Input target sequence

Length: 811
GCAGAAGCGTTCCGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCATGGCCAACTGTGAGCGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGGTCTTGTGGGAGAGATTATCAAGCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAAATTCATGCAAGCTTCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTCTTTGCCGGCCTGGTGAAATACATGCACTCAGGGCCGGTAGTTGCCATGGTCTGGGAGGGGCTGAATGTGGTGAAGACGGGCCGAGTCATGCTCGGGGAGACCAACCCTGCAGACTCCAAGCCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCAGGAACATTATACATGGCAGTGATTCTGTGGAGAGTGCAGAGAAGGAGATCGGCTTGTGGTTTCACCCTGAGGAACTGGTAGATTACACGAGCTGTGCTCAGAACTGGATCTATGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCCATTTCCCCTCCTTCCCATGGGCAGAGGACCAGGCTGTAGGAAATCTAGTTATTTACAGGAACTTCATCATAATTTGGAGGGAAGCTCTTGGAGCTGTGAGTTCTCCCTGTACAGTGTTACCATCCCCGACCATCTGATTAAAATGCTTCCTCCCAGCATAGGATTCATTGAGTTGGTTACTTCATATTGTTGCATTGCTTTTTTTTCCTTCT