siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 647   765   771  
Biltr, Rnaxs, Sidirect 188   635   638   782  
Biltr, Rnaxs 16   72   73   74   76   77   78   100   103   121   122   123   124   125   126   127   128   131   132   162  
163   164   165   167   168   171   172   173   174   175   182   183   186   187   212   213   216   217   220   221  
227   228   230   231   232   234   235   246   249   250   251   255   257   258   268   269   296   297   298   299  
339   341   342   343   344   345   346   347   348   402   411   423   424   433   434   435   437   438   440   441  
442   444   445   446   448   449   450   452   453   454   473   474   476   477   478   479   480   506   512   513  
514   516   517   518   519   538   539   540   541   543   544   545   546   548   551   552   554   566   573   575  
576   578   579   580   583   584   585   586   587   594   595   598   599   624   626   627   628   629   630   631  
634   636   637   642   643   644   645   646   652   653   654   656   657   698   699   700   701   703   704   705  
714   715   718   719   720   721   722   723   730   733   763   764   768   770   772   773   774   777   778   781  
783   784   785   786   787   788   790   791   792  
Biltr, Ernai, Rnaxs 439   515   574   625   632   633   655   724   725   769  


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435CAUACAAGUUGGCAGGAAC79.0712155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181453CATACAAGTTGGCAGGAACGTTCCTGCCAACTTGTATG0.029300.026500.508600.500001.000001.00000


Target Position: 574, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574GGCAGACCACAUUGCUUUU84.187586

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_157419GGCAGACCACATTGCTTTT1/1/0/097.75NME1NM_000269.2+NM_198175.11+1NANANA17:49239213..49239231(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69592GGCAGACCACATTGCTTTTAAAAGCAATGTGGTCTGCC0.167100.036101.000001.000000.918500.62500


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730CAUCUGAUUAAAAUGCUUC72.6884297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189748CATCTGATTAAAATGCTTCGAAGCATTTTAATCAGATG0.092400.057000.482800.500001.000001.00000


Target Position: 164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164GUCUUGUGGGAGAGAUUAU84.269283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150182GTCTTGTGGGAGAGATTATATAATCTCTCCCACAAGAC0.141900.003000.775900.750001.000001.00000


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628CCAGGCUGUAGGAAAUCUA88.667237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154646CCAGGCTGTAGGAAATCTATAGATTTCCTACAGCCTGG0.125000.002700.672401.000001.000001.00000


Target Position: 632, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632GCUGUAGGAAAUCUAGUUA92.705411

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1063219GCTGTAGGAAATCTAGTTA1/1/0/088.31NME1NM_000269.2+NM_198175.11+1NANANA17:49239271..49239289(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115650GCTGTAGGAAATCTAGTTATAACTAGATTTCCTACAGC0.235600.010500.819001.000001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548AGAACUGGAUCUAUGAAUG77.0317202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118566AGAACTGGATCTATGAATGCATTCATAGATCCAGTTCT0.293400.084200.569000.500001.000001.00000


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175GAGAUUAUCAAGCGUUUUG71.9327318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193193GAGATTATCAAGCGTTTTGCAAAACGCTTGATAATCTC0.045400.017200.663800.500001.000001.00000


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72GCAGCCGGAGUUCAAACCU69.1909382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15690GCAGCCGGAGTTCAAACCTAGGTTTGAACTCCGGCTGC0.157700.017500.508600.750000.956500.75000


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516UGAGGAACUGGUAGAUUAC71.4365329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191534TGAGGAACTGGTAGATTACGTAATCTACCAGTTCCTCA0.020000.001300.543100.500001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257AACACUACGUUGACCUGAA89.399730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192275AACACTACGTTGACCTGAATTCAGGTCAACGTAGTGTT0.049300.019500.474100.500001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654ACAGGAACUUCAUCAUAAU88.668136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47672ACAGGAACTTCATCATAATATTATGATGAAGTTCCTGT0.269400.050800.698300.750001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GCUUUUCACAUCCAUUUCC63.1303526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185605GCTTTTCACATCCATTTCCGGAAATGGATGTGAAAAGC0.146000.034000.482800.500001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173GAGAGAUUAUCAAGCGUUU89.09331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100191GAGAGATTATCAAGCGTTTAAACGCTTGATAATCTCTC0.130300.045800.810300.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723CCCCGACCAUCUGAUUAAA86.15867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
21741CCCCGACCATCTGATTAAATTTAATCAGATGGTCGGGG0.269700.196400.991401.000001.000001.00000


Target Position: 269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
269ACCUGAAGGACCGUCCAUU70.9717338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146287ACCTGAAGGACCGTCCATTAATGGACGGTCCTTCAGGT0.117100.003200.844800.750000.945700.87500


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722UCCCCGACCAUCUGAUUAA76.2658225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58740TCCCCGACCATCTGATTAATTAATCAGATGGTCGGGGA0.485100.359800.836200.750001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163GGUCUUGUGGGAGAGAUUA88.769835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156181GGTCTTGTGGGAGAGATTATAATCTCTCCCACAAGACC0.145400.002700.819001.000001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518AGGAACUGGUAGAUUACAC71.5403327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183536AGGAACTGGTAGATTACACGTGTAATCTACCAGTTCCT0.028900.001500.551700.500001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477GGAGAGUGCAGAGAAGGAG74.2002263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149495GGAGAGTGCAGAGAAGGAGCTCCTTCTCTGCACTCTCC0.052600.011700.560300.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655CAGGAACUUCAUCAUAAUU87.644949

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_365519CAGGAACTTCATCATAATT1/1/0/094.96NME1NM_000269.2+NM_198175.11+1NANANA17:49239294..49239312(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44673CAGGAACTTCATCATAATTAATTATGATGAAGTTCCTG0.610000.144400.775900.750001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514CCUGAGGAACUGGUAGAUU77.7974181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200532CCTGAGGAACTGGTAGATTAATCTACCAGTTCCTCAGG0.013200.001100.836201.000001.000001.00000


Target Position: 341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341GGGAGGGGCUGAAUGUGGU76.7866207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
157359GGGAGGGGCTGAATGTGGTACCACATTCAGCCCCTCCC0.049600.002700.637900.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538AGCUGUGCUCAGAACUGGA86.341761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182556AGCTGTGCTCAGAACTGGATCCAGTTCTGAGCACAGCT0.134800.008600.482800.500000.989100.75000


Target Position: 165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
165UCUUGUGGGAGAGAUUAUC57.598606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173183TCTTGTGGGAGAGATTATCGATAATCTCTCCCACAAGA0.139100.004000.543100.500001.000001.00000


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127ACCUUCAUUGCGAUCAAAC61.3526557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195145ACCTTCATTGCGATCAAACGTTTGATCGCAATGAAGGT0.112900.001200.706900.500001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785AUUGUUGCAUUGCUUUUUU68.7619397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187803ATTGTTGCATTGCTTTTTTAAAAAAGCAATGCAACAAT0.185200.072700.508600.500001.000001.00000


Target Position: 73, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
73CAGCCGGAGUUCAAACCUA92.346314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591CAGCCGGAGTTCAAACCTATAGGTTTGAACTCCGGCTG0.163400.017500.612100.750000.956500.75000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584AUUGCUUUUCACAUCCAUU75.9336232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162602ATTGCTTTTCACATCCATTAATGGATGTGAAAAGCAAT0.249900.064500.500000.500000.994600.75000


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346GGGCUGAAUGUGGUGAAGA83.735892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140364GGGCTGAATGTGGTGAAGATCTTCACCACATTCAGCCC0.064200.004100.767200.750001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473CUGUGGAGAGUGCAGAGAA93.59618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167491CTGTGGAGAGTGCAGAGAATTCTCTGCACTCTCCACAG0.069800.002200.612100.750001.000001.00000


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230UGCAAGCUUCCGAAGAUCU68.419404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114248TGCAAGCTTCCGAAGATCTAGATCTTCGGAAGCTTGCA0.124800.041200.629300.500001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791GCAUUGCUUUUUUUUCCUU79.45151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34809GCATTGCTTTTTTTTCCTTAAGGAAAAAAAAGCAATGC0.983100.178700.715501.000001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704CCCUGUACAGUGUUACCAU87.977346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135722CCCTGTACAGTGTTACCATATGGTAACACTGTACAGGG0.142000.004500.836201.000001.000001.00000


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268GACCUGAAGGACCGUCCAU80.4274135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149286GACCTGAAGGACCGTCCATATGGACGGTCCTTCAGGTC0.123000.003100.663800.750000.945700.75000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183CAAGCGUUUUGAGCAGAAA88.534339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196201CAAGCGTTTTGAGCAGAAATTTCTGCTCAAAACGCTTG0.017300.005300.646600.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585UUGCUUUUCACAUCCAUUU62.5466538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131603TTGCTTTTCACATCCATTTAAATGGATGTGAAAAGCAA0.188400.044600.646600.500000.994600.62500


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578GACCACAUUGCUUUUCACA86.633956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201596GACCACATTGCTTTTCACATGTGAAAAGCAATGTGGTC0.218100.116400.612100.500000.994600.62500


Target Position: 103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
103GGAACCAUGGCCAACUGUG71.6321323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193121GGAACCATGGCCAACTGTGCACAGTTGGCCATGGTTCC0.018500.001500.577600.750001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GUUCUCCCUGUACAGUGUU72.3383302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192717GTTCTCCCTGTACAGTGTTAACACTGTACAGGGAGAAC0.022200.001300.500000.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GCUGUGCUCAGAACUGGAU80.5372132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112557GCTGTGCTCAGAACTGGATATCCAGTTCTGAGCACAGC0.203500.011000.672401.000000.989100.62500


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790UGCAUUGCUUUUUUUUCCU62.9414530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155808TGCATTGCTTTTTTTTCCTAGGAAAAAAAAGCAATGCA0.982400.175800.508600.500001.000001.00000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77CGGAGUUCAAACCUAAGCA86.206665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15895CGGAGTTCAAACCTAAGCATGCTTAGGTTTGAACTCCG0.045500.007300.560300.750000.956500.75000


Target Position: 633, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633CUGUAGGAAAUCUAGUUAU84.935577

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_663319CTGTAGGAAATCTAGTTAT1/1/0/091.46NME1NM_000269.2+NM_198175.11+1NANANANA00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76651CTGTAGGAAATCTAGTTATATAACTAGATTTCCTACAG0.187200.032200.741400.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781UCAUAUUGUUGCAUUGCUU77.6616184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124799TCATATTGTTGCATTGCTTAAGCAATGCAACAATATGA0.086500.063400.586200.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625GGACCAGGCUGUAGGAAAU90.909219

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_262519GGACCAGGCTGTAGGAAAT1/1/0/097.21NME1NM_000269.2+NM_198175.11+1NANANA17:49239264..49239282(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141643GGACCAGGCTGTAGGAAATATTTCCTACAGCCTGGTCC0.079100.003600.862101.000000.967400.87500


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517GAGGAACUGGUAGAUUACA88.364342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189535GAGGAACTGGTAGATTACATGTAATCTACCAGTTCCTC0.032600.001300.603400.500001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631GGCUGUAGGAAAUCUAGUU88.43941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123649GGCTGTAGGAAATCTAGTTAACTAGATTTCCTACAGCC0.237000.008100.853401.000001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74AGCCGGAGUUCAAACCUAA90.211324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292AGCCGGAGTTCAAACCTAATTAGGTTTGAACTCCGGCT0.153600.018100.819000.750000.956500.87500


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258ACACUACGUUGACCUGAAG71.3138333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195276ACACTACGTTGACCTGAAGCTTCAGGTCAACGTAGTGT0.018000.002600.569000.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132CAUUGCGAUCAAACCAGAU83.696895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197150CATTGCGATCAAACCAGATATCTGGTTTGATCGCAATG0.030500.001300.474100.750001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656AGGAACUUCAUCAUAAUUU75.9352231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58674AGGAACTTCATCATAATTTAAATTATGATGAAGTTCCT0.181300.101100.844800.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GGGUCUUGUGGGAGAGAUU86.930554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187180GGGTCTTGTGGGAGAGATTAATCTCTCCCACAAGACCC0.116500.001400.982801.000001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554GGAUCUAUGAAUGACAGGA90.128825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166572GGATCTATGAATGACAGGATCCTGTCATTCATAGATCC0.036200.002600.500000.750000.978300.75000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437UACAAGUUGGCAGGAACAU63.6546514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171455TACAAGTTGGCAGGAACATATGTTCCTGCCAACTTGTA0.042000.025200.525900.500001.000001.00000


Target Position: 515, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CUGAGGAACUGGUAGAUUA97.25622

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_451519CTGAGGAACTGGTAGATTA1/1/0/093.71NME1NM_000269.2+NM_198175.11+1NANANA17:49239154..49239172(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197533CTGAGGAACTGGTAGATTATAATCTACCAGTTCCTCAG0.017300.001800.750000.750001.000001.00000


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228CAUGCAAGCUUCCGAAGAU88.976232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194246CATGCAAGCTTCCGAAGATATCTTCGGAAGCTTGCATG0.114600.060200.474100.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGAGUUGGUUACUUCAUAU86.441258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80786TGAGTTGGTTACTTCATATATATGAAGTAACCAACTCA0.155200.025900.681000.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792CAUUGCUUUUUUUUCCUUC67.9365421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183810CATTGCTTTTTTTTCCTTCGAAGGAAAAAAAAGCAATG0.985100.179800.482800.500001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GCUCAGAACUGGAUCUAUG83.708893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90562GCTCAGAACTGGATCTATGCATAGATCCAGTTCTGAGC0.284800.018500.698300.750000.940200.62500


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423UGGAGACUUCUGCAUACAA88.872734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172441TGGAGACTTCTGCATACAATTGTATGCAGAAGTCTCCA0.032400.001900.698300.750001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217GGUCUGAAAUUCAUGCAAG83.1313101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99235GGTCTGAAATTCATGCAAGCTTGCATGAATTTCAGACC0.391200.015100.715500.750001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424GGAGACUUCUGCAUACAAG84.133887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162442GGAGACTTCTGCATACAAGCTTGTATGCAGAAGTCTCC0.050000.002500.732800.750001.000001.00000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703UCCCUGUACAGUGUUACCA67.6265428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151721TCCCTGTACAGTGTTACCATGGTAACACTGTACAGGGA0.076200.003700.525900.500001.000001.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347GGCUGAAUGUGGUGAAGAC85.584774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169365GGCTGAATGTGGTGAAGACGTCTTCACCACATTCAGCC0.033100.008900.681000.750001.000001.00000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250CUCAAGGAACACUACGUUG70.1693363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153268CTCAAGGAACACTACGTTGCAACGTAGTGTTCCTTGAG0.187000.002800.663800.500001.000001.00000


Target Position: 171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171GGGAGAGAUUAUCAAGCGU83.745691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116189GGGAGAGATTATCAAGCGTACGCTTGATAATCTCTCCC0.109000.044600.715500.750001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551ACUGGAUCUAUGAAUGACA86.358960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170569ACTGGATCTATGAATGACATGTCATTCATAGATCCAGT0.253800.095300.500000.500001.000001.00000


Target Position: 541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541UGUGCUCAGAACUGGAUCU71.6053325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186559TGTGCTCAGAACTGGATCTAGATCCAGTTCTGAGCACA0.191100.018400.482800.500000.972800.62500


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434GCAUACAAGUUGGCAGGAA87.340252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176452GCATACAAGTTGGCAGGAATTCCTGCCAACTTGTATGC0.029900.029400.681001.000001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167UUGUGGGAGAGAUUAUCAA80.1834140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197185TTGTGGGAGAGATTATCAATTGATAATCTCTCCCACAA0.187700.008500.500000.500001.000001.00000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595CAUCCAUUUCCCCUCCUUC70.6669347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188613CATCCATTTCCCCTCCTTCGAAGGAGGGGAAATGGATG0.029600.010900.482800.500001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AUCUAGUUAUUUACAGGAA85.764173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
157660ATCTAGTTATTTACAGGAATTCCTGTAAATAACTAGAT0.070300.020900.508600.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778ACUUCAUAUUGUUGCAUUG73.6906276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134796ACTTCATATTGTTGCATTGCAATGCAACAATATGAAGT0.118600.048100.560300.500001.000001.00000


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124CGUACCUUCAUUGCGAUCA75.2292242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185142CGTACCTTCATTGCGATCATGATCGCAATGAAGGTACG0.149800.001500.551700.750000.983700.62500


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246UCUUCUCAAGGAACACUAC64.9789484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173264TCTTCTCAAGGAACACTACGTAGTGTTCCTTGAGAAGA0.057600.001800.543100.500001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446GCAGGAACAUUAUACAUGG78.2423166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159464GCAGGAACATTATACATGGCCATGTATAATGTTCCTGC0.325700.012200.508600.500001.000001.00000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512ACCCUGAGGAACUGGUAGA73.651279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199530ACCCTGAGGAACTGGTAGATCTACCAGTTCCTCAGGGT0.014600.002300.629300.500000.983700.75000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251UCAAGGAACACUACGUUGA72.7729296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172269TCAAGGAACACTACGTTGATCAACGTAGTGTTCCTTGA0.175300.003200.500000.500001.000001.00000


Target Position: 573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
573GGGCAGACCACAUUGCUUU81.8703115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79591GGGCAGACCACATTGCTTTAAAGCAATGTGGTCTGCCC0.156900.022700.991401.000000.918500.62500


Target Position: 100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
100GAAGGAACCAUGGCCAACU76.2928223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201118GAAGGAACCATGGCCAACTAGTTGGCCATGGTTCCTTC0.012000.001600.465500.500001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442GUUGGCAGGAACAUUAUAC70.6396349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202460GTTGGCAGGAACATTATACGTATAATGTTCCTGCCAAC0.232600.017400.465500.500001.000001.00000


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227UCAUGCAAGCUUCCGAAGA67.48433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164245TCATGCAAGCTTCCGAAGATCTTCGGAAGCTTGCATGA0.140200.074100.500000.500001.000001.00000


Target Position: 126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126UACCUUCAUUGCGAUCAAA80.5579131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166144TACCTTCATTGCGATCAAATTTGATCGCAATGAAGGTA0.193100.002200.681000.500000.983700.62500


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643UCUAGUUAUUUACAGGAAC62.9049531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141661TCTAGTTATTTACAGGAACGTTCCTGTAAATAACTAGA0.066000.021300.577600.500001.000001.00000


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298CUGGUGAAAUACAUGCACU82.9024105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170316CTGGTGAAATACATGCACTAGTGCATGTATTTCACCAG0.033700.001900.577600.500001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UUGGUUACUUCAUAUUGUU72.578298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199790TTGGTTACTTCATATTGTTAACAATATGAAGTAACCAA0.207800.066200.500000.500001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445GGCAGGAACAUUAUACAUG77.8752177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101463GGCAGGAACATTATACATGCATGTATAATGTTCCTGCC0.195800.014600.844800.750001.000001.00000


Target Position: 235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235GCUUCCGAAGAUCUUCUCA83.957590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135253GCTTCCGAAGATCTTCTCATGAGAAGATCTTCGGAAGC0.069000.013700.629300.750001.000001.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700UUCUCCCUGUACAGUGUUA75.7206235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182718TTCTCCCTGTACAGTGTTATAACACTGTACAGGGAGAA0.037200.002400.637900.500001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580CCACAUUGCUUUUCACAUC73.8095272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105598CCACATTGCTTTTCACATCGATGTGAAAAGCAATGTGG0.123500.076500.663800.750000.994600.75000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452ACAUUAUACAUGGCAGUGA78.2415167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187470ACATTATACATGGCAGTGATCACTGCCATGTATAATGT0.093600.053900.482800.500001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453CAUUAUACAUGGCAGUGAU93.77387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193471CATTATACATGGCAGTGATATCACTGCCATGTATAATG0.055300.028000.474100.750001.000001.00000


Target Position: 647, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647GUUAUUUACAGGAACUUCA86.051168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
645-667TAGTTATTTACAGGAACTTCATCUGAAGUUCCUGUAAAUAACUAGUUAUUUACAGGAACUUCAUCU21.5-7.501


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764UCAUUGAGUUGGUUACUUC71.5141328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148782TCATTGAGTTGGTTACTTCGAAGTAACCAACTCAATGA0.125400.003100.551700.500001.000001.00000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634UGUAGGAAAUCUAGUUAUU80.8378129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86652TGTAGGAAATCTAGTTATTAATAACTAGATTTCCTACA0.146400.032500.698300.750001.000001.00000


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576CAGACCACAUUGCUUUUCA87.385351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122594CAGACCACATTGCTTTTCATGAAAAGCAATGTGGTCTG0.192100.074100.560300.500001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480GAGUGCAGAGAAGGAGAUC70.8388343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122498GAGTGCAGAGAAGGAGATCGATCTCCTTCTCTGCACTC0.112500.010000.629300.500001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CAUAUUGUUGCAUUGCUUU80.8555128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70800CATATTGTTGCATTGCTTTAAAGCAATGCAACAATATG0.175500.064100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
780-802TTCATATTGTTGCATTGCTTTTTAAAGCAAUGCAACAAUAUGAACAUAUUGUUGCAUUGCUUUUUU18.56.722


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474UGUGGAGAGUGCAGAGAAG73.8735270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150492TGTGGAGAGTGCAGAGAAGCTTCTCTGCACTCTCCACA0.083900.005600.569000.500001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575GCAGACCACAUUGCUUUUC57.568607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93593GCAGACCACATTGCTTTTCGAAAAGCAATGTGGTCTGC0.179000.051300.681000.750000.962000.62500


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627ACCAGGCUGUAGGAAAUCU70.354356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180645ACCAGGCTGTAGGAAATCTAGATTTCCTACAGCCTGGT0.081700.002900.629300.500000.967400.75000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763UUCAUUGAGUUGGUUACUU63.0296527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196781TTCATTGAGTTGGTTACTTAAGTAACCAACTCAATGAA0.096500.001400.534500.500001.000001.00000


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636UAGGAAAUCUAGUUAUUUA95.8973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168654TAGGAAATCTAGTTATTTATAAATAACTAGATTTCCTA0.161000.034400.637900.500001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476UGGAGAGUGCAGAGAAGGA81.3148122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195494TGGAGAGTGCAGAGAAGGATCCTTCTCTGCACTCTCCA0.052600.006500.474100.500001.000001.00000


Target Position: 769, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GAGUUGGUUACUUCAUAUU85.846871

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_776919GAGTTGGTTACTTCATATT1/1/0/091.46NME1NM_000269.2+NM_198175.11+1NANANA17:49239408..49239426(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73787GAGTTGGTTACTTCATATTAATATGAAGTAACCAACTC0.730200.025100.801700.750001.000001.00000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624AGGACCAGGCUGUAGGAAA83.485397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192642AGGACCAGGCTGTAGGAAATTTCCTACAGCCTGGTCCT0.019400.001600.844800.750000.967400.87500


Target Position: 546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
546UCAGAACUGGAUCUAUGAA84.735679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136564TCAGAACTGGATCTATGAATTCATAGATCCAGTTCTGA0.279900.061700.551700.750000.940200.62500


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232CAAGCUUCCGAAGAUCUUC67.8346422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196250CAAGCTTCCGAAGATCTTCGAAGATCTTCGGAAGCTTG0.121500.027800.474100.500001.000001.00000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450GAACAUUAUACAUGGCAGU80.3041137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199468GAACATTATACATGGCAGTACTGCCATGTATAATGTTC0.094200.049900.465500.500001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GGUUACUUCAUAUUGUUGC64.5484495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165792GGTTACTTCATATTGTTGCGCAACAATATGAAGTAACC0.158700.065900.500000.500001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519GGAACUGGUAGAUUACACG77.1873198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193537GGAACTGGTAGATTACACGCGTGTAATCTACCAGTTCC0.022400.001200.594800.500001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CUGUGCUCAGAACUGGAUC63.7647510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184558CTGTGCTCAGAACTGGATCGATCCAGTTCTGAGCACAG0.191100.014700.603400.500001.000001.00000


Target Position: 724, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724CCCGACCAUCUGAUUAAAA84.594380

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_972419CCCGACCATCTGATTAAAA1/1/0/088.67NME1NM_000269.2+NM_198175.11+1NANANA17:49239363..49239381(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84742CCCGACCATCTGATTAAAATTTTAATCAGATGGTCGGG0.146800.127000.991401.000001.000001.00000


Target Position: 186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186GCGUUUUGAGCAGAAAGGA78.2241168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162204GCGTTTTGAGCAGAAAGGATCCTTTCTGCTCAAAACGC0.040100.006200.551700.750001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770AGUUGGUUACUUCAUAUUG72.9105291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190788AGTTGGTTACTTCATATTGCAATATGAAGTAACCAACT0.146700.027000.560300.500001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545CUCAGAACUGGAUCUAUGA88.038644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146563CTCAGAACTGGATCTATGATCATAGATCCAGTTCTGAG0.289600.060000.586200.500000.940200.62500


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579ACCACAUUGCUUUUCACAU76.3356221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77597ACCACATTGCTTTTCACATATGTGAAAAGCAATGTGGT0.214700.119700.698300.750000.994600.62500


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637AGGAAAUCUAGUUAUUUAC72.2192309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185655AGGAAATCTAGTTATTTACGTAAATAACTAGATTTCCT0.067900.016300.663800.500001.000001.00000


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125GUACCUUCAUUGCGAUCAA92.057115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171143GTACCTTCATTGCGATCAATTGATCGCAATGAAGGTAC0.191700.001900.534500.750000.983700.62500


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174AGAGAUUAUCAAGCGUUUU74.8787251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101192AGAGATTATCAAGCGTTTTAAAACGCTTGATAATCTCT0.127500.049600.724100.750001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657GGAACUUCAUCAUAAUUUG83.568496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61675GGAACTTCATCATAATTTGCAAATTATGATGAAGTTCC0.243200.076300.724100.750001.000001.00000


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212UUGUUGGUCUGAAAUUCAU72.8176294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196230TTGTTGGTCTGAAATTCATATGAATTTCAGACCAACAA0.152300.001200.491400.500001.000001.00000


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345GGGGCUGAAUGUGGUGAAG70.2775361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151363GGGGCTGAATGTGGTGAAGCTTCACCACATTCAGCCCC0.051800.003700.853400.750001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AUAUUGUUGCAUUGCUUUU71.6935322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161801ATATTGTTGCATTGCTTTTAAAAGCAATGCAACAATAT0.179500.064400.543100.500001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221UGAAAUUCAUGCAAGCUUC66.6677447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
132239TGAAATTCATGCAAGCTTCGAAGCTTGCATGAATTTCA0.219200.073500.551700.500001.000001.00000


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213UGUUGGUCUGAAAUUCAUG68.6921400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176231TGTTGGTCTGAAATTCATGCATGAATTTCAGACCAACA0.174300.001700.551700.500001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441AGUUGGCAGGAACAUUAUA88.248843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
85459AGTTGGCAGGAACATTATATATAATGTTCCTGCCAACT0.366800.020900.663800.750001.000001.00000


Target Position: 76, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
76CCGGAGUUCAAACCUAAGC54.1305652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
20294CCGGAGTTCAAACCTAAGCGCTTAGGTTTGAACTCCGG0.057200.003500.560300.500000.956500.75000


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CUGGAUCUAUGAAUGACAG76.7663208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177570CTGGATCTATGAATGACAGCTGTCATTCATAGATCCAG0.029900.007300.500000.500001.000001.00000


Target Position: 123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
123GCGUACCUUCAUUGCGAUC65.0375483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197141GCGTACCTTCATTGCGATCGATCGCAATGAAGGTACGC0.156800.001100.741400.750000.983700.62500


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718ACCAUCCCCGACCAUCUGA66.0381462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170736ACCATCCCCGACCATCTGATCAGATGGTCGGGGATGGT0.414900.329900.629300.500000.978300.62500


Target Position: 594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594ACAUCCAUUUCCCCUCCUU71.0667337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172612ACATCCATTTCCCCTCCTTAAGGAGGGGAAATGGATGT0.032100.010300.569000.750001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733CUGAUUAAAAUGCUUCCUC63.4746518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191751CTGATTAAAATGCTTCCTCGAGGAAGCATTTTAATCAG0.075300.070000.474100.500001.000001.00000


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342GGAGGGGCUGAAUGUGGUG70.8296344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155360GGAGGGGCTGAATGTGGTGCACCACATTCAGCCCCTCC0.049600.002700.577600.750001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255GGAACACUACGUUGACCUG80.5284133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143273GGAACACTACGTTGACCTGCAGGTCAACGTAGTGTTCC0.060700.014400.586200.750001.000001.00000


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721AUCCCCGACCAUCUGAUUA73.2965282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189739ATCCCCGACCATCTGATTATAATCAGATGGTCGGGGAT0.435600.350600.646600.500001.000001.00000


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131UCAUUGCGAUCAAACCAGA78.0229174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180149TCATTGCGATCAAACCAGATCTGGTTTGATCGCAATGA0.029400.002000.500000.500001.000001.00000


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788GUUGCAUUGCUUUUUUUUC66.0535461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190806GTTGCATTGCTTTTTTTTCGAAAAAAAAGCAATGCAAC0.373200.078600.474100.500001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344AGGGGCUGAAUGUGGUGAA79.2369154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148362AGGGGCTGAATGTGGTGAATTCACCACATTCAGCCCCT0.053500.003300.672400.750001.000001.00000


Target Position: 725, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725CCGACCAUCUGAUUAAAAU84.361782

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_572519CCGACCATCTGATTAAAAT1/1/0/093.71NME1NM_000269.2+NM_198175.11+1NANANA17:49239364..49239382(+)00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73743CCGACCATCTGATTAAAATATTTTAATCAGATGGTCGG0.161900.103400.905201.000001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348GCUGAAUGUGGUGAAGACG68.057415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195366GCTGAATGTGGTGAAGACGCGTCTTCACCACATTCAGC0.025900.022600.577600.500001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216UGGUCUGAAAUUCAUGCAA79.5825149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111234TGGTCTGAAATTCATGCAATTGCATGAATTTCAGACCA0.446500.011700.698300.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784UAUUGUUGCAUUGCUUUUU64.6949494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142802TATTGTTGCATTGCTTTTTAAAAAGCAATGCAACAATA0.181000.065500.543100.500001.000001.00000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646AGUUAUUUACAGGAACUUC70.2877360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146664AGTTATTTACAGGAACTTCGAAGTTCCTGTAAATAACT0.067200.022900.534500.500001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506GGUUUCACCCUGAGGAACU76.8464205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202524GGTTTCACCCTGAGGAACTAGTTCCTCAGGGTGAAACC0.261900.001000.646600.750000.967400.75000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433UGCAUACAAGUUGGCAGGA66.3432456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184451TGCATACAAGTTGGCAGGATCCTGCCAACTTGTATGCA0.031000.006800.482800.500001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297CCUGGUGAAAUACAUGCAC66.7539446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178315CCTGGTGAAATACATGCACGTGCATGTATTTCACCAGG0.050800.001700.551700.750001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168UGUGGGAGAGAUUAUCAAG73.1568285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119186TGTGGGAGAGATTATCAAGCTTGATAATCTCTCCCACA0.168900.012600.569000.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765CAUUGAGUUGGUUACUUCA95.32814

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
763-785TTCATTGAGTTGGTTACTTCATAUGAAGUAACCAACUCAAUGAACAUUGAGUUGGUUACUUCAUAU14.619.223


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513CCCUGAGGAACUGGUAGAU76.121229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202531CCCTGAGGAACTGGTAGATATCTACCAGTTCCTCAGGG0.011800.001500.810301.000001.000001.00000


Target Position: 78, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
78GGAGUUCAAACCUAAGCAG76.5544210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
16596GGAGTTCAAACCTAAGCAGCTGCTTAGGTTTGAACTCC0.036600.019200.586200.750001.000001.00000


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234AGCUUCCGAAGAUCUUCUC59.3677583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141252AGCTTCCGAAGATCTTCTCGAGAAGATCTTCGGAAGCT0.072200.017300.543100.500001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720CAUCCCCGACCAUCUGAUU77.2377195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74738CATCCCCGACCATCTGATTAATCAGATGGTCGGGGATG0.425600.349100.646600.750001.000001.00000


Target Position: 121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
121GAGCGUACCUUCAUUGCGA90.878120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199139GAGCGTACCTTCATTGCGATCGCAATGAAGGTACGCTC0.018300.001100.517200.500001.000001.00000


Target Position: 638, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638GGAAAUCUAGUUAUUUACA93.28559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142656GGAAATCTAGTTATTTACATGTAAATAACTAGATTTCC0.062400.019200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
636-658TAGGAAATCTAGTTATTTACAGGUGUAAAUAACUAGAUUUCCUAGGAAAUCUAGUUAUUUACAGGU1.414.802


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182UCAAGCGUUUUGAGCAGAA77.2009197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185200TCAAGCGTTTTGAGCAGAATTCTGCTCAAAACGCTTGA0.024900.006900.551700.750001.000001.00000


Target Position: 16, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
16GCGUGCAAGUGCUGCGAAC71.9547317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17534GCGTGCAAGTGCTGCGAACGTTCGCAGCACTTGCACGC0.034100.001700.775900.750000.902201.00000


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CUAGUUAUUUACAGGAACU82.9676104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198662CTAGTTATTTACAGGAACTAGTTCCTGTAAATAACTAG0.064600.024200.465500.500001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UGCUUUUCACAUCCAUUUC59.1219586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186604TGCTTTTCACATCCATTTCGAAATGGATGTGAAAAGCA0.177500.045700.681000.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449GGAACAUUAUACAUGGCAG86.031269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126467GGAACATTATACATGGCAGCTGCCATGTATAATGTTCC0.082800.052500.586200.750001.000001.00000


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543UGCUCAGAACUGGAUCUAU79.9965142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89561TGCTCAGAACTGGATCTATATAGATCCAGTTCTGAGCA0.153900.019100.810300.750000.940200.62500


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645UAGUUAUUUACAGGAACUU69.2735380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148663TAGTTATTTACAGGAACTTAAGTTCCTGTAAATAACTA0.062900.022800.534500.500001.000001.00000


Target Position: 187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CGUUUUGAGCAGAAAGGAU86.385959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178205CGTTTTGAGCAGAAAGGATATCCTTTCTGCTCAAAACG0.029700.005000.594801.000001.000001.00000


Target Position: 701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
701UCUCCCUGUACAGUGUUAC53.1634671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163719TCTCCCTGTACAGTGTTACGTAACACTGTACAGGGAGA0.037200.002900.543100.500000.994600.62500


Target Position: 188, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
188GUUUUGAGCAGAAAGGAUU78.1818170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183206GTTTTGAGCAGAAAGGATTAATCCTTTCTGCTCAAAAC0.027900.004000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
186-208GCGTTTTGAGCAGAAAGGATTCCAAUCCUUUCUGCUCAAAACGCGUUUUGAGCAGAAAGGAUUCCU18.712.202


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299UGGUGAAAUACAUGCACUC67.6206429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190317TGGTGAAATACATGCACTCGAGTGCATGTATTTCACCA0.020900.001600.534500.500001.000001.00000


Target Position: 122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122AGCGUACCUUCAUUGCGAU80.0644141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201140AGCGTACCTTCATTGCGATATCGCAATGAAGGTACGCT0.170700.001000.672400.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719CCAUCCCCGACCAUCUGAU74.7222253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65737CCATCCCCGACCATCTGATATCAGATGGTCGGGGATGG0.421700.345600.663801.000001.000001.00000


Target Position: 439, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439CAAGUUGGCAGGAACAUUA92.411213

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_843919CAAGTTGGCAGGAACATTA1/1/0/088.67NME1NM_000269.2+NM_198175.11+1NANANANA00NME1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97457CAAGTTGGCAGGAACATTATAATGTTCCTGCCAACTTG0.165200.024000.612100.750001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786UUGUUGCAUUGCUUUUUUU68.3877408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158804TTGTTGCATTGCTTTTTTTAAAAAAAGCAATGCAACAA0.187800.074800.646600.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402CUCCAAGCCUGGGACCAUC62.0566545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198420CTCCAAGCCTGGGACCATCGATGGTCCCAGGCTTGGAG0.021700.012600.629300.500000.902200.75000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626GACCAGGCUGUAGGAAAUC63.9578506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194644GACCAGGCTGTAGGAAATCGATTTCCTACAGCCTGGTC0.075600.003200.637900.500000.967400.75000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GCCUGGUGAAAUACAUGCA87.086653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168314GCCTGGTGAAATACATGCATGCATGTATTTCACCAGGC0.132200.002100.646600.750001.000001.00000


Target Position: 172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172GGAGAGAUUAUCAAGCGUU87.912748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123190GGAGAGATTATCAAGCGTTAACGCTTGATAATCTCTCC0.090400.045400.724101.000001.000001.00000


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599CAUUUCCCCUCCUUCCCAU77.2374196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174617CATTTCCCCTCCTTCCCATATGGGAAGGAGGGGAAATG0.141500.007500.500000.750001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438ACAAGUUGGCAGGAACAUU75.0609248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117456ACAAGTTGGCAGGAACATTAATGTTCCTGCCAACTTGT0.097100.024600.698300.750001.000001.00000


Target Position: 231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231GCAAGCUUCCGAAGAUCUU77.4197190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
113249GCAAGCTTCCGAAGATCTTAAGATCTTCGGAAGCTTGC0.113400.032000.715501.000001.000001.00000


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715GUUACCAUCCCCGACCAUC60.0307574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200733GTTACCATCCCCGACCATCGATGGTCGGGGATGGTAAC0.601600.137500.465500.500000.940200.62500


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479AGAGUGCAGAGAAGGAGAU78.0482173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143497AGAGTGCAGAGAAGGAGATATCTCCTTCTCTGCACTCT0.114500.011000.543100.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787UGUUGCAUUGCUUUUUUUU68.5649402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97805TGTTGCATTGCTTTTTTTTAAAAAAAAGCAATGCAACA0.251200.079200.706900.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CAUUGCUUUUCACAUCCAU84.25384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166601CATTGCTTTTCACATCCATATGGATGTGAAAAGCAATG0.258600.065800.500000.750000.994600.87500


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773UGGUUACUUCAUAUUGUUG69.4789373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156791TGGTTACTTCATATTGTTGCAACAATATGAAGTAACCA0.185600.081300.698300.500001.000001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652UUACAGGAACUUCAUCAUA79.6332148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177670TTACAGGAACTTCATCATATATGATGAAGTTCCTGTAA0.220500.030900.491400.500001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220CUGAAAUUCAUGCAAGCUU75.1004246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78238CTGAAATTCATGCAAGCTTAAGCTTGCATGAATTTCAG0.243000.068000.646600.750001.000001.00000


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454AUUAUACAUGGCAGUGAUU75.2667241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191472ATTATACATGGCAGTGATTAATCACTGCCATGTATAAT0.041600.005100.500000.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440AAGUUGGCAGGAACAUUAU77.864179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183458AAGTTGGCAGGAACATTATATAATGTTCCTGCCAACTT0.208800.022600.594800.500001.000001.00000


Target Position: 635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635GUAGGAAAUCUAGUUAUUU86.217464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88653GTAGGAAATCTAGTTATTTAAATAACTAGATTTCCTAC0.145600.032300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
633-655CTGTAGGAAATCTAGTTATTTACAAAUAACUAGAUUUCCUACAGGUAGGAAAUCUAGUUAUUUACU4.619.903


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128CCUUCAUUGCGAUCAAACC68.0224418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184146CCTTCATTGCGATCAAACCGGTTTGATCGCAATGAAGG0.094200.001500.491400.500001.000001.00000


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249UCUCAAGGAACACUACGUU71.4162330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161267TCTCAAGGAACACTACGTTAACGTAGTGTTCCTTGAGA0.193200.002600.577600.750001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714UGUUACCAUCCCCGACCAU67.3897435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131732TGTTACCATCCCCGACCATATGGTCGGGGATGGTAACA0.613900.132200.551700.750000.962000.62500


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598CCAUUUCCCCUCCUUCCCA75.7931234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163616CCATTTCCCCTCCTTCCCATGGGAAGGAGGGGAAATGG0.141300.011700.500000.750001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339CUGGGAGGGGCUGAAUGUG60.7044565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181357CTGGGAGGGGCTGAATGTGCACATTCAGCCCCTCCCAG0.030300.002400.491400.500001.000001.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343GAGGGGCUGAAUGUGGUGA76.5378211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163361GAGGGGCTGAATGTGGTGATCACCACATTCAGCCCCTC0.049800.003200.586200.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GUUGGUUACUUCAUAUUGU83.2181100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
769-791GAGTTGGTTACTTCATATTGTTGACAAUAUGAAGUAACCAACUCGUUGGUUACUUCAUAUUGUUGU5.620.032


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777UACUUCAUAUUGUUGCAUU75.8632233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
113795TACTTCATATTGTTGCATTAATGCAACAATATGAAGTA0.135500.052400.672400.500001.000001.00000


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705CCUGUACAGUGUUACCAUC76.9345203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122723CCTGTACAGTGTTACCATCGATGGTAACACTGTACAGG0.169400.008100.663800.750000.994600.62500


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448AGGAACAUUAUACAUGGCA76.4189215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180466AGGAACATTATACATGGCATGCCATGTATAATGTTCCT0.163700.022500.491400.500001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653UACAGGAACUUCAUCAUAA91.590717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192671TACAGGAACTTCATCATAATTATGATGAAGTTCCTGTA0.222000.040600.646600.500001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411UGGGACCAUCCGUGGAGAC55.64635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186429TGGGACCATCCGTGGAGACGTCTCCACGGATGGTCCCA0.023000.001700.525900.500000.951100.75000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444UGGCAGGAACAUUAUACAU79.3975152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103462TGGCAGGAACATTATACATATGTATAATGTTCCTGCCA0.210200.014000.689700.750001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478GAGAGUGCAGAGAAGGAGA90.622221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148496GAGAGTGCAGAGAAGGAGATCTCCTTCTCTGCACTCTC0.134100.012500.586200.500001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630AGGCUGUAGGAAAUCUAGU73.7117275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176648AGGCTGTAGGAAATCTAGTACTAGATTTCCTACAGCCT0.235800.008300.637900.500001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698AGUUCUCCCUGUACAGUGU78.2052169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198716AGTTCTCCCTGTACAGTGTACACTGTACAGGGAGAACT0.015900.001100.500000.500001.000001.00000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GACAGGAGGGCAGACCACA84.03489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194584GACAGGAGGGCAGACCACATGTGGTCTGCCCTCCTGTC0.059900.001200.612100.500000.967400.87500


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629CAGGCUGUAGGAAAUCUAG78.0575172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188647CAGGCTGTAGGAAATCTAGCTAGATTTCCTACAGCCTG0.183900.002700.612100.500001.000001.00000