396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072021GCCTGTATTTTCGGGATTCGAATCCCGAAAATACAGGC0.033500.002900.827600.750001.000001.00000


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335GUGGUAUGUCUCUUUAAGU82.8379358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4252353GTGGTATGTCTCTTTAAGTACTTAAAGAGACATACCAC0.130100.015500.586200.500001.000001.00000


Target Position: 2517, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517GAUGUUUAACAAAUCUAAU90.688194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2152535GATGTTTAACAAATCTAATATTAGATTTGTTAAACATC0.367000.052300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2515-2537TAGATGTTTAACAAATCTAATCTAUUAGAUUUGUUAAACAUCUAGAUGUUUAACAAAUCUAAUCUU6.96.923


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675ACUUUGAGAAGAUCAGUGA81.7684412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552693ACTTTGAGAAGATCAGTGATCACTGATCTTCTCAAAGT0.046200.006200.482800.500001.000001.00000


Target Position: 2197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197AGCAGUUGACAUCCAAAUC67.72391283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722215AGCAGTTGACATCCAAATCGATTTGGATGTCAACTGCT0.385100.027400.672400.500000.945700.62500


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439UCCAAGUACCAAUGCUGUU67.74451282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972457TCCAAGTACCAATGCTGTTAACAGCATTGGTACTTGGA0.011900.012000.724100.750001.000001.00000


Target Position: 2034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2034UGGUACUUUAUUCUUGCUG55.43822010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442052TGGTACTTTATTCTTGCTGCAGCAAGAATAAAGTACCA0.055700.030700.560300.500001.000001.00000


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955GUCAUUCUUACAAUUGCAC64.89561465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921973GTCATTCTTACAATTGCACGTGCAATTGTAAGAATGAC0.083200.028200.525900.500001.000001.00000


Target Position: 2215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2215CUAGCCAGAGCCCUUCACU72.1845989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972233CTAGCCAGAGCCCTTCACTAGTGAAGGGCTCTGGCTAG0.133600.011200.465500.500000.918500.75000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797UUCUACUCUUGUCAUUUUU65.74171415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551815TTCTACTCTTGTCATTTTTAAAAATGACAAGAGTAGAA0.272800.057700.672400.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765AGCUAAUUCAUCUGGAGAU82.0348395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415783AGCTAATTCATCTGGAGATATCTCCAGATGAATTAGCT0.069500.047900.672400.750001.000001.00000


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CUGUUCCUGCUCCAUGACU69.8731127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921994CTGTTCCTGCTCCATGACTAGTCATGGAGCAGGAACAG0.111800.018200.577600.500001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CAUUUUAACCUAGAUGUUU81.397437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882523CATTTTAACCTAGATGTTTAAACATCTAGGTTAAAATG0.040800.004800.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2503-2525ACCATTTTAACCTAGATGTTTAAAAACAUCUAGGUUAAAAUGGUCAUUUUAACCUAGAUGUUUAAU19.2-9.732


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720CUCCUUCCCAUGCCUGUCU63.39511545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231738CTCCTTCCCATGCCTGTCTAGACAGGCATGGGAAGGAG0.066500.039900.586200.500001.000001.00000


Target Position: 1718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718GCCUCCUUCCCAUGCCUGU66.08911391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321736GCCTCCTTCCCATGCCTGTACAGGCATGGGAAGGAGGC0.064200.044800.793100.750001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485UUGUGAAUAAAUGCUUAAU68.84441204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701503TTGTGAATAAATGCTTAATATTAAGCATTTATTCACAA0.432900.096600.637900.500001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583GCUAAAAAAAAAAAAAAAA86.9032202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352601GCTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTAGC0.998000.992600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2581-2603AAGCTAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGCUUGCUAAAAAAAAAAAAAAAAAAU-11.3-3.800


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718GGUGUUCAAGGUCUCCCAC70.6061078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404736GGTGTTCAAGGTCTCCCACGTGGGAGACCTTGAACACC0.073200.016400.560300.750000.923900.75000


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529AUCUAAUCUCUUAUUCUAA90.776591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322547ATCTAATCTCTTATTCTAATTAGAATAAGAGATTAGAT0.440300.147600.646600.500001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356UGAUUAAUGUUUCUUAAAU82.0744394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5152374TGATTAATGTTTCTTAAATATTTAAGAAACATTAATCA0.031400.017400.715500.750001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970UUUAGGAAAAGUUAGCAUU67.13281315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583988TTTAGGAAAAGTTAGCATTAATGCTAACTTTTCCTAAA0.015400.002300.491400.500001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GACUUUGAGAAGAUCAGUG77.7961666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550692GACTTTGAGAAGATCAGTGCACTGATCTTCTCAAAGTC0.056100.005400.525900.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526CAAAUCUAAUCUCUUAUUC72.4916967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732544CAAATCTAATCTCTTATTCGAATAAGAGATTAGATTTG0.455300.158700.474100.500001.000001.00000


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484UUUGUGAAUAAAUGCUUAA75.4727804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901502TTTGTGAATAAATGCTTAATTAAGCATTTATTCACAAA0.437300.099000.465500.500001.000001.00000


Target Position: 2279, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2279GUAGACUUCUGGUUGUAUU85.2409264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152297GTAGACTTCTGGTTGTATTAATACAACCAGAAGTCTAC0.096700.006100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2277-2299CTGTAGACTTCTGGTTGTATTTCAAUACAACCAGAAGUCUACAGGUAGACUUCUGGUUGUAUUUCU14.618.922


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GCUAAUUCAUCUGGAGAUC68.11971257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417784GCTAATTCATCTGGAGATCGATCTCCAGATGAATTAGC0.068400.065100.672400.750001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522AGCAGAUUUGAAGCAACUC63.3861548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961540AGCAGATTTGAAGCAACTCGAGTTGCTTCAAATCTGCT0.012000.002600.543100.500000.983700.75000


Target Position: 2543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543UCUAAUAAAUAUACUAUGA84.6754291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922561TCTAATAAATATACTATGATCATAGTATATTTATTAGA0.556900.477000.500000.500000.972800.62500


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927UGGAUCAAGUCCUGAAGAA83.5246327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537945TGGATCAAGTCCTGAAGAATTCTTCAGGACTTGATCCA0.024300.004500.672400.750000.913000.62500