siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai 2444   3880   4610   4662   6622  
Biltr, Sidirect 188   302   307   358   371   399   400   402   406   530   533   537   577   787   796   831   855   856   863   867  
868   872   901   929   1018   1020   1042   1106   1126   1210   1324   1334   1445   1514   1681   1712   1900   1975   2088   2089  
2171   2181   2218   2225   2229   2246   2257   2289   2308   2355   2364   2366   2418   2427   2428   2493   2494   2520   2580   2692  
2701   2708   2718   2776   2810   2847   2849   2851   2864   2892   2989   3075   3173   3177   3180   3182   3187   3225   3227   3230  
3336   3427   3436   3462   3463   3476   3486   3487   3499   3558   3560   3592   3682   3690   3699   3729   3884   3889   3958   3959  
3968   4073   4135   4142   4263   4368   4405   4489   4514   4515   4612   4632   4640   4708   4788   4793   4818   4870   4879   4881  
4890   5168   5169   5195   5220   5229   5248   5250   5275   5287   5291   5310   5333   5383   5388   5397   5399   5408   5418   5420  
5434   5449   5451   5454   5464   5480   5497   5547   5620   5623   5624   5646   5659   5667   5669   5678   5720   5768   5777   5833  
5841   5842   5852   5853   5858   5866   5868   5901   5944   5989   5995   6001   6003   6147   6164   6213   6221   6223   6224   6235  
6250   6257   6270   6287   6355   6356   6410   6412   6454   6505   6506   6508   6512   6514   6518   6521   6560   6565   6569   6581  
6594   6596   6603   6606   6615  
Biltr, Ernai, Rnaxs 300   898  
Biltr, Rnaxs 292   298   299   628   630   635   681   790   791   794   795   800   820   895   896   897   961   1100   1101   1113  
1283   1284   1288   1289   1290   1326   1392   1510   1511   1523   1544   1545   1546   1613   1619   1623   1624   1721   1732   1788  
1789   1896   1897   1966   1972   1973   1974   1976   2045   2048   2103   2109   2136   2213   2214   2215   2216   2217   2281   2309  
2327   2333   2334   2335   2336   2359   2362   2426   2443   2446   2447   2517   2518   2519   2633   2638   2644   2645   2646   2676  
2685   2716   2717   2721   2752   2758   2764   2807   2808   2816   2821   2823   2910   2916   2954   2955   2956   2959   2962   2963  
2975   3063   3064   3066   3073   3205   3332   3343   3455   3496   3538   3598   3718   3719   3721   3727   3830   4045   4046   4047  
4066   4067   4103   4122   4123   4125   4126   4172   4173   4174   4180   4218   4288   4289   4290   4446   4467   4487   4488   4490  
4493   4636   4680   4681   4682   4721   4767   4768   4769   4775   4776   4777   4820   4821   4868   5029   5030   5113   5217   5218  
5219   5224   5237   5290   5295   5301   5377   5378   5415   5440   5460   5565   5566   5567   5569   5570   5688   5692   5701   5706  
5827   5828   5887   5939   5940   6032   6039   6041   6042   6043   6084   6142   6145   6146   6148   6188   6193   6220   6242   6243  
6292   6293   6294   6296   6315   6353   6362   6393   6450   6624   6628   6631   6634  
Biltr, Rnaxs, Sidirect 801   957   958   962   966   1524   1967   1968   1977   1978   2104   2110   2139   2280   2282   2283   2314   2438   2677   2686  
2696   2720   2765   2777   2822   3065   3067   3497   3584   3585   3720   3904   4049   4058   4061   4068   4175   4217   4219   4468  
4469   4480   4491   4683   4825   4826   4869   5031   5032   5225   5294   5302   5411   5439   5441   5461   5683   5693   5707   5778  
6149   6150   6234   6244   6245   6445   6451   6625   6626   6629   6632   6635  
Biltr, Ernai, Sidirect 827   1128  
Biltr, Ernai, Rnaxs, Sidirect 4060  


Target Position: 2214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214GUGGCACUUUACUUACUUU90.0436506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2772232GTGGCACTTTACTTACTTTAAAGTAAGTAAAGTGCCAC0.549000.159500.793100.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801CCAUAAAUUCUUCUUAUUU86.4094881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137819CCATAAATTCTTCTTATTTAAATAAGAAGAATTTATGG0.611000.366400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
799-821TACCATAAATTCTTCTTATTTCCAAAUAAGAAGAAUUUAUGGUACCAUAAAUUCUUCUUAUUUCCU6.9-1.822


Target Position: 1106, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106GAAAAGAGAAAAAAGAGAU87.6459737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1104-1126CAGAAAAGAGAAAAAAGAGATCCAUCUCUUUUUUCUCUUUUCUGGAAAAGAGAAAAAAGAGAUCCU19.110.311


Target Position: 6224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6224CUAUUACAAUCCAAAUAUU91.0125420

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6222-6244AGCTATTACAATCCAAATATTGCAAUAUUUGGAUUGUAAUAGCUCUAUUACAAUCCAAAUAUUGCU-1.88.522


Target Position: 2493, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493GGAAAAACCUGAAUUCAGU86.5343863

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2491-2513TGGGAAAAACCTGAATTCAGTTAACUGAAUUCAGGUUUUUCCCAGGAAAAACCUGAAUUCAGUUAU12.08.722


Target Position: 4142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4142GAAGUAAUGCUAAAAUGCU84.5961109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4140-4162ATGAAGTAATGCTAAAATGCTGGAGCAUUUUAGCAUUACUUCAUGAAGUAAUGCUAAAAUGCUGGU14.04.632


Target Position: 3729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3729CAACUGUAAAAGAUCUUAU89.8491531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3727-3749TCCAACTGTAAAAGATCTTATTGAUAAGAUCUUUUACAGUUGGACAACUGUAAAAGAUCUUAUUGU16.019.023


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546AGACCUCACCAUAGCUAAU84.56781112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451564AGACCTCACCATAGCTAATATTAGCTATGGTGAGGTCT0.415300.078300.715500.750001.000001.00000


Target Position: 4818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4818GUUGUAUGGUCAAUAACAU89.8727526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4816-4838GTGTTGTATGGTCAATAACATTTAUGUUAUUGACCAUACAACACGUUGUAUGGUCAAUAACAUUUU6.913.522


Target Position: 635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635GUCUUUCCCCACAAUCAUA90.6464449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
693653GTCTTTCCCCACAATCATATATGATTGTGGGGAAAGAC0.437800.366900.775900.750001.000001.00000


Target Position: 2218, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218CACUUUACUUACUUUAACU89.0227609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2216-2238GGCACTTTACTTACTTTAACTGGAGUUAAAGUAAGUAAAGUGCCCACUUUACUUACUUUAACUGGU4.912.922


Target Position: 2638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638ACUCCCCCUGAAAACCAAA74.73572856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002656ACTCCCCCTGAAAACCAAATTTGGTTTTCAGGGGGAGT0.205500.146400.706900.750001.000001.00000


Target Position: 2716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2716UCCUGUGUUUAAGCCUUUU65.49524576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792734TCCTGTGTTTAAGCCTTTTAAAAGGCTTAAACACAGGA0.282500.021600.870700.750001.000001.00000


Target Position: 4776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776GCCACUCAUUUAGAAUUCU77.5252305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6234794GCCACTCATTTAGAATTCTAGAATTCTAAATGAGTGGC0.420600.148900.775900.750000.923900.75000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820CCCAGAUCAUCCAUUGCAU85.5827991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973838CCCAGATCATCCATTGCATATGCAATGGATGATCTGGG0.131400.056000.836201.000001.000001.00000


Target Position: 4490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4490ACUUGUAUUGUUAUUUAAA89.4865563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3724508ACTTGTATTGTTATTTAAATTTAAATAACAATACAAGT0.355200.084000.706900.750001.000001.00000


Target Position: 5939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5939ACUGUGAACAUUUUAGAAA84.22631160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7205957ACTGTGAACATTTTAGAAATTTCTAAAATGTTCACAGT0.515800.035700.706900.750001.000001.00000


Target Position: 2282, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GGAAAAACAUGUACUUUAA101.91616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762300GGAAAAACATGTACTTTAATTAAAGTACATGTTTTTCC0.193000.064500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2280-2302GTGGAAAAACATGTACTTTAAAAUUAAAGUACAUGUUUUUCCACGGAAAAACAUGUACUUUAAAAU6.68.721


Target Position: 5388, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5388CUAAUGAAUGUGAACAUGU79.2051980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5386-5408ATCTAATGAATGTGAACATGTAGACAUGUUCACAUUCAUUAGAUCUAAUGAAUGUGAACAUGUAGU20.58.922


Target Position: 3958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3958GGAAAGUCUGCAAACUCAA94.2696214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3956-3978TTGGAAAGTCTGCAAACTCAAAAUUGAGUUUGCAGACUUUCCAAGGAAAGUCUGCAAACUCAAAAU19.221.522


Target Position: 6521, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6521CUAAGAAUUAGAUACUUGU82.95051353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6519-6541TTCTAAGAATTAGATACTTGTCAACAAGUAUCUAAUUCUUAGAACUAAGAAUUAGAUACUUGUCAU11.66.923


Target Position: 1042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042GUUCUGUUCCAUAAACUCU81.19171607

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1040-1062AGGTTCTGTTCCATAAACTCTGGAGAGUUUAUGGAACAGAACCUGUUCUGUUCCAUAAACUCUGGU14.619.232


Target Position: 5333, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5333GAAAUAUUUAGUUGUCAUA96.7643115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5331-5353ATGAAATATTTAGTTGTCATATAUAUGACAACUAAAUAUUUCAUGAAAUAUUUAGUUGUCAUAUAU20.5-10.322


Target Position: 6213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6213GUACUGAAGAGCUAUUACA92.9044304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6211-6233TTGTACTGAAGAGCTATTACAATUGUAAUAGCUCUUCAGUACAAGUACUGAAGAGCUAUUACAAUU6.320.332


Target Position: 2823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2823UGUUAAAAGUUGGAAAUAA87.4936754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282841TGTTAAAAGTTGGAAATAATTATTTCCAACTTTTAACA0.315600.073800.672400.750001.000001.00000


Target Position: 4820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4820UGUAUGGUCAAUAACAUUU73.83113029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6944838TGTATGGTCAATAACATTTAAATGTTATTGACCATACA0.189800.052100.706900.750001.000001.00000


Target Position: 5237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5237CAAAAUAGCAUCACACAAA96.0934136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8365255CAAAATAGCATCACACAAATTTGTGTGATGCTATTTTG0.445900.236100.646600.750001.000001.00000


Target Position: 4467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4467UGCCAAAAUUGCACUAUUA88.2673678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4464485TGCCAAAATTGCACTATTATAATAGTGCAATTTTGGCA0.266600.067100.819000.750000.967400.62500


Target Position: 5569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5569UGGAUGGAUUGAAAAGAUU75.35132730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7635587TGGATGGATTGAAAAGATTAATCTTTTCAATCCATCCA0.242000.034500.836200.750001.000001.00000


Target Position: 2910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2910UGAACAGCGAGCUAAAUAU80.98021649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602928TGAACAGCGAGCTAAATATATATTTAGCTCGCTGTTCA0.295400.063000.681000.750001.000001.00000


Target Position: 5944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5944GAACAUUUUAGAAAAGGUA93.3653280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5942-5964GTGAACATTTTAGAAAAGGTATGUACCUUUUCUAAAAUGUUCACGAACAUUUUAGAAAAGGUAUGU17.35.322


Target Position: 4487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4487AGGACUUGUAUUGUUAUUU74.17432961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5854505AGGACTTGTATTGTTATTTAAATAACAATACAAGTCCT0.314500.056300.844800.750001.000001.00000


Target Position: 6624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6624UGCAACAUCUUGUAAAAAA83.86811210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9646642TGCAACATCTTGTAAAAAATTTTTTACAAGATGTTGCA0.406200.047300.853400.750001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392GCUUUAAUAGGACACUUCU83.85121212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931410GCTTTAATAGGACACTTCTAGAAGTGTCCTATTAAAGC0.204600.027600.629300.750001.000001.00000


Target Position: 6635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6635GUAAAAAAAAAAAAAAAAA85.6732980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6636653GTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAC0.992000.917000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6633-6655TTGTAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUACAAGUAAAAAAAAAAAAAAAAAAAU-11.3-9.100


Target Position: 2171, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171CCUGUAAUAACAAGUAUUU82.79731367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2169-2191ATCCTGTAATAACAAGTATTTCGAAAUACUUGUUAUUACAGGAUCCUGUAAUAACAAGUAUUUCGU4.611.623


Target Position: 4493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4493UGUAUUGUUAUUUAAAUUA82.27561448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6324511TGTATTGTTATTTAAATTATAATTTAAATAACAATACA0.266200.101400.672400.750001.000001.00000


Target Position: 929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929GAUUCUUACCCCAUUAAGU84.57171111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
927-949GAGATTCTTACCCCATTAAGTATACUUAAUGGGGUAAGAAUCUCGAUUCUUACCCCAUUAAGUAUU3.56.933


Target Position: 6292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6292UGGUGGAUGACAAAAGAAA84.01331183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8256310TGGTGGATGACAAAAGAAATTTCTTTTGTCATCCACCA0.766900.037400.844800.750001.000001.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288GUGUGCAUUCCCUAUCAAA93.9622231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691306GTGTGCATTCCCTATCAAATTTGATAGGGAATGCACAC0.583400.125300.793100.750001.000001.00000


Target Position: 5669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5669GUGUUUUAUGUUAAGCAAA88.4005668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5667-5689GTGTGTTTTATGTTAAGCAAAACUUUGCUUAACAUAAAACACACGUGUUUUAUGUUAAGCAAAACU19.77.222


Target Position: 4721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4721AGAAAACUCAGAAGAGAUA89.7091540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9764739AGAAAACTCAGAAGAGATATATCTCTTCTGAGTTTTCT0.210300.021600.681000.750000.907600.87500


Target Position: 2892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892CCAAUGACCUGCUGAAAUU84.57491110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2890-2912CCCCAATGACCTGCTGAAATTGAAAUUUCAGCAGGUCAUUGGGGCCAAUGACCUGCUGAAAUUGAU12.020.533


Target Position: 2821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821AGUGUUAAAAGUUGGAAAU76.51382505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622839AGTGTTAAAAGTTGGAAATATTTCCAACTTTTAACACT0.552600.253700.698300.750001.000001.00000


Target Position: 3227, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227GAAGAUCAGUUUCCUAAUU86.0229936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3225-3247CAGAAGATCAGTTTCCTAATTCAAAUUAGGAAACUGAUCUUCUGGAAGAUCAGUUUCCUAAUUCAU19.920.423


Target Position: 5852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5852CGUAAACAUUUAAAGUGUU86.4821870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5850-5872GACGTAAACATTTAAAGTGTTATAACACUUUAAAUGUUUACGUCCGUAAACAUUUAAAGUGUUAUU17.814.722


Target Position: 2701, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2701CAUUUAUGUACAUAAUCCU84.74371091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2699-2721CTCATTTATGTACATAATCCTGTAGGAUUAUGUACAUAAAUGAGCAUUUAUGUACAUAAUCCUGUU15.4-1.832


Target Position: 6615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6615GUAAAGUGAUGCAACAUCU86.99814

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6613-6635AAGTAAAGTGATGCAACATCTTGAGAUGUUGCAUCACUUUACUUGUAAAGUGAUGCAACAUCUUGU20.511.822


Target Position: 5868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5868GUUAUAUUUUUUAUAAAAA94.1543221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5866-5888GTGTTATATTTTTTATAAAAATGUUUUUAUAAAAAAUAUAACACGUUAUAUUUUUUAUAAAAAUGU-7.5-8.021


Target Position: 6606, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6606GCAAUUAAAGUAAAGUGAU84.82741076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6604-6626ATGCAATTAAAGTAAAGTGATGCAUCACUUUACUUUAAUUGCAUGCAAUUAAAGUAAAGUGAUGCU19.2-1.423


Target Position: 2427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427CCAUUGUCUAUGAAAUUCA89.5018562

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2425-2447TCCCATTGTCTATGAAATTCATCUGAAUUUCAUAGACAAUGGGACCAUUGUCUAUGAAAUUCAUCU10.420.522


Target Position: 2962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2962UGGAAAAGUAAUAGUUCAA84.2671151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152980TGGAAAAGTAATAGTTCAATTGAACTATTACTTTTCCA0.182400.079000.698300.750001.000001.00000


Target Position: 5547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5547CAUAGGUAGAGCAAAGAAA94.8812175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5545-5567CTCATAGGTAGAGCAAAGAAAGGUUUCUUUGCUCUACCUAUGAGCAUAGGUAGAGCAAAGAAAGGU12.219.832


Target Position: 4047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4047CACCUUAUCCUGACGUAAA92.8689310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5464065CACCTTATCCTGACGTAAATTTACGTCAGGATAAGGTG0.235000.224100.793100.750001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GCAAUACCAUAAAUUCUUC77.45462325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
646813GCAATACCATAAATTCTTCGAAGAATTTATGGTATTGC0.456600.167400.681000.750001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966UGGAUUUCGGAGGAAUAAU68.444042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381984TGGATTTCGGAGGAATAATATTATTCCTCCGAAATCCA0.372600.042100.836200.750001.000001.00000


Target Position: 3487, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3487GACUUUGUUGGACAAUGAU86.0911930

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3485-3507GGGACTTTGTTGGACAATGATGGAUCAUUGUCCAACAAAGUCCCGACUUUGUUGGACAAUGAUGGU20.517.823


Target Position: 868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868GAAAGAUGGUUUUAUGUUU90.4756473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
866-888ACGAAAGATGGTTTTATGTTTTTAAACAUAAAACCAUCUUUCGUGAAAGAUGGUUUUAUGUUUUUU6.912.032


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332AGUCCAUUACUGCAAAAUA93.2497287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223350AGTCCATTACTGCAAAATATATTTTGCAGTAATGGACT0.140300.063300.663800.750001.000001.00000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443UCAUCCAACCAAAUCUUUU71.09773538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702461TCATCCAACCAAATCTTTTAAAAGATTTGGTTGGATGA0.332000.062800.724100.750001.000001.00000


Target Position: 4826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4826GUCAAUAACAUUUUUCAUU78.29752151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8984844GTCAATAACATTTTTCATTAATGAAAAATGTTATTGAC0.568000.114000.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4824-4846TGGTCAATAACATTTTTCATTACAAUGAAAAAUGUUAUUGACCAGUCAAUAACAUUUUUCAUUACU7.48.912


Target Position: 6041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6041CCCCACCCUCAUUACAUCA79.5791909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6106059CCCCACCCTCATTACATCATGATGTAATGAGGGTGGGG0.341300.150800.767200.750001.000001.00000


Target Position: 4446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446GCCAUCGAUAUUCUUUGCU66.00544500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9914464GCCATCGATATTCTTTGCTAGCAAAGAATATCGATGGC0.134100.030700.646600.750001.000001.00000


Target Position: 2776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2776GGAAAUUAAGGGAAAUGAU89.2251592

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2774-2796CTGGAAATTAAGGGAAATGATATAUCAUUUCCCUUAAUUUCCAGGGAAAUUAAGGGAAAUGAUAUU16.32.122


Target Position: 6145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6145UGCAGGAAAAUGAUUAUAA85.32921025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4956163TGCAGGAAAATGATTATAATTATAATCATTTTCCTGCA0.519100.097600.819000.750001.000001.00000


Target Position: 2089, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089CAUGAAUAAGCAUUUCAAU89.4258570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2087-2109GCCATGAATAAGCATTTCAATATAUUGAAAUGCUUAUUCAUGGCCAUGAAUAAGCAUUUCAAUAUU7.48.722


Target Position: 5397, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5397GUGAACAUGUAGAUGUUUU83.63481242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5395-5417ATGTGAACATGTAGATGTTTTGTAAAACAUCUACAUGUUCACAUGUGAACAUGUAGAUGUUUUGUU14.820.522


Target Position: 5778, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5778CUUCAUUCUGUGGAAUUUU74.36532927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9425796CTTCATTCTGTGGAATTTTAAAATTCCACAGAATGAAG0.186200.023400.637900.750000.978300.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5776-5798TGCTTCATTCTGTGGAATTTTGTAAAAUUCCACAGAAUGAAGCACUUCAUUCUGUGGAAUUUUGUU14.216.322


Target Position: 6287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6287GUAAAUGGUGGAUGACAAA91.7225363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6285-6307TTGTAAATGGTGGATGACAAAAGUUUGUCAUCCACCAUUUACAAGUAAAUGGUGGAUGACAAAAGU20.512.822


Target Position: 1712, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712GUUAUCACUGGGAAGAAGA80.87791672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1710-1732TGGTTATCACTGGGAAGAAGATCUCUUCUUCCCAGUGAUAACCAGUUAUCACUGGGAAGAAGAUCU19.116.122


Target Position: 2864, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864CAUUCUGAAGCCGUUUUAU81.38981579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884TACATTCTGAAGCCGTTTTATGCAUAAAACGGCUUCAGAAUGUACAUUCUGAAGCCGUUUUAUGCU7.120.433


Target Position: 1524, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524CUAUAUCCACCUUCAUUAA93.9856230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251542CTATATCCACCTTCATTAATTAATGAAGGTGGATATAG0.193300.138100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1522-1544ATCTATATCCACCTTCATTAAAGUUAAUGAAGGUGGAUAUAGAUCUAUAUCCACCUUCAUUAAAGU8.916.732


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113GAAAAAAGAGAUCCACAAA96.9767111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791131GAAAAAAGAGATCCACAAATTTGTGGATCTCTTTTTTC0.199900.200100.672400.750001.000001.00000


Target Position: 4122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4122ACUGCCCAGACCCCUUAUA71.29853500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6794140ACTGCCCAGACCCCTTATATATAAGGGGTCTGGGCAGT0.518900.351700.663800.750001.000001.00000


Target Position: 4067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4067ACCUUUGAUAUAACUGUUU71.113537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9774085ACCTTTGATATAACTGTTTAAACAGTTATATCAAAGGT0.133400.049000.853400.750001.000001.00000


Target Position: 4515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4515GAUUCUAAGGAAUUUCUUA99.940439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4513-4535TGGATTCTAAGGAATTTCTTATCUAAGAAAUUCCUUAGAAUCCAGAUUCUAAGGAAUUUCUUAUCU5.36.922


Target Position: 5940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5940CUGUGAACAUUUUAGAAAA96.5171124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9755958CTGTGAACATTTTAGAAAATTTTCTAAAATGTTCACAG0.506500.024600.784500.750001.000001.00000


Target Position: 6518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6518CUUCUAAGAAUUAGAUACU80.95691654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6516-6538TTCTTCTAAGAATTAGATACTTGAGUAUCUAAUUCUUAGAAGAACUUCUAAGAAUUAGAUACUUGU15.811.722


Target Position: 3830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3830UGUAUGCUGGAUGAAAAAU70.05143738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303848TGTATGCTGGATGAAAAATATTTTTCATCCAGCATACA0.459700.023800.698300.750001.000001.00000


Target Position: 5030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5030CGGCUAAUUUUUGUAUUUU81.49491558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4205048CGGCTAATTTTTGTATTTTAAAATACAAAAATTAGCCG0.356800.062800.913801.000001.000001.00000


Target Position: 4288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4288CGCUCCGUAUCCUUCUCUG73.26013152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9404306CGCTCCGTATCCTTCTCTGCAGAGAAGGATACGGAGCG0.410400.317900.637900.750001.000001.00000


Target Position: 6596, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6596GAUAAAUCAUGCAAUUAAA102.92713

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6594-6616CTGATAAATCATGCAATTAAAGTUUUAAUUGCAUGAUUUAUCAGGAUAAAUCAUGCAAUUAAAGUU-1.41.822


Target Position: 5858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5858CAUUUAAAGUGUUAUAUUU93.6139255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5856-5878AACATTTAAAGTGTTATATTTTTAAAUAUAACACUUUAAAUGUUCAUUUAAAGUGUUAUAUUUUUU-8.0-9.722


Target Position: 2708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2708GUACAUAAUCCUGUGUUUA90.4357475

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2706-2728ATGTACATAATCCTGTGTTTAAGUAAACACAGGAUUAUGUACAUGUACAUAAUCCUGUGUUUAAGU19.38.522


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644CCUGAAAACCAAAGCCUUU78.27332156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532662CCTGAAAACCAAAGCCTTTAAAGGCTTTGGTTTTCAGG0.232500.076300.844801.000000.945700.62500


Target Position: 2494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494GAAAAACCUGAAUUCAGUU86.6655845

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2492-2514GGGAAAAACCTGAATTCAGTTAGAACUGAAUUCAGGUUUUUCCCGAAAAACCUGAAUUCAGUUAGU19.212.621


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681GCAUAUUCUCCCCACAGAU87.2634778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
620699GCATATTCTCCCCACAGATATCTGTGGGGAGAATATGC0.384900.046400.672401.000000.951100.62500


Target Position: 4125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4125GCCCAGACCCCUUAUAUGA83.53491263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3964143GCCCAGACCCCTTATATGATCATATAAGGGGTCTGGGC0.422300.352400.775900.750001.000001.00000


Target Position: 6445, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6445GAAAAUCACGUUUGCUAUU81.36081584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9846463GAAAATCACGTTTGCTATTAATAGCAAACGTGATTTTC0.129400.027800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6443-6465GTGAAAATCACGTTTGCTATTTAAAUAGCAAACGUGAUUUUCACGAAAAUCACGUUUGCUAUUUAU19.77.422


Target Position: 4173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4173CCGAAAUGCGCCCAUCCUU71.95453376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2534191CCGAAATGCGCCCATCCTTAAGGATGGGCGCATTTCGG0.438900.175100.775901.000000.902200.62500


Target Position: 1210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CCUGAAUGAUGACAUUCUU87.5398746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1208-1230AGCCTGAATGATGACATTCTTTTAAGAAUGUCAUCAUUCAGGCUCCUGAAUGAUGACAUUCUUUUU19.218.132


Target Position: 5377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5377GCUACUCUGAUCUAAUGAA96.7183117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7755395GCTACTCTGATCTAATGAATTCATTAGATCAGAGTAGC0.165800.034200.681001.000001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732CACGAAGAUCCCAUUGAAU86.5552859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521750CACGAAGATCCCATTGAATATTCAATGGGATCTTCGTG0.266100.066300.784500.750001.000001.00000


Target Position: 3584, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3584GGAAUCAUCAUGAAAGAUU84.98661063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923602GGAATCATCATGAAAGATTAATCTTTCATGATGATTCC0.217100.048800.862101.000000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3582-3604AGGGAATCATCATGAAAGATTTTAAUCUUUCAUGAUGAUUCCCUGGAAUCAUCAUGAAAGAUUUUU14.816.222


Target Position: 3064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3064GCUGAAAAAGAGAAAGCAA95.221166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3773082GCTGAAAAAGAGAAAGCAATTGCTTTCTCTTTTTCAGC0.407500.087800.706901.000001.000001.00000


Target Position: 3968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3968CAAACUCAAAAGUUUACCA86.1574909

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3966-3988TGCAAACTCAAAAGTTTACCACCUGGUAAACUUUUGAGUUUGCACAAACUCAAAAGUUUACCACCU21.119.232


Target Position: 5420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5420GUAUUUUUUUAAAUGAAAA92.0624343

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5418-5440GTGTATTTTTTTAAATGAAAACTUUUUCAUUUAAAAAAAUACACGUAUUUUUUUAAAUGAAAACUU7.4-9.710


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066UGAAAAAGAGAAAGCAAAU77.32356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843084TGAAAAAGAGAAAGCAAATATTTGCTTTCTCTTTTTCA0.477700.177900.715500.750001.000001.00000


Target Position: 4793, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4793CUAGUGUUUCAAAACACUU80.9151661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4791-4813TTCTAGTGTTTCAAAACACTTTTAAGUGUUUUGAAACACUAGAACUAGUGUUUCAAAACACUUUUU17.819.022


Target Position: 2758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758GGGCAAUGAAAAUGUACUG76.17612577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572776GGGCAATGAAAATGTACTGCAGTACATTTTCATTGCCC0.250400.027700.706900.750001.000001.00000


Target Position: 2963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963GGAAAAGUAAUAGUUCAAC72.81063234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612981GGAAAAGTAATAGTTCAACGTTGAACTATTACTTTTCC0.151200.056600.724100.750001.000001.00000


Target Position: 4870, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4870GUAAACAUUCCCUUUUAAA88.396669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4868-4890AGGTAAACATTCCCTTTTAAATGUUUAAAAGGGAAUGUUUACCUGUAAACAUUCCCUUUUAAAUGU-3.86.922


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045AGUGAGAGCACGAUGAAUA92.1988334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692063AGTGAGAGCACGATGAATATATTCATCGTGCTCTCACT0.305400.033100.663800.750000.967400.62500


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791GUAGGCAAUACCAUAAAUU82.16291456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
605809GTAGGCAATACCATAAATTAATTTATGGTATTGCCTAC0.337300.054200.672400.750000.940200.87500


Target Position: 6149, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6149GGAAAAUGAUUAUAACUAA106.9762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1186167GGAAAATGATTATAACTAATTAGTTATAATCATTTTCC0.522000.362600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6147-6169CAGGAAAATGATTATAACTAAAAUUAGUUAUAAUCAUUUUCCUGGGAAAAUGAUUAUAACUAAAAU6.37.422


Target Position: 2518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518CCCGAGAAUGGUCAUAAAU79.29351956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4802536CCCGAGAATGGTCATAAATATTTATGACCATTCTCGGG0.255800.055500.982801.000000.945700.75000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426CCCAUUGUCUAUGAAAUUC66.52664404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402444CCCATTGTCTATGAAATTCGAATTTCATAGACAATGGG0.422100.079800.819000.750001.000001.00000


Target Position: 4636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4636UCUGGGUUGAAUUUUUUAA76.08412597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9064654TCTGGGTTGAATTTTTTAATTAAAAAATTCAACCCAGA0.178000.027000.689700.750001.000001.00000


Target Position: 5901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5901GAUAUGAGAAAAAUUUUGU80.44041747

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5899-5921ATGATATGAGAAAAATTTTGTTAACAAAAUUUUUCUCAUAUCAUGAUAUGAGAAAAAUUUUGUUAU-3.313.322


Target Position: 1290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290GUGCAUUCCCUAUCAAAUA90.1824491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911308GTGCATTCCCTATCAAATATATTTGATAGGGAATGCAC0.428600.159100.750000.750001.000001.00000


Target Position: 3177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177CUACAGAAAUGGUUUCAAA97.422495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3175-3197AACTACAGAAATGGTTTCAAATGUUUGAAACCAUUUCUGUAGUUCUACAGAAAUGGUUUCAAAUGU14.920.321


Target Position: 5275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5275GGAUGUAAUGUACAUAGAU97.825279

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5273-5295CAGGATGTAATGTACATAGATGAAUCUAUGUACAUUACAUCCUGGGAUGUAAUGUACAUAGAUGAU20.316.123


Target Position: 3718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3718GACUCAUAAUCCAACUGUA105.3013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083736GACTCATAATCCAACTGTATACAGTTGGATTATGAGTC0.530900.095900.637900.750001.000001.00000


Target Position: 2314, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2314CAGUAUUCUUGAAUGUUAU92.8888308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922332CAGTATTCTTGAATGTTATATAACATTCAAGAATACTG0.128300.057900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2312-2334AACAGTATTCTTGAATGTTATACAUAACAUUCAAGAAUACUGUUCAGUAUUCUUGAAUGUUAUACU6.914.532


Target Position: 3180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3180CAGAAAUGGUUUCAAAUGA88.1512689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3178-3200TACAGAAATGGTTTCAAATGAATUCAUUUGAAACCAUUUCUGUACAGAAAUGGUUUCAAAUGAAUU13.812.021


Target Position: 5287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5287CAUAGAUGACAUUAAGAAA103.5948

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5285-5307TACATAGATGACATTAAGAAAATUUUCUUAAUGUCAUCUAUGUACAUAGAUGACAUUAAGAAAAUU7.113.322


Target Position: 3884, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3884GACAUGUAUGAUAAAGAAU89.5718555

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3882-3904GAGACATGTATGATAAAGAATACAUUCUUUAUCAUACAUGUCUCGACAUGUAUGAUAAAGAAUACU7.120.422


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CCCUCAUGUGAAUUUUCUC72.97783206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721642CCCTCATGTGAATTTTCTCGAGAAAATTCACATGAGGG0.552800.330600.681000.750001.000001.00000


Target Position: 3558, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3558GAGAAGUUUCCCAAUUUCU82.1321462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3556-3578AGGAGAAGTTTCCCAATTTCTGAAGAAAUUGGGAAACUUCUCCUGAGAAGUUUCCCAAUUUCUGAU7.417.722


Target Position: 3173, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173CCAACUACAGAAAUGGUUU80.95861652

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3171-3193GCCCAACTACAGAAATGGTTTCAAAACCAUUUCUGUAGUUGGGCCCAACUACAGAAAUGGUUUCAU18.819.022


Target Position: 3230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230GAUCAGUUUCCUAAUUCAU89.6373546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250AAGATCAGTTTCCTAATTCATCTAUGAAUUAGGAAACUGAUCUUGAUCAGUUUCCUAAUUCAUCUU8.919.222


Target Position: 4868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4868AGGUAAACAUUCCCUUUUA90.1852490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8194886AGGTAAACATTCCCTTTTATAAAAGGGAATGTTTACCT0.949000.029800.810300.750000.929300.62500


Target Position: 787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787CUUUGUAGGCAAUACCAUA95.1836168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
785-807TTCTTTGTAGGCAATACCATAAAUAUGGUAUUGCCUACAAAGAACUUUGUAGGCAAUACCAUAAAU20.011.823


Target Position: 6148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6148AGGAAAAUGAUUAUAACUA90.1307496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6216166AGGAAAATGATTATAACTATAGTTATAATCATTTTCCT0.513000.358300.672400.750001.000001.00000


Target Position: 6146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6146GCAGGAAAAUGAUUAUAAC85.23331037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3886164GCAGGAAAATGATTATAACGTTATAATCATTTTCCTGC0.503300.109200.706900.750001.000001.00000


Target Position: 1900, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CAAGGUUUUCCCAAAUAGU80.30281773

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1898-1920TACAAGGTTTTCCCAAATAGTGCACUAUUUGGGAAAACCUUGUACAAGGUUUUCCCAAAUAGUGCU3.517.332


Target Position: 3721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721UCAUAAUCCAACUGUAAAA85.31791028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5153739TCATAATCCAACTGTAAAATTTTACAGTTGGATTATGA0.426900.333500.724100.750001.000001.00000


Target Position: 6242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6242UGCCGUUUCAUAAAUGUAA79.53071920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8676260TGCCGTTTCATAAATGTAATTACATTTATGAAACGGCA0.149700.043300.819000.750001.000001.00000


Target Position: 3463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463GCAUUUUGGUUGUGUAUAU90.2862483

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3461-3483GGGCATTTTGGTTGTGTATATCAAUAUACACAACCAAAAUGCCCGCAUUUUGGUUGUGUAUAUCAU15.84.223


Target Position: 5692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5692ACUUUAGAAACAAAUGAAA84.26651152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3755710ACTTTAGAAACAAATGAAATTTCATTTGTTTCTAAAGT0.526100.161700.706900.750001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283GCCAUGUGUGCAUUCCCUA87.1085800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601301GCCATGTGTGCATTCCCTATAGGGAATGCACACATGGC0.347300.057100.827601.000001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967GGAUUUCGGAGGAAUAAUA95.9678141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641985GGATTTCGGAGGAATAATATATTATTCCTCCGAAATCC0.427100.040200.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1965-1987TTGGATTTCGGAGGAATAATAAAUAUUAUUCCUCCGAAAUCCAAGGAUUUCGGAGGAAUAAUAAAU1.816.733


Target Position: 6003, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6003GUAAAUUGCGAUAAGGAAA87.5486745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6001-6023CTGTAAATTGCGATAAGGAAATGUUUCCUUAUCGCAAUUUACAGGUAAAUUGCGAUAAGGAAAUGU19.9-1.433


Target Position: 3889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889GUAUGAUAAAGAAUACUAU95.9975138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3887-3909ATGTATGATAAAGAATACTATAGAUAGUAUUCUUUAUCAUACAUGUAUGAUAAAGAAUACUAUAGU6.310.232


Target Position: 5451, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5451CAAGUAAUUUGUUGAUAAA100.81829

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5449-5471GACAAGTAATTTGTTGATAAATAUUUAUCAACAAAUUACUUGUCCAAGUAAUUUGUUGAUAAAUAU8.94.632


Target Position: 4821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4821GUAUGGUCAAUAACAUUUU82.53231407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5894839GTATGGTCAATAACATTTTAAAATGTTATTGACCATAC0.217500.061900.681000.750001.000001.00000


Target Position: 4890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4890GUUUGUUUGUUUUUUGAGA83.13171328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4888-4910ATGTTTGTTTGTTTTTTGAGACAUCUCAAAAAACAAACAAACAUGUUUGUUUGUUUUUUGAGACAU12.25.600


Target Position: 6245, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6245CGUUUCAUAAAUGUAAUAA88.5302650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7706263CGTTTCATAAATGTAATAATTATTACATTTATGAAACG0.167700.070400.741401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6243-6265GCCGTTTCATAAATGTAATAAGTUUAUUACAUUUAUGAAACGGCCGUUUCAUAAAUGUAAUAAGUU8.514.832


Target Position: 1334, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334GUCAACAAAAACAAUGUGA78.37412133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1332-1354TCGTCAACAAAAACAATGTGAGAUCACAUUGUUUUUGUUGACGAGUCAACAAAAACAAUGUGAGAU18.120.522


Target Position: 6362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6362CGCAUCAAUAGAAAGAACU75.2462746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8146380CGCATCAATAGAAAGAACTAGTTCTTTCTATTGATGCG0.610500.260500.715500.750001.000001.00000


Target Position: 5768, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5768CUUUGUGAUGCUUCAUUCU78.47442118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5766-5788AACTTTGTGATGCTTCATTCTGTAGAAUGAAGCAUCACAAAGUUCUUUGUGAUGCUUCAUUCUGUU16.320.532


Target Position: 3585, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585GAAUCAUCAUGAAAGAUUU96.3727129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6173603GAATCATCATGAAAGATTTAAATCTTTCATGATGATTC0.223000.068000.672400.750000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3583-3605GGGAATCATCATGAAAGATTTTAAAAUCUUUCAUGAUGAUUCCCGAAUCAUCAUGAAAGAUUUUAU5.316.222


Target Position: 5439, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5439CUCAAAAUAAGACAAGUAA88.6704639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5455457CTCAAAATAAGACAAGTAATTACTTGTCTTATTTTGAG0.235300.115700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5437-5459AACTCAAAATAAGACAAGTAATTUUACUUGUCUUAUUUUGAGUUCUCAAAAUAAGACAAGUAAUUU19.07.422


Target Position: 3205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3205AGACUACCGAGCUACUUUU81.79681511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943223AGACTACCGAGCTACTTTTAAAAGTAGCTCGGTAGTCT0.143700.114900.724100.750001.000001.00000


Target Position: 2696, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696GAUCUCAUUUAUGUACAUA97.0926105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052714GATCTCATTTATGTACATATATGTACATAAATGAGATC0.278500.043500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2694-2716TTGATCTCATTTATGTACATAATUAUGUACAUAAAUGAGAUCAAGAUCUCAUUUAUGUACAUAAUU20.420.422


Target Position: 4469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4469CCAAAAUUGCACUAUUAUA96.3715130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6564487CCAAAATTGCACTATTATATATAATAGTGCAATTTTGG0.197800.047400.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4467-4489TGCCAAAATTGCACTATTATAGGUAUAAUAGUGCAAUUUUGGCACCAAAAUUGCACUAUUAUAGGU-2.7-3.322


Target Position: 5707, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5707GAAAAAGGCAAUUGAAAAU83.64031241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6775725GAAAAAGGCAATTGAAAATATTTTCAATTGCCTTTTTC0.624900.331800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5705-5727ATGAAAAAGGCAATTGAAAATCCAUUUUCAAUUGCCUUUUUCAUGAAAAAGGCAAUUGAAAAUCCU7.79.522


Target Position: 827, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CAUCCAUUGCAUUCGAUAU88.9949610

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_482719CATCCATTGCATTCGATAT1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116339763..116339781(+)00MET(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
825-847ATCATCCATTGCATTCGATATCAAUAUCGAAUGCAAUGGAUGAUCAUCCAUUGCAUUCGAUAUCAU17.920.132


Target Position: 4468, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4468GCCAAAAUUGCACUAUUAU83.60141248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7974486GCCAAAATTGCACTATTATATAATAGTGCAATTTTGGC0.161600.066700.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4466-4488TTGCCAAAATTGCACTATTATAGAUAAUAGUGCAAUUUUGGCAAGCCAAAAUUGCACUAUUAUAGU6.311.332


Target Position: 2686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2686CAAAUACUUUGAUCUCAUU91.0013421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312704CAAATACTTTGATCTCATTAATGAGATCAAAGTATTTG0.173000.066400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2684-2706TCCAAATACTTTGATCTCATTTAAAUGAGAUCAAAGUAUUUGGACAAAUACUUUGAUCUCAUUUAU20.44.622


Target Position: 5842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5842GUUUUGUCGACGUAAACAU80.84251681

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5840-5862TGGTTTTGTCGACGTAAACATTTAUGUUUACGUCGACAAAACCAGUUUUGUCGACGUAAACAUUUU14.714.933


Target Position: 5866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5866GUGUUAUAUUUUUUAUAAA98.242766

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5864-5886AAGTGTTATATTTTTTATAAAAAUUUAUAAAAAAUAUAACACUUGUGUUAUAUUUUUUAUAAAAAU-7.58.521


Target Position: 4662, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662GUACCACUUGAUUUCAUAU90.6425450

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10466219GTACCACTTGATTTCATAT1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116436465..116436483(+)00MET(0.002)


Target Position: 6042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6042CCCACCCUCAUUACAUCAU71.86573394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4006060CCCACCCTCATTACATCATATGATGTAATGAGGGTGGG0.289400.141000.836201.000001.000001.00000


Target Position: 6594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6594CUGAUAAAUCAUGCAAUUA88.7027636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6592-6614TTCTGATAAATCATGCAATTAAAUAAUUGCAUGAUUUAUCAGAACUGAUAAAUCAUGCAAUUAAAU20.08.922


Target Position: 2520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CGAGAAUGGUCAUAAAUGU88.6887638

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2518-2540CCCGAGAATGGTCATAAATGTGCACAUUUAUGACCAUUCUCGGGCGAGAAUGGUCAUAAAUGUGCU-1.820.432


Target Position: 831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831CAUUGCAUUCGAUAUCAGU83.46651277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
829-851TCCATTGCATTCGATATCAGTGAACUGAUAUCGAAUGCAAUGGACAUUGCAUUCGAUAUCAGUGAU13.319.933


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800ACCAUAAAUUCUUCUUAUU79.30161955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741818ACCATAAATTCTTCTTATTAATAAGAAGAATTTATGGT0.595900.363800.844800.750001.000001.00000


Target Position: 6514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6514GAUUCUUCUAAGAAUUAGA94.2643215

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6512-6534GTGATTCTTCTAAGAATTAGATAUCUAAUUCUUAGAAGAAUCACGAUUCUUCUAAGAAUUAGAUAU6.914.832


Target Position: 2217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2217GCACUUUACUUACUUUAAC75.24482747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572235GCACTTTACTTACTTTAACGTTAAAGTAAGTAAAGTGC0.134600.071800.706900.750001.000001.00000


Target Position: 6315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6315GCUCUGUGGAAAGAAAGAA86.1282916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9266333GCTCTGTGGAAAGAAAGAATTCTTTCTTTCCACAGAGC0.180800.024000.681001.000001.000001.00000


Target Position: 856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GCUAAAGGAAACGAAAGAU80.51361736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
854-876AGGCTAAAGGAAACGAAAGATGGAUCUUUCGUUUCCUUUAGCCUGCUAAAGGAAACGAAAGAUGGU21.015.822


Target Position: 4881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4881CUUUUAAAUGUUUGUUUGU71.9863364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4879-4901CCCTTTTAAATGTTTGTTTGTTTACAAACAAACAUUUAAAAGGGCUUUUAAAUGUUUGUUUGUUUU12.2-9.101


Target Position: 2692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692CUUUGAUCUCAUUUAUGUA97.898174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2690-2712TACTTTGATCTCATTTATGTACAUACAUAAAUGAGAUCAAAGUACUUUGAUCUCAUUUAUGUACAU6.916.322


Target Position: 5032, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5032GCUAAUUUUUGUAUUUUUU82.23091449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2895050GCTAATTTTTGTATTTTTTAAAAAATACAAAAATTAGC0.350100.140100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5030-5052CGGCTAATTTTTGTATTTTTTGTAAAAAAUACAAAAAUUAGCCGGCUAAUUUUUGUAUUUUUUGUU-9.7-4.300


Target Position: 2280, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280GUGGAAAAACAUGUACUUU81.78931512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592298GTGGAAAAACATGTACTTTAAAGTACATGTTTTTCCAC0.133900.052700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2278-2300TGGTGGAAAAACATGTACTTTAAAAAGUACAUGUUUUUCCACCAGUGGAAAAACAUGUACUUUAAU19.020.122


Target Position: 3496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496GGACAAUGAUGGCAAGAAA102.96512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183514GGACAATGATGGCAAGAAATTTCTTGCCATCATTGTCC0.170800.024300.870701.000001.000001.00000


Target Position: 3699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3699GAAAUUUCAUUCGAAAUGA86.1012925

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3697-3719TCGAAATTTCATTCGAAATGAGAUCAUUUCGAAUGAAAUUUCGAGAAAUUUCAUUCGAAAUGAGAU14.10.432


Target Position: 1445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GAAUAUCGAACAGAGUUUA91.9862352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1443-1465ATGAATATCGAACAGAGTTTACCUAAACUCUGUUCGAUAUUCAUGAAUAUCGAACAGAGUUUACCU17.78.823


Target Position: 3720, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3720CUCAUAAUCCAACUGUAAA90.5565463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673738CTCATAATCCAACTGTAAATTTACAGTTGGATTATGAG0.479000.397800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3718-3740GACTCATAATCCAACTGTAAAAGUUUACAGUUGGAUUAUGAGUCCUCAUAAUCCAACUGUAAAAGU19.08.722


Target Position: 5295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5295ACAUUAAGAAAAUUUGUAU83.07771333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9335313ACATTAAGAAAATTTGTATATACAAATTTTCTTAATGT0.217400.088400.663800.750001.000001.00000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916GCGAGCUAAAUAUAGAGUG69.90173765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792934GCGAGCTAAATATAGAGTGCACTCTATATTTAGCTCGC0.226600.063200.629300.750001.000001.00000


Target Position: 371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371CUACAUGAGCAUCACAUUU83.00551347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
369-391TTCTACATGAGCATCACATTTTCAAAUGUGAUGCUCAUGUAGAACUACAUGAGCAUCACAUUUUCU20.521.512


Target Position: 4289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289GCUCCGUAUCCUUCUCUGU78.46092121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8484307GCTCCGTATCCTTCTCTGTACAGAGAAGGATACGGAGC0.288400.234800.646600.750001.000001.00000


Target Position: 2246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246CUAAACAGUGGGAAUUCUA87.7411728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2244-2266ACCTAAACAGTGGGAATTCTAGAUAGAAUUCCCACUGUUUAGGUCUAAACAGUGGGAAUUCUAGAU14.811.822


Target Position: 3486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3486GGACUUUGUUGGACAAUGA95.6213149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3484-3506TGGGACTTTGTTGGACAATGATGUCAUUGUCCAACAAAGUCCCAGGACUUUGUUGGACAAUGAUGU20.519.223


Target Position: 5378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5378CUACUCUGAUCUAAUGAAU85.45581007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7055396CTACTCTGATCTAATGAATATTCATTAGATCAGAGTAG0.293600.121200.663800.750001.000001.00000


Target Position: 3719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3719ACUCAUAAUCCAACUGUAA89.1713595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593737ACTCATAATCCAACTGTAATTACAGTTGGATTATGAGT0.529600.150600.672400.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336CCAGCCCAAACCAUUUCAA80.36481762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4492354CCAGCCCAAACCATTTCAATTGAAATGGTTTGGGCTGG0.300800.147900.698301.000001.000001.00000


Target Position: 6294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6294GUGGAUGACAAAAGAAAAU79.41971936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9746312GTGGATGACAAAAGAAAATATTTTCTTTTGTCATCCAC0.284900.058200.784500.750001.000001.00000


Target Position: 2959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2959CCUUGGAAAAGUAAUAGUU83.30661301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672977CCTTGGAAAAGTAATAGTTAACTATTACTTTTCCAAGG0.246400.022100.698301.000001.000001.00000


Target Position: 2216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2216GGCACUUUACUUACUUUAA93.8826237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1522234GGCACTTTACTTACTTTAATTAAAGTAAGTAAAGTGCC0.608900.335100.965501.000001.000001.00000


Target Position: 5833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5833CUCUAACUGGUUUUGUCGA78.84432049

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5831-5853TACTCTAACTGGTTTTGTCGACGUCGACAAAACCAGUUAGAGUACUCUAACUGGUUUUGUCGACGU21.118.933


Target Position: 4640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4640GGUUGAAUUUUUUAAAAAU93.7937244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4638-4660TGGGTTGAATTTTTTAAAAATCAAUUUUUAAAAAAUUCAACCCAGGUUGAAUUUUUUAAAAAUCAU-9.114.811


Target Position: 5841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5841GGUUUUGUCGACGUAAACA87.9655704

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5839-5861CTGGTTTTGTCGACGTAAACATTUGUUUACGUCGACAAAACCAGGGUUUUGUCGACGUAAACAUUU15.013.333


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721UGUUUAAGCCUUUUGAAAA84.4781123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232739TGTTTAAGCCTTTTGAAAATTTTCAAAAGGCTTAAACA0.203600.094600.706900.750001.000001.00000


Target Position: 2103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2103UCAAUAUGUCCAUAAUUAU82.64071390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432121TCAATATGTCCATAATTATATAATTATGGACATATTGA0.242300.058100.681000.750001.000001.00000


Target Position: 6569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6569GGUACUUCGUAUGUUAAUA95.7551148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6567-6589ATGGTACTTCGTATGTTAATAGTUAUUAACAUACGAAGUACCAUGGUACUUCGUAUGUUAAUAGUU6.921.432


Target Position: 2428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428CAUUGUCUAUGAAAUUCAU94.3024210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2426-2448CCCATTGTCTATGAAATTCATCCAUGAAUUUCAUAGACAAUGGGCAUUGUCUAUGAAAUUCAUCCU7.419.222


Target Position: 3065, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065CUGAAAAAGAGAAAGCAAA86.5139866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5043083CTGAAAAAGAGAAAGCAAATTTGCTTTCTCTTTTTCAG0.472200.134900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3063-3085GGCTGAAAAAGAGAAAGCAAATTUUUGCUUUCUCUUUUUCAGCCCUGAAAAAGAGAAAGCAAAUUU18.67.721


Target Position: 2822, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2822GUGUUAAAAGUUGGAAAUA85.34851023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4122840GTGTTAAAAGTTGGAAATATATTTCCAACTTTTAACAC0.556300.261400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2820-2842AAGTGTTAAAAGTTGGAAATAAGUAUUUCCAACUUUUAACACUUGUGUUAAAAGUUGGAAAUAAGU20.17.221


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326ACAAGAUCGUCAACAAAAA89.7027541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941344ACAAGATCGTCAACAAAAATTTTTGTTGACGATCTTGT0.288800.048600.706900.750001.000001.00000


Target Position: 400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
400CACUAACUACAUUUAUGUU91.9337354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
398-420GCCACTAACTACATTTATGTTTTAACAUAAAUGUAGUUAGUGGCCACUAACUACAUUUAUGUUUUU6.917.632


Target Position: 6142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6142UGUUGCAGGAAAAUGAUUA80.72691699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7926160TGTTGCAGGAAAATGATTATAATCATTTTCCTGCAACA0.497700.058700.672400.750001.000001.00000


Target Position: 4489, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4489GACUUGUAUUGUUAUUUAA101.12325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4487-4509AGGACTTGTATTGTTATTTAAATUUAAAUAACAAUACAAGUCCUGACUUGUAUUGUUAUUUAAAUU-7.519.022


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794GGCAAUACCAUAAAUUCUU81.72331525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167812GGCAATACCATAAATTCTTAAGAATTTATGGTATTGCC0.460300.169700.862101.000001.000001.00000


Target Position: 5620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5620CAAGCAAUUGGAAACAAAA95.4424156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5618-5640CGCAAGCAATTGGAAACAAAACTUUUUGUUUCCAAUUGCUUGCGCAAGCAAUUGGAAACAAAACUU5.618.512


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CCCCUCAUGUGAAUUUUCU73.83913026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261641CCCCTCATGTGAATTTTCTAGAAAATTCACATGAGGGG0.494200.339500.767200.750001.000001.00000


Target Position: 796, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796CAAUACCAUAAAUUCUUCU80.22331789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
794-816GGCAATACCATAAATTCTTCTTAAGAAGAAUUUAUGGUAUUGCCCAAUACCAUAAAUUCUUCUUAU14.820.022


Target Position: 2139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139CAACACAAUACAGUACAUU81.02071635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9282157CAACACAATACAGTACATTAATGTACTGTATTGTGTTG0.141100.107200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2137-2159GACAACACAATACAGTACATTCTAAUGUACUGUAUUGUGUUGUCCAACACAAUACAGUACAUUCUU19.019.322


Target Position: 2720, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720GUGUUUAAGCCUUUUGAAA87.9209705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802738GTGTTTAAGCCTTTTGAAATTTCAAAAGGCTTAAACAC0.211600.048400.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2718-2740CTGTGTTTAAGCCTTTTGAAAAGUUUCAAAAGGCUUAAACACAGGUGUUUAAGCCUUUUGAAAAGU7.77.212


Target Position: 2851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851GAAUAUACACUUACAUUCU91.2361401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2849-2871GAGAATATACACTTACATTCTGAAGAAUGUAAGUGUAUAUUCUCGAAUAUACACUUACAUUCUGAU16.11.133


Target Position: 5461, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5461GUUGAUAAAUAUUUUUAAA95.9873139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8585479GTTGATAAATATTTTTAAATTTAAAAATATTTATCAAC0.151800.046700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5459-5481TTGTTGATAAATATTTTTAAAGAUUUAAAAAUAUUUAUCAACAAGUUGAUAAAUAUUUUUAAAGAU-9.18.911


Target Position: 1324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324CAACAAGAUCGUCAACAAA98.091570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1322-1344TTCAACAAGATCGTCAACAAAAAUUUGUUGACGAUCUUGUUGAACAACAAGAUCGUCAACAAAAAU20.519.222


Target Position: 3560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3560GAAGUUUCCCAAUUUCUGA88.5501648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3558-3580GAGAAGTTTCCCAATTTCTGACCUCAGAAAUUGGGAAACUUCUCGAAGUUUCCCAAUUUCUGACCU12.013.322


Target Position: 5031, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5031GGCUAAUUUUUGUAUUUUU90.1325495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3475049GGCTAATTTTTGTATTTTTAAAAATACAAAAATTAGCC0.346500.078001.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5029-5051CCGGCTAATTTTTGTATTTTTTGAAAAAUACAAAAAUUAGCCGGGGCUAAUUUUUGUAUUUUUUGU-0.313.600


Target Position: 5720, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5720GAAAAUCCCAGCUAUUUCA89.5188560

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5718-5740TTGAAAATCCCAGCTATTTCACCUGAAAUAGCUGGGAUUUUCAAGAAAAUCCCAGCUAUUUCACCU6.914.222


Target Position: 4068, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068CCUUUGAUAUAACUGUUUA94.6855187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8734086CCTTTGATATAACTGTTTATAAACAGTTATATCAAAGG0.149100.054400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4066-4088CACCTTTGATATAACTGTTTACTUAAACAGUUAUAUCAAAGGUGCCUUUGAUAUAACUGUUUACUU17.812.022


Target Position: 962, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962GAAAGCAACAAUUUUAUUU81.63861537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622980GAAAGCAACAATTTTATTTAAATAAAATTGTTGCTTTC0.609200.175600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
960-982TTGAAAGCAACAATTTTATTTACAAAUAAAAUUGUUGCUUUCAAGAAAGCAACAAUUUUAUUUACU-9.718.621


Target Position: 5701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5701ACAAAUGAAAAAGGCAAUU63.58224881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9975719ACAAATGAAAAAGGCAATTAATTGCCTTTTTCATTTGT0.381900.291900.698300.750001.000001.00000


Target Position: 4682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4682GGAAAUUGAAGCAGGAAAU83.92081201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7924700GGAAATTGAAGCAGGAAATATTTCCTGCTTCAATTTCC0.162400.051400.862101.000001.000001.00000


Target Position: 6250, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6250CAUAAAUGUAAUAAGUAAU90.4522474

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6248-6270TTCATAAATGTAATAAGTAATACAUUACUUAUUACAUUUAUGAACAUAAAUGUAAUAAGUAAUACU6.6-1.802


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284CCAUGUGUGCAUUCCCUAU86.2953897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471302CCATGTGTGCATTCCCTATATAGGGAATGCACACATGG0.429100.058800.801701.000001.000001.00000


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523UCUAUAUCCACCUUCAUUA83.50351271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6251541TCTATATCCACCTTCATTATAATGAAGGTGGATATAGA0.208000.168000.689700.750001.000001.00000


Target Position: 5706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5706UGAAAAAGGCAAUUGAAAA84.92861069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8155724TGAAAAAGGCAATTGAAAATTTTCAATTGCCTTTTTCA0.654000.301400.724100.750001.000001.00000


Target Position: 3880, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3880CAGAGACAUGUAUGAUAAA100.59732

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7388019CAGAGACATGTATGATAAA1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116423403..116423421(+)00MET(0.002)


Target Position: 3073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3073GAGAAAGCAAAUUAAAGAU87.6224739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873091GAGAAAGCAAATTAAAGATATCTTTAATTTGCTTTCTC0.390100.197000.629300.750001.000001.00000


Target Position: 4612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4612CAUAUUGGAGUCCAAAACU79.68341889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4610-4632GTCATATTGGAGTCCAAAACTTGAGUUUUGGACUCCAAUAUGACCAUAUUGGAGUCCAAAACUUGU18.812.632


Target Position: 3592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592CAUGAAAGAUUUUAGUCAU93.3165282

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3590-3612ATCATGAAAGATTTTAGTCATCCAUGACUAAAAUCUUUCAUGAUCAUGAAAGAUUUUAGUCAUCCU20.312.023


Target Position: 6353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6353GAGCAUGAACGCAUCAAUA99.264449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8566371GAGCATGAACGCATCAATATATTGATGCGTTCATGCTC0.152100.055900.767200.750000.962000.75000


Target Position: 5460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5460UGUUGAUAAAUAUUUUUAA88.4309663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9295478TGTTGATAAATATTTTTAATTAAAAATATTTATCAACA0.154300.023800.672400.750001.000001.00000


Target Position: 1681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GCAUACAUUAAACCAAAAU80.48741738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1679-1701GAGCATACATTAAACCAAAATGGAUUUUGGUUUAAUGUAUGCUCGCAUACAUUAAACCAAAAUGGU18.813.322


Target Position: 3499, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3499CAAUGAUGGCAAGAAAAUU86.1082923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3497-3519GACAATGATGGCAAGAAAATTCAAAUUUUCUUGCCAUCAUUGUCCAAUGAUGGCAAGAAAAUUCAU5.313.612


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619UCAACCCCUCAUGUGAAUU61.36685224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901637TCAACCCCTCATGTGAATTAATTCACATGAGGGGTTGA0.476200.121000.715500.750001.000001.00000


Target Position: 4680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4680UGGGAAAUUGAAGCAGGAA76.51652504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9474698TGGGAAATTGAAGCAGGAATTCCTGCTTCAATTTCCCA0.135400.053800.672400.750001.000001.00000


Target Position: 4060, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4060CGUAAACACCUUUGAUAUA95.4489155

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8406019CGTAAACACCTTTGATATA1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116435768..116435786(+)00MET(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484078CGTAAACACCTTTGATATATATATCAAAGGTGTTTACG0.434800.041300.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4058-4080GACGTAAACACCTTTGATATAACUAUAUCAAAGGUGUUUACGUCCGUAAACACCUUUGAUAUAACU8.714.732


Target Position: 6581, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6581GUUAAUAGUUGUUCUGAUA96.1104133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6579-6601ATGTTAATAGTTGTTCTGATAAAUAUCAGAACAACUAUUAACAUGUUAAUAGUUGUUCUGAUAAAU20.4-2.322


Target Position: 958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958CUUUGAAAGCAACAAUUUU81.51741557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973976CTTTGAAAGCAACAATTTTAAAATTGTTGCTTTCAAAG0.524200.086500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978GCCTTTGAAAGCAACAATTTTATAAAAUUGUUGCUUUCAAAGGCCUUUGAAAGCAACAAUUUUAUU5.37.722


Target Position: 5229, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5229CAAAGUUUCAAAAUAGCAU83.89761207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5227-5249GTCAAAGTTTCAAAATAGCATCAAUGCUAUUUUGAAACUUUGACCAAAGUUUCAAAAUAGCAUCAU19.73.222


Target Position: 6626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6626CAACAUCUUGUAAAAAAAA92.9941301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8436644CAACATCTTGTAAAAAAAATTTTTTTTACAAGATGTTG0.525500.049200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6624-6646TGCAACATCTTGTAAAAAAAAAAUUUUUUUUACAAGAUGUUGCACAACAUCUUGUAAAAAAAAAAU-11.319.222


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976AGGAAUAAUAAAUUUGAUU79.35081946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621994AGGAATAATAAATTTGATTAATCAAATTTATTATTCCT0.259600.120000.836200.750001.000001.00000


Target Position: 4405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4405CACUUUGUCCAAUGGUUUU79.19791984

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4403-4425CACACTTTGTCCAATGGTTTTTTAAAACCAUUGGACAAAGUGUGCACUUUGUCCAAUGGUUUUUUU18.817.822


Target Position: 6244, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6244CCGUUUCAUAAAUGUAAUA88.2899675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7906262CCGTTTCATAAATGTAATATATTACATTTATGAAACGG0.162500.061400.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6242-6264TGCCGTTTCATAAATGTAATAAGUAUUACAUUUAUGAAACGGCACCGUUUCAUAAAUGUAAUAAGU6.721.133


Target Position: 2359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359GUUUGCUGUUAAAUUGAAA90.2331487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102377GTTTGCTGTTAAATTGAAATTTCAATTTAACAGCAAAC0.309700.040800.646600.750001.000001.00000


Target Position: 5441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5441CAAAAUAAGACAAGUAAUU82.4491420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9205459CAAAATAAGACAAGTAATTAATTACTTGTCTTATTTTG0.397900.155900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5439-5461CTCAAAATAAGACAAGTAATTTGAAUUACUUGUCUUAUUUUGAGCAAAAUAAGACAAGUAAUUUGU4.6-9.721


Target Position: 4491, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4491CUUGUAUUGUUAUUUAAAU85.7076973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964509CTTGTATTGTTATTTAAATATTTAAATAACAATACAAG0.402900.087700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4489-4511GACTTGTATTGTTATTTAAATTAAUUUAAAUAACAAUACAAGUCCUUGUAUUGUUAUUUAAAUUAU-9.76.912


Target Position: 2677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677GAUCCUUUCCAAAUACUUU88.7348633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112695GATCCTTTCCAAATACTTTAAAGTATTTGGAAAGGATC0.776400.038200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2675-2697GGGATCCTTTCCAAATACTTTGAAAAGUAUUUGGAAAGGAUCCCGAUCCUUUCCAAAUACUUUGAU4.618.722


Target Position: 5218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5218GGCAAUACAGUCAAAGUUU85.784962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7745236GGCAATACAGTCAAAGTTTAAACTTTGACTGTATTGCC0.166500.071001.000001.000001.000001.00000


Target Position: 3538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538GAACAGAAUCACUGACAUA105.2344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913556GAACAGAATCACTGACATATATGTCAGTGATTCTGTTC0.145500.034600.629300.750000.956500.87500


Target Position: 300, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300CCGAGAUGAAUGUGAAUAU88.1619688

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_330019CCGAGATGAATGTGAATAT1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116339236..116339254(+)00MET(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949318CCGAGATGAATGTGAATATATATTCACATTCATCTCGG0.135300.117700.870701.000001.000001.00000


Target Position: 2519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2519CCGAGAAUGGUCAUAAAUG76.36442541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7772537CCGAGAATGGTCATAAATGCATTTATGACCATTCTCGG0.222700.056800.758600.750001.000001.00000


Target Position: 2847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2847GUGAGAAUAUACACUUACA99.830842

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2845-2867CTGTGAGAATATACACTTACATTUGUAAGUGUAUAUUCUCACAGGUGAGAAUAUACACUUACAUUU19.020.432


Target Position: 1789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789CCUCUCUGCCCCACCCUUU69.24353888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981807CCTCTCTGCCCCACCCTTTAAAGGGTGGGGCAGAGAGG0.187100.166600.844801.000001.000001.00000


Target Position: 4488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4488GGACUUGUAUUGUUAUUUA103.34410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3604506GGACTTGTATTGTTATTTATAAATAACAATACAAGTCC0.610300.074900.836201.000001.000001.00000


Target Position: 1978, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978GAAUAAUAAAUUUGAUUUA96.9131113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751996GAATAATAAATTTGATTTATAAATCAAATTTATTATTC0.264600.173100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1976-1998AGGAATAATAAATTTGATTTAAAUAAAUCAAAUUUAUUAUUCCUGAAUAAUAAAUUUGAUUUAAAU7.4-8.022


Target Position: 5195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5195CUUUGGUUGGAAGAAUAUU75.26222743

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5193-5215TCCTTTGGTTGGAAGAATATTTAAAUAUUCUUCCAACCAAAGGACUUUGGUUGGAAGAAUAUUUAU6.618.832


Target Position: 307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307GAAUGUGAAUAUGAAGUAU94.8442179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
305-327ATGAATGTGAATATGAAGTATCAAUACUUCAUAUUCACAUUCAUGAAUGUGAAUAUGAAGUAUCAU20.320.532


Target Position: 6451, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6451CACGUUUGCUAUUUAUAAA96.2615131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6736469CACGTTTGCTATTTATAAATTTATAAATAGCAAACGTG0.436100.038900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6449-6471ATCACGTTTGCTATTTATAAACTUUUAUAAAUAGCAAACGUGAUCACGUUUGCUAUUUAUAAACUU-7.519.822


Target Position: 3690, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3690GAGAUCUUCGAAAUUUCAU82.01541478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3688-3710TGGAGATCTTCGAAATTTCATTCAUGAAAUUUCGAAGAUCUCCAGAGAUCUUCGAAAUUUCAUUCU7.419.122


Target Position: 1977, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977GGAAUAAUAAAUUUGAUUU88.4524661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711995GGAATAATAAATTTGATTTAAATCAAATTTATTATTCC0.259300.138400.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1975-1997GAGGAATAATAAATTTGATTTAAAAAUCAAAUUUAUUAUUCCUCGGAAUAAUAAAUUUGAUUUAAU7.41.822


Target Position: 5029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5029CCGGCUAAUUUUUGUAUUU79.25751963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5255047CCGGCTAATTTTTGTATTTAAATACAAAAATTAGCCGG0.367500.050900.913801.000001.000001.00000


Target Position: 2418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418GUGAAGAUCCCAUUGUCUA91.3453394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2416-2438CCGTGAAGATCCCATTGTCTATGUAGACAAUGGGAUCUUCACGGGUGAAGAUCCCAUUGUCUAUGU19.220.432


Target Position: 4126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4126CCCAGACCCCUUAUAUGAA89.44569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4694144CCCAGACCCCTTATATGAATTCATATAAGGGGTCTGGG0.259900.178500.819001.000001.000001.00000


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048GAGAGCACGAUGAAUACAU86.5957856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722066GAGAGCACGATGAATACATATGTATTCATCGTGCTCTC0.131800.030100.655200.750000.972800.75000


Target Position: 4769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4769AGAACAGGCCACUCAUUUA94.7233186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7174787AGAACAGGCCACTCATTTATAAATGAGTGGCCTGTTCT0.189500.035900.689700.750001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676GGAUCCUUUCCAAAUACUU84.76231086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582694GGATCCTTTCCAAATACTTAAGTATTTGGAAAGGATCC0.760700.033500.732801.000000.983700.62500


Target Position: 6622, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6622GAUGCAACAUCUUGUAAAA101.65318

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2662219GATGCAACATCTTGTAAAA1/1/0/0100.00METNM_000245.2+NM_001127500.11+1NANANANA00MET(0.002)


Target Position: 5659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5659GCAUUAGGGUGUGUUUUAU86.1691908

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5657-5679TTGCATTAGGGTGTGTTTTATGTAUAAAACACACCCUAAUGCAAGCAUUAGGGUGUGUUUUAUGUU7.217.422


Target Position: 3497, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497GACAAUGAUGGCAAGAAAA93.7664249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003515GACAATGATGGCAAGAAAATTTTCTTGCCATCATTGTC0.180500.030600.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3495-3517TGGACAATGATGGCAAGAAAATTUUUUCUUGCCAUCAUUGUCCAGACAAUGAUGGCAAGAAAAUUU12.220.512


Target Position: 2283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283GAAAAACAUGUACUUUAAA94.8071183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6092301GAAAAACATGTACTTTAAATTTAAAGTACATGTTTTTC0.216100.077900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2281-2303TGGAAAAACATGTACTTTAAAAAUUUAAAGUACAUGUUUUUCCAGAAAAACAUGUACUUUAAAAAU4.95.621


Target Position: 4103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103AGACUCCUACAACCCGAAU72.79833240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7124121AGACTCCTACAACCCGAATATTCGGGTTGTAGGAGTCT0.264800.075600.715500.750000.978300.75000


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955CCGUCCUUGGAAAAGUAAU75.14492771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782973CCGTCCTTGGAAAAGTAATATTACTTTTCCAAGGACGG0.319700.038400.905201.000001.000001.00000


Target Position: 4135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4135CUUAUAUGAAGUAAUGCUA90.5569462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4133-4155CCCTTATATGAAGTAATGCTAAAUAGCAUUACUUCAUAUAAGGGCUUAUAUGAAGUAAUGCUAAAU19.70.022


Target Position: 6270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6270CUAAUUCACAGAGUAUUGU71.51613458

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6268-6290TACTAATTCACAGAGTATTGTAAACAAUACUCUGUGAAUUAGUACUAAUUCACAGAGUAUUGUAAU11.68.931


Target Position: 3436, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3436GCAUUUCAAUGAAGUCAUA97.1774101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3434-3456GTGCATTTCAATGAAGTCATAGGUAUGACUUCAUUGAAAUGCACGCAUUUCAAUGAAGUCAUAGGU19.213.833


Target Position: 3187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187GGUUUCAAAUGAAUCUGUA97.429693

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3185-3207ATGGTTTCAAATGAATCTGTAGAUACAGAUUCAUUUGAAACCAUGGUUUCAAAUGAAUCUGUAGAU19.214.932


Target Position: 6293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6293GGUGGAUGACAAAAGAAAA100.55333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6126311GGTGGATGACAAAAGAAAATTTTCTTTTGTCATCCACC0.313900.044000.853401.000001.000001.00000


Target Position: 6150, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6150GAAAAUGAUUAUAACUAAA101.76117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9956168GAAAATGATTATAACTAAATTTAGTTATAATCATTTTC0.215900.179300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6148-6170AGGAAAATGATTATAACTAAAAGUUUAGUUAUAAUCAUUUUCCUGAAAAUGAUUAUAACUAAAAGU6.67.421


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954ACCGUCCUUGGAAAAGUAA74.35622930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402972ACCGTCCTTGGAAAAGTAATTACTTTTCCAAGGACGGT0.268400.040500.819000.750000.994600.75000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362UGCUGUUAAAUUGAAAAUU67.06544302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422380TGCTGTTAAATTGAAAATTAATTTTCAATTTAACAGCA0.251900.045200.844800.750001.000001.00000


Target Position: 6508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6508GUAAGUGAUUCUUCUAAGA90.6706446

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6506-6528GAGTAAGTGATTCTTCTAAGAATUCUUAGAAGAAUCACUUACUCGUAAGUGAUUCUUCUAAGAAUU11.720.313


Target Position: 4066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4066CACCUUUGAUAUAACUGUU87.9657703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9454084CACCTTTGATATAACTGTTAACAGTTATATCAAAGGTG0.135800.046100.646600.750001.000001.00000


Target Position: 6625, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6625GCAACAUCUUGUAAAAAAA98.178868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5376643GCAACATCTTGTAAAAAAATTTTTTTACAAGATGTTGC0.416800.049200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6623-6645ATGCAACATCTTGTAAAAAAAAAUUUUUUUACAAGAUGUUGCAUGCAACAUCUUGUAAAAAAAAAU-9.120.522


Target Position: 1544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544GGAGACCUCACCAUAGCUA91.3564393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011562GGAGACCTCACCATAGCTATAGCTATGGTGAGGTCTCC0.142900.030700.698301.000001.000001.00000


Target Position: 5411, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5411GUUUUGUGUGUAUUUUUUU79.07072005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9895429GTTTTGTGTGTATTTTTTTAAAAAAATACACACAAAAC0.128800.042400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5409-5431ATGTTTTGTGTGTATTTTTTTAAAAAAAAAUACACACAAAACAUGUUUUGUGUGUAUUUUUUUAAU-12.012.211


Target Position: 5434, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5434GAAAACUCAAAAUAAGACA86.1074924

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5432-5454ATGAAAACTCAAAATAAGACAAGUGUCUUAUUUUGAGUUUUCAUGAAAACUCAAAAUAAGACAAGU14.513.322


Target Position: 4879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4879CCCUUUUAAAUGUUUGUUU74.12492975

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4877-4899TTCCCTTTTAAATGTTTGTTTGTAAACAAACAUUUAAAAGGGAACCCUUUUAAAUGUUUGUUUGUU13.311.011


Target Position: 6043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6043CCACCCUCAUUACAUCAUC69.44143854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6906061CCACCCTCATTACATCATCGATGATGTAATGAGGGTGG0.284200.126000.663800.750001.000001.00000


Target Position: 5480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5480GAUAACUCAGCAUGUUUGU75.28062739

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5478-5500AAGATAACTCAGCATGTTTGTAAACAAACAUGCUGAGUUAUCUUGAUAACUCAGCAUGUUUGUAAU12.114.522


Target Position: 2257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257GAAUUCUAGACACAUUUCA87.0687805

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2255-2277GGGAATTCTAGACACATTTCAATUGAAAUGUGUCUAGAAUUCCCGAAUUCUAGACACAUUUCAAUU14.86.932


Target Position: 402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402CUAACUACAUUUAUGUUUU84.5221118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
400-422CACTAACTACATTTATGTTTTAAAAAACAUAAAUGUAGUUAGUGCUAACUACAUUUAUGUUUUAAU6.914.322


Target Position: 896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
896CAGUCCUACAUUGAUGUUU75.54792694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943914CAGTCCTACATTGATGTTTAAACATCAATGTAGGACTG0.176600.037100.784500.750001.000001.00000


Target Position: 2215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2215UGGCACUUUACUUACUUUA77.37442339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112233TGGCACTTTACTTACTTTATAAAGTAAGTAAAGTGCCA0.601900.185500.810300.750001.000001.00000


Target Position: 2752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2752CUCAAUGGGCAAUGAAAAU76.49992509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862770CTCAATGGGCAATGAAAATATTTTCATTGCCCATTGAG0.515100.042600.801700.750000.962000.62500


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633CUGCAACUCCCCCUGAAAA84.04191180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472651CTGCAACTCCCCCTGAAAATTTTCAGGGGGAGTTGCAG0.200700.155500.784500.750001.000001.00000


Target Position: 5169, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5169CCUUAUAAAUUUUUGUAUA95.8261144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5167-5189GCCCTTATAAATTTTTGTATAGAUAUACAAAAAUUUAUAAGGGCCCUUAUAAAUUUUUGUAUAGAU6.9-2.322


Target Position: 6235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6235CAAAUAUUGCCGUUUCAUA94.8663176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6233-6255TCCAAATATTGCCGTTTCATAAAUAUGAAACGGCAAUAUUUGGACAAAUAUUGCCGUUUCAUAAAU14.8-10.332


Target Position: 530, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530GGUGUUUGGAAAGAUAACA84.64561101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
528-550GAGGTGTTTGGAAAGATAACATCUGUUAUCUUUCCAAACACCUCGGUGUUUGGAAAGAUAACAUCU14.519.322


Target Position: 5667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5667GUGUGUUUUAUGUUAAGCA89.5465558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5665-5687GGGTGTGTTTTATGTTAAGCAAAUGCUUAACAUAAAACACACCCGUGUGUUUUAUGUUAAGCAAAU20.919.322


Target Position: 5440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5440UCAAAAUAAGACAAGUAAU78.3432139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7505458TCAAAATAAGACAAGTAATATTACTTGTCTTATTTTGA0.252700.152600.715500.750001.000001.00000


Target Position: 5408, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5408GAUGUUUUGUGUGUAUUUU83.6481236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5406-5428TAGATGTTTTGTGTGTATTTTTTAAAAUACACACAAAACAUCUAGAUGUUUUGUGUGUAUUUUUUU6.95.311


Target Position: 3343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3343GCAAAAUACUGUCCACAUU87.3262769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4793361GCAAAATACTGTCCACATTAATGTGGACAGTATTTTGC0.255800.109100.844801.000001.000001.00000


Target Position: 6412, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6412CUUGUAUAUACAUUCUUGA86.6244851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6410-6432CACTTGTATATACATTCTTGAGAUCAAGAAUGUAUAUACAAGUGCUUGUAUAUACAUUCUUGAGAU12.08.522


Target Position: 6032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6032GCCAAUACACCCCACCCUC63.72544864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9546050GCCAATACACCCCACCCTCGAGGGTGGGGTGTATTGGC0.304400.106900.689700.750001.000001.00000


Target Position: 4263, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4263CUACUUAUGUGAACGUAAA93.5332262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4261-4283CGCTACTTATGTGAACGTAAAATUUUACGUUCACAUAAGUAGCGCUACUUAUGUGAACGUAAAAUU15.06.333


Target Position: 4175, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4175GAAAUGCGCCCAUCCUUUU77.94872222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5994193GAAATGCGCCCATCCTTTTAAAAGGATGGGCGCATTTC0.456200.177600.672400.750000.902200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4173-4195CCGAAATGCGCCCATCCTTTTCTAAAAGGAUGGGCGCAUUUCGGGAAAUGCGCCCAUCCUUUUCUU18.720.632


Target Position: 577, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577CUAUGAUGAUCAACUCAUU93.1318296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
575-597TACTATGATGATCAACTCATTAGAAUGAGUUGAUCAUCAUAGUACUAUGAUGAUCAACUCAUUAGU19.214.923


Target Position: 957, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957CCUUUGAAAGCAACAAUUU78.37592131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361975CCTTTGAAAGCAACAATTTAAATTGTTGCTTTCAAAGG0.307100.077200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
955-977TGCCTTTGAAAGCAACAATTTTAAAAUUGUUGCUUUCAAAGGCACCUUUGAAAGCAACAAUUUUAU5.312.222


Target Position: 867, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867CGAAAGAUGGUUUUAUGUU83.73791227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
865-887AACGAAAGATGGTTTTATGTTTTAACAUAAAACCAUCUUUCGUUCGAAAGAUGGUUUUAUGUUUUU6.914.822


Target Position: 6257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6257GUAAUAAGUAAUACUAAUU88.4778657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6255-6277ATGTAATAAGTAATACTAATTCAAAUUAGUAUUACUUAUUACAUGUAAUAAGUAAUACUAAUUCAU6.3-2.312


Target Position: 5248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5248CACACAAAACAUGUUUAUA93.1992290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5246-5268ATCACACAAAACATGTTTATAAAUAUAAACAUGUUUUGUGUGAUCACACAAAACAUGUUUAUAAAU6.919.322


Target Position: 3476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476GUAUAUCAUGGGACUUUGU80.64221715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3474-3496GTGTATATCATGGGACTTTGTTGACAAAGUCCCAUGAUAUACACGUAUAUCAUGGGACUUUGUUGU19.210.222


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298GUCCGAGAUGAAUGUGAAU84.48991120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834316GTCCGAGATGAATGTGAATATTCACATTCATCTCGGAC0.154400.065200.810300.750001.000001.00000


Target Position: 4681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4681GGGAAAUUGAAGCAGGAAA88.3687671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8814699GGGAAATTGAAGCAGGAAATTTCCTGCTTCAATTTCCC0.147900.050300.991401.000001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136GGACAACACAAUACAGUAC81.01981636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062154GGACAACACAATACAGTACGTACTGTATTGTGTTGTCC0.171900.024900.689700.750001.000001.00000


Target Position: 3727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3727UCCAACUGUAAAAGAUCUU62.7425001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953745TCCAACTGTAAAAGATCTTAAGATCTTTTACAGTTGGA0.127900.085900.732800.750001.000001.00000


Target Position: 4869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4869GGUAAACAUUCCCUUUUAA97.273797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8964887GGTAAACATTCCCTTTTAATTAAAAGGGAATGTTTACC0.163100.025300.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4867-4889TAGGTAAACATTCCCTTTTAAATUUAAAAGGGAAUGUUUACCUAGGUAAACAUUCCCUUUUAAAUU11.014.722


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281UGGAAAAACAUGUACUUUA85.9163946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6652299TGGAAAAACATGTACTTTATAAAGTACATGTTTTTCCA0.195000.060100.810300.750001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972UCGGAGGAAUAAUAAAUUU74.34792932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851990TCGGAGGAATAATAAATTTAAATTTATTATTCCTCCGA0.402500.114700.793100.750001.000001.00000


Target Position: 302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
302GAGAUGAAUGUGAAUAUGA95.2326165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
300-322CCGAGATGAATGTGAATATGAAGUCAUAUUCACAUUCAUCUCGGGAGAUGAAUGUGAAUAUGAAGU8.720.422


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100CUCACAGAAAAGAGAAAAA88.6079644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691118CTCACAGAAAAGAGAAAAATTTTTCTCTTTTCTGTGAG0.176900.041700.810300.750000.934800.62500


Target Position: 5827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5827AGGUUACUCUAACUGGUUU81.95221490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8525845AGGTTACTCTAACTGGTTTAAACCAGTTAGAGTAACCT0.253800.027900.844800.750001.000001.00000


Target Position: 6628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6628ACAUCUUGUAAAAAAAAAA86.6607846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8236646ACATCTTGTAAAAAAAAAATTTTTTTTTTACAAGATGT0.927300.068900.706900.750001.000001.00000


Target Position: 6505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6505GGAGUAAGUGAUUCUUCUA102.12315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6503-6525TGGGAGTAAGTGATTCTTCTAAGUAGAAGAAUCACUUACUCCCAGGAGUAAGUGAUUCUUCUAAGU19.118.922


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292AGCAAAGUCCGAGAUGAAU75.72742669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398310AGCAAAGTCCGAGATGAATATTCATCTCGGACTTTGCT0.588500.267800.844800.750001.000001.00000


Target Position: 4368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4368CAUCAUAGUGCUAGUACUA98.612458

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4366-4388GACATCATAGTGCTAGTACTATGUAGUACUAGCACUAUGAUGUCCAUCAUAGUGCUAGUACUAUGU18.813.323


Target Position: 2308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308GUCAAACAGUAUUCUUGAA93.497269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2306-2328GTGTCAAACAGTATTCTTGAATGUUCAAGAAUACUGUUUGACACGUCAAACAGUAUUCUUGAAUGU20.420.522


Target Position: 4058, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4058GACGUAAACACCUUUGAUA95.2609164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6214076GACGTAAACACCTTTGATATATCAAAGGTGTTTACGTC0.421800.043600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4056-4078CTGACGTAAACACCTTTGATATAUAUCAAAGGUGUUUACGUCAGGACGUAAACACCUUUGAUAUAU12.015.032


Target Position: 2366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366GUUAAAUUGAAAAUUGACU74.8752819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2364-2386CTGTTAAATTGAAAATTGACTTAAGUCAAUUUUCAAUUUAACAGGUUAAAUUGAAAAUUGACUUAU14.8-9.731


Target Position: 6147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6147CAGGAAAAUGAUUAUAACU87.5534744

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6145-6167TGCAGGAAAATGATTATAACTAAAGUUAUAAUCAUUUUCCUGCACAGGAAAAUGAUUAUAACUAAU1.418.721


Target Position: 6223, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6223GCUAUUACAAUCCAAAUAU85.40111015

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6221-6243GAGCTATTACAATCCAAATATTGAUAUUUGGAUUGUAAUAGCUCGCUAUUACAAUCCAAAUAUUGU12.86.322


Target Position: 533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533GUUUGGAAAGAUAACAUCA91.4298384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
531-553GTGTTTGGAAAGATAACATCAACUGAUGUUAUCUUUCCAAACACGUUUGGAAAGAUAACAUCAACU16.120.122


Target Position: 5449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5449GACAAGUAAUUUGUUGAUA90.2929482

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5447-5469AAGACAAGTAATTTGTTGATAAAUAUCAACAAAUUACUUGUCUUGACAAGUAAUUUGUUGAUAAAU20.519.032


Target Position: 6634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6634UGUAAAAAAAAAAAAAAAA79.19361988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9506652TGTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTACA0.990000.518000.706900.750001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CUACAAGGUUUUCCCAAAU79.74151876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191915CTACAAGGTTTTCCCAAATATTTGGGAAAACCTTGTAG0.234700.043400.663800.750000.929301.00000


Target Position: 6410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6410CACUUGUAUAUACAUUCUU83.2081317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6408-6430CACACTTGTATATACATTCTTGAAAGAAUGUAUAUACAAGUGUGCACUUGUAUAUACAUUCUUGAU19.219.032


Target Position: 5693, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5693CUUUAGAAACAAAUGAAAA90.9775423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9365711CTTTAGAAACAAATGAAAATTTTCATTTGTTTCTAAAG0.519600.177900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5691-5713TACTTTAGAAACAAATGAAAAAGUUUUCAUUUGUUUCUAAAGUACUUUAGAAACAAAUGAAAAAGU7.47.122


Target Position: 2110, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110GUCCAUAAUUAUUUCAAAU88.0272697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562128GTCCATAATTATTTCAAATATTTGAAATAATTATGGAC0.230100.062200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2108-2130ATGTCCATAATTATTTCAAATGGAUUUGAAAUAAUUAUGGACAUGUCCAUAAUUAUUUCAAAUGGU7.721.221


Target Position: 2225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225CUUACUUUAACUGGAAAUU69.89743767

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2223-2245TACTTACTTTAACTGGAAATTACAAUUUCCAGUUAAAGUAAGUACUUACUUUAACUGGAAAUUACU20.14.932


Target Position: 2717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717CCUGUGUUUAAGCCUUUUG63.78134848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412735CCTGTGTTTAAGCCTTTTGCAAAAGGCTTAAACACAGG0.278900.023400.698300.750001.000001.00000


Target Position: 6193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6193ACCAGAAGACACAAGGAAU82.72421380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9246211ACCAGAAGACACAAGGAATATTCCTTGTGTCTTCTGGT0.149400.037400.844800.750001.000001.00000


Target Position: 863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863GAAACGAAAGAUGGUUUUA87.3123770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
861-883AGGAAACGAAAGATGGTTTTATGUAAAACCAUCUUUCGUUUCCUGAAACGAAAGAUGGUUUUAUGU18.815.332


Target Position: 2229, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229CUUUAACUGGAAAUUACCU74.06832983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2227-2249TACTTTAACTGGAAATTACCTAAAGGUAAUUUCCAGUUAAAGUACUUUAACUGGAAAUUACCUAAU13.94.932


Target Position: 5250, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5250CACAAAACAUGUUUAUAAA99.531645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5248-5270CACACAAAACATGTTTATAAATGUUUAUAAACAUGUUUUGUGUGCACAAAACAUGUUUAUAAAUGU-7.513.322


Target Position: 6039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6039CACCCCACCCUCAUUACAU80.38551758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8796057CACCCCACCCTCATTACATATGTAATGAGGGTGGGGTG0.342700.189500.637900.750001.000001.00000


Target Position: 6188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6188GACUUACCAGAAGACACAA93.3705279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6166206GACTTACCAGAAGACACAATTGTGTCTTCTGGTAAGTC0.586800.177900.672400.750001.000001.00000


Target Position: 2088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088CCAUGAAUAAGCAUUUCAA97.834877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2086-2108TGCCATGAATAAGCATTTCAATAUUGAAAUGCUUAUUCAUGGCACCAUGAAUAAGCAUUUCAAUAU13.813.612


Target Position: 5565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5565AGGGUGGAUGGAUUGAAAA84.22771159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8885583AGGGTGGATGGATTGAAAATTTTCAATCCATCCACCCT0.484000.025600.844800.750001.000001.00000


Target Position: 4046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046CCACCUUAUCCUGACGUAA87.2193782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5504064CCACCTTATCCTGACGTAATTACGTCAGGATAAGGTGG0.233800.233500.810301.000001.000001.00000


Target Position: 5623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5623GCAAUUGGAAACAAAACUU80.14681800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5621-5643AAGCAATTGGAAACAAAACTTTTAAGUUUUGUUUCCAAUUGCUUGCAAUUGGAAACAAAACUUUUU10.317.723


Target Position: 5688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5688ACAUACUUUAGAAACAAAU76.34482544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5235706ACATACTTTAGAAACAAATATTTGTTTCTAAAGTATGT0.611400.085300.698300.750001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765GAAAAUGUACUGGAAAUUA93.4489271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762783GAAAATGTACTGGAAATTATAATTTCCAGTACATTTTC0.344600.194100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2763-2785ATGAAAATGTACTGGAAATTAAGUAAUUUCCAGUACAUUUUCAUGAAAAUGUACUGGAAAUUAAGU14.25.322


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613GGACCAUCAACCCCUCAUG74.06822984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701631GGACCATCAACCCCTCATGCATGAGGGGTTGATGGTCC0.207100.042300.715500.750000.945700.62500


Target Position: 2289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289CAUGUACUUUAAAAAGUGU83.99371190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2287-2309AACATGTACTTTAAAAAGTGTGTACACUUUUUAAAGUACAUGUUCAUGUACUUUAAAAAGUGUGUU10.319.021


Target Position: 3682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3682GAAACAUGGAGAUCUUCGA86.9774816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3680-3702ATGAAACATGGAGATCTTCGAAAUCGAAGAUCUCCAUGUUUCAUGAAACAUGGAGAUCUUCGAAAU21.012.123


Target Position: 4514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4514GGAUUCUAAGGAAUUUCUU83.39811284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4512-4534CTGGATTCTAAGGAATTTCTTATAAGAAAUUCCUUAGAAUCCAGGGAUUCUAAGGAAUUUCUUAUU5.316.023


Target Position: 6512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6512GUGAUUCUUCUAAGAAUUA90.0957502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6510-6532AAGTGATTCTTCTAAGAATTAGAUAAUUCUUAGAAGAAUCACUUGUGAUUCUUCUAAGAAUUAGAU5.320.423


Target Position: 3336, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3336CAUUACUGCAAAAUACUGU78.32552143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3334-3356TCCATTACTGCAAAATACTGTCCACAGUAUUUUGCAGUAAUGGACAUUACUGCAAAAUACUGUCCU11.611.622


Target Position: 2104, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2104CAAUAUGUCCAUAAUUAUU91.6983366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832122CAATATGTCCATAATTATTAATAATTATGGACATATTG0.251200.118100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2102-2124TTCAATATGTCCATAATTATTTCAAUAAUUAUGGACAUAUUGAACAAUAUGUCCAUAAUUAUUUCU-8.06.722


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721GGGAAGAAGAUCACGAAGA85.5177999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731739GGGAAGAAGATCACGAAGATCTTCGTGATCTTCTTCCC0.444600.055800.767200.750001.000001.00000


Target Position: 4218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4218CGAUCUUCUCUACUUUCAU90.0273508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9234236CGATCTTCTCTACTTTCATATGAAAGTAGAGAAGATCG0.379000.047900.637901.000001.000001.00000


Target Position: 406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406CUACAUUUAUGUUUUAAAU87.5131751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
404-426AACTACATTTATGTTTTAAATGAAUUUAAAACAUAAAUGUAGUUCUACAUUUAUGUUUUAAAUGAU-9.16.921


Target Position: 3063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3063GGCUGAAAAAGAGAAAGCA88.4124666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613081GGCTGAAAAAGAGAAAGCATGCTTTCTCTTTTTCAGCC0.270300.079800.646600.750001.000001.00000


Target Position: 5383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5383CUGAUCUAAUGAAUGUGAA89.6499545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5381-5403CTCTGATCTAATGAATGTGAACAUUCACAUUCAUUAGAUCAGAGCUGAUCUAAUGAAUGUGAACAU20.521.423


Target Position: 5570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5570GGAUGGAUUGAAAAGAUUA100.7730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6025588GGATGGATTGAAAAGATTATAATCTTTTCAATCCATCC0.223800.044800.836201.000001.000001.00000


Target Position: 4480, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4480CUAUUAUAGGACUUGUAUU89.2056594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9814498CTATTATAGGACTTGTATTAATACAAGTCCTATAATAG0.129700.040500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4478-4500CACTATTATAGGACTTGTATTGTAAUACAAGUCCUAUAAUAGUGCUAUUAUAGGACUUGUAUUGUU11.6-5.923


Target Position: 6631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6631UCUUGUAAAAAAAAAAAAA79.06042007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9166649TCTTGTAAAAAAAAAAAAATTTTTTTTTTTTTACAAGA0.972600.330100.724100.750001.000001.00000


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446UCCAACCAAAUCUUUUAUU61.1555253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4032464TCCAACCAAATCTTTTATTAATAAAAGATTTGGTTGGA0.311100.065900.862100.750001.000001.00000


Target Position: 2645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645CUGAAAACCAAAGCCUUUU67.4734216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062663CTGAAAACCAAAGCCTTTTAAAAGGCTTTGGTTTTCAG0.212000.085900.784500.750000.945700.62500


Target Position: 5989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5989GAUUUUCAAUGACUGUAAA97.808880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5987-6009ATGATTTTCAATGACTGTAAATTUUUACAGUCAUUGAAAAUCAUGAUUUUCAAUGACUGUAAAUUU19.07.422


Target Position: 4073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4073GAUAUAACUGUUUACUUGU85.14841050

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4071-4093TTGATATAACTGTTTACTTGTTGACAAGUAAACAGUUAUAUCAAGAUAUAACUGUUUACUUGUUGU11.81.121


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299UCCGAGAUGAAUGUGAAUA73.18763168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883317TCCGAGATGAATGTGAATATATTCACATTCATCTCGGA0.147100.128600.827600.750001.000001.00000


Target Position: 5683, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5683GCAAAACAUACUUUAGAAA92.8783309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5985701GCAAAACATACTTTAGAAATTTCTAAAGTATGTTTTGC0.215400.068200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5681-5703AAGCAAAACATACTTTAGAAACAUUUCUAAAGUAUGUUUUGCUUGCAAAACAUACUUUAGAAACAU7.112.222


Target Position: 2580, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2580GCUCUAAUUCAGAGAUAAU94.8098182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2578-2600TCGCTCTAATTCAGAGATAATCTAUUAUCUCUGAAUUAGAGCGAGCUCUAAUUCAGAGAUAAUCUU16.011.633


Target Position: 5678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5678GUUAAGCAAAACAUACUUU80.84841678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5676-5698ATGTTAAGCAAAACATACTTTAGAAAGUAUGUUUUGCUUAACAUGUUAAGCAAAACAUACUUUAGU11.619.721


Target Position: 2989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2989GAAUUUCACAGGAUUGAUU87.1217798

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2987-3009CAGAATTTCACAGGATTGATTGCAAUCAAUCCUGUGAAAUUCUGGAAUUUCACAGGAUUGAUUGCU16.27.432


Target Position: 3225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225CAGAAGAUCAGUUUCCUAA95.2736162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3223-3245TCCAGAAGATCAGTTTCCTAATTUUAGGAAACUGAUCUUCUGGACAGAAGAUCAGUUUCCUAAUUU19.919.122


Target Position: 6629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6629CAUCUUGUAAAAAAAAAAA89.114600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8946647CATCTTGTAAAAAAAAAAATTTTTTTTTTTACAAGATG0.934300.079500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6627-6649AACATCTTGTAAAAAAAAAAAAAUUUUUUUUUUUACAAGAUGUUCAUCUUGUAAAAAAAAAAAAAU-11.319.201


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CCAGUCCUACAUUGAUGUU79.17511992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982913CCAGTCCTACATTGATGTTAACATCAATGTAGGACTGG0.146200.021400.698301.000001.000001.00000


Target Position: 4683, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4683GAAAUUGAAGCAGGAAAUA86.1142921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9974701GAAATTGAAGCAGGAAATATATTTCCTGCTTCAATTTC0.420700.053400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4681-4703GGGAAATTGAAGCAGGAAATATTUAUUUCCUGCUUCAAUUUCCCGAAAUUGAAGCAGGAAAUAUUU18.77.422


Target Position: 5464, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5464GAUAAAUAUUUUUAAAGAU94.5182195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5462-5484TTGATAAATATTTTTAAAGATAAAUCUUUAAAAAUAUUUAUCAAGAUAAAUAUUUUUAAAGAUAAU7.1-8.011


Target Position: 2975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2975GUUCAACCAGAUCAGAAUU81.0881625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592993GTTCAACCAGATCAGAATTAATTCTGATCTGGTTGAAC0.378500.026800.637900.750001.000001.00000


Target Position: 5113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5113ACCCACCUCAGCCUCCCAA68.75753974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7815131ACCCACCTCAGCCTCCCAATTGGGAGGCTGAGGTGGGT0.164300.070400.706900.750000.989100.62500


Target Position: 5302, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5302GAAAAUUUGUAUGAAAUAA95.0106173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8995320GAAAATTTGTATGAAATAATTATTTCATACAAATTTTC0.152000.142700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5300-5322AAGAAAATTTGTATGAAATAATTUUAUUUCAUACAAAUUUUCUUGAAAAUUUGUAUGAAAUAAUUU8.9-12.011


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897AGUCCUACAUUGAUGUUUU86.1236919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816915AGTCCTACATTGATGTTTTAAAACATCAATGTAGGACT0.175600.040600.706900.750001.000001.00000


Target Position: 6234, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6234CCAAAUAUUGCCGUUUCAU75.97112612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7316252CCAAATATTGCCGTTTCATATGAAACGGCAATATTTGG0.178300.093800.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6232-6254ATCCAAATATTGCCGTTTCATAAAUGAAACGGCAAUAUUUGGAUCCAAAUAUUGCCGUUUCAUAAU21.1-1.822


Target Position: 3904, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904CUAUAGUGUACACAACAAA93.5384261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6233922CTATAGTGTACACAACAAATTTGTTGTGTACACTATAG0.419800.063200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3902-3924TACTATAGTGTACACAACAAAACUUUGUUGUGUACACUAUAGUACUAUAGUGUACACAACAAAACU19.313.122


Target Position: 2213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2213GGUGGCACUUUACUUACUU84.30871145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3462231GGTGGCACTTTACTTACTTAAGTAAGTAAAGTGCCACC0.542400.138300.715501.000001.000001.00000


Target Position: 6356, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6356CAUGAACGCAUCAAUAGAA97.1135103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6354-6376AGCATGAACGCATCAATAGAAAGUUCUAUUGAUGCGUUCAUGCUCAUGAACGCAUCAAUAGAAAGU13.421.133


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334CCCCAGCCCAAACCAUUUC53.3086112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4472352CCCCAGCCCAAACCATTTCGAAATGGTTTGGGCTGGGG0.266600.144700.819000.750001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790UGUAGGCAAUACCAUAAAU81.80351509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518808TGTAGGCAATACCATAAATATTTATGGTATTGCCTACA0.316900.051500.698300.750000.940201.00000


Target Position: 1126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CACAAAGAAGGAAGUGUUU79.8591850

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1124-1146TCCACAAAGAAGGAAGTGTTTAAAAACACUUCCUUCUUUGUGGACACAAAGAAGGAAGUGUUUAAU17.819.222


Target Position: 6393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6393CCAUCAACAGGACUACACA94.7673184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9136411CCATCAACAGGACTACACATGTGTAGTCCTGTTGATGG0.718100.036300.637900.750001.000001.00000


Target Position: 6560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6560GAACUGAAUGGUACUUCGU78.28152155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6558-6580CTGAACTGAATGGTACTTCGTATACGAAGUACCAUUCAGUUCAGGAACUGAAUGGUACUUCGUAUU20.919.233


Target Position: 358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358CCAGAAUGUCAUUCUACAU90.8916426

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
356-378ATCCAGAATGTCATTCTACATGAAUGUAGAAUGACAUUCUGGAUCCAGAAUGUCAUUCUACAUGAU20.318.122


Target Position: 6296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6296GGAUGACAAAAGAAAAUCU91.4236385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8336314GGATGACAAAAGAAAATCTAGATTTTCTTTTGTCATCC0.157900.047400.646600.750000.962000.62500


Target Position: 6506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6506GAGUAAGUGAUUCUUCUAA97.424394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6504-6526GGGAGTAAGTGATTCTTCTAAGAUUAGAAGAAUCACUUACUCCCGAGUAAGUGAUUCUUCUAAGAU20.217.613


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956CGUCCUUGGAAAAGUAAUA89.859529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332974CGTCCTTGGAAAAGTAATATATTACTTTTCCAAGGACG0.303800.034300.732801.000001.000001.00000


Target Position: 2807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GCAGUUAAAGGUGAAGUGU74.2792944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222825GCAGTTAAAGGTGAAGTGTACACTTCACCTTTAACTGC0.267900.037400.646600.750001.000001.00000


Target Position: 4290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4290CUCCGUAUCCUUCUCUGUU78.07762196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8244308CTCCGTATCCTTCTCTGTTAACAGAGAAGGATACGGAG0.247200.205700.663800.750001.000001.00000


Target Position: 5415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5415UGUGUGUAUUUUUUUAAAU77.38982337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9325433TGTGTGTATTTTTTTAAATATTTAAAAAAATACACACA0.138100.037600.698300.750001.000001.00000


Target Position: 5853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5853GUAAACAUUUAAAGUGUUA88.4473662

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5851-5873ACGTAAACATTTAAAGTGTTATAUAACACUUUAAAUGUUUACGUGUAAACAUUUAAAGUGUUAUAU17.86.932


Target Position: 4123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4123CUGCCCAGACCCCUUAUAU76.75282463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4254141CTGCCCAGACCCCTTATATATATAAGGGGTCTGGGCAG0.442700.349000.741400.750001.000001.00000


Target Position: 5777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5777GCUUCAUUCUGUGGAAUUU83.66871234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5775-5797ATGCTTCATTCTGTGGAATTTTGAAAUUCCACAGAAUGAAGCAUGCUUCAUUCUGUGGAAUUUUGU20.112.022


Target Position: 5224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5224ACAGUCAAAGUUUCAAAAU73.21963164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6785242ACAGTCAAAGTTTCAAAATATTTTGAAACTTTGACTGT0.531300.148900.698300.750001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101UCACAGAAAAGAGAAAAAA77.42252335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761119TCACAGAAAAGAGAAAAAATTTTTTCTCTTTTCTGTGA0.174700.041500.724100.750001.000001.00000


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335CCCAGCCCAAACCAUUUCA70.92613575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782353CCCAGCCCAAACCATTTCATGAAATGGTTTGGGCTGGG0.267800.143200.767200.750001.000001.00000


Target Position: 4045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045CCCACCUUAUCCUGACGUA85.46681006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5094063CCCACCTTATCCTGACGTATACGTCAGGATAAGGTGGG0.247600.102900.810301.000001.000001.00000


Target Position: 537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GGAAAGAUAACAUCAACAU90.0506505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
535-557TTGGAAAGATAACATCAACATGGAUGUUGAUGUUAUCUUUCCAAGGAAAGAUAACAUCAACAUGGU20.514.822


Target Position: 4174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4174CGAAAUGCGCCCAUCCUUU77.66012275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2084192CGAAATGCGCCCATCCTTTAAAGGATGGGCGCATTTCG0.462100.177900.793101.000000.902200.62500


Target Position: 4217, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4217GCGAUCUUCUCUACUUUCA85.10721053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9424235GCGATCTTCTCTACTTTCATGAAAGTAGAGAAGATCGC0.365200.051600.698300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4215-4237CAGCGATCTTCTCTACTTTCATTUGAAAGUAGAGAAGAUCGCUGGCGAUCUUCUCUACUUUCAUUU14.621.022


Target Position: 4768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4768CAGAACAGGCCACUCAUUU78.47272119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344786CAGAACAGGCCACTCATTTAAATGAGTGGCCTGTTCTG0.195200.030900.784500.750001.000001.00000


Target Position: 2444, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2444CAUCCAACCAAAUCUUUUA92.8971306

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6244419CATCCAACCAAATCTTTTA1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANANA00MET(0.002)


Target Position: 6220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6220AGAGCUAUUACAAUCCAAA92.1167339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9536238AGAGCTATTACAATCCAAATTTGGATTGTAATAGCTCT0.197300.053300.724100.750001.000001.00000


Target Position: 5225, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5225CAGUCAAAGUUUCAAAAUA98.477462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4185243CAGTCAAAGTTTCAAAATATATTTTGAAACTTTGACTG0.528200.160900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5223-5245TACAGTCAAAGTTTCAAAATAGCUAUUUUGAAACUUUGACUGUACAGUCAAAGUUUCAAAAUAGCU7.419.222


Target Position: 3182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182GAAAUGGUUUCAAAUGAAU87.0267810

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3180-3202CAGAAATGGTTTCAAATGAATCTAUUCAUUUGAAACCAUUUCUGGAAAUGGUUUCAAAUGAAUCUU7.418.812


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646UGAAAACCAAAGCCUUUUU66.38744433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552664TGAAAACCAAAGCCTTTTTAAAAAGGCTTTGGTTTTCA0.197900.096000.724100.750000.945700.62500


Target Position: 6632, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6632CUUGUAAAAAAAAAAAAAA84.55431114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9546650CTTGTAAAAAAAAAAAAAATTTTTTTTTTTTTTACAAG0.980100.393800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6630-6652ATCTTGTAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUACAAGAUCUUGUAAAAAAAAAAAAAAAAU-11.37.200


Target Position: 2810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810GUUAAAGGUGAAGUGUUAA87.277776

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2808-2830CAGTTAAAGGTGAAGTGTTAAAAUUAACACUUCACCUUUAACUGGUUAAAGGUGAAGUGUUAAAAU19.011.022


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788GCCUCUCUGCCCCACCCUU72.30573317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721806GCCTCTCTGCCCCACCCTTAAGGGTGGGGCAGAGAGGC0.193700.188900.862101.000001.000001.00000


Target Position: 4708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708GCUUCUUGAUCACAGAAAA96.849114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4706-4728GGGCTTCTTGATCACAGAAAACTUUUUCUGUGAUCAAGAAGCCCGCUUCUUGAUCACAGAAAACUU19.216.632


Target Position: 2849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2849GAGAAUAUACACUUACAUU97.358796

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2847-2869GTGAGAATATACACTTACATTCTAAUGUAAGUGUAUAUUCUCACGAGAAUAUACACUUACAUUCUU11.66.623


Target Position: 6001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6001CUGUAAAUUGCGAUAAGGA87.4106761

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5999-6021GACTGTAAATTGCGATAAGGAAAUCCUUAUCGCAAUUUACAGUCCUGUAAAUUGCGAUAAGGAAAU19.96.933


Target Position: 2364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CUGUUAAAUUGAAAAUUGA89.4459568

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2362-2384TGCTGTTAAATTGAAAATTGACTUCAAUUUUCAAUUUAACAGCACUGUUAAAUUGAAAAUUGACUU-3.37.222


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973CGGAGGAAUAAUAAAUUUG75.06632780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441991CGGAGGAATAATAAATTTGCAAATTTATTATTCCTCCG0.333500.078700.767200.750001.000001.00000


Target Position: 5454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5454GUAAUUUGUUGAUAAAUAU91.3897387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5452-5474AAGTAATTTGTTGATAAATATTTAUAUUUAUCAACAAAUUACUUGUAAUUUGUUGAUAAAUAUUUU-8.0-1.422


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511GUCCUCUUAACAUCUAUAU79.37461942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691529GTCCTCTTAACATCTATATATATAGATGTTAAGAGGAC0.761900.393000.775900.750001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974GGAGGAAUAAUAAAUUUGA93.5006268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171992GGAGGAATAATAAATTTGATCAAATTTATTATTCCTCC0.290900.083600.646600.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181CAAGUAUUUCGCCGAAAUA91.6774369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2179-2201AACAAGTATTTCGCCGAAATACGUAUUUCGGCGAAAUACUUGUUCAAGUAUUUCGCCGAAAUACGU20.74.633


Target Position: 5624, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5624CAAUUGGAAACAAAACUUU80.77341692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5622-5644AGCAATTGGAAACAAAACTTTTGAAAGUUUUGUUUCCAAUUGCUCAAUUGGAAACAAAACUUUUGU3.220.122


Target Position: 4219, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4219GAUCUUCUCUACUUUCAUU94.7479185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8804237GATCTTCTCTACTTTCATTAATGAAAGTAGAGAAGATC0.336200.029300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4217-4239GCGATCTTCTCTACTTTCATTGGAAUGAAAGUAGAGAAGAUCGCGAUCUUCUCUACUUUCAUUGGU12.019.131


Target Position: 3462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462GGCAUUUUGGUUGUGUAUA83.16591323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3460-3482AGGGCATTTTGGTTGTGTATATCUAUACACAACCAAAAUGCCCUGGCAUUUUGGUUGUGUAUAUCU20.414.023


Target Position: 872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872GAUGGUUUUAUGUUUUUGA87.8595713

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
870-892AAGATGGTTTTATGTTTTTGACGUCAAAAACAUAAAACCAUCUUGAUGGUUUUAUGUUUUUGACGU5.618.822


Target Position: 2438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GAAAUUCAUCCAACCAAAU84.65771100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632456GAAATTCATCCAACCAAATATTTGGTTGGATGAATTTC0.178200.092500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2436-2458ATGAAATTCATCCAACCAAATCTAUUUGGUUGGAUGAAUUUCAUGAAAUUCAUCCAACCAAAUCUU18.87.422


Target Position: 1975, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975GAGGAAUAAUAAAUUUGAU94.8572178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1973-1995CGGAGGAATAATAAATTTGATTTAUCAAAUUUAUUAUUCCUCCGGAGGAAUAAUAAAUUUGAUUUU7.419.922


Target Position: 5497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5497GUAAAGCAGGAUACAUUUU79.83031857

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5495-5517TTGTAAAGCAGGATACATTTTACAAAAUGUAUCCUGCUUUACAAGUAAAGCAGGAUACAUUUUACU6.919.721


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961UGAAAGCAACAAUUUUAUU74.94412801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347979TGAAAGCAACAATTTTATTAATAAAATTGTTGCTTTCA0.637300.159400.715500.750001.000001.00000


Target Position: 5291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5291GAUGACAUUAAGAAAAUUU85.7362968

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5289-5311TAGATGACATTAAGAAAATTTGTAAAUUUUCUUAAUGUCAUCUAGAUGACAUUAAGAAAAUUUGUU0.420.512


Target Position: 1289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289UGUGCAUUCCCUAUCAAAU79.48411926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651307TGTGCATTCCCTATCAAATATTTGATAGGGAATGCACA0.582400.146600.698300.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327UGUUAUACCCCAGCCCAAA75.85272643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622345TGTTATACCCCAGCCCAAATTTGGGCTGGGGTATAACA0.338200.205800.706900.750001.000001.00000


Target Position: 3075, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3075GAAAGCAAAUUAAAGAUCU83.59011250

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3073-3095GAGAAAGCAAATTAAAGATCTGGAGAUCUUUAAUUUGCUUUCUCGAAAGCAAAUUAAAGAUCUGGU14.818.622


Target Position: 5646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5646GGAGUUUUAUUUUGCAUUA94.4628201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5644-5666GGGGAGTTTTATTTTGCATTAGGUAAUGCAAAAUAAAACUCCCCGGAGUUUUAUUUUGCAUUAGGU20.013.322


Target Position: 5301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5301AGAAAAUUUGUAUGAAAUA90.1126499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8745319AGAAAATTTGTATGAAATATATTTCATACAAATTTTCT0.157100.149400.681000.750001.000001.00000


Target Position: 4610, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4610GUCAUAUUGGAGUCCAAAA90.4819470

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9461019GTCATATTGGAGTCCAAAA1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116436413..116436431(+)00MET(0.002)


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109UGUCCAUAAUUAUUUCAAA91.7797359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5032127TGTCCATAATTATTTCAAATTTGAAATAATTATGGACA0.250600.063100.706900.750001.000001.00000


Target Position: 2777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2777GAAAUUAAGGGAAAUGAUA93.8609239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862795GAAATTAAGGGAAATGATATATCATTTCCCTTAATTTC0.265500.053300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2775-2797TGGAAATTAAGGGAAATGATATTUAUCAUUUCCCUUAAUUUCCAGAAAUUAAGGGAAAUGAUAUUU7.2-9.722


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309UCAAACAGUAUUCUUGAAU67.05324305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262327TCAAACAGTATTCTTGAATATTCAAGAATACTGTTTGA0.155500.060600.715500.750001.000001.00000


Target Position: 1514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514CUCUUAACAUCUAUAUCCA93.9448232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1512-1534TCCTCTTAACATCTATATCCACCUGGAUAUAGAUGUUAAGAGGACUCUUAACAUCUAUAUCCACCU16.714.633


Target Position: 5567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5567GGUGGAUGGAUUGAAAAGA84.40871133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9905585GGTGGATGGATTGAAAAGATCTTTTCAATCCATCCACC0.257700.025500.629300.750001.000001.00000


Target Position: 855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855GGCUAAAGGAAACGAAAGA84.24491155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
853-875AAGGCTAAAGGAAACGAAAGATGUCUUUCGUUUCCUUUAGCCUUGGCUAAAGGAAACGAAAGAUGU19.718.323


Target Position: 2816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816GGUGAAGUGUUAAAAGUUG79.87811847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642834GGTGAAGTGTTAAAAGTTGCAACTTTTAACACTTCACC0.483100.225800.706900.750001.000001.00000


Target Position: 5168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5168CCCUUAUAAAUUUUUGUAU80.48021740

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5166-5188AGCCCTTATAAATTTTTGTATAGAUACAAAAAUUUAUAAGGGCUCCCUUAUAAAUUUUUGUAUAGU7.212.322


Target Position: 6164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6164CUAAAAGCUCUCUGAUAGU79.7411877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6162-6184AACTAAAAGCTCTCTGATAGTGCACUAUCAGAGAGCUUUUAGUUCUAAAAGCUCUCUGAUAGUGCU17.813.723


Target Position: 2447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2447CCAACCAAAUCUUUUAUUA89.9394517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902465CCAACCAAATCTTTTATTATAATAAAAGATTTGGTTGG0.300600.054400.810301.000001.000001.00000


Target Position: 5399, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5399GAACAUGUAGAUGUUUUGU78.94832033

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5397-5419GTGAACATGTAGATGTTTTGTGTACAAAACAUCUACAUGUUCACGAACAUGUAGAUGUUUUGUGUU12.219.322


Target Position: 4777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4777CCACUCAUUUAGAAUUCUA95.0824171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9174795CCACTCATTTAGAATTCTATAGAATTCTAAATGAGTGG0.140700.047300.672401.000000.923900.75000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GACAUGUCUUUCCCCACAA90.5697459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615648GACATGTCTTTCCCCACAATTGTGGGGAAAGACATGTC0.612700.249100.672400.750000.956500.62500


Target Position: 5566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5566GGGUGGAUGGAUUGAAAAG77.58292292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9455584GGGTGGATGGATTGAAAAGCTTTTCAATCCATCCACCC0.474500.023200.853400.750001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685CCAAAUACUUUGAUCUCAU89.4508567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892703CCAAATACTTTGATCTCATATGAGATCAAAGTATTTGG0.162900.068800.689701.000001.000001.00000


Target Position: 966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966GCAACAAUUUUAUUUACUU89.0495605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350984GCAACAATTTTATTTACTTAAGTAAATAAAATTGTTGC0.321500.240800.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
964-986AAGCAACAATTTTATTTACTTCTAAGUAAAUAAAAUUGUUGCUUGCAACAAUUUUAUUUACUUCUU4.612.122


Target Position: 2718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718CUGUGUUUAAGCCUUUUGA80.03971817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2716-2738TCCTGTGTTTAAGCCTTTTGAAAUCAAAAGGCUUAAACACAGGACUGUGUUUAAGCCUUUUGAAAU16.119.323


Target Position: 4788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4788GAAUUCUAGUGUUUCAAAA96.5448121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4786-4808TAGAATTCTAGTGTTTCAAAACAUUUUGAAACACUAGAAUUCUAGAAUUCUAGUGUUUCAAAACAU7.76.921


Target Position: 1128, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128CAAAGAAGGAAGUGUUUAA97.1122104

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5112819CAAAGAAGGAAGTGTTTAA1/1/0/097.75METNM_000245.2+NM_001127500.11+1NANANA7:116340064..116340082(+)00MET(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1126-1148CACAAAGAAGGAAGTGTTTAATAUUAAACACUUCCUUCUUUGUGCAAAGAAGGAAGUGUUUAAUAU14.710.322


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896UCUACAAGGUUUUCCCAAA81.85711500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8501914TCTACAAGGTTTTCCCAAATTTGGGAAAACCTTGTAGA0.242900.043700.724100.750000.929300.87500


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628GCGACAUGUCUUUCCCCAC71.59333448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995646GCGACATGTCTTTCCCCACGTGGGGAAAGACATGTCGC0.620700.228200.629300.750000.962000.62500


Target Position: 4767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4767CCAGAACAGGCCACUCAUU81.32681588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624785CCAGAACAGGCCACTCATTAATGAGTGGCCTGTTCTGG0.192200.027600.836201.000000.989100.75000


Target Position: 1020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020CUUUUCACACAAGAAUAAU76.78322454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1018-1040GACTTTTCACACAAGAATAATCAAUUAUUCUUGUGUGAAAAGUCCUUUUCACACAAGAAUAAUCAU6.914.922


Target Position: 3455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3455GGAAGAGGGCAUUUUGGUU84.66661099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673473GGAAGAGGGCATTTTGGTTAACCAAAATGCCCTCTTCC0.195400.027100.724101.000001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333ACCCCAGCCCAAACCAUUU66.89844342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642351ACCCCAGCCCAAACCATTTAAATGGTTTGGGCTGGGGT0.261700.153200.853400.750001.000001.00000


Target Position: 6450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6450UCACGUUUGCUAUUUAUAA84.44361128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7536468TCACGTTTGCTATTTATAATTATAAATAGCAAACGTGA0.450700.033600.689700.750001.000001.00000


Target Position: 4172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4172GCCGAAAUGCGCCCAUCCU70.24673706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7404190GCCGAAATGCGCCCATCCTAGGATGGGCGCATTTCGGC0.471100.089400.655200.750000.902200.62500


Target Position: 6243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6243GCCGUUUCAUAAAUGUAAU83.35651292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8546261GCCGTTTCATAAATGTAATATTACATTTATGAAACGGC0.152500.051100.991401.000001.000001.00000


Target Position: 6603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6603CAUGCAAUUAAAGUAAAGU77.83322246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6601-6623ATCATGCAATTAAAGTAAAGTGAACUUUACUUUAAUUGCAUGAUCAUGCAAUUAAAGUAAAGUGAU9.819.922


Target Position: 5219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5219GCAAUACAGUCAAAGUUUC75.3462732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5515237GCAATACAGTCAAAGTTTCGAAACTTTGACTGTATTGC0.400900.086800.681000.750001.000001.00000


Target Position: 5887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5887UGUUUAUUUUUAAUGAUAU82.66261387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9595905TGTTTATTTTTAATGATATATATCATTAAAAATAAACA0.257900.022500.663800.750001.000001.00000


Target Position: 4061, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061GUAAACACCUUUGAUAUAA87.5392747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8044079GTAAACACCTTTGATATAATTATATCAAAGGTGTTTAC0.434600.042600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4059-4081ACGTAAACACCTTTGATATAACTUUAUAUCAAAGGUGUUUACGUGUAAACACCUUUGAUAUAACUU10.214.722


Target Position: 5828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5828GGUUACUCUAACUGGUUUU81.38761580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6175846GGTTACTCTAACTGGTTTTAAAACCAGTTAGAGTAACC0.247500.043700.853401.000001.000001.00000


Target Position: 3067, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3067GAAAAAGAGAAAGCAAAUU77.8552241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8193085GAAAAAGAGAAAGCAAATTAATTTGCTTTCTCTTTTTC0.471400.182600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3065-3087CTGAAAAAGAGAAAGCAAATTAAAAUUUGCUUUCUCUUUUUCAGGAAAAAGAGAAAGCAAAUUAAU18.55.512


Target Position: 5290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5290AGAUGACAUUAAGAAAAUU87.2956773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6825308AGATGACATTAAGAAAATTAATTTTCTTAATGTCATCT0.343800.038100.715500.750001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764UGAAAAUGUACUGGAAAUU69.39833866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722782TGAAAATGTACTGGAAATTAATTTCCAGTACATTTTCA0.249400.195600.715500.750001.000001.00000


Target Position: 3598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598AGAUUUUAGUCAUCCCAAU84.77691084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853616AGATTTTAGTCATCCCAATATTGGGATGACTAAAATCT0.202700.050100.715500.750000.940200.62500


Target Position: 188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
188GAUAAACCUCUCAUAAUGA96.077137

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
186-208AAGATAAACCTCTCATAATGAAGUCAUUAUGAGAGGUUUAUCUUGAUAAACCUCUCAUAAUGAAGU5.613.912


Target Position: 6084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6084CCCAGCAAGCUACAAAGAG65.97574506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5716102CCCAGCAAGCTACAAAGAGCTCTTTGTAGCTTGCTGGG0.286800.047300.681000.750001.000001.00000


Target Position: 3427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3427CCUGAUUGUGCAUUUCAAU83.83381217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3425-3447AGCCTGATTGTGCATTTCAATGAAUUGAAAUGCACAAUCAGGCUCCUGAUUGUGCAUUUCAAUGAU7.418.121


Target Position: 1545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1545GAGACCUCACCAUAGCUAA94.3382206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721563GAGACCTCACCATAGCTAATTAGCTATGGTGAGGTCTC0.149200.087300.775900.750001.000001.00000


Target Position: 901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901CUACAUUGAUGUUUUACCU80.46331744

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
899-921TCCTACATTGATGTTTTACCTGAAGGUAAAACAUCAAUGUAGGACUACAUUGAUGUUUUACCUGAU14.013.533


Target Position: 5418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5418GUGUAUUUUUUUAAAUGAA92.8193311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5416-5438GTGTGTATTTTTTTAAATGAAAAUUCAUUUAAAAAAAUACACACGUGUAUUUUUUUAAAUGAAAAU8.96.911


Target Position: 6454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6454GUUUGCUAUUUAUAAACUU83.37521288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6452-6474ACGTTTGCTATTTATAAACTTGTAAGUUUAUAAAUAGCAAACGUGUUUGCUAUUUAUAAACUUGUU4.619.722


Target Position: 3959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3959GAAAGUCUGCAAACUCAAA96.4974125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3957-3979TGGAAAGTCTGCAAACTCAAAAGUUUGAGUUUGCAGACUUUCCAGAAAGUCUGCAAACUCAAAAGU19.217.722


Target Position: 399, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399CCACUAACUACAUUUAUGU82.05211469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
397-419TGCCACTAACTACATTTATGTTTACAUAAAUGUAGUUAGUGGCACCACUAACUACAUUUAUGUUUU-1.819.032


Target Position: 2355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355CUGAGUUUGCUGUUAAAUU81.83981503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2353-2375AACTGAGTTTGCTGTTAAATTGAAAUUUAACAGCAAACUCAGUUCUGAGUUUGCUGUUAAAUUGAU-0.319.222


Target Position: 1968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968GAUUUCGGAGGAAUAAUAA93.4201272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081986GATTTCGGAGGAATAATAATTATTATTCCTCCGAAATC0.453000.040900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1966-1988TGGATTTCGGAGGAATAATAAATUUAUUAUUCCUCCGAAAUCCAGAUUUCGGAGGAAUAAUAAAUU-8.020.732


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517UCCCGAGAAUGGUCAUAAA86.1351914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8592535TCCCGAGAATGGTCATAAATTTATGACCATTCTCGGGA0.281200.027600.870700.750000.945700.75000


Target Position: 5995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5995CAAUGACUGUAAAUUGCGA90.6002455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5993-6015TTCAATGACTGTAAATTGCGATAUCGCAAUUUACAGUCAUUGAACAAUGACUGUAAAUUGCGAUAU20.619.223


Target Position: 5310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5310GUAUGAAAUAAUUUAGUCA96.1425132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5308-5330TTGTATGAAATAATTTAGTCATCUGACUAAAUUAUUUCAUACAAGUAUGAAAUAAUUUAGUCAUCU14.68.922


Target Position: 4632, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4632GAAUUCUGGGUUGAAUUUU74.80262836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4630-4652TTGAATTCTGGGTTGAATTTTTTAAAAUUCAACCCAGAAUUCAAGAAUUCUGGGUUGAAUUUUUUU7.412.021


Target Position: 898, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898GUCCUACAUUGAUGUUUUA93.5162266

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_189819GTCCTACATTGATGTTTTA1/1/0/0100.00METNM_000245.2+NM_001127500.11+1NANANA7:116339834..116339852(+)00MET(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703916GTCCTACATTGATGTTTTATAAAACATCAATGTAGGAC0.186300.086100.784500.750001.000001.00000


Target Position: 5217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5217AGGCAAUACAGUCAAAGUU79.32751953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8685235AGGCAATACAGTCAAAGTTAACTTTGACTGTATTGCCT0.152300.056900.698300.750001.000001.00000


Target Position: 6565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6565GAAUGGUACUUCGUAUGUU90.8434430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6563-6585CTGAATGGTACTTCGTATGTTAAAACAUACGAAGUACCAUUCAGGAAUGGUACUUCGUAUGUUAAU21.020.033


Target Position: 5220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5220CAAUACAGUCAAAGUUUCA91.3098397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5218-5240GGCAATACAGTCAAAGTTTCAAAUGAAACUUUGACUGUAUUGCCCAAUACAGUCAAAGUUUCAAAU13.311.632


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510AGUCCUCUUAACAUCUAUA93.9405234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061528AGTCCTCTTAACATCTATATATAGATGTTAAGAGGACT0.771700.402000.663800.750001.000001.00000


Target Position: 4180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4180GCGCCCAUCCUUUUCUGAA84.37011139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2904198GCGCCCATCCTTTTCTGAATTCAGAAAAGGATGGGCGC0.348700.218300.750001.000001.000001.00000


Target Position: 2808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2808CAGUUAAAGGUGAAGUGUU87.0512808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942826CAGTTAAAGGTGAAGTGTTAACACTTCACCTTTAACTG0.276400.069400.637900.750001.000001.00000


Target Position: 4825, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4825GGUCAAUAACAUUUUUCAU92.4608324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4944843GGTCAATAACATTTTTCATATGAAAAATGTTATTGACC0.393100.102300.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4823-4845ATGGTCAATAACATTTTTCATTAAUGAAAAAUGUUAUUGACCAUGGUCAAUAACAUUUUUCAUUAU7.716.113


Target Position: 1018, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018GACUUUUCACACAAGAAUA97.50688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1016-1038CAGACTTTTCACACAAGAATAATUAUUCUUGUGUGAAAAGUCUGGACUUUUCACACAAGAAUAAUU12.013.322


Target Position: 4775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4775GGCCACUCAUUUAGAAUUC69.65763814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794793GGCCACTCATTTAGAATTCGAATTCTAAATGAGTGGCC0.417100.129300.827600.750000.923900.75000


Target Position: 4049, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049CCUUAUCCUGACGUAAACA84.73461093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434067CCTTATCCTGACGTAAACATGTTTACGTCAGGATAAGG0.214100.197600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4047-4069CACCTTATCCTGACGTAAACACCUGUUUACGUCAGGAUAAGGUGCCUUAUCCUGACGUAAACACCU15.019.933


Target Position: 6221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6221GAGCUAUUACAAUCCAAAU91.922355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6219-6241AAGAGCTATTACAATCCAAATATAUUUGGAUUGUAAUAGCUCUUGAGCUAUUACAAUCCAAAUAUU20.118.321


Target Position: 6355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6355GCAUGAACGCAUCAAUAGA93.8184243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6353-6375GAGCATGAACGCATCAATAGAAAUCUAUUGAUGCGUUCAUGCUCGCAUGAACGCAUCAAUAGAAAU13.420.532


Target Position: 5294, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5294GACAUUAAGAAAAUUUGUA91.3738391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515312GACATTAAGAAAATTTGTATACAAATTTTCTTAATGTC0.236500.086300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5292-5314ATGACATTAAGAAAATTTGTATGUACAAAUUUUCUUAAUGUCAUGACAUUAAGAAAAUUUGUAUGU5.36.912