siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 98   119   123   124   496   544   1231   2016   2074   2075   2249   2250   2297   2352   2354   2524   2529   2548   2549   2562  
2763   2815   3079   3377   3780   3912   3913   4060   4589   4590   4675   4721   4791   4979   5232   5411   5412   5536   5541   5579  
5580   5588   5589   5612   5613   5848   6039   6345   6346   6347   6499   7097   7098   7150   7155   7266   7276   7277   7278   7365  
7474   7756   7764   7910   8097   8263   8274   8365   8366   8532   8728   8729   8731   8790   9334   9548   9899   10207   10208   10211  
10294   10295   10381   10385   10422   10532  
Biltr, Ernai, Sidirect 9889  
Biltr, Rnaxs, Sidirect 2353   2488   2550   2816   2817   4591   4713   5173   5493   6040   6213   6390   6723   7269   7270   7765   8098   8461   8462   8788  
10212   10383   10384   10488   10529  
Biltr, Sidirect 545   559   598   600   602   607   666   689   824   839   846   847   848   855   863   1103   1183   1184   1224   1228  
1233   1293   1303   1340   1341   1381   1452   1480   1536   1539   1552   1590   1613   1636   1638   1711   1813   1823   1824   1827  
1881   1883   1950   1951   1957   1961   1962   1983   1998   2020   2023   2025   2028   2037   2076   2119   2138   2140   2147   2148  
2150   2271   2273   2275   2298   2301   2321   2322   2331   2355   2381   2384   2389   2432   2433   2434   2444   2448   2454   2457  
2464   2491   2508   2525   2585   2628   2638   2639   2643   2649   2659   2660   2674   2684   2696   2697   2784   2795   2807   2830  
2845   2846   2847   2854   2858   2859   2898   2903   2922   2943   2945   2956   2966   2968   3022   3031   3035   3043   3045   3056  
3060   3066   3071   3080   3103   3112   3122   3123   3126   3175   3177   3178   3241   3251   3253   3287   3307   3311   3312   3315  
3348   3350   3355   3386   3390   3416   3420   3425   3426   3445   3448   3475   3477   3483   3492   3502   3506   3508   3511   3514  
3522   3528   3541   3568   3578   3647   3658   3697   3773   3839   3841   3846   3847   3856   3875   3883   3885   3890   3921   3927  
3946   3947   3950   3953   3986   4000   4003   4005   4031   4063   4068   4074   4190   4199   4250   4260   4264   4347   4382   4383  
4420   4429   4465   4474   4477   4516   4526   4535   4541   4558   4560   4563   4566   4592   4594   4635   4637   4643   4656   4667  
4669   4673   4676   4684   4700   4701   4722   4727   4773   4776   4777   4787   4792   4873   4875   4916   4917   4921   4927   4931  
4957   4981   4984   5020   5030   5031   5040   5042   5061   5065   5072   5077   5093   5099   5101   5109   5118   5120   5124   5126  
5170   5233   5282   5301   5309   5318   5322   5326   5339   5348   5351   5364   5386   5389   5400   5414   5424   5425   5426   5431  
5465   5470   5480   5484   5508   5530   5531   5534   5537   5542   5569   5570   5593   5594   5604   5619   5626   5648   5649   5693  
5694   5703   5724   5733   5753   5820   5821   5824   5850   5852   5855   5858   5882   5890   5891   5895   5899   5903   5919   5922  
5923   5932   5933   5938   5942   5943   6020   6032   6041   6044   6051   6214   6215   6366   6369   6382   6391   6398   6426   6438  
6468   6474   6477   6503   6513   6536   6544   6545   6555   6589   6625   6626   6627   6634   6653   6688   6697   6699   6700   6710  
6720   6729   6743   6753   6773   6821   6832   6859   6862   6866   6867   6916   6919   6921   6931   6969   6971   6979   6982   6999  
7001   7005   7018   7024   7026   7028   7051   7053   7070   7099   7101   7156   7158   7179   7180   7188   7190   7193   7214   7239  
7240   7271   7279   7281   7305   7321   7329   7330   7336   7340   7343   7367   7422   7432   7434   7459   7473   7475   7482   7483  
7545   7546   7548   7586   7676   7699   7700   7706   7713   7716   7727   7740   7755   7775   7777   7778   7785   7786   7788   7792  
7798   7814   7818   7831   7835   7840   7852   7859   7862   7867   7869   7872   7878   7889   7892   7930   7940   7941   7942   7949  
7955   7980   7989   7990   7999   8000   8019   8020   8054   8067   8119   8128   8163   8172   8183   8251   8254   8260   8264   8275  
8331   8340   8343   8345   8367   8370   8390   8391   8429   8454   8463   8470   8500   8508   8509   8517   8522   8568   8589   8590  
8598   8599   8601   8612   8615   8672   8674   8732   8733   8779   8791   8799   8810   8814   8822   8830   8831   8839   8871   8878  
8887   8890   8895   8897   8938   8958   8963   8966   8972   9032   9033   9039   9088   9091   9102   9103   9208   9218   9225   9242  
9301   9302   9308   9310   9313   9318   9321   9324   9335   9341   9343   9355   9358   9363   9422   9437   9490   9492   9502   9527  
9529   9544   9549   9623   9679   9684   9687   9688   9692   9717   9719   9726   9727   9728   9734   9740   9742   9761   9772   9773  
9789   9865   9866   9868   9874   9890   9891   9893   9897   9902   9967   10057   10063   10152   10175   10180   10209   10213   10256   10259  
10264   10267   10276   10305   10307   10308   10319   10321   10347   10352   10362   10374   10376   10415   10445   10486   10513   10514   10519   10521  
10524   10530  
Biltr, Ernai 844   1033   1508   1948   2072   2717   5029   5160   7387  


Target Position: 8822, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8822GAUUAAUUGCAAAAAGAGA91.7331571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8820-8842TGGATTAATTGCAAAAAGAGAATUCUCUUUUUGCAAUUAAUCCAGAUUAAUUGCAAAAAGAGAAUU10.3-10.321


Target Position: 1341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341GUUUACUCUCCAAUGUUAA88.48231056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1339-1361AGGTTTACTCTCCAATGTTAACCUUAACAUUGGAGAGUAAACCUGUUUACUCUCCAAUGUUAACCU6.914.633


Target Position: 8370, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8370CUGUUUGACAAAAUAUAGA84.02441947

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8368-8390AACTGTTTGACAAAATATAGAACUCUAUAUUUUGUCAAACAGUUCUGUUUGACAAAAUAUAGAACU-2.720.523


Target Position: 2321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2321GCAGAUUUUCCUGUAGAAA88.8131000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2319-2341AAGCAGATTTTCCTGTAGAAAAAUUUCUACAGGAAAAUCUGCUUGCAGAUUUUCCUGUAGAAAAAU20.312.021


Target Position: 1636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636CACCAUAAGAAUGAGUUUU77.02133894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1634-1656TGCACCATAAGAATGAGTTTTGTAAAACUCAUUCUUAUGGUGCACACCAUAAGAAUGAGUUUUGUU19.220.032


Target Position: 5029, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5029CGCUGAUUGUGCUCUUUUU89.2755923

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4502919CGCTGATTGTGCTCTTTTT1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45364955..45364973(-)00SMAD2(0.002)


Target Position: 7024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7024CACUCAUAGACAAACUUAA97.4067144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7022-7044TACACTCATAGACAAACTTAACAUUAAGUUUGUCUAUGAGUGUACACUCAUAGACAAACUUAACAU4.920.323


Target Position: 7942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7942CUUUAAAGUUUUUGACUAU87.96531161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7940-7962GGCTTTAAAGTTTTTGACTATTTAUAGUCAAAAACUUUAAAGCCCUUUAAAGUUUUUGACUAUUUU20.3-3.822


Target Position: 2898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898GAGUAGUUUGAUUUGGUUU85.07931714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2896-2918TCGAGTAGTTTGATTTGGTTTAGAAACCAAAUCAAACUACUCGAGAGUAGUUUGAUUUGGUUUAGU18.817.621


Target Position: 9088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9088CUUGAAAGUUCUUACCUUU85.47921606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9086-9108CCCTTGAAAGTTCTTACCTTTTCAAAGGUAAGAACUUUCAAGGGCUUGAAAGUUCUUACCUUUUCU18.612.212


Target Position: 9242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9242GUGGAUUUUUCUGAUAAGU73.37455062

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9240-9262ATGTGGATTTTTCTGATAAGTAGACUUAUCAGAAAAAUCCACAUGUGGAUUUUUCUGAUAAGUAGU13.420.122


Target Position: 9874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9874GUUGUUAACAUUUUUCCGU66.94777007

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9872-9894GTGTTGTTAACATTTTTCCGTGAACGGAAAAAUGUUAACAACACGUUGUUAACAUUUUUCCGUGAU20.77.231


Target Position: 545, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545GUGAAGAAGCUAAAGAAAA89.6761858

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
543-565TGGTGAAGAAGCTAAAGAAAACAUUUUCUUUAGCUUCUUCACCAGUGAAGAAGCUAAAGAAAACAU5.520.422


Target Position: 5351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5351GUUGUAUUUUUUACCUUAA91.3824608

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5349-5371TAGTTGTATTTTTTACCTTAAGCUUAAGGUAAAAAAUACAACUAGUUGUAUUUUUUACCUUAAGCU19.86.922


Target Position: 9719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9719CCUUAUGGGGUUAAACUUA88.06381140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9717-9739GTCCTTATGGGGTTAAACTTAATUAAGUUUAACCCCAUAAGGACCCUUAUGGGGUUAAACUUAAUU4.917.423


Target Position: 6653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6653GUCAGAAUAAUGAUAGUGU82.36342337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6651-6673CAGTCAGAATAATGATAGTGTGTACACUAUCAUUAUUCUGACUGGUCAGAAUAAUGAUAGUGUGUU20.320.422


Target Position: 846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846GCGAAUAUGCUUUUAAUCU80.60242786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
844-866CTGCGAATATGCTTTTAATCTTAAGAUUAAAAGCAUAUUCGCAGGCGAAUAUGCUUUUAAUCUUAU2.18.822


Target Position: 9343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9343CUGAUUUUUAAUCUUGUAA83.42942084

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9341-9363CTCTGATTTTTAATCTTGTAAAGUUACAAGAUUAAAAAUCAGAGCUGAUUUUUAAUCUUGUAAAGU20.37.422


Target Position: 7814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7814GAUGGUAAUUUAUUGAACA97.6908132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7812-7834AAGATGGTAATTTATTGAACAATUGUUCAAUAAAUUACCAUCUUGAUGGUAAUUUAUUGAACAAUU14.820.023


Target Position: 598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598CACUCAAAACUGUAAUACU92.0139533

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
596-618ACCACTCAAAACTGTAATACTAAAGUAUUACAGUUUUGAGUGGUCACUCAAAACUGUAAUACUAAU9.519.222


Target Position: 4063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4063CAUCAGUACUACUUAAUUU95.8391222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4061-4083CACATCAGTACTACTTAATTTAAAAAUUAAGUAGUACUGAUGUGCAUCAGUACUACUUAAUUUAAU-4.320.333


Target Position: 4031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4031CAACCUUUGCUGUAAAAAU87.74011200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4029-4051CTCAACCTTTGCTGTAAAAATTTAUUUUUACAGCAAAGGUUGAGCAACCUUUGCUGUAAAAAUUUU0.017.332


Target Position: 2643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643CAGUAAGAAUUCAUAUGGA97.7613128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2641-2663TACAGTAAGAATTCATATGGAGAUCCAUAUGAAUUCUUACUGUACAGUAAGAAUUCAUAUGGAGAU18.818.933


Target Position: 5531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5531CUAGUUGAAAUCAAAUAAA90.0612786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5529-5551TGCTAGTTGAAATCAAATAAAAGUUUAUUUGAUUUCAACUAGCACUAGUUGAAAUCAAAUAAAAGU-1.420.332


Target Position: 5534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5534GUUGAAAUCAAAUAAAAGA86.82881358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5532-5554TAGTTGAAATCAAATAAAAGAAAUCUUUUAUUUGAUUUCAACUAGUUGAAAUCAAAUAAAAGAAAU-4.37.421


Target Position: 10319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10319GUCUAUUUAAAGUACAAAA93.1948424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10317-10339TAGTCTATTTAAAGTACAAAAAAUUUUGUACUUUAAAUAGACUAGUCUAUUUAAAGUACAAAAAAU14.76.912


Target Position: 8779, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8779GAAUAUUUUCACCUAAAAA99.529372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8777-8799TAGAATATTTTCACCTAAAAAAGUUUUUAGGUGAAAAUAUUCUAGAAUAUUUUCACCUAAAAAAGU11.0-10.322


Target Position: 9890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9890CGUGAAUGUUGUGUUAAAA95.6399236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9888-9910TCCGTGAATGTTGTGTTAAAATGUUUUAACACAACAUUCACGGACGUGAAUGUUGUGUUAAAAUGU7.220.532


Target Position: 6390, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6390CCUUUGAACUUAUUAACAA95.894220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8786408CCTTTGAACTTATTAACAATTGTTAATAAGTTCAAAGG0.556500.081000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6388-6410CTCCTTTGAACTTATTAACAAAAUUGUUAAUAAGUUCAAAGGAGCCUUUGAACUUAUUAACAAAAU6.912.222


Target Position: 10519, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10519GAGUUGUUUACCAUGUUAA95.5829239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10517-10539TTGAGTTGTTTACCATGTTAAAAUUAACAUGGUAAACAACUCAAGAGUUGUUUACCAUGUUAAAAU13.517.8


Target Position: 3241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3241GUUCAUUCUGCAGCAAAUA83.58252045

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3239-3261TAGTTCATTCTGCAGCAAATAATUAUUUGCUGCAGAAUGAACUAGUUCAUUCUGCAGCAAAUAAUU18.516.332


Target Position: 9684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9684GAACCUAUGUGUAUAUGUA106.8873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9682-9704CTGAACCTATGTGTATATGTAAGUACAUAUACACAUAGGUUCAGGAACCUAUGUGUAUAUGUAAGU8.218.522


Target Position: 9893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9893GAAUGUUGUGUUAAAAUGA93.9067359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9891-9913GTGAATGTTGTGTTAAAATGATTUCAUUUUAACACAACAUUCACGAAUGUUGUGUUAAAAUGAUUU-1.412.122


Target Position: 4700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4700GCAACAUUACUUAGGAUUU84.31581889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4698-4720TAGCAACATTACTTAGGATTTATAAAUCCUAAGUAAUGUUGCUAGCAACAUUACUUAGGAUUUAUU19.912.132


Target Position: 5604, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5604CUUUAAGAUCCUUCUCUUU82.73622244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5602-5624ACCTTTAAGATCCTTCTCTTTTTAAAGAGAAGGAUCUUAAAGGUCUUUAAGAUCCUUCUCUUUUUU19.17.122


Target Position: 4068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068GUACUACUUAAUUUAACAA95.3352254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4066-4088CAGTACTACTTAATTTAACAAGCUUGUUAAAUUAAGUAGUACUGGUACUACUUAAUUUAACAAGCU7.218.833


Target Position: 9103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9103CUUUUCUCUAGUGAUAUUA81.81942456

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9101-9123ACCTTTTCTCTAGTGATATTAAGUAAUAUCACUAGAGAAAAGGUCUUUUCUCUAGUGAUAUUAAGU8.714.822


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249CCCACUUCUCUGUUAUUUU81.94012426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6002267CCCACTTCTCTGTTATTTTAAAATAACAGAGAAGTGGG0.395800.175400.991401.000001.000001.00000


Target Position: 2945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945CUUUUGUAAAUGUAAUUGU74.62974643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2943-2965GCCTTTTGTAAATGTAATTGTTTACAAUUACAUUUACAAAAGGCCUUUUGUAAAUGUAAUUGUUUU6.97.222


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124GCUCCCUCCGUCUUCCAUA85.01591725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319142GCTCCCTCCGTCTTCCATATATGGAAGACGGAGGGAGC0.811000.639700.810301.000001.000001.00000


Target Position: 10321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10321CUAUUUAAAGUACAAAAAA90.0523788

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10319-10341GTCTATTTAAAGTACAAAAAAAGUUUUUUGUACUUUAAAUAGACCUAUUUAAAGUACAAAAAAAGU5.6-7.512


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763GUGGCAGUAUAAUUAUUUU89.6964851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912781GTGGCAGTATAATTATTTTAAAATAATTATACTGCCAC0.649600.079700.793100.750001.000001.00000


Target Position: 2037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037GACUUAAUGAUGUCUUAUU90.0803783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2035-2057AAGACTTAATGATGTCTTATTGGAAUAAGACAUCAUUAAGUCUUGACUUAAUGAUGUCUUAUUGGU14.54.622


Target Position: 8733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8733CUUUGUUUUAAUAUAUAAU85.70981561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8731-8753GCCTTTGTTTTAATATATAATGCAUUAUAUAUUAAAACAAAGGCCUUUGUUUUAAUAUAUAAUGCU-5.95.611


Target Position: 3514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3514GUAAAUUUGGUAUAGUAAU83.96661968

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3512-3534ATGTAAATTTGGTATAGTAATTTAUUACUAUACCAAAUUUACAUGUAAAUUUGGUAUAGUAAUUUU6.3-9.722


Target Position: 6544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6544GCAUAAAUUAUGUUUAAGA93.3333402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6542-6564TGGCATAAATTATGTTTAAGATTUCUUAAACAUAAUUUAUGCCAGCAUAAAUUAUGUUUAAGAUUU4.9-1.822


Target Position: 4637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4637GGUUUUCAUUUUUCUAAGU80.84582731

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4635-4657GTGGTTTTCATTTTTCTAAGTGAACUUAGAAAAAUGAAAACCACGGUUUUCAUUUUUCUAAGUGAU11.714.922


Target Position: 3348, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3348GUCUUUUCAUAAAUUUUCA87.3661268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3346-3368TCGTCTTTTCATAAATTTTCATAUGAAAAUUUAUGAAAAGACGAGUCUUUUCAUAAAUUUUCAUAU0.414.822


Target Position: 2389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389GUGGAUUAACUUUUGAAAU81.14482649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2387-2409AAGTGGATTAACTTTTGAAATCCAUUUCAAAAGUUAAUCCACUUGUGGAUUAACUUUUGAAAUCCU7.721.222


Target Position: 5431, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5431GUUAAAAUUAUUUUAAUUU80.60952783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5429-5451TTGTTAAAATTATTTTAATTTCAAAAUUAAAAUAAUUUUAACAAGUUAAAAUUAUUUUAAUUUCAU-9.7-9.722


Target Position: 5820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5820CCAAGUAUCUCUUUAGAUA100.23956

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5818-5840CACCAAGTATCTCTTTAGATATCUAUCUAAAGAGAUACUUGGUGCCAAGUAUCUCUUUAGAUAUCU6.911.622


Target Position: 3035, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035GUUGUAUUCAGUUUAUAAA93.7287370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3033-3055ATGTTGTATTCAGTTTATAAATTUUUAUAAACUGAAUACAACAUGUUGUAUUCAGUUUAUAAAUUU-7.56.922


Target Position: 6971, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6971CUUUUUAAGAAGGAAAUAA85.07791715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6969-6991GTCTTTTTAAGAAGGAAATAAATUUAUUUCCUUCUUAAAAAGACCUUUUUAAGAAGGAAAUAAAUU15.5-9.122


Target Position: 5580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5580CUCUUAAAAGCUUCCCAUA87.09171313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5475598CTCTTAAAAGCTTCCCATATATGGGAAGCTTTTAAGAG0.844500.194700.767200.750001.000001.00000


Target Position: 9734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9734CUUAAUCUGAAAUUUACAU79.58743118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9732-9754AACTTAATCTGAAATTTACATTTAUGUAAAUUUCAGAUUAAGUUCUUAAUCUGAAAUUUACAUUUU6.96.921


Target Position: 8264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8264GCUUUAUAUAACUAAUAUA103.57417

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8262-8284TTGCTTTATATAACTAATATACAUAUAUUAGUUAUAUAAAGCAAGCUUUAUAUAACUAAUAUACAU-2.7-2.322


Target Position: 9502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9502GAUACUUAUUGGGAUAUGU85.26791663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9500-9522CTGATACTTATTGGGATATGTGCACAUAUCCCAAUAAGUAUCAGGAUACUUAUUGGGAUAUGUGCU21.26.332


Target Position: 3508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508GUUCAUGUAAAUUUGGUAU80.63832772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3506-3528GTGTTCATGTAAATTTGGTATAGAUACCAAAUUUACAUGAACACGUUCAUGUAAAUUUGGUAUAGU20.020.522


Target Position: 2550, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2550CCAUUUUUGUCCUCAUAAU87.33651272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2802568CCATTTTTGTCCTCATAATATTATGAGGACAAAAATGG0.793200.216700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2548-2570TCCCATTTTTGTCCTCATAATCAAUUAUGAGGACAAAAAUGGGACCAUUUUUGUCCUCAUAAUCAU13.4-3.322


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GGUGAAGAAGCUAAAGAAA96.608180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225562GGTGAAGAAGCTAAAGAAATTTCTTTAGCTTCTTCACC0.626900.544200.853401.000001.000001.00000


Target Position: 9687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9687CCUAUGUGUAUAUGUAAGU77.42843767

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9685-9707AACCTATGTGTATATGTAAGTACACUUACAUAUACACAUAGGUUCCUAUGUGUAUAUGUAAGUACU11.617.922


Target Position: 2488, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2488CUGCUAAAUCUUAUUAUAA96.5981181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882506CTGCTAAATCTTATTATAATTATAATAAGATTTAGCAG0.503300.303900.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2486-2508AACTGCTAAATCTTATTATAAGGUUAUAAUAAGAUUUAGCAGUUCUGCUAAAUCUUAUUAUAAGGU-5.919.723


Target Position: 4465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4465CUUUGAAAACACCUAUUGA89.7402841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4463-4485CTCTTTGAAAACACCTATTGAGCUCAAUAGGUGUUUUCAAAGAGCUUUGAAAACACCUAUUGAGCU17.47.723


Target Position: 4563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4563GAUGUUUUUUGUAUUUUAU89.608864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4561-4583ATGATGTTTTTTGTATTTTATCTAUAAAAUACAAAAAACAUCAUGAUGUUUUUUGUAUUUUAUCUU-7.55.322


Target Position: 4917, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4917GUUUCUUUUGGAAAGAGUU79.17823235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4915-4937GGGTTTCTTTTGGAAAGAGTTTCAACUCUUUCCAAAAGAAACCCGUUUCUUUUGGAAAGAGUUUCU17.75.522


Target Position: 10207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10207UGGUUCCUUUUUUAUUUUU67.40186876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77410225TGGTTCCTTTTTTATTTTTAAAAATAAAAAAGGAACCA0.526700.147500.844800.750001.000001.00000


Target Position: 6589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6589CAAUGUUUUCCCUACGAUA97.1415158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6587-6609GCCAATGTTTTCCCTACGATACCUAUCGUAGGGAAAACAUUGGCCAAUGUUUUCCCUACGAUACCU20.95.333


Target Position: 3846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3846GCAUCAAAUGCAAAAAGGU81.38382576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3844-3866TAGCATCAAATGCAAAAAGGTTCACCUUUUUGCAUUUGAUGCUAGCAUCAAAUGCAAAAAGGUUCU9.513.823


Target Position: 5030, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5030GCUGAUUGUGCUCUUUUUA88.9696974

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5028-5050CCGCTGATTGTGCTCTTTTTATCUAAAAAGAGCACAAUCAGCGGGCUGAUUGUGCUCUUUUUAUCU5.518.122


Target Position: 6916, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6916GAACUGUUUUAUCUUGAAU89.4391891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6914-6936AGGAACTGTTTTATCTTGAATATAUUCAAGAUAAAACAGUUCCUGAACUGUUUUAUCUUGAAUAUU20.417.822


Target Position: 5891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5891CAUUGAUACUUAGACAUAU95.3427253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5889-5911GGCATTGATACTTAGACATATCAAUAUGUCUAAGUAUCAAUGCCCAUUGAUACUUAGACAUAUCAU20.38.733


Target Position: 6710, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6710CUUUUUAUAUCUUCCUUUU81.65382498

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6708-6730TTCTTTTTATATCTTCCTTTTCAAAAAGGAAGAUAUAAAAAGAACUUUUUAUAUCUUCCUUUUCAU18.7-9.721


Target Position: 7001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7001GUAUGAAUUUAUAUAUACA105.1668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6999-7021GTGTATGAATTTATATATACATAUGUAUAUAUAAAUUCAUACACGUAUGAAUUUAUAUAUACAUAU2.88.712


Target Position: 1983, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983GAAAAUUAGUGUCUAGAAA98.2489107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1981-2003GGGAAAATTAGTGTCTAGAAATAUUUCUAGACACUAAUUUUCCCGAAAAUUAGUGUCUAGAAAUAU20.2-9.722


Target Position: 9363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9363GUUUUUGCUAAACUCAAAA83.96171969

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9361-9383AAGTTTTTGCTAAACTCAAAACAUUUUGAGUUUAGCAAAAACUUGUUUUUGCUAAACUCAAAACAU19.214.122


Target Position: 7852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7852GAUUUAAGGACAAAAGUGA90.2813753

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7850-7872TTGATTTAAGGACAAAAGTGAAGUCACUUUUGUCCUUAAAUCAAGAUUUAAGGACAAAAGUGAAGU10.3-4.312


Target Position: 602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602CAAAACUGUAAUACUAAAU82.60692281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
600-622CTCAAAACTGTAATACTAAATGTAUUUAGUAUUACAGUUUUGAGCAAAACUGUAAUACUAAAUGUU6.610.321


Target Position: 2457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457GUUUUUUGUUUUUUUUUGU71.1985750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2455-2477TGGTTTTTTGTTTTTTTTTGTTTACAAAAAAAAACAAAAAACCAGUUUUUUGUUUUUUUUUGUUUU-2.9-2.910


Target Position: 3126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126GUUUUUUAGCUUAUAAGUU80.85222728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3124-3146AAGTTTTTTAGCTTATAAGTTACAACUUAUAAGCUAAAAAACUUGUUUUUUAGCUUAUAAGUUACU6.3-9.122


Target Position: 7422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7422CUACUACAAGGUCAAAUUU82.09882393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7420-7442TACTACTACAAGGTCAAATTTTCAAAUUUGACCUUGUAGUAGUACUACUACAAGGUCAAAUUUUCU7.420.232


Target Position: 4541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4541GUUUGAUGCUUUUUAACGA86.13661484

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4539-4561GTGTTTGATGCTTTTTAACGAGAUCGUUAAAAAGCAUCAAACACGUUUGAUGCUUUUUAACGAGAU7.113.832


Target Position: 8254, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8254GAAAUCCAUUGCUUUAUAU89.7906830

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8252-8274TGGAAATCCATTGCTTTATATAAAUAUAAAGCAAUGGAUUUCCAGAAAUCCAUUGCUUUAUAUAAU-2.320.132


Target Position: 7340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7340GUUGUUGUUGAUAAUACUA91.3568610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7338-7360TTGTTGTTGTTGATAATACTAGAUAGUAUUAUCAACAACAACAAGUUGUUGUUGAUAAUACUAGAU6.319.323


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529CCAAGCCUCUUUUUUCCAU76.17474149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9742547CCAAGCCTCTTTTTTCCATATGGAAAAAAGAGGCTTGG0.644600.541500.689701.000001.000001.00000


Target Position: 10347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10347CUUAAGAAAACAUUGCUUA85.44721615

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10345-10367TGCTTAAGAAAACATTGCTTACAUAAGCAAUGUUUUCUUAAGCACUUAAGAAAACAUUGCUUACAU18.57.112


Target Position: 4984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4984CGAUUAGAAAAAUAUAACU87.65221216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4982-5004AACGATTAGAAAAATATAACTGGAGUUAUAUUUUUCUAAUCGUUCGAUUAGAAAAAUAUAACUGGU1.116.023


Target Position: 7305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7305CAGAUUCUGGGAUGUACUA91.0408650

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7303-7325AGCAGATTCTGGGATGTACTAACUAGUACAUCCCAGAAUCUGCUCAGAUUCUGGGAUGUACUAACU19.019.122


Target Position: 3912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912ACCUCUAUACAAAUCCAAA90.6811701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783930ACCTCTATACAAATCCAAATTTGGATTTGTATAGAGGT0.466400.255900.853400.750001.000001.00000


Target Position: 5170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5170GAUGGAUAUUGAAUAAUAA108.8242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5168-5190GTGATGGATATTGAATAATAAAAUUAUUAUUCAAUAUCCAUCACGAUGGAUAUUGAAUAAUAAAAU-8.021.222


Target Position: 2322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322CAGAUUUUCCUGUAGAAAA94.0582347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2320-2342AGCAGATTTTCCTGTAGAAAAACUUUUCUACAGGAAAAUCUGCUCAGAUUUUCCUGUAGAAAAACU14.65.322


Target Position: 2352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352UGCCUUUUACCAAAAAUAA80.08992970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612370TGCCTTTTACCAAAAATAATTATTTTTGGTAAAAGGCA0.276400.121600.819000.750001.000001.00000


Target Position: 3060, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060GUUAUUCUACACAUAAUUA96.9926165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3058-3080TTGTTATTCTACACATAATTATGUAAUUAUGUGUAGAAUAACAAGUUAUUCUACACAUAAUUAUGU-1.86.922


Target Position: 4558, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4558GAGAUGAUGUUUUUUGUAU90.1113778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4556-4578ACGAGATGATGTTTTTTGTATTTAUACAAAAAACAUCAUCUCGUGAGAUGAUGUUUUUUGUAUUUU7.220.422


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CCCAAAGGUUUAUUAAUAA93.6496379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8812092CCCAAAGGTTTATTAATAATTATTAATAAACCTTTGGG0.297100.083300.956901.000000.994600.75000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UCAUAAUCAAAACAGCAUA82.23612362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772580TCATAATCAAAACAGCATATATGCTGTTTTGATTATGA0.411200.306800.681000.750001.000001.00000


Target Position: 5942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5942GCUAAAUCUAUUAUAUUCA92.3219505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5940-5962TTGCTAAATCTATTATATTCATTUGAAUAUAAUAGAUUUAGCAAGCUAAAUCUAUUAUAUUCAUUU3.56.932


Target Position: 5364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5364CCUUAAGCCACAUUGAGUU79.89623021

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5362-5384TACCTTAAGCCACATTGAGTTTTAACUCAAUGUGGCUUAAGGUACCUUAAGCCACAUUGAGUUUUU19.218.322


Target Position: 2830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830GCUAAUCUAUAAAUACCGU82.9672198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2828-2850AAGCTAATCTATAAATACCGTTTACGGUAUUUAUAGAUUAGCUUGCUAAUCUAUAAAUACCGUUUU20.611.633


Target Position: 7070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7070CAAUUGUUCCAUUGUUUAA93.6851374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7068-7090AACAATTGTTCCATTGTTTAAATUUAAACAAUGGAACAAUUGUUCAAUUGUUCCAUUGUUUAAAUU7.25.322


Target Position: 6773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6773GGAUUGAGGGGCAAAUUAU90.2482757

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6771-6793AGGGATTGAGGGGCAAATTATCTAUAAUUUGCCCCUCAAUCCCUGGAUUGAGGGGCAAAUUAUCUU-1.420.433


Target Position: 10524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10524GUUUACCAUGUUAAAAAAA84.55181829

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10522-10544TTGTTTACCATGTTAAAAAAAAAUUUUUUUAACAUGGUAAACAAGUUUACCAUGUUAAAAAAAAAU-9.120.0


Target Position: 9899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9899UGUGUUAAAAUGAUUAAAU77.22663831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8359917TGTGTTAAAATGATTAAATATTTAATCATTTTAACACA0.346000.195300.698300.750001.000001.00000


Target Position: 2271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271GUGUCUUUUUUAAUAUAUA97.8558123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2269-2291GTGTGTCTTTTTTAATATATAATUAUAUAUUAAAAAAGACACACGUGUCUUUUUUAAUAUAUAAUU-8.619.222


Target Position: 7716, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7716CAAAAAAAUUUCGAGAAAA90.3477744

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7714-7736TTCAAAAAAATTTCGAGAAAAGTUUUUCUCGAAAUUUUUUUGAACAAAAAAAUUUCGAGAAAAGUU21.0-11.322


Target Position: 5753, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5753CAUGUACAGUCUUUACUUU91.609589

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5751-5773TTCATGTACAGTCTTTACTTTAAAAAGUAAAGACUGUACAUGAACAUGUACAGUCUUUACUUUAAU4.920.423


Target Position: 2816, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816CCCUUUUUAAAAAAGCUAA82.3212346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612834CCCTTTTTAAAAAAGCTAATTAGCTTTTTTAAAAAGGG0.602800.271600.956901.000000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2814-2836ATCCCTTTTTAAAAAAGCTAATCUUAGCUUUUUUAAAAAGGGAUCCCUUUUUAAAAAAGCUAAUCU18.39.522


Target Position: 9033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9033CAUUAGCUAGUGAUGUAAA98.2486108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9031-9053GCCATTAGCTAGTGATGTAAAAAUUUACAUCACUAGCUAAUGGCCAUUAGCUAGUGAUGUAAAAAU16.118.323


Target Position: 6503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6503CAAAAAUUCUGUUCAGUAA98.3523101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6501-6523CTCAAAAATTCTGTTCAGTAAATUUACUGAACAGAAUUUUUGAGCAAAAAUUCUGUUCAGUAAAUU20.3-12.012


Target Position: 2847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2847GUUUUUCCAAAGGUAUUUU72.09035437

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2845-2867CCGTTTTTCCAAAGGTATTTTACAAAAUACCUUUGGAAAAACGGGUUUUUCCAAAGGUAUUUUACU13.914.322


Target Position: 4589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4589GGCCUGAUUUUUUUUUUGU76.02374193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8894607GGCCTGATTTTTTTTTTGTACAAAAAAAAAATCAGGCC0.748800.155400.793100.750001.000001.00000


Target Position: 8599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8599CAGAAUAAAAAAUGUUCAU83.41342087

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8597-8619GGCAGAATAAAAAATGTTCATATAUGAACAUUUUUUAUUCUGCCCAGAAUAAAAAAUGUUCAUAUU20.56.912


Target Position: 3511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511CAUGUAAAUUUGGUAUAGU83.97731964

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3509-3531TTCATGTAAATTTGGTATAGTAAACUAUACCAAAUUUACAUGAACAUGUAAAUUUGGUAUAGUAAU19.86.923


Target Position: 1881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881GACUGUUUACUAUCCAAAA98.013118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1879-1901TGGACTGTTTACTATCCAAAAGTUUUUGGAUAGUAAACAGUCCAGACUGUUUACUAUCCAAAAGUU20.117.832


Target Position: 10175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10175GCUUUCGUUCUAUGAUUGU73.76644927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10173-10195GAGCTTTCGTTCTATGATTGTCAACAAUCAUAGAACGAAAGCUCGCUUUCGUUCUAUGAUUGUCAU13.619.733


Target Position: 6699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6699GCUAUUGAGUUCUUUUUAU87.96781160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6697-6719CTGCTATTGAGTTCTTTTTATATAUAAAAAGAACUCAAUAGCAGGCUAUUGAGUUCUUUUUAUAUU-3.813.432


Target Position: 8790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8790CCUAAAAAAGAAAGAAAAG72.07975444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7448808CCTAAAAAAGAAAGAAAAGCTTTTCTTTCTTTTTTAGG0.538100.406600.706900.750001.000001.00000


Target Position: 6982, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6982GGAAAUAAAUAAUAUAUGU92.8893447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6980-7002AAGGAAATAAATAATATATGTGTACAUAUAUUAUUUAUUUCCUUGGAAAUAAAUAAUAUAUGUGUU-0.32.111


Target Position: 8128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8128CCUAAGAAAACAUUUGUUU77.43483764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8126-8148TCCCTAAGAAAACATTTGTTTGCAAACAAAUGUUUUCUUAGGGACCUAAGAAAACAUUUGUUUGCU5.311.711


Target Position: 6720, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6720CUUCCUUUUCAAUUUUUUA86.39651439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6718-6740ATCTTCCTTTTCAATTTTTTATTUAAAAAAUUGAAAAGGAAGAUCUUCCUUUUCAAUUUUUUAUUU-12.018.721


Target Position: 7276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7276ACCCCGUUACUAAAUUAUU73.30965077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4347294ACCCCGTTACTAAATTATTAATAATTTAGTAACGGGGT0.773000.700300.844800.750001.000001.00000


Target Position: 7910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7910UCCAUUUCAUAAUUGUUUU69.47976260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8707928TCCATTTCATAATTGTTTTAAAACAATTATGAAATGGA0.627200.273100.870700.750001.000001.00000


Target Position: 3913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3913CCUCUAUACAAAUCCAAAC72.38725368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663931CCTCTATACAAATCCAAACGTTTGGATTTGTATAGAGG0.603200.260300.698300.750001.000001.00000


Target Position: 4667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4667CUCUUUGUUGAAUUUUUGU70.91045825

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4665-4687CCCTCTTTGTTGAATTTTTGTCTACAAAAAUUCAACAAAGAGGGCUCUUUGUUGAAUUUUUGUCUU-3.319.221


Target Position: 8799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8799GAAAGAAAAGACAUACAAA105.07210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8797-8819AAGAAAGAAAAGACATACAAAACUUUGUAUGUCUUUUCUUUCUUGAAAGAAAAGACAUACAAAACU13.55.521


Target Position: 847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847CGAAUAUGCUUUUAAUCUU89.9037812

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
845-867TGCGAATATGCTTTTAATCTTAAAAGAUUAAAAGCAUAUUCGCACGAAUAUGCUUUUAAUCUUAAU6.98.732


Target Position: 6382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6382GUUUCUCUCCUUUGAACUU80.16522942

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6380-6402ATGTTTCTCTCCTTTGAACTTATAAGUUCAAAGGAGAGAAACAUGUUUCUCUCCUUUGAACUUAUU19.219.122


Target Position: 3386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386GGUACUUGUUCUUUGAAAU91.4847598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3384-3406TTGGTACTTGTTCTTTGAAATCAAUUUCAAAGAACAAGUACCAAGGUACUUGUUCUUUGAAAUCAU7.719.022


Target Position: 2649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649GAAUUCAUAUGGAGAAAGU85.57531590

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2647-2669AAGAATTCATATGGAGAAAGTCCACUUUCUCCAUAUGAAUUCUUGAAUUCAUAUGGAGAAAGUCCU19.17.223


Target Position: 4592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4592CUGAUUUUUUUUUUGUUUU72.62365291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4590-4612GCCTGATTTTTTTTTTGTTTTCTAAAACAAAAAAAAAAUCAGGCCUGAUUUUUUUUUUGUUUUCUU5.67.411


Target Position: 3426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3426GUAUCAUUUUCAAUACUUU92.3725496

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3424-3446AGGTATCATTTTCAATACTTTCAAAAGUAUUGAAAAUGAUACCUGUAUCAUUUUCAAUACUUUCAU4.68.732


Target Position: 119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CCUCCGCUCCCUCCGUCUU67.25476915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832137CCTCCGCTCCCTCCGTCTTAAGACGGAGGGAGCGGAGG0.714000.486400.706901.000000.989101.00000


Target Position: 4382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4382CCUACUAUGCUGUUUCAGU81.48462548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4380-4402TGCCTACTATGCTGTTTCAGTAGACUGAAACAGCAUAGUAGGCACCUACUAUGCUGUUUCAGUAGU19.211.233


Target Position: 7999, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7999GGUUCUAUAUUAAGUUCUA103.06919

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7997-8019CTGGTTCTATATTAAGTTCTATCUAGAACUUAAUAUAGAACCAGGGUUCUAUAUUAAGUUCUAUCU17.714.523


Target Position: 7869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7869GAAGUUUUAGAAUUAUAAA99.092782

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7867-7889GTGAAGTTTTAGAATTATAAAAGUUUAUAAUUCUAAAACUUCACGAAGUUUUAGAAUUAUAAAAGU-8.03.222


Target Position: 7321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7321CUAACUUAGGGUUAACUUU80.94872695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7319-7341TACTAACTTAGGGTTAACTTTGTAAAGUUAACCCUAAGUUAGUACUAACUUAGGGUUAACUUUGUU4.96.632


Target Position: 5480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5480CUAAGACUUUGAAGGUAAA93.3082408

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5478-5500GACTAAGACTTTGAAGGTAAAACUUUACCUUCAAAGUCUUAGUCCUAAGACUUUGAAGGUAAAACU18.618.922


Target Position: 1711, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711GAUUGAACUUCAUCUGAAU97.2731151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1709-1731TGGATTGAACTTCATCTGAATGGAUUCAGAUGAAGUUCAAUCCAGAUUGAACUUCAUCUGAAUGGU20.414.822


Target Position: 7835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7835GAAAUCCGUAAUAUAUUGA85.9671514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7833-7855ATGAAATCCGTAATATATTGATTUCAAUAUAUUACGGAUUUCAUGAAAUCCGUAAUAUAUUGAUUU0.020.722


Target Position: 2275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275CUUUUUUAAUAUAUAAUAU91.0533649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2273-2295GTCTTTTTTAATATATAATATATAUAUUAUAUAUUAAAAAAGACCUUUUUUAAUAUAUAAUAUAUU-5.9-9.121


Target Position: 3856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3856CAAAAAGGUUCACACUAAA96.2875200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3854-3876TGCAAAAAGGTTCACACTAAAGGUUUAGUGUGAACCUUUUUGCACAAAAAGGUUCACACUAAAGGU19.09.532


Target Position: 6545, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6545CAUAAAUUAUGUUUAAGAU94.6247301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6543-6565GGCATAAATTATGTTTAAGATTAAUCUUAAACAUAAUUUAUGCCCAUAAAUUAUGUUUAAGAUUAU7.1-10.332


Target Position: 5693, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5693GGUUUAUGUUGGGAUAUAA101.91735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5691-5713TAGGTTTATGTTGGGATATAAAGUUAUAUCCCAACAUAAACCUAGGUUUAUGUUGGGAUAUAAAGU16.76.933


Target Position: 7188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7188CAGUUCAUUUAAUAUACCA93.9131358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7186-7208GGCAGTTCATTTAATATACCATTUGGUAUAUUAAAUGAACUGCCCAGUUCAUUUAAUAUACCAUUU15.219.222


Target Position: 6555, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6555GUUUAAGAUUAUGAACUUU85.21651679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6553-6575ATGTTTAAGATTATGAACTTTTCAAAGUUCAUAAUCUUAAACAUGUUUAAGAUUAUGAACUUUUCU19.27.122


Target Position: 7818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7818GUAAUUUAUUGAACAAUGA88.21131114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7816-7838TGGTAATTTATTGAACAATGAAAUCAUUGUUCAAUAAAUUACCAGUAAUUUAUUGAACAAUGAAAU12.1-7.532


Target Position: 7474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7474AGAUCUUUGCUCAAUAUAA97.3028149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9567492AGATCTTTGCTCAATATAATTATATTGAGCAAAGATCT0.605900.130700.689700.750001.000001.00000


Target Position: 7367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7367CCUCUUUAAUUCUUCUUCU82.42952321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7365-7387TCCCTCTTTAATTCTTCTTCTGGAGAAGAAGAAUUAAAGAGGGACCUCUUUAAUUCUUCUUCUGGU19.111.712


Target Position: 3377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3377GCUGUCUUUGGUACUUGUU76.12944165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883395GCTGTCTTTGGTACTTGTTAACAAGTACCAAAGACAGC0.336500.171700.706901.000001.000001.00000


Target Position: 6345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345CCAGCCUAGCCAUAUUUUU76.22064136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9046363CCAGCCTAGCCATATTTTTAAAAATATGGCTAGGCTGG0.663600.078400.844801.000000.978300.75000


Target Position: 3927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3927CAAACUUGAAGAUCAGAAU86.8941344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3925-3947TCCAAACTTGAAGATCAGAATGGAUUCUGAUCUUCAAGUUUGGACAAACUUGAAGAUCAGAAUGGU20.410.322


Target Position: 9302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9302CAUUGAGAGUACAUAUCUU99.097281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9300-9322TCCATTGAGAGTACATATCTTGAAAGAUAUGUACUCUCAAUGGACAUUGAGAGUACAUAUCUUGAU13.320.433


Target Position: 9341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9341CUCUGAUUUUUAAUCUUGU80.06452979

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9339-9361TGCTCTGATTTTTAATCTTGTAAACAAGAUUAAAAAUCAGAGCACUCUGAUUUUUAAUCUUGUAAU12.020.411


Target Position: 4713, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4713GGAUUUAUUCUUCACAAUA98.929887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6704731GGATTTATTCTTCACAATATATTGTGAAGAATAAATCC0.382500.106300.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4711-4733TAGGATTTATTCTTCACAATACTUAUUGUGAAGAAUAAAUCCUAGGAUUUAUUCUUCACAAUACUU20.51.822


Target Position: 4250, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4250CCUUCUUUUUCUUACUUGA87.45351252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4248-4270GCCCTTCTTTTTCTTACTTGAGAUCAAGUAAGAAAAAGAAGGGCCCUUCUUUUUCUUACUUGAGAU11.810.321


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354CCUUUUACCAAAAAUAAAC68.16276675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472372CCTTTTACCAAAAATAAACGTTTATTTTTGGTAAAAGG0.808300.207600.698300.750001.000001.00000


Target Position: 2846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846CGUUUUUCCAAAGGUAUUU71.76555568

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2844-2866ACCGTTTTTCCAAAGGTATTTTAAAAUACCUUUGGAAAAACGGUCGUUUUUCCAAAGGUAUUUUAU18.58.721


Target Position: 1224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GUUCGAUAGCAUAUUAUGA92.3427504

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1222-1244GTGTTCGATAGCATATTATGAATUCAUAAUAUGCUAUCGAACACGUUCGAUAGCAUAUUAUGAAUU0.017.933


Target Position: 5824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5824GUAUCUCUUUAGAUAUCUA105.4885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5822-5844AAGTATCTCTTTAGATATCTAGTUAGAUAUCUAAAGAGAUACUUGUAUCUCUUUAGAUAUCUAGUU15.920.222


Target Position: 2585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585GACAUCAUCACCAGUAAUA91.3945607

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2583-2605ATGACATCATCACCAGTAATAGTUAUUACUGGUGAUGAUGUCAUGACAUCAUCACCAGUAAUAGUU11.620.512


Target Position: 1827, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827GAAAAGACUUAAUGUAACA96.3865196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1825-1847ATGAAAAGACTTAATGTAACAACUGUUACAUUAAGUCUUUUCAUGAAAAGACUUAAUGUAACAACU14.613.322


Target Position: 8590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8590CAUUGUAGGCAGAAUAAAA102.17229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8588-8610AGCATTGTAGGCAGAATAAAAAAUUUUAUUCUGCCUACAAUGCUCAUUGUAGGCAGAAUAAAAAAU2.111.633


Target Position: 6859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6859CAUGAUAGCAUUUACGAUA94.8528285

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6857-6879CTCATGATAGCATTTACGATAAGUAUCGUAAAUGCUAUCAUGAGCAUGAUAGCAUUUACGAUAAGU16.513.332


Target Position: 8098, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8098CCAGUAAGUUUUUUCUUUU85.40881622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6758116CCAGTAAGTTTTTTCTTTTAAAAGAAAAAACTTACTGG0.366400.123200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8096-8118TCCCAGTAAGTTTTTTCTTTTCTAAAAGAAAAAACUUACUGGGACCAGUAAGUUUUUUCUUUUCUU5.516.422


Target Position: 2854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854CAAAGGUAUUUUACAAUAU90.8977664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2852-2874TCCAAAGGTATTTTACAATATTTAUAUUGUAAAAUACCUUUGGACAAAGGUAUUUUACAAUAUUUU8.518.622


Target Position: 5508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5508CAAACAUCAGUCUUAGUCU88.08081138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5506-5528AACAAACATCAGTCTTAGTCTCTAGACUAAGACUGAUGUUUGUUCAAACAUCAGUCUUAGUCUCUU18.914.823


Target Position: 7778, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7778CAAAUAUGCUCUUUGAUUU89.1235945

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7776-7798TCCAAATATGCTCTTTGATTTACAAAUCAAAGAGCAUAUUUGGACAAAUAUGCUCUUUGAUUUACU7.4-1.832


Target Position: 8263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8263UGCUUUAUAUAACUAAUAU85.6391573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7278281TGCTTTATATAACTAATATATATTAGTTATATAAAGCA0.485500.230800.810300.750001.000001.00000


Target Position: 4516, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4516GUUGUAAUUACAUUUGUGU77.10893872

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4514-4536TGGTTGTAATTACATTTGTGTGAACACAAAUGUAAUUACAACCAGUUGUAAUUACAUUUGUGUGAU12.16.932


Target Position: 4003, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4003GUGAUUCUCACUAACAUAU84.02061949

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4001-4023ATGTGATTCTCACTAACATATCTAUAUGUUAGUGAGAAUCACAUGUGAUUCUCACUAACAUAUCUU8.520.423


Target Position: 5694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5694GUUUAUGUUGGGAUAUAAA95.2756256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5692-5714AGGTTTATGTTGGGATATAAAGTUUUAUAUCCCAACAUAAACCUGUUUAUGUUGGGAUAUAAAGUU3.56.933


Target Position: 7777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7777CCAAAUAUGCUCUUUGAUU83.39392091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7775-7797CTCCAAATATGCTCTTTGATTTAAAUCAAAGAGCAUAUUUGGAGCCAAAUAUGCUCUUUGAUUUAU12.0-1.822


Target Position: 6697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6697CUGCUAUUGAGUUCUUUUU76.87893928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6695-6717TCCTGCTATTGAGTTCTTTTTATAAAAAGAACUCAAUAGCAGGACUGCUAUUGAGUUCUUUUUAUU5.519.722


Target Position: 6729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6729CAAUUUUUUAUUACCAUUU79.0923270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6727-6749TTCAATTTTTTATTACCATTTTGAAAUGGUAAUAAAAAAUUGAACAAUUUUUUAUUACCAUUUUGU20.0-12.022


Target Position: 8878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8878GAACCUUUAGAAGAUUUGU77.83983645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8876-8898AAGAACCTTTAGAAGATTTGTCTACAAAUCUUCUAAAGGUUCUUGAACCUUUAGAAGAUUUGUCUU12.017.322


Target Position: 9868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9868GAAUGUGUUGUUAACAUUU89.2728925

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9866-9888CAGAATGTGTTGTTAACATTTTTAAAUGUUAACAACACAUUCUGGAAUGUGUUGUUAACAUUUUUU6.919.332


Target Position: 2684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684CAAAUUUCAACAGGAAUAA83.85181986

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2682-2704CCCAAATTTCAACAGGAATAATTUUAUUCCUGUUGAAAUUUGGGCAAAUUUCAACAGGAAUAAUUU19.90.422


Target Position: 9313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9313CAUAUCUUGAACUUAAGAA91.9203545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9311-9333TACATATCTTGAACTTAAGAAATUUCUUAAGUUCAAGAUAUGUACAUAUCUUGAACUUAAGAAAUU11.76.632


Target Position: 1184, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GAUUUACAGCCAGUUACUU83.92061975

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1182-1204TGGATTTACAGCCAGTTACTTACAAGUAACUGGCUGUAAAUCCAGAUUUACAGCCAGUUACUUACU17.66.932


Target Position: 9091, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9091GAAAGUUCUUACCUUUUCU86.29881460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9089-9111TTGAAAGTTCTTACCTTTTCTCTAGAAAAGGUAAGAACUUUCAAGAAAGUUCUUACCUUUUCUCUU18.713.312


Target Position: 7266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7266UCUGCCAUAUACCCCGUUA75.3174421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9447284TCTGCCATATACCCCGTTATAACGGGGTATATGGCAGA0.811500.523800.689700.750001.000001.00000


Target Position: 5589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5589GCUUCCCAUAUAUACCUUU79.85273035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8035607GCTTCCCATATATACCTTTAAAGGTATATATGGGAAGC0.319600.232800.853401.000001.000001.00000


Target Position: 8729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8729CAGCCUUUGUUUUAAUAUA95.5446243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6518747CAGCCTTTGTTTTAATATATATATTAAAACAAAGGCTG0.510000.108600.741400.750001.000001.00000


Target Position: 4060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4060CCACAUCAGUACUACUUAA101.9834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3344078CCACATCAGTACTACTTAATTAAGTAGTACTGATGTGG0.620200.288900.810301.000001.000001.00000


Target Position: 8532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8532AGAAAAACUACAGCGAUUA82.42592322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9378550AGAAAAACTACAGCGATTATAATCGCTGTAGTTTTTCT0.376200.310000.689700.750001.000001.00000


Target Position: 2943, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943GCCUUUUGUAAAUGUAAUU78.973308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2941-2963GGGCCTTTTGTAAATGTAATTGTAAUUACAUUUACAAAAGGCCCGCCUUUUGUAAAUGUAAUUGUU6.716.123


Target Position: 8966, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8966CUUAAAGUUAACACGUUUA85.82351538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8964-8986TTCTTAAAGTTAACACGTTTAAGUAAACGUGUUAACUUUAAGAACUUAAAGUUAACACGUUUAAGU19.84.912


Target Position: 8887, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8887GAAGAUUUGUCUGAAAACA90.1509771

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8885-8907TAGAAGATTTGTCTGAAAACAGAUGUUUUCAGACAAAUCUUCUAGAAGAUUUGUCUGAAAACAGAU14.95.321


Target Position: 2025, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025GAAGAUUUUAAAGACUUAA91.2476625

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2023-2045GAGAAGATTTTAAAGACTTAATGUUAAGUCUUUAAAAUCUUCUCGAAGAUUUUAAAGACUUAAUGU18.95.322


Target Position: 6369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6369CAUAUAUCAGAAUGUUUCU85.13271705

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6367-6389TGCATATATCAGAATGTTTCTCTAGAAACAUUCUGAUAUAUGCACAUAUAUCAGAAUGUUUCUCUU14.83.222


Target Position: 607, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607CUGUAAUACUAAAUGUGUU88.80241001

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
605-627AACTGTAATACTAAATGTGTTACAACACAUUUAGUAUUACAGUUCUGUAAUACUAAAUGUGUUACU19.38.533


Target Position: 1233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CAUAUUAUGAAUUAAAUCA92.7213465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1231-1253AGCATATTATGAATTAAATCAGAUGAUUUAAUUCAUAAUAUGCUCAUAUUAUGAAUUAAAUCAGAU2.1-8.622


Target Position: 7872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7872GUUUUAGAAUUAUAAAAGU82.98752192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7870-7892AAGTTTTAGAATTATAAAAGTACACUUUUAUAAUUCUAAAACUUGUUUUAGAAUUAUAAAAGUACU-4.37.121


Target Position: 5326, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5326GUUUUUACAAAUUGUUUAA86.31821455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5324-5346AAGTTTTTACAAATTGTTTAATAUUAAACAAUUUGUAAAAACUUGUUUUUACAAAUUGUUUAAUAU7.20.022


Target Position: 1340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340GGUUUACUCUCCAAUGUUA102.01432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1338-1360TAGGTTTACTCTCCAATGTTAACUAACAUUGGAGAGUAAACCUAGGUUUACUCUCCAAUGUUAACU12.112.932


Target Position: 9529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9529GUCAUUUAGUACUUUGAAU86.03531505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9527-9549CAGTCATTTAGTACTTTGAATGGAUUCAAAGUACUAAAUGACUGGUCAUUUAGUACUUUGAAUGGU12.28.932


Target Position: 5120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5120CAUUCAGUUAGUAAACAUU90.1432774

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5118-5140CACATTCAGTTAGTAAACATTTAAAUGUUUACUAACUGAAUGUGCAUUCAGUUAGUAAACAUUUAU6.919.222


Target Position: 3528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528GUAAUUUUUUAUUCAUUCA88.60031032

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3526-3548TAGTAATTTTTTATTCATTCAACUGAAUGAAUAAAAAAUUACUAGUAAUUUUUUAUUCAUUCAACU16.3-9.722


Target Position: 4594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4594GAUUUUUUUUUUGUUUUCU74.19364770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4592-4614CTGATTTTTTTTTTGTTTTCTGCAGAAAACAAAAAAAAAAUCAGGAUUUUUUUUUUGUUUUCUGCU14.9-12.011


Target Position: 5065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5065CUUUCAUGAUUAGAUUUGA86.53951418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5063-5085AGCTTTCATGATTAGATTTGAGCUCAAAUCUAAUCAUGAAAGCUCUUUCAUGAUUAGAUUUGAGCU12.013.822


Target Position: 7277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7277CCCCGUUACUAAAUUAUUA92.8595452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907295CCCCGTTACTAAATTATTATAATAATTTAGTAACGGGG0.769300.695100.956901.000001.000001.00000


Target Position: 10513, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10513CCAUUUGAGUUGUUUACCA89.771835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10511-10533AGCCATTTGAGTTGTTTACCATGUGGUAAACAACUCAAAUGGCUCCAUUUGAGUUGUUUACCAUGU21.113.832


Target Position: 9301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9301CCAUUGAGAGUACAUAUCU85.12551707

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9299-9321CTCCATTGAGAGTACATATCTTGAGAUAUGUACUCUCAAUGGAGCCAUUGAGAGUACAUAUCUUGU16.018.133


Target Position: 9902, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9902GUUAAAAUGAUUAAAUGCA82.21732366

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9900-9922GTGTTAAAATGATTAAATGCATCUGCAUUUAAUCAUUUUAACACGUUAAAAUGAUUAAAUGCAUCU15.3-9.722


Target Position: 6499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6499GGCUCAAAAAUUCUGUUCA88.60371031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7046517GGCTCAAAAATTCTGTTCATGAACAGAATTTTTGAGCC0.524400.447200.775900.750001.000001.00000


Target Position: 7785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7785GCUCUUUGAUUUACUUAUU85.17781692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7783-7805ATGCTCTTTGATTTACTTATTTTAAUAAGUAAAUCAAAGAGCAUGCUCUUUGAUUUACUUAUUUUU6.316.622


Target Position: 7329, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7329GGGUUAACUUUGUUGUUGU86.28771463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7327-7349TAGGGTTAACTTTGTTGTTGTTGACAACAACAAAGUUAACCCUAGGGUUAACUUUGUUGUUGUUGU19.321.132


Target Position: 2491, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491CUAAAUCUUAUUAUAAGGA80.86842722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2489-2511TGCTAAATCTTATTATAAGGAAAUCCUUAUAAUAAGAUUUAGCACUAAAUCUUAUUAUAAGGAAAU12.36.932


Target Position: 5537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5537GAAAUCAAAUAAAAGAAAA93.9272357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5535-5557TTGAAATCAAATAAAAGAAAATAUUUUCUUUUAUUUGAUUUCAAGAAAUCAAAUAAAAGAAAAUAU5.57.422


Target Position: 7269, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7269GCCAUAUACCCCGUUACUA86.56011410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2447287GCCATATACCCCGTTACTATAGTAACGGGGTATATGGC0.812900.748700.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7267-7289CTGCCATATACCCCGTTACTAAAUAGUAACGGGGUAUAUGGCAGGCCAUAUACCCCGUUACUAAAU19.614.033


Target Position: 5414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5414CAAAUGCUUUCCCUUUUGU74.30574735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5412-5434GTCAAATGCTTTCCCTTTTGTTAACAAAAGGGAAAGCAUUUGACCAAAUGCUUUCCCUUUUGUUAU16.118.512


Target Position: 5895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5895GAUACUUAGACAUAUCAAA99.833569

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5893-5915TTGATACTTAGACATATCAAACAUUUGAUAUGUCUAAGUAUCAAGAUACUUAGACAUAUCAAACAU8.76.323


Target Position: 4875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4875GACUUAGUGGCAUAUUUAU91.0105654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4873-4895CTGACTTAGTGGCATATTTATTCAUAAAUAUGCCACUAAGUCAGGACUUAGUGGCAUAUUUAUUCU-8.017.623


Target Position: 2331, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331CUGUAGAAAAACUAAUUUU83.87681983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2329-2351TCCTGTAGAAAAACTAATTTTTCAAAAUUAGUUUUUCUACAGGACUGUAGAAAAACUAAUUUUUCU-4.320.322


Target Position: 4669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4669CUUUGUUGAAUUUUUGUCU73.81494913

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4667-4689CTCTTTGTTGAATTTTTGTCTTTAGACAAAAAUUCAACAAAGAGCUUUGUUGAAUUUUUGUCUUUU14.912.221


Target Position: 4656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4656GAUAGAAUCCCCUCUUUGU85.80581539

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4654-4676GTGATAGAATCCCCTCTTTGTTGACAAAGAGGGGAUUCUAUCACGAUAGAAUCCCCUCUUUGUUGU16.66.633


Target Position: 5426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5426CUUUUGUUAAAAUUAUUUU76.40224065

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5424-5446CCCTTTTGTTAAAATTATTTTAAAAAAUAAUUUUAACAAAAGGGCUUUUGUUAAAAUUAUUUUAAU-10.35.611


Target Position: 855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855CUUUUAAUCUUAAAAAGGA84.1131933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
853-875TGCTTTTAATCTTAAAAAGGATGUCCUUUUUAAGAUUAAAAGCACUUUUAAUCUUAAAAAGGAUGU9.5-9.732


Target Position: 1033, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GCCACAGAGUAAUUAUAUU91.4772599

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2103319GCCACAGAGTAATTATATT1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45394698..45394716(-)00SMAD2(0.002)


Target Position: 4000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4000CAUGUGAUUCUCACUAACA95.0304271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3998-4020TTCATGTGATTCTCACTAACATAUGUUAGUGAGAAUCACAUGAACAUGUGAUUCUCACUAACAUAU19.020.532


Target Position: 123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
123CGCUCCCUCCGUCUUCCAU74.52964669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536141CGCTCCCTCCGTCTTCCATATGGAAGACGGAGGGAGCG0.796900.633400.767201.000001.000001.00000


Target Position: 3287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287CAGUUUAAACAUUUCUUCU84.90881752

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3285-3307TGCAGTTTAAACATTTCTTCTTGAGAAGAAAUGUUUAAACUGCACAGUUUAAACAUUUCUUCUUGU14.84.921


Target Position: 4566, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4566GUUUUUUGUAUUUUAUCUA88.48251055

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4564-4586ATGTTTTTTGTATTTTATCTACTUAGAUAAAAUACAAAAAACAUGUUUUUUGUAUUUUAUCUACUU6.9-2.912


Target Position: 5124, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5124CAGUUAGUAAACAUUUAUU89.3114916

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5122-5144TTCAGTTAGTAAACATTTATTGAAAUAAAUGUUUACUAACUGAACAGUUAGUAAACAUUUAUUGAU-1.817.622


Target Position: 10488, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10488CAGUUUUCCUAGCAUUAAA96.2676202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77210506CAGTTTTCCTAGCATTAAATTTAATGCTAGGAAAACTG0.333700.185400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10486-10508GACAGTTTTCCTAGCATTAAAAGUUUAAUGCUAGGAAAACUGUCCAGUUUUCCUAGCAUUAAAAGU15.313.322


Target Position: 7586, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7586CAUGAGAUCCAUAAUGAAU91.7871563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7584-7606GCCATGAGATCCATAATGAATCCAUUCAUUAUGGAUCUCAUGGCCAUGAGAUCCAUAAUGAAUCCU8.920.422


Target Position: 3875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3875GGAAACUCCUGAUUAGGUA94.7712293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3873-3895AAGGAAACTCCTGATTAGGTATTUACCUAAUCAGGAGUUUCCUUGGAAACUCCUGAUUAGGUAUUU18.521.532


Target Position: 8260, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8260CAUUGCUUUAUAUAACUAA95.2036259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8258-8280TCCATTGCTTTATATAACTAATAUUAGUUAUAUAAAGCAAUGGACAUUGCUUUAUAUAACUAAUAU6.318.522


Target Position: 4927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4927GAAAGAGUUUCAUUGCUUU90.9542658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4925-4947TGGAAAGAGTTTCATTGCTTTAAAAAGCAAUGAAACUCUUUCCAGAAAGAGUUUCAUUGCUUUAAU18.517.722


Target Position: 1948, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948GUGGAAUCUGUUUCCUAUA90.1076779

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9194819GTGGAATCTGTTTCCTATA1/1/0/097.75SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45368036..45368054(-)00SMAD2(0.002)


Target Position: 3568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3568GUUUGUACCAGGAACUUUU82.89322212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3566-3588CTGTTTGTACCAGGAACTTTTCTAAAAGUUCCUGGUACAAACAGGUUUGUACCAGGAACUUUUCUU13.314.722


Target Position: 9727, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9727GGUUAAACUUAAUCUGAAA103.00321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9725-9747GGGGTTAAACTTAATCTGAAATTUUUCAGAUUAAGUUUAACCCCGGUUAAACUUAAUCUGAAAUUU20.48.223


Target Position: 1951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951GAAUCUGUUUCCUAUAUUU96.5943182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1949-1971TGGAATCTGTTTCCTATATTTGAAAAUAUAGGAAACAGAUUCCAGAAUCUGUUUCCUAUAUUUGAU-2.719.212


Target Position: 9437, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9437CCUUACUUCCCUAUGUUGU71.82685547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9435-9457ATCCTTACTTCCCTATGTTGTCAACAACAUAGGGAAGUAAGGAUCCUUACUUCCCUAUGUUGUCAU13.59.813


Target Position: 4776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776GCUUUCUAUCACAUUUCUA93.4611390

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4774-4796ATGCTTTCTATCACATTTCTAAGUAGAAAUGUGAUAGAAAGCAUGCUUUCUAUCACAUUUCUAAGU12.011.722


Target Position: 10415, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10415CUGUAUGUGCUUUCACUUU80.68892761

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10413-10435ATCTGTATGTGCTTTCACTTTTTAAAGUGAAAGCACAUACAGAUCUGUAUGUGCUUUCACUUUUUU19.220.422


Target Position: 600, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600CUCAAAACUGUAAUACUAA93.2957411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
598-620CACTCAAAACTGTAATACTAAATUUAGUAUUACAGUUUUGAGUGCUCAAAACUGUAAUACUAAAUU6.314.922


Target Position: 5932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5932GCUUUACUUUGCUAAAUCU88.851991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5930-5952ATGCTTTACTTTGCTAAATCTATAGAUUUAGCAAAGUAAAGCAUGCUUUACUUUGCUAAAUCUAUU6.99.832


Target Position: 9865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9865CCAGAAUGUGUUGUUAACA85.5331598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9863-9885AGCCAGAATGTGTTGTTAACATTUGUUAACAACACAUUCUGGCUCCAGAAUGUGUUGUUAACAUUU14.718.122


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250CCACUUCUCUGUUAUUUUU85.25441669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882268CCACTTCTCTGTTATTTTTAAAAATAACAGAGAAGTGG0.324300.105600.844801.000001.000001.00000


Target Position: 5118, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5118CACAUUCAGUUAGUAAACA86.35031446

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5116-5138TACACATTCAGTTAGTAAACATTUGUUUACUAACUGAAUGUGUACACAUUCAGUUAGUAAACAUUU12.920.522


Target Position: 5109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5109CUUAUAAUACACAUUCAGU84.22751902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5107-5129ACCTTATAATACACATTCAGTTAACUGAAUGUGUAUUAUAAGGUCUUAUAAUACACAUUCAGUUAU18.1-8.032


Target Position: 7980, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7980GGUAACUUGCCAUAUUUCU79.31323193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7978-8000TAGGTAACTTGCCATATTTCTGGAGAAAUAUGGCAAGUUACCUAGGUAACUUGCCAUAUUUCUGGU1.812.933


Target Position: 7098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7098CCUGGUAAAAUGUUCUUAA92.7849457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9157116CCTGGTAAAATGTTCTTAATTAAGAACATTTTACCAGG0.386100.076600.810301.000001.000001.00000


Target Position: 6346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6346CAGCCUAGCCAUAUUUUUA96.0283212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9856364CAGCCTAGCCATATTTTTATAAAAATATGGCTAGGCTG0.672800.098500.750000.750000.978300.62500


Target Position: 8391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8391CCAAAUUGGUACUUUCUUA95.1445264

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8389-8411ACCCAAATTGGTACTTTCTTAGAUAAGAAAGUACCAAUUUGGGUCCAAAUUGGUACUUUCUUAGAU10.34.223


Target Position: 10212, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10212CCUUUUUUAUUUUUAUUAA91.7452567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36510230CCTTTTTTATTTTTATTAATTAATAAAAATAAAAAAGG0.524600.352100.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10210-10232TTCCTTTTTTATTTTTATTAAACUUAAUAAAAAUAAAAAAGGAACCUUUUUUAUUUUUAUUAAACU-7.5-5.911


Target Position: 9789, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9789CUUUUCUUGUGAGGAAAUA79.81093047

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9787-9809TTCTTTTCTTGTGAGGAAATACAUAUUUCCUCACAAGAAAAGAACUUUUCUUGUGAGGAAAUACAU18.75.512


Target Position: 4383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383CUACUAUGCUGUUUCAGUA98.822689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4381-4403GCCTACTATGCTGTTTCAGTAGTUACUGAAACAGCAUAGUAGGCCUACUAUGCUGUUUCAGUAGUU19.213.123


Target Position: 2859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859GUAUUUUACAAUAUUUCAA91.6184588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2857-2879AGGTATTTTACAATATTTCAACAUUGAAAUAUUGUAAAAUACCUGUAUUUUACAAUAUUUCAACAU8.9-7.522


Target Position: 9679, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9679CUUCUGAACCUAUGUGUAU83.45232079

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9677-9699TTCTTCTGAACCTATGTGTATATAUACACAUAGGUUCAGAAGAACUUCUGAACCUAUGUGUAUAUU20.420.422


Target Position: 3425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425GGUAUCAUUUUCAAUACUU88.34261081

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3423-3445TAGGTATCATTTTCAATACTTTCAAGUAUUGAAAAUGAUACCUAGGUAUCAUUUUCAAUACUUUCU11.616.022


Target Position: 1539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1539GUAAUCUGAAGAUCUUCAA87.4671251

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1537-1559CTGTAATCTGAAGATCTTCAACAUUGAAGAUCUUCAGAUUACAGGUAAUCUGAAGAUCUUCAACAU20.413.422


Target Position: 2717, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717CUAGCAGUCUGUUGAUUUA96.5406187

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3271719CTAGCAGTCTGTTGATTTA1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45367267..45367285(-)00SMAD2(0.002)


Target Position: 3177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177GGUUUUGUGAUUGACAAUA87.67741213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3175-3197CTGGTTTTGTGATTGACAATATTUAUUGUCAAUCACAAAACCAGGGUUUUGUGAUUGACAAUAUUU20.513.322


Target Position: 7271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7271CAUAUACCCCGUUACUAAA95.5675242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7269-7291GCCATATACCCCGTTACTAAATTUUUAGUAACGGGGUAUAUGGCCAUAUACCCCGUUACUAAAUUU6.615.233


Target Position: 6743, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6743CAUUUUGUUUGUUUAGACU83.83281990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6741-6763ACCATTTTGTTTGTTTAGACTACAGUCUAAACAAACAAAAUGGUCAUUUUGUUUGUUUAGACUACU14.65.322


Target Position: 5536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5536UGAAAUCAAAUAAAAGAAA80.56582802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8195554TGAAATCAAATAAAAGAAATTTCTTTTATTTGATTTCA0.518900.181100.724100.750001.000001.00000


Target Position: 2384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2384GAAAAGUGGAUUAACUUUU81.34212586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2382-2404AAGAAAAGTGGATTAACTTTTGAAAAAGUUAAUCCACUUUUCUUGAAAAGUGGAUUAACUUUUGAU4.910.322


Target Position: 2454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454GUGGUUUUUUGUUUUUUUU75.84184250

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474TTGTGGTTTTTTGTTTTTTTTTGAAAAAAAACAAAAAACCACAAGUGGUUUUUUGUUUUUUUUUGU-11.318.801


Target Position: 1183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183GGAUUUACAGCCAGUUACU85.77741545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1181-1203TTGGATTTACAGCCAGTTACTTAAGUAACUGGCUGUAAAUCCAAGGAUUUACAGCCAGUUACUUAU19.010.033


Target Position: 5101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5101GAUUAUACCUUAUAAUACA103.68316

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5099-5121CCGATTATACCTTATAATACACAUGUAUUAUAAGGUAUAAUCGGGAUUAUACCUUAUAAUACACAU1.11.133


Target Position: 9527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9527CAGUCAUUUAGUACUUUGA90.7717689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9525-9547TCCAGTCATTTAGTACTTTGAATUCAAAGUACUAAAUGACUGGACAGUCAUUUAGUACUUUGAAUU11.819.231


Target Position: 5126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5126GUUAGUAAACAUUUAUUGA90.777688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5124-5146CAGTTAGTAAACATTTATTGATGUCAAUAAAUGUUUACUAACUGGUUAGUAAACAUUUAUUGAUGU-1.46.622


Target Position: 3841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3841GAAUAGCAUCAAAUGCAAA99.028484

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3839-3861GAGAATAGCATCAAATGCAAAAAUUUGCAUUUGAUGCUAUUCUCGAAUAGCAUCAAAUGCAAAAAU20.019.732


Target Position: 3773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3773GCUAACACCUGACAUUAAA91.8762553

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3771-3793GAGCTAACACCTGACATTAAAGAUUUAAUGUCAGGUGUUAGCUCGCUAACACCUGACAUUAAAGAU6.919.022


Target Position: 8097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8097CCCAGUAAGUUUUUUCUUU80.45162847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6518115CCCAGTAAGTTTTTTCTTTAAAGAAAAAACTTACTGGG0.374800.111400.991401.000001.000001.00000


Target Position: 7756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7756AGUUAACAGCUCUUAGUUU85.60741579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9077774AGTTAACAGCTCTTAGTTTAAACTAAGAGCTGTTAACT0.490900.131400.706900.750000.989100.62500


Target Position: 3178, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178GUUUUGUGAUUGACAAUAU89.4136895

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3176-3198TGGTTTTGTGATTGACAATATTTAUAUUGUCAAUCACAAAACCAGUUUUGUGAUUGACAAUAUUUU16.112.222


Target Position: 6536, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6536GGCAAAUGGCAUAAAUUAU88.62171029

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6534-6556CTGGCAAATGGCATAAATTATGTAUAAUUUAUGCCAUUUGCCAGGGCAAAUGGCAUAAAUUAUGUU-7.520.023


Target Position: 9208, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9208GGAUACAAAACUUUUAGCA89.1636941

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9206-9228CTGGATACAAAACTTTTAGCAGAUGCUAAAAGUUUUGUAUCCAGGGAUACAAAACUUUUAGCAGAU13.716.122


Target Position: 7432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7432GUCAAAUUUUCUAGUAUCU81.26892612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7430-7452AGGTCAAATTTTCTAGTATCTTAAGAUACUAGAAAAUUUGACCUGUCAAAUUUUCUAGUAUCUUAU15.87.432


Target Position: 7279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7279CCGUUACUAAAUUAUUAUA93.9413356

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7277-7299CCCCGTTACTAAATTATTATACAUAUAAUAAUUUAGUAACGGGGCCGUUACUAAAUUAUUAUACAU-8.019.633


Target Position: 3847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3847CAUCAAAUGCAAAAAGGUU84.89841753

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3845-3867AGCATCAAATGCAAAAAGGTTCAAACCUUUUUGCAUUUGAUGCUCAUCAAAUGCAAAAAGGUUCAU17.37.223


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079UGAAUUCAGAAUUUUAAAA80.72662753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823097TGAATTCAGAATTTTAAAATTTTAAAATTCTGAATTCA0.296300.085900.724100.750001.000001.00000


Target Position: 7765, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7765CUCUUAGUUUCUCCAAAUA89.7889831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5297783CTCTTAGTTTCTCCAAATATATTTGGAGAAACTAAGAG0.622100.425800.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7763-7785AGCTCTTAGTTTCTCCAAATATGUAUUUGGAGAAACUAAGAGCUCUCUUAGUUUCUCCAAAUAUGU20.118.933


Target Position: 7676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7676GGUGUAUUAACUCAACAUA97.2361153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7674-7696AAGGTGTATTAACTCAACATAGAUAUGUUGAGUUAAUACACCUUGGUGUAUUAACUCAACAUAGAU20.514.633


Target Position: 4347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4347GUUACUCUUGCAUUACUGU78.76533360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4345-4367TGGTTACTCTTGCATTACTGTGTACAGUAAUGCAAGAGUAACCAGUUACUCUUGCAUUACUGUGUU11.618.932


Target Position: 7764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7764GCUCUUAGUUUCUCCAAAU89.6389859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2787782GCTCTTAGTTTCTCCAAATATTTGGAGAAACTAAGAGC0.646200.429600.844801.000001.000001.00000


Target Position: 4701, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4701CAACAUUACUUAGGAUUUA92.3165507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4699-4721AGCAACATTACTTAGGATTTATTUAAAUCCUAAGUAAUGUUGCUCAACAUUACUUAGGAUUUAUUU18.76.932


Target Position: 1480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480CAAUUGUAAUCAGAGAUAU90.1542770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1478-1500CCCAATTGTAATCAGAGATATGGAUAUCUCUGAUUACAAUUGGGCAAUUGUAAUCAGAGAUAUGGU20.26.922


Target Position: 9308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9308GAGUACAUAUCUUGAACUU90.2908751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9306-9328GAGAGTACATATCTTGAACTTAAAAGUUCAAGAUAUGUACUCUCGAGUACAUAUCUUGAACUUAAU19.219.022


Target Position: 5648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5648GCAUUUAUUCAGUGUUAGA93.243418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5646-5668CAGCATTTATTCAGTGTTAGATAUCUAACACUGAAUAAAUGCUGGCAUUUAUUCAGUGUUAGAUAU19.0-1.822


Target Position: 8810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8810CAUACAAAACUGGAUUAAU88.40561069

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8808-8830GACATACAAAACTGGATTAATTGAUUAAUCCAGUUUUGUAUGUCCAUACAAAACUGGAUUAAUUGU15.56.931


Target Position: 4787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4787CAUUUCUAAGAUGAGUAAU80.5972791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4785-4807CACATTTCTAAGATGAGTAATATAUUACUCAUCUUAGAAAUGUGCAUUUCUAAGAUGAGUAAUAUU20.36.922


Target Position: 6700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6700CUAUUGAGUUCUUUUUAUA97.0718161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6698-6720TGCTATTGAGTTCTTTTTATATCUAUAAAAAGAACUCAAUAGCACUAUUGAGUUCUUUUUAUAUCU-9.713.422


Target Position: 7706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7706GAUUUUUCUUCAAAAAAAU87.36161269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7704-7726TAGATTTTTCTTCAAAAAAATTTAUUUUUUUGAAGAAAAAUCUAGAUUUUUCUUCAAAAAAAUUUU-11.30.411


Target Position: 3697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697GUACUGUACUGGAGAAUAA100.28755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3695-3717GGGTACTGTACTGGAGAATAACAUUAUUCUCCAGUACAGUACCCGUACUGUACUGGAGAAUAACAU16.020.222


Target Position: 3307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3307GUUUGCAUCUUAGUAGAAA89.1574943

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3305-3327TTGTTTGCATCTTAGTAGAAATGUUUCUACUAAGAUGCAAACAAGUUUGCAUCUUAGUAGAAAUGU18.920.022


Target Position: 8163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8163CCAAUCUUGGAUUGUUCGA73.70614953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8161-8183TCCCAATCTTGGATTGTTCGAGCUCGAACAAUCCAAGAUUGGGACCAAUCUUGGAUUGUUCGAGCU21.112.033


Target Position: 7434, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7434CAAAUUUUCUAGUAUCUUA101.4839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7432-7454GTCAAATTTTCTAGTATCTTACAUAAGAUACUAGAAAAUUUGACCAAAUUUUCUAGUAUCUUACAU14.5-12.022


Target Position: 7026, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7026CUCAUAGACAAACUUAACA83.49142072

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7024-7046CACTCATAGACAAACTTAACAGTUGUUAAGUUUGUCUAUGAGUGCUCAUAGACAAACUUAACAGUU12.921.423


Target Position: 3883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3883CUGAUUAGGUAUUAAUGCU83.11482163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3881-3903TCCTGATTAGGTATTAATGCTTTAGCAUUAAUACCUAAUCAGGACUGAUUAGGUAUUAAUGCUUUU15.313.431


Target Position: 2966, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2966CUGCAAAAUACCUAGAAAA91.4742600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2964-2986TTCTGCAAAATACCTAGAAAAGTUUUUCUAGGUAUUUUGCAGAACUGCAAAAUACCUAGAAAAGUU11.720.022


Target Position: 9492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9492CAACAUUUCUGAUACUUAU95.1054267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9490-9512GTCAACATTTCTGATACTTATTGAUAAGUAUCAGAAAUGUUGACCAACAUUUCUGAUACUUAUUGU6.35.321


Target Position: 7278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7278CCCGUUACUAAAUUAUUAU82.57572288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7277296CCCGTTACTAAATTATTATATAATAATTTAGTAACGGG0.349700.337800.948301.000001.000001.00000


Target Position: 3123, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123CAAGUUUUUUAGCUUAUAA97.2034154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3121-3143AGCAAGTTTTTTAGCTTATAAGTUUAUAAGCUAAAAAACUUGCUCAAGUUUUUUAGCUUAUAAGUU14.93.222


Target Position: 8938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8938CUAAUUUGCUUGAUUACUA93.423394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8936-8958CACTAATTTGCTTGATTACTACCUAGUAAUCAAGCAAAUUAGUGCUAAUUUGCUUGAUUACUACCU14.5-1.422


Target Position: 5031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5031CUGAUUGUGCUCUUUUUAU81.13152656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5029-5051CGCTGATTGTGCTCTTTTTATCCAUAAAAAGAGCACAAUCAGCGCUGAUUGUGCUCUUUUUAUCCU-3.820.532


Target Position: 7330, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7330GGUUAACUUUGUUGUUGUU89.5502873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7328-7350AGGGTTAACTTTGTTGTTGTTGAAACAACAACAAAGUUAACCCUGGUUAACUUUGUUGUUGUUGAU19.312.921


Target Position: 9102, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9102CCUUUUCUCUAGUGAUAUU89.0118966

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9100-9122TACCTTTTCTCTAGTGATATTAAAAUAUCACUAGAGAAAAGGUACCUUUUCUCUAGUGAUAUUAAU16.010.331


Target Position: 8672, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8672CACAGUUAAAAGUAACAUU87.05111322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8670-8692AGCACAGTTAAAAGTAACATTCTAAUGUUACUUUUAACUGUGCUCACAGUUAAAAGUAACAUUCUU14.619.033


Target Position: 8788, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8788CACCUAAAAAAGAAAGAAA93.0607437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9548806CACCTAAAAAAGAAAGAAATTTCTTTCTTTTTTAGGTG0.507900.365700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8786-8808TTCACCTAAAAAAGAAAGAAAAGUUUCUUUCUUUUUUAGGUGAACACCUAAAAAAGAAAGAAAAGU14.818.621


Target Position: 5541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5541UCAAAUAAAAGAAAAUAUA82.32682344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9905559TCAAATAAAAGAAAATATATATATTTTCTTTTATTTGA0.618100.289400.681000.750001.000001.00000


Target Position: 9866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9866CAGAAUGUGUUGUUAACAU90.891665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9864-9886GCCAGAATGTGTTGTTAACATTTAUGUUAACAACACAUUCUGGCCAGAAUGUGUUGUUAACAUUUU14.719.232


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016AGAGGAAGAGAAGAUUUUA92.0474531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352034AGAGGAAGAGAAGATTTTATAAAATCTTCTCTTCCTCT0.448600.180100.689700.750001.000001.00000


Target Position: 9544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9544GAAUGGAACAUGAGAUUUA99.862668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9542-9564TTGAATGGAACATGAGATTTATAUAAAUCUCAUGUUCCAUUCAAGAAUGGAACAUGAGAUUUAUAU14.820.122


Target Position: 2628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628GUUAAUUCUGGGAUACAGU78.44513453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2626-2648CAGTTAATTCTGGGATACAGTAAACUGUAUCCCAGAAUUAACUGGUUAAUUCUGGGAUACAGUAAU20.32.133


Target Position: 6513, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6513GUUCAGUAAAUGUCUUUGU75.22244447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6511-6533CTGTTCAGTAAATGTCTTTGTGAACAAAGACAUUUACUGAACAGGUUCAGUAAAUGUCUUUGUGAU19.220.322


Target Position: 3986, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3986GUGAUAGUCUGCUUCAUGU85.73411550

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3984-4006TTGTGATAGTCTGCTTCATGTGAACAUGAAGCAGACUAUCACAAGUGAUAGUCUGCUUCAUGUGAU18.120.332


Target Position: 9692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9692GUGUAUAUGUAAGUACAAA97.6323133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9690-9712ATGTGTATATGTAAGTACAAATCUUUGUACUUACAUAUACACAUGUGUAUAUGUAAGUACAAAUCU19.08.223


Target Position: 9688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9688CUAUGUGUAUAUGUAAGUA98.0411116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9686-9708ACCTATGTGTATATGTAAGTACAUACUUACAUAUACACAUAGGUCUAUGUGUAUAUGUAAGUACAU19.020.422


Target Position: 4005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4005GAUUCUCACUAACAUAUCU92.8871448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4003-4025GTGATTCTCACTAACATATCTCCAGAUAUGUUAGUGAGAAUCACGAUUCUCACUAACAUAUCUCCU16.020.422


Target Position: 5612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5612UCCUUCUCUUUUUUCUUUA73.78974925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8285630TCCTTCTCTTTTTTCTTTATAAAGAAAAAAGAGAAGGA0.360200.313500.836200.750001.000001.00000


Target Position: 8429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8429CUCAGUUUUGCUUUUCCAA83.22312137

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8427-8449ACCTCAGTTTTGCTTTTCCAACCUUGGAAAAGCAAAACUGAGGUCUCAGUUUUGCUUUUCCAACCU20.119.222


Target Position: 9335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9335CAUUUGCUCUGAUUUUUAA96.8791169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9333-9355TTCATTTGCTCTGATTTTTAATCUUAAAAAUCAGAGCAAAUGAACAUUUGCUCUGAUUUUUAAUCU-9.718.522


Target Position: 5899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5899CUUAGACAUAUCAAACAUU85.95971516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5897-5919TACTTAGACATATCAAACATTTCAAUGUUUGAUAUGUCUAAGUACUUAGACAUAUCAAACAUUUCU12.120.322


Target Position: 5425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5425CCUUUUGUUAAAAUUAUUU77.65363689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5423-5445TCCCTTTTGTTAAAATTATTTTAAAAUAAUUUUAACAAAAGGGACCUUUUGUUAAAAUUAUUUUAU-10.310.320


Target Position: 4429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4429CGAUUUUUCUGUACAGUAU92.0909529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4427-4449TGCGATTTTTCTGTACAGTATGAAUACUGUACAGAAAAAUCGCACGAUUUUUCUGUACAGUAUGAU20.20.422


Target Position: 1883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883CUGUUUACUAUCCAAAAGU73.92394867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1881-1903GACTGTTTACTATCCAAAAGTTCACUUUUGGAUAGUAAACAGUCCUGUUUACUAUCCAAAAGUUCU16.114.723


Target Position: 6979, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6979GAAGGAAAUAAAUAAUAUA104.87611

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6977-6999AAGAAGGAAATAAATAATATATGUAUAUUAUUUAUUUCCUUCUUGAAGGAAAUAAAUAAUAUAUGU-8.618.722


Target Position: 9334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9334UCAUUUGCUCUGAUUUUUA82.1562380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9329352TCATTTGCTCTGATTTTTATAAAAATCAGAGCAAATGA0.294700.096900.689700.750001.000001.00000


Target Position: 6921, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6921GUUUUAUCUUGAAUAUUGU83.6172035

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6919-6941CTGTTTTATCTTGAATATTGTAGACAAUAUUCAAGAUAAAACAGGUUUUAUCUUGAAUAUUGUAGU-1.82.122


Target Position: 9318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9318CUUGAACUUAAGAAAUUCA87.37041266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9316-9338ATCTTGAACTTAAGAAATTCATTUGAAUUUCUUAAGUUCAAGAUCUUGAACUUAAGAAAUUCAUUU10.419.232


Target Position: 3647, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647GUUACACUAACCCUUAAUU81.03412671

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3645-3667CAGTTACACTAACCCTTAATTATAAUUAAGGGUUAGUGUAACUGGUUACACUAACCCUUAAUUAUU10.919.033


Target Position: 9549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9549GAACAUGAGAUUUAUAACA93.3278404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9547-9569TGGAACATGAGATTTATAACACAUGUUAUAAAUCUCAUGUUCCAGAACAUGAGAUUUAUAACACAU1.420.522


Target Position: 7099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7099CUGGUAAAAUGUUCUUAAU86.34861447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7097-7119TCCTGGTAAAATGTTCTTAATTTAUUAAGAACAUUUUACCAGGACUGGUAAAAUGUUCUUAAUUUU7.120.032


Target Position: 10374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10374GUGAUUUCUGGUCAAUUUU76.70243980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10372-10394CTGTGATTTCTGGTCAATTTTTAAAAAUUGACCAGAAAUCACAGGUGAUUUCUGGUCAAUUUUUAU7.416.322


Target Position: 4675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4675UGAAUUUUUGUCUUUAUUU73.83114908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9124693TGAATTTTTGTCTTTATTTAAATAAAGACAAAAATTCA0.289500.090600.724100.750001.000001.00000


Target Position: 3839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3839GAGAAUAGCAUCAAAUGCA94.0017353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3837-3859AAGAGAATAGCATCAAATGCAAAUGCAUUUGAUGCUAUUCUCUUGAGAAUAGCAUCAAAUGCAAAU20.011.631


Target Position: 7387, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7387GUGCAAGGUUGCUGCUUAA94.6187302

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6738719GTGCAAGGTTGCTGCTTAA1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANANA00SMAD2(0.002)


Target Position: 6051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6051GUUUUUUUUUUUUUUUUUU71.9645495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6049-6071TTGTTTTTTTTTTTTTTTTTTGAAAAAAAAAAAAAAAAAAACAAGUUUUUUUUUUUUUUUUUUGAU-11.3-11.300


Target Position: 8367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8367CAACUGUUUGACAAAAUAU90.2606755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8365-8387CCCAACTGTTTGACAAAATATAGAUAUUUUGUCAAACAGUUGGGCAACUGUUUGACAAAAUAUAGU-1.417.822


Target Position: 8461, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8461GGCAUAUUUGUAUCUUUUU84.01411951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7798479GGCATATTTGTATCTTTTTAAAAAGATACAAATATGCC0.517500.092801.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8459-8481AAGGCATATTTGTATCTTTTTATAAAAAGAUACAAAUAUGCCUUGGCAUAUUUGUAUCUUUUUAUU5.315.232


Target Position: 6866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6866GCAUUUACGAUAAGAACUU81.05662667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6864-6886TAGCATTTACGATAAGAACTTATAAGUUCUUAUCGUAAAUGCUAGCAUUUACGAUAAGAACUUAUU17.76.923


Target Position: 6426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6426CAUACCUAGAGUCCUAAUU78.13783545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6424-6446TTCATACCTAGAGTCCTAATTTCAAUUAGGACUCUAGGUAUGAACAUACCUAGAGUCCUAAUUUCU19.919.833


Target Position: 8674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8674CAGUUAAAAGUAACAUUCU85.35111643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8672-8694CACAGTTAAAAGTAACATTCTGGAGAAUGUUACUUUUAACUGUGCAGUUAAAAGUAACAUUCUGGU14.84.922


Target Position: 7193, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7193CAUUUAAUAUACCAUUUUU92.5854473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7191-7213TTCATTTAATATACCATTTTTTGAAAAAUGGUAUAUUAAAUGAACAUUUAAUAUACCAUUUUUUGU11.3-10.322


Target Position: 2381, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381GAAGAAAAGUGGAUUAACU92.295508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2379-2401GGGAAGAAAAGTGGATTAACTTTAGUUAAUCCACUUUUCUUCCCGAAGAAAAGUGGAUUAACUUUU10.05.523


Target Position: 10295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10295CUCCCACCUACACCAAAUA82.44932317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96010313CTCCCACCTACACCAAATATATTTGGTGTAGGTGGGAG0.276600.278000.767200.750001.000001.00000


Target Position: 9740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9740CUGAAAUUUACAUUUUUCA82.7572233

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9738-9760ATCTGAAATTTACATTTTTCATAUGAAAAAUGUAAAUUUCAGAUCUGAAAUUUACAUUUUUCAUAU0.47.422


Target Position: 2660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660GAGAAAGUCCCUUUGUCUU84.56351824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2658-2680TGGAGAAAGTCCCTTTGTCTTATAAGACAAAGGGACUUUCUCCAGAGAAAGUCCCUUUGUCUUAUU19.217.723


Target Position: 10057, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10057CAUUAACUUUGUAAUGCAA98.3517102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10055-10077GGCATTAACTTTGTAATGCAATAUUGCAUUACAAAGUUAAUGCCCAUUAACUUUGUAAUGCAAUAU21.14.632


Target Position: 9897, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9897GUUGUGUUAAAAUGAUUAA88.23721103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9895-9917ATGTTGTGTTAAAATGATTAAATUUAAUCAUUUUAACACAACAUGUUGUGUUAAAAUGAUUAAAUU8.719.322


Target Position: 5020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5020CUGGAAUACCGCUGAUUGU76.61184006

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5018-5040TTCTGGAATACCGCTGATTGTGCACAAUCAGCGGUAUUCCAGAACUGGAAUACCGCUGAUUGUGCU18.121.233


Target Position: 7180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7180CCAUUUGGCAGUUCAUUUA87.84411181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7178-7200TGCCATTTGGCAGTTCATTTAATUAAAUGAACUGCCAAAUGGCACCAUUUGGCAGUUCAUUUAAUU7.417.722


Target Position: 4643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4643CAUUUUUCUAAGUGAUAGA89.0836951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4641-4663TTCATTTTTCTAAGTGATAGAATUCUAUCACUUAGAAAAAUGAACAUUUUUCUAAGUGAUAGAAUU20.30.422


Target Position: 2815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815UCCCUUUUUAAAAAAGCUA69.48026259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622833TCCCTTTTTAAAAAAGCTATAGCTTTTTTAAAAAGGGA0.590700.203700.698300.750000.972800.62500


Target Position: 8615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8615CAUAUCUGAGAAUAUUCCU78.82623340

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8613-8635TTCATATCTGAGAATATTCCTTTAGGAAUAUUCUCAGAUAUGAACAUAUCUGAGAAUAUUCCUUUU15.413.322


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UCCCAUUUUUGUCCUCAUA76.27034119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602566TCCCATTTTTGTCCTCATATATGAGGACAAAAATGGGA0.593500.237300.827600.750001.000001.00000


Target Position: 4535, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4535GAAUGUGUUUGAUGCUUUU90.7325693

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4533-4555GTGAATGTGTTTGATGCTTTTTAAAAAGCAUCAAACACAUUCACGAAUGUGUUUGAUGCUUUUUAU18.519.322


Target Position: 5594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5594CCAUAUAUACCUUUAAGAU93.5321388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5592-5614TCCCATATATACCTTTAAGATCCAUCUUAAAGGUAUAUAUGGGACCAUAUAUACCUUUAAGAUCCU7.1-0.323


Target Position: 3311, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3311GCAUCUUAGUAGAAAUGGA96.4739191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3309-3331TTGCATCTTAGTAGAAATGGAAAUCCAUUUCUACUAAGAUGCAAGCAUCUUAGUAGAAAUGGAAAU20.113.433


Target Position: 3885, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885GAUUAGGUAUUAAUGCUUU90.1828767

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3883-3905CTGATTAGGTATTAATGCTTTATAAAGCAUUAAUACCUAAUCAGGAUUAGGUAUUAAUGCUUUAUU18.518.532


Target Position: 4477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4477CUAUUGAGCAGUUAUACCU79.09043271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4475-4497ACCTATTGAGCAGTTATACCTGTAGGUAUAACUGCUCAAUAGGUCUAUUGAGCAGUUAUACCUGUU15.313.433


Target Position: 3175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175CUGGUUUUGUGAUUGACAA89.1179947

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3173-3195TCCTGGTTTTGTGATTGACAATAUUGUCAAUCACAAAACCAGGACUGGUUUUGUGAUUGACAAUAU20.518.833


Target Position: 8897, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8897CUGAAAACAGAUUUCAAGA84.93271743

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8895-8917GTCTGAAAACAGATTTCAAGAGTUCUUGAAAUCUGUUUUCAGACCUGAAAACAGAUUUCAAGAGUU12.214.922


Target Position: 1961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961CCUAUAUUUGAAUAUUAGA90.9333660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1959-1981TTCCTATATTTGAATATTAGATGUCUAAUAUUCAAAUAUAGGAACCUAUAUUUGAAUAUUAGAUGU-2.7-2.732


Target Position: 6969, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6969GUCUUUUUAAGAAGGAAAU75.56734356

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6967-6989CAGTCTTTTTAAGAAGGAAATAAAUUUCCUUCUUAAAAAGACUGGUCUUUUUAAGAAGGAAAUAAU18.75.522


Target Position: 2922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922CCAGAUUGCAUUAUGAAAU81.95312424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2920-2942AACCAGATTGCATTATGAAATGGAUUUCAUAAUGCAAUCUGGUUCCAGAUUGCAUUAUGAAAUGGU8.918.132


Target Position: 5724, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5724CAAUCUUCACUGUACAUAA103.95915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5722-5744GACAATCTTCACTGTACATAAAAUUAUGUACAGUGAAGAUUGUCCAAUCUUCACUGUACAUAAAAU15.814.821


Target Position: 2150, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150GUUUAUAUACAUUUUUAGU83.14452157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2148-2170CTGTTTATATACATTTTTAGTTTACUAAAAAUGUAUAUAAACAGGUUUAUAUACAUUUUUAGUUUU-3.8-8.021


Target Position: 5309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5309CUAAAUUUUCUUUGUAAGU71.97355490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5307-5329AGCTAAATTTTCTTTGTAAGTTTACUUACAAAGAAAAUUUAGCUCUAAAUUUUCUUUGUAAGUUUU11.8-9.721


Target Position: 1962, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962CUAUAUUUGAAUAUUAGAU87.43461254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1960-1982TCCTATATTTGAATATTAGATGGAUCUAAUAUUCAAAUAUAGGACUAUAUUUGAAUAUUAGAUGGU8.4-8.022


Target Position: 9726, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9726GGGUUAAACUUAAUCUGAA102.4524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9724-9746TGGGGTTAAACTTAATCTGAAATUUCAGAUUAAGUUUAACCCCAGGGUUAAACUUAAUCUGAAAUU20.414.022


Target Position: 10267, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10267GUUAAAAUUGUUGAAUACU75.61574340

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10265-10287AAGTTAAAATTGTTGAATACTGAAGUAUUCAACAAUUUUAACUUGUUAAAAUUGUUGAAUACUGAU16.1-9.722


Target Position: 1638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638CCAUAAGAAUGAGUUUUGU79.56863122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1636-1658CACCATAAGAATGAGTTTTGTGAACAAAACUCAUUCUUAUGGUGCCAUAAGAAUGAGUUUUGUGAU10.313.422


Target Position: 10307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10307CCAAAUAUUUUAGUCUAUU82.61322276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10305-10327CACCAAATATTTTAGTCTATTTAAAUAGACUAAAAUAUUUGGUGCCAAAUAUUUUAGUCUAUUUAU18.9-1.832


Target Position: 6366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6366CUGCAUAUAUCAGAAUGUU83.71662008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6364-6386ATCTGCATATATCAGAATGTTTCAACAUUCUGAUAUAUGCAGAUCUGCAUAUAUCAGAAUGUUUCU19.221.132


Target Position: 3483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483CCUAUAUUUGUGUGUAUAU89.1594942

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3481-3503TTCCTATATTTGTGTGTATATGTAUAUACACACAAAUAUAGGAACCUAUAUUUGUGUGUAUAUGUU15.8-2.712


Target Position: 848, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GAAUAUGCUUUUAAUCUUA100.48348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
846-868GCGAATATGCTTTTAATCTTAAAUAAGAUUAAAAGCAUAUUCGCGAAUAUGCUUUUAAUCUUAAAU6.915.231


Target Position: 9310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9310GUACAUAUCUUGAACUUAA102.00833

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9308-9330GAGTACATATCTTGAACTTAAGAUUAAGUUCAAGAUAUGUACUCGUACAUAUCUUGAACUUAAGAU14.68.223


Target Position: 7053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7053CAUUCUAACAGUUAAAACA94.1468336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7051-7073GTCATTCTAACAGTTAAAACAATUGUUUUAACUGUUAGAAUGACCAUUCUAACAGUUAAAACAAUU0.06.922


Target Position: 8251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8251GUGGAAAUCCAUUGCUUUA90.295750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8249-8271ATGTGGAAATCCATTGCTTTATAUAAAGCAAUGGAUUUCCACAUGUGGAAAUCCAUUGCUUUAUAU18.620.133


Target Position: 8890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8890GAUUUGUCUGAAAACAGAU89.4412890

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8888-8910AAGATTTGTCTGAAAACAGATTTAUCUGUUUUCAGACAAAUCUUGAUUUGUCUGAAAACAGAUUUU19.214.821


Target Position: 2903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GUUUGAUUUGGUUUAGUAA94.7965289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2901-2923TAGTTTGATTTGGTTTAGTAACCUUACUAAACCAAAUCAAACUAGUUUGAUUUGGUUUAGUAACCU6.67.433


Target Position: 7239, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7239CCAAAAUUUGUUAACAUCA86.42821435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7237-7259AGCCAAAATTTGTTAACATCAAAUGAUGUUAACAAAUUUUGGCUCCAAAAUUUGUUAACAUCAAAU16.1-3.331


Target Position: 7158, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7158GUACAUUAAUUUUCUUAAU87.04031323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7156-7178GAGTACATTAATTTTCTTAATCTAUUAAGAAAAUUAAUGUACUCGUACAUUAAUUUUCUUAAUCUU7.18.523


Target Position: 5093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5093GUUAUACCGAUUAUACCUU79.41743166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5091-5113CAGTTATACCGATTATACCTTATAAGGUAUAAUCGGUAUAACUGGUUAUACCGAUUAUACCUUAUU19.815.332


Target Position: 5938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5938CUUUGCUAAAUCUAUUAUA89.5197876

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5936-5958TACTTTGCTAAATCTATTATATTUAUAAUAGAUUUAGCAAAGUACUUUGCUAAAUCUAUUAUAUUU-2.719.721


Target Position: 8839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8839GAAUACAGUAAAAUACCAU90.924663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8837-8859GAGAATACAGTAAAATACCATATAUGGUAUUUUACUGUAUUCUCGAAUACAGUAAAAUACCAUAUU20.011.633


Target Position: 8830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8830GCAAAAAGAGAAUACAGUA99.25677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8828-8850TTGCAAAAAGAGAATACAGTAAAUACUGUAUUCUCUUUUUGCAAGCAAAAAGAGAAUACAGUAAAU19.02.122


Target Position: 8612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8612GUUCAUAUCUGAGAAUAUU87.59741227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8610-8632ATGTTCATATCTGAGAATATTCCAAUAUUCUCAGAUAUGAACAUGUUCAUAUCUGAGAAUAUUCCU6.68.722


Target Position: 8522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8522GAGUAAAGAAAGAAAAACU89.9287806

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8520-8542AAGAGTAAAGAAAGAAAAACTACAGUUUUUCUUUCUUUACUCUUGAGUAAAGAAAGAAAAACUACU8.79.822


Target Position: 9358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9358GUAAAGUUUUUGCUAAACU79.09933265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9356-9378TTGTAAAGTTTTTGCTAAACTCAAGUUUAGCAAAAACUUUACAAGUAAAGUUUUUGCUAAACUCAU20.94.932


Target Position: 7867, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7867GUGAAGUUUUAGAAUUAUA96.4816190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7865-7887AAGTGAAGTTTTAGAATTATAAAUAUAAUUCUAAAACUUCACUUGUGAAGUUUUAGAAUUAUAAAU1.819.223


Target Position: 10208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10208GGUUCCUUUUUUAUUUUUA90.4829728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41110226GGTTCCTTTTTTATTTTTATAAAAATAAAAAAGGAACC0.526700.164300.819001.000001.000001.00000


Target Position: 1303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303CUUUACAGACCCAUCAAAU82.7152248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1301-1323GGCTTTACAGACCCATCAAATTCAUUUGAUGGGUCUGUAAAGCCCUUUACAGACCCAUCAAAUUCU13.811.823


Target Position: 7343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7343GUUGUUGAUAAUACUAGAU83.98141962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7341-7363TTGTTGTTGATAATACTAGATTGAUCUAGUAUUAUCAACAACAAGUUGUUGAUAAUACUAGAUUGU20.120.532


Target Position: 8274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8274ACUAAUAUACACACAGAUU84.12391928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9058292ACTAATATACACACAGATTAATCTGTGTGTATATTAGT0.391500.220500.698300.750001.000001.00000


Target Position: 7775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7775CUCCAAAUAUGCUCUUUGA88.48071057

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7773-7795TTCTCCAAATATGCTCTTTGATTUCAAAGAGCAUAUUUGGAGAACUCCAAAUAUGCUCUUUGAUUU16.620.123


Target Position: 2639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2639GAUACAGUAAGAAUUCAUA101.00642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2637-2659GGGATACAGTAAGAATTCATATGUAUGAAUUCUUACUGUAUCCCGAUACAGUAAGAAUUCAUAUGU7.219.022


Target Position: 2674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674GUCUUAUGCCCAAAUUUCA86.88481346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694TTGTCTTATGCCCAAATTTCAACUGAAAUUUGGGCAUAAGACAAGUCUUAUGCCCAAAUUUCAACU0.413.422


Target Position: 5424, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5424CCCUUUUGUUAAAAUUAUU81.51752540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5422-5444TTCCCTTTTGTTAAAATTATTTTAAUAAUUUUAACAAAAGGGAACCCUUUUGUUAAAAUUAUUUUU-10.316.121


Target Position: 3475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3475CCCAUUUUCCUAUAUUUGU72.33255380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3473-3495TCCCCATTTTCCTATATTTGTGTACAAAUAUAGGAAAAUGGGGACCCAUUUUCCUAUAUUUGUGUU-1.811.323


Target Position: 4777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4777CUUUCUAUCACAUUUCUAA94.2239330

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4775-4797TGCTTTCTATCACATTTCTAAGAUUAGAAAUGUGAUAGAAAGCACUUUCUAUCACAUUUCUAAGAU6.96.922


Target Position: 7892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7892CUUAAAUAUUAUAUAUUUU90.1067780

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7890-7912TACTTAAATATTATATATTTTCCAAAAUAUAUAAUAUUUAAGUACUUAAAUAUUAUAUAUUUUCCU-8.0-7.512


Target Position: 3420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3420CUAUAGGUAUCAUUUUCAA96.941166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3418-3440CTCTATAGGTATCATTTTCAATAUUGAAAAUGAUACCUAUAGAGCUAUAGGUAUCAUUUUCAAUAU7.419.832


Target Position: 3445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3445CAACAUUUGGUGGUUUUCU73.87534884

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3443-3465TTCAACATTTGGTGGTTTTCTATAGAAAACCACCAAAUGUUGAACAACAUUUGGUGGUUUUCUAUU21.25.322


Target Position: 2119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119GUAUCAUGAUCCAGUAUCA101.22441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2117-2139ATGTATCATGATCCAGTATCACAUGAUACUGGAUCAUGAUACAUGUAUCAUGAUCCAGUAUCACAU20.314.923


Target Position: 2858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858GGUAUUUUACAAUAUUUCA94.6385299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2856-2878AAGGTATTTTACAATATTTCAACUGAAAUAUUGUAAAAUACCUUGGUAUUUUACAAUAUUUCAACU1.8-0.322


Target Position: 6474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6474GAUCAAUCAUUUUAAUUUU91.1546636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6472-6494TTGATCAATCATTTTAATTTTACAAAAUUAAAAUGAUUGAUCAAGAUCAAUCAUUUUAAUUUUACU-9.716.222


Target Position: 5233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5233CUUGUAGAGGUUGUGUUUU71.93345501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5231-5253GTCTTGTAGAGGTTGTGTTTTTTAAAACACAACCUCUACAAGACCUUGUAGAGGUUGUGUUUUUUU19.320.321


Target Position: 3541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3541CAUUCAACAAAUAUUUAUU88.843993

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3539-3561TTCATTCAACAAATATTTATTGTAAUAAAUAUUUGUUGAAUGAACAUUCAACAAAUAUUUAUUGUU-8.014.800


Target Position: 7546, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7546GAGUAUAUUAACUUAACUU94.7783292

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7544-7566TGGAGTATATTAACTTAACTTCAAAGUUAAGUUAAUAUACUCCAGAGUAUAUUAACUUAACUUCAU9.86.122


Target Position: 1950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GGAAUCUGUUUCCUAUAUU87.89591176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1948-1970GTGGAATCTGTTTCCTATATTTGAAUAUAGGAAACAGAUUCCACGGAAUCUGUUUCCUAUAUUUGU12.220.422


Target Position: 7955, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7955GACUAUUUUACAAUGUUAA94.8536284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7953-7975TTGACTATTTTACAATGTTAATCUUAACAUUGUAAAAUAGUCAAGACUAUUUUACAAUGUUAAUCU6.94.622


Target Position: 2023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023GAGAAGAUUUUAAAGACUU88.37921074

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2021-2043AAGAGAAGATTTTAAAGACTTAAAAGUCUUUAAAAUCUUCUCUUGAGAAGAUUUUAAAGACUUAAU17.719.122


Target Position: 2020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020GAAGAGAAGAUUUUAAAGA89.7135848

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2018-2040AGGAAGAGAAGATTTTAAAGACTUCUUUAAAAUCUUCUCUUCCUGAAGAGAAGAUUUUAAAGACUU-3.819.113


Target Position: 3416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3416GUCUCUAUAGGUAUCAUUU88.63661028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3414-3436CTGTCTCTATAGGTATCATTTTCAAAUGAUACCUAUAGAGACAGGUCUCUAUAGGUAUCAUUUUCU8.720.222


Target Position: 2434, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434CUUAAACAGUCAUUCUUUU82.67882256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2432-2454GGCTTAAACAGTCATTCTTTTTGAAAAGAAUGACUGUUUAAGCCCUUAAACAGUCAUUCUUUUUGU5.37.232


Target Position: 3950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3950CUACAGUUCAUAACAUUUU79.65263096

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3948-3970TTCTACAGTTCATAACATTTTGAAAAAUGUUAUGAACUGUAGAACUACAGUUCAUAACAUUUUGAU5.319.022


Target Position: 1590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590CUGUUAAUCAGGGUUUUGA79.65753094

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1588-1610GTCTGTTAATCAGGGTTTTGAAGUCAAAACCCUGAUUAACAGACCUGUUAAUCAGGGUUUUGAAGU18.86.923


Target Position: 8020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8020CUUUAUAAUGCUGUUAUUA87.90281172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8018-8040TCCTTTATAATGCTGTTATTATAUAAUAACAGCAUUAUAAAGGACUUUAUAAUGCUGUUAUUAUAU6.9-7.522


Target Position: 559, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559GAAAACAGGACGAUUAGAU85.29371654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
557-579AAGAAAACAGGACGATTAGATGAAUCUAAUCGUCCUGUUUUCUUGAAAACAGGACGAUUAGAUGAU16.010.323


Target Position: 4721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4721UCUUCACAAUACUGUUAAU83.74742006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894739TCTTCACAATACTGTTAATATTAACAGTATTGTGAAGA0.266900.170400.715500.750001.000001.00000


Target Position: 5061, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5061GAAGCUUUCAUGAUUAGAU90.751692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5059-5081AAGAAGCTTTCATGATTAGATTTAUCUAAUCAUGAAAGCUUCUUGAAGCUUUCAUGAUUAGAUUUU16.017.023


Target Position: 4635, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4635GUGGUUUUCAUUUUUCUAA85.2441671

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4633-4655GTGTGGTTTTCATTTTTCTAAGTUUAGAAAAAUGAAAACCACACGUGGUUUUCAUUUUUCUAAGUU7.118.822


Target Position: 10209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10209GUUCCUUUUUUAUUUUUAU83.23822133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10207-10229TGGTTCCTTTTTTATTTTTATTAAUAAAAAUAAAAAAGGAACCAGUUCCUUUUUUAUUUUUAUUAU-9.718.711


Target Position: 6999, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6999GUGUAUGAAUUUAUAUAUA100.65346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6997-7019ATGTGTATGAATTTATATATACAUAUAUAUAAAUUCAUACACAUGUGUAUGAAUUUAUAUAUACAU-6.421.512


Target Position: 7483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7483CUCAAUAUAAAUGGAUUUU71.69015596

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7481-7503TGCTCAATATAAATGGATTTTCCAAAAUCCAUUUAUAUUGAGCACUCAAUAUAAAUGGAUUUUCCU20.18.722


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524CCUUUCCAAGCCUCUUUUU70.73795878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292542CCTTTCCAAGCCTCTTTTTAAAAAGAGGCTTGGAAAGG0.625300.247200.844801.000001.000001.00000


Target Position: 8119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8119CAGUAAGUCCCUAAGAAAA96.763172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8117-8139CTCAGTAAGTCCCTAAGAAAACAUUUUCUUAGGGACUUACUGAGCAGUAAGUCCCUAAGAAAACAU7.117.633


Target Position: 4792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4792CUAAGAUGAGUAAUAUUUU88.3341085

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4790-4812TTCTAAGATGAGTAATATTTTTTAAAAUAUUACUCAUCUUAGAACUAAGAUGAGUAAUAUUUUUUU-10.313.422


Target Position: 7214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7214GCAACUUGGUAACUAAGAA96.6615179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7212-7234TGGCAACTTGGTAACTAAGAATCUUCUUAGUUACCAAGUUGCCAGCAACUUGGUAACUAAGAAUCU18.916.732


Target Position: 5626, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5626CUUUAACUACUAAAUAGGU77.43983763

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5624-5646TTCTTTAACTACTAAATAGGTTCACCUAUUUAGUAGUUAAAGAACUUUAACUACUAAAUAGGUUCU10.94.932


Target Position: 1103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103CAACAGUUGAAUCAAAGUA91.6502582

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1101-1123ACCAACAGTTGAATCAAAGTATGUACUUUGAUUCAACUGUUGGUCAACAGUUGAAUCAAAGUAUGU19.217.822


Target Position: 3315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315CUUAGUAGAAAUGGAAAAU77.1113869

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3313-3335ATCTTAGTAGAAATGGAAAATAAAUUUUCCAUUUCUACUAAGAUCUUAGUAGAAAUGGAAAAUAAU20.111.322


Target Position: 2807, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807CAUAUUUAUCCCUUUUUAA95.1144266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2805-2827CACATATTTATCCCTTTTTAAAAUUAAAAAGGGAUAAAUAUGUGCAUAUUUAUCCCUUUUUAAAAU-3.8-8.022


Target Position: 7699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7699GCUUUUAGAUUUUUCUUCA91.7135574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7697-7719GGGCTTTTAGATTTTTCTTCAAAUGAAGAAAAAUCUAAAAGCCCGCUUUUAGAUUUUUCUUCAAAU14.81.321


Target Position: 5570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5570GUUUCUCUACCUCUUAAAA91.6593581

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5568-5590TGGTTTCTCTACCTCTTAAAAGCUUUUAAGAGGUAGAGAAACCAGUUUCUCUACCUCUUAAAAGCU7.119.132


Target Position: 7862, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7862CAAAAGUGAAGUUUUAGAA92.6689468

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7860-7882GACAAAAGTGAAGTTTTAGAATTUUCUAAAACUUCACUUUUGUCCAAAAGUGAAGUUUUAGAAUUU7.110.322


Target Position: 7270, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7270CCAUAUACCCCGUUACUAA98.3373103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3307288CCATATACCCCGTTACTAATTAGTAACGGGGTATATGG0.814400.751900.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7268-7290TGCCATATACCCCGTTACTAAATUUAGUAACGGGGUAUAUGGCACCAUAUACCCCGUUACUAAAUU14.38.233


Target Position: 7989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7989CCAUAUUUCUGGUUCUAUA100.70845

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7987-8009TGCCATATTTCTGGTTCTATATTUAUAGAACCAGAAAUAUGGCACCAUAUUUCUGGUUCUAUAUUU14.5-1.832


Target Position: 3043, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043CAGUUUAUAAAUUGAUUGU79.66623089

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3041-3063TTCAGTTTATAAATTGATTGTTAACAAUCAAUUUAUAAACUGAACAGUUUAUAAAUUGAUUGUUAU13.84.622


Target Position: 1381, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381GACAAGAAGGCAUAUAGGA88.50151050

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1379-1401ATGACAAGAAGGCATATAGGAAGUCCUAUAUGCCUUCUUGUCAUGACAAGAAGGCAUAUAGGAAGU12.219.231


Target Position: 8172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8172GAUUGUUCGAGCUGAAAAA94.7963290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8170-8192TGGATTGTTCGAGCTGAAAAAAAUUUUUCAGCUCGAACAAUCCAGAUUGUUCGAGCUGAAAAAAAU12.214.832


Target Position: 5542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5542CAAAUAAAAGAAAAUAUAU92.1514523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5540-5562ATCAAATAAAAGAAAATATATACAUAUAUUUUCUUUUAUUUGAUCAAAUAAAAGAAAAUAUAUACU-8.0-9.711


Target Position: 4916, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4916GGUUUCUUUUGGAAAGAGU79.08623272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4914-4936GGGGTTTCTTTTGGAAAGAGTTTACUCUUUCCAAAAGAAACCCCGGUUUCUUUUGGAAAGAGUUUU19.113.322


Target Position: 6020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6020GUUAUCCUCUUUCUUGUUA83.27482121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6018-6040TGGTTATCCTCTTTCTTGTTAGCUAACAAGAAAGAGGAUAACCAGUUAUCCUCUUUCUUGUUAGCU19.219.932


Target Position: 3056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056GAUUGUUAUUCUACACAUA104.47812

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3054-3076TTGATTGTTATTCTACACATAATUAUGUGUAGAAUAACAAUCAAGAUUGUUAUUCUACACAUAAUU20.46.932


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075CCAAAGGUUUAUUAAUAAC75.20384451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242093CCAAAGGTTTATTAATAACGTTATTAATAAACCTTTGG0.287600.114800.698300.750001.000001.00000


Target Position: 10422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10422UGCUUUCACUUUUUACCUU73.27935091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68010440TGCTTTCACTTTTTACCTTAAGGTAAAAAGTGAAAGCA0.479100.261500.715500.750001.000001.00000


Target Position: 5389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5389GAUUUGUCUGUCUUUUAAA96.757173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5387-5409TTGATTTGTCTGTCTTTTAAACAUUUAAAAGACAGACAAAUCAAGAUUUGUCUGUCUUUUAAACAU-3.814.821


Target Position: 5593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5593CCCAUAUAUACCUUUAAGA86.2051474

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5591-5613TTCCCATATATACCTTTAAGATCUCUUAAAGGUAUAUAUGGGAACCCAUAUAUACCUUUAAGAUCU1.314.022


Target Position: 8275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8275CUAAUAUACACACAGAUUA91.6606580

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8273-8295AACTAATATACACACAGATTAATUAAUCUGUGUGUAUAUUAGUUCUAAUAUACACACAGAUUAAUU19.2-5.931


Target Position: 8731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8731GCCUUUGUUUUAAUAUAUA94.6805296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4198749GCCTTTGTTTTAATATATATATATATTAAAACAAAGGC0.489400.199300.956901.000001.000001.00000


Target Position: 1613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613GUCUAUCAGCUAACUAGAA93.5607386

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1611-1633CCGTCTATCAGCTAACTAGAATGUUCUAGUUAGCUGAUAGACGGGUCUAUCAGCUAACUAGAAUGU18.921.432


Target Position: 5855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5855GAACAAUGAAUACUUUUUU85.26131667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5853-5875ATGAACAATGAATACTTTTTTCTAAAAAAGUAUUCAUUGUUCAUGAACAAUGAAUACUUUUUUCUU3.212.122


Target Position: 5484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5484GACUUUGAAGGUAAAACAA93.6098380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5482-5504AAGACTTTGAAGGTAAAACAAACUUGUUUUACCUUCAAAGUCUUGACUUUGAAGGUAAAACAAACU7.219.222


Target Position: 1536, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536GCUGUAAUCUGAAGAUCUU90.7832686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1534-1556AGGCTGTAATCTGAAGATCTTCAAAGAUCUUCAGAUUACAGCCUGCUGUAAUCUGAAGAUCUUCAU19.111.632


Target Position: 10308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10308CAAAUAUUUUAGUCUAUUU93.1372429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10306-10328ACCAAATATTTTAGTCTATTTAAAAAUAGACUAAAAUAUUUGGUCAAAUAUUUUAGUCUAUUUAAU14.5-10.322


Target Position: 5318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5318CUUUGUAAGUUUUUACAAA94.0831341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5316-5338TTCTTTGTAAGTTTTTACAAATTUUUGUAAAAACUUACAAAGAACUUUGUAAGUUUUUACAAAUUU7.27.222


Target Position: 7365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7365UCCCUCUUUAAUUCUUCUU59.88048611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8407383TCCCTCTTTAATTCTTCTTAAGAAGAATTAAAGAGGGA0.408500.234200.732800.750001.000001.00000


Target Position: 2448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2448CUUUUUGUGGUUUUUUGUU71.05775784

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2446-2468TTCTTTTTGTGGTTTTTTGTTTTAACAAAAAACCACAAAAAGAACUUUUUGUGGUUUUUUGUUUUU5.65.620


Target Position: 2659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659GGAGAAAGUCCCUUUGUCU89.0514958

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2657-2679ATGGAGAAAGTCCCTTTGTCTTAAGACAAAGGGACUUUCUCCAUGGAGAAAGUCCCUUUGUCUUAU19.219.132


Target Position: 8067, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8067GCAAUAGAAAUUUUACUAA94.571306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8065-8087TAGCAATAGAAATTTTACTAAGTUUAGUAAAAUUUCUAUUGCUAGCAAUAGAAAUUUUACUAAGUU6.613.422


Target Position: 3780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3780CCUGACAUUAAAGAAGCAA80.64262769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173798CCTGACATTAAAGAAGCAATTGCTTCTTTAATGTCAGG0.631800.076500.698301.000001.000001.00000


Target Position: 4873, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4873CUGACUUAGUGGCAUAUUU83.78922000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4871-4893CACTGACTTAGTGGCATATTTATAAAUAUGCCACUAAGUCAGUGCUGACUUAGUGGCAUAUUUAUU15.220.332


Target Position: 5099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5099CCGAUUAUACCUUAUAAUA94.9732274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5097-5119TACCGATTATACCTTATAATACAUAUUAUAAGGUAUAAUCGGUACCGAUUAUACCUUAUAAUACAU-8.08.822


Target Position: 2298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298CAAGAUUUUCAAAUUAUUU85.85671532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2296-2318ATCAAGATTTTCAAATTATTTAGAAAUAAUUUGAAAAUCUUGAUCAAGAUUUUCAAAUUAUUUAGU-10.35.321


Target Position: 3477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477CAUUUUCCUAUAUUUGUGU76.16034155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3475-3497CCCATTTTCCTATATTTGTGTGTACACAAAUAUAGGAAAAUGGGCAUUUUCCUAUAUUUGUGUGUU12.114.233


Target Position: 10385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10385UCAAUUUUUAUAUAUAUUU72.67285279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77410403TCAATTTTTATATATATTTAAATATATATAAAAATTGA0.333000.277500.724100.750001.000001.00000


Target Position: 8366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8366CCAACUGUUUGACAAAAUA92.7995456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8208384CCAACTGTTTGACAAAATATATTTTGTCAAACAGTTGG0.423500.088300.801701.000001.000001.00000


Target Position: 4727, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4727CAAUACUGUUAAUUUUCUA97.4171142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4725-4747CACAATACTGTTAATTTTCTAGGUAGAAAAUUAACAGUAUUGUGCAAUACUGUUAAUUUUCUAGGU5.311.621


Target Position: 4931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4931GAGUUUCAUUGCUUUAAAA99.897566

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4929-4951AAGAGTTTCATTGCTTTAAAAAGUUUUAAAGCAAUGAAACUCUUGAGUUUCAUUGCUUUAAAAAGU-3.819.211


Target Position: 7727, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7727CGAGAAAAGUAUUCUUUUA99.866367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7725-7747TTCGAGAAAAGTATTCTTTTACCUAAAAGAAUACUUUUCUCGAACGAGAAAAGUAUUCUUUUACCU5.514.831


Target Position: 98, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
98GCUCGGCCUCGUUCCUUUC64.98037558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982116GCTCGGCCTCGTTCCTTTCGAAAGGAACGAGGCCGAGC0.793000.071600.681000.750001.000001.00000


Target Position: 10256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10256CUGGUUUUCAAGUUAAAAU79.18193232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10254-10276AGCTGGTTTTCAAGTTAAAATTGAUUUUAACUUGAAAACCAGCUCUGGUUUUCAAGUUAAAAUUGU0.018.822


Target Position: 5072, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5072GAUUAGAUUUGAGCUAUAU93.2607415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5070-5092ATGATTAGATTTGAGCTATATCAAUAUAGCUCAAAUCUAAUCAUGAUUAGAUUUGAGCUAUAUCAU19.56.622


Target Position: 8019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8019CCUUUAUAAUGCUGUUAUU89.0698953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8017-8039ATCCTTTATAATGCTGTTATTATAAUAACAGCAUUAUAAAGGAUCCUUUAUAAUGCUGUUAUUAUU11.6-2.321


Target Position: 8463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8463CAUAUUUGUAUCUUUUUAU87.75261198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8461-8483GGCATATTTGTATCTTTTTATTAAUAAAAAGAUACAAAUAUGCCCAUAUUUGUAUCUUUUUAUUAU-3.8-1.822


Target Position: 6832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6832GGAAAUAUGAGCUAUACUA102.2128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6830-6852CAGGAAATATGAGCTATACTAGAUAGUAUAGCUCAUAUUUCCUGGGAAAUAUGAGCUAUACUAGAU11.21.833


Target Position: 2845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845CCGUUUUUCCAAAGGUAUU74.17014781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2843-2865TACCGTTTTTCCAAAGGTATTTTAAUACCUUUGGAAAAACGGUACCGUUUUUCCAAAGGUAUUUUU18.55.522


Target Position: 5848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5848UGGACAUGAACAAUGAAUA86.10781492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9455866TGGACATGAACAATGAATATATTCATTGTTCATGTCCA0.289500.099200.801700.750001.000001.00000


Target Position: 9225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9225CAGAGUUUUGUAUAUAUGU84.18931911

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9223-9245AGCAGAGTTTTGTATATATGTGGACAUAUAUACAAAACUCUGCUCAGAGUUUUGUAUAUAUGUGGU-0.317.722


Target Position: 7949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7949GUUUUUGACUAUUUUACAA93.7852367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7947-7969AAGTTTTTGACTATTTTACAATGUUGUAAAAUAGUCAAAAACUUGUUUUUGACUAUUUUACAAUGU7.27.712


Target Position: 8871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8871GCUAGAAGAACCUUUAGAA98.857588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8869-8891AAGCTAGAAGAACCTTTAGAAGAUUCUAAAGGUUCUUCUAGCUUGCUAGAAGAACCUUUAGAAGAU11.716.322


Target Position: 5569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5569GGUUUCUCUACCUCUUAAA91.4392602

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5567-5589TTGGTTTCTCTACCTCTTAAAAGUUUAAGAGGUAGAGAAACCAAGGUUUCUCUACCUCUUAAAAGU11.721.532


Target Position: 2072, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072GUCCCAAAGGUUUAUUAAU81.96382423

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10207219GTCCCAAAGGTTTATTAAT1/1/0/097.75SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANANA00SMAD2(0.002)


Target Position: 4199, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4199CUAGGUAAUACCACUAUCA91.7528566

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4197-4219TCCTAGGTAATACCACTATCAGGUGAUAGUGGUAUUACCUAGGACUAGGUAAUACCACUAUCAGGU20.319.823


Target Position: 1293, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293CUGUAGAUGGCUUUACAGA86.21111473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1291-1313CACTGTAGATGGCTTTACAGACCUCUGUAAAGCCAUCUACAGUGCUGUAGAUGGCUUUACAGACCU11.820.322


Target Position: 8390, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8390CCCAAAUUGGUACUUUCUU72.85765219

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8388-8410AACCCAAATTGGTACTTTCTTAGAAGAAAGUACCAAUUUGGGUUCCCAAAUUGGUACUUUCUUAGU17.711.322


Target Position: 844, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844CUGCGAAUAUGCUUUUAAU90.138775

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_184419CTGCGAATATGCTTTTAAT1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANANA00SMAD2(0.002)


Target Position: 10305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10305CACCAAAUAUUUUAGUCUA97.7577129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10303-10325TACACCAAATATTTTAGTCTATTUAGACUAAAAUAUUUGGUGUACACCAAAUAUUUUAGUCUAUUU18.918.822


Target Position: 2956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956GUAAUUGUUUCUGCAAAAU77.49933741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2954-2976ATGTAATTGTTTCTGCAAAATACAUUUUGCAGAAACAAUUACAUGUAAUUGUUUCUGCAAAAUACU20.06.922


Target Position: 9772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9772CCAAUUGUUGCAGAUUUCU70.81385851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9770-9792AACCAATTGTTGCAGATTTCTTTAGAAAUCUGCAACAAUUGGUUCCAAUUGUUGCAGAUUUCUUUU14.812.122


Target Position: 2297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2297UCAAGAUUUUCAAAUUAUU77.45743755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332315TCAAGATTTTCAAATTATTAATAATTTGAAAATCTTGA0.522100.235000.715500.750001.000001.00000


Target Position: 8568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8568CAGUUGUUGAACUAGAUCA92.4875485

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8566-8588TGCAGTTGTTGAACTAGATCACAUGAUCUAGUUCAACAACUGCACAGUUGUUGAACUAGAUCACAU20.217.833


Target Position: 10352, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10352GAAAACAUUGCUUACAUGU78.4553447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10350-10372AAGAAAACATTGCTTACATGTCCACAUGUAAGCAAUGUUUUCUUGAAAACAUUGCUUACAUGUCCU13.55.322


Target Position: 7930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7930CUUUCUCUGUGGCUUUAAA90.6502707

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7928-7950TCCTTTCTCTGTGGCTTTAAAGTUUUAAAGCCACAGAGAAAGGACUUUCUCUGUGGCUUUAAAGUU13.719.122


Target Position: 7840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7840CCGUAAUAUAUUGAUUUAA89.222933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7838-7860ATCCGTAATATATTGATTTAAGGUUAAAUCAAUAUAUUACGGAUCCGUAAUAUAUUGAUUUAAGGU8.98.533


Target Position: 6919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6919CUGUUUUAUCUUGAAUAUU77.76873662

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6917-6939AACTGTTTTATCTTGAATATTGTAAUAUUCAAGAUAAAACAGUUCUGUUUUAUCUUGAAUAUUGUU8.77.222


Target Position: 5703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5703GGGAUAUAAAGUAACACAA97.4717140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5701-5723TTGGGATATAAAGTAACACAAGAUUGUGUUACUUUAUAUCCCAAGGGAUAUAAAGUAACACAAGAU20.416.732


Target Position: 1552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1552CUUCAACAACCAGGAAUUU73.59534991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1550-1572ATCTTCAACAACCAGGAATTTGCAAAUUCCUGGUUGUUGAAGAUCUUCAACAACCAGGAAUUUGCU18.720.512


Target Position: 4722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4722CUUCACAAUACUGUUAAUU72.00465479

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4720-4742TTCTTCACAATACTGTTAATTTTAAUUAACAGUAUUGUGAAGAACUUCACAAUACUGUUAAUUUUU6.920.532


Target Position: 3355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355CAUAAAUUUUCAUAUUUUU88.32951086

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3353-3375TTCATAAATTTTCATATTTTTGAAAAAAUAUGAAAAUUUAUGAACAUAAAUUUUCAUAUUUUUGAU-10.3-10.321


Target Position: 2273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2273GUCUUUUUUAAUAUAUAAU84.22671904

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2271-2293GTGTCTTTTTTAATATATAATATAUUAUAUAUUAAAAAAGACACGUCUUUUUUAAUAUAUAAUAUU-5.95.522


Target Position: 1452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452GUGAUAGUGCAAUCUUUGU78.15913537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1450-1472AAGTGATAGTGCAATCTTTGTGCACAAAGAUUGCACUAUCACUUGUGAUAGUGCAAUCUUUGUGCU12.020.323


Target Position: 5579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5579CCUCUUAAAAGCUUCCCAU80.23842915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9385597CCTCTTAAAAGCTTCCCATATGGGAAGCTTTTAAGAGG0.843100.191900.689701.000001.000001.00000


Target Position: 9728, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9728GUUAAACUUAAUCUGAAAU80.35052880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9726-9748GGGTTAAACTTAATCTGAAATTTAUUUCAGAUUAAGUUUAACCCGUUAAACUUAAUCUGAAAUUUU20.44.922


Target Position: 6040, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6040CCUUGUUUUUUGUUUUUUU80.94962693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2746058CCTTGTTTTTTGTTTTTTTAAAAAAACAAAAAACAAGG0.705200.459300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6038-6060AGCCTTGTTTTTTGTTTTTTTTTAAAAAAACAAAAAACAAGGCUCCUUGUUUUUUGUUUUUUUUUU-1.810.310


Target Position: 6821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6821CCUUACAACCAGGAAAUAU81.13842652

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6819-6841AGCCTTACAACCAGGAAATATGAAUAUUUCCUGGUUGUAAGGCUCCUUACAACCAGGAAAUAUGAU15.511.812


Target Position: 6627, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6627CAUAUUGGAUUGUUGUAUU89.0424961

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6625-6647GGCATATTGGATTGTTGTATTTAAAUACAACAAUCCAAUAUGCCCAUAUUGGAUUGUUGUAUUUAU14.612.622


Target Position: 5613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5613CCUUCUCUUUUUUCUUUAA91.0757645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7785631CCTTCTCTTTTTTCTTTAATTAAAGAAAAAAGAGAAGG0.331500.309100.810301.000001.000001.00000


Target Position: 8958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8958CAACUCUUCUUAAAGUUAA92.7081466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8956-8978ACCAACTCTTCTTAAAGTTAACAUUAACUUUAAGAAGAGUUGGUCAACUCUUCUUAAAGUUAACAU4.917.712


Target Position: 10486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10486GACAGUUUUCCUAGCAUUA93.0377438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10484-10506TGGACAGTTTTCCTAGCATTAAAUAAUGCUAGGAAAACUGUCCAGACAGUUUUCCUAGCAUUAAAU19.717.823


Target Position: 7713, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7713CUUCAAAAAAAUUUCGAGA79.14563244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7711-7733TTCTTCAAAAAAATTTCGAGAAAUCUCGAAAUUUUUUUGAAGAACUUCAAAAAAAUUUCGAGAAAU21.07.722


Target Position: 3658, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658CCUUAAUUAUCUUACUUGU84.58911819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3656-3678ACCCTTAATTATCTTACTTGTCTACAAGUAAGAUAAUUAAGGGUCCUUAAUUAUCUUACUUGUCUU11.8-4.322


Target Position: 1998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998GAAAUACUCUCCCAUUAAA100.18261

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1996-2018TAGAAATACTCTCCCATTAAAGAUUUAAUGGGAGAGUAUUUCUAGAAAUACUCUCCCAUUAAAGAU12.84.632


Target Position: 3506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3506GUGUUCAUGUAAAUUUGGU75.48144379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3504-3526ATGTGTTCATGTAAATTTGGTATACCAAAUUUACAUGAACACAUGUGUUCAUGUAAAUUUGGUAUU11.320.523


Target Position: 3522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522GGUAUAGUAAUUUUUUAUU87.12221309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3520-3542TTGGTATAGTAATTTTTTATTCAAAUAAAAAAUUACUAUACCAAGGUAUAGUAAUUUUUUAUUCAU-9.714.222


Target Position: 5042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5042CUUUUUAUCCUACUUUAAA88.8363995

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5040-5062CTCTTTTTATCCTACTTTAAAGAUUUAAAGUAGGAUAAAAAGAGCUUUUUAUCCUACUUUAAAGAU4.9-9.722


Target Position: 5400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5400CUUUUAAACACUGUCAAAU77.27943812

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5398-5420GTCTTTTAAACACTGTCAAATGCAUUUGACAGUGUUUAAAAGACCUUUUAAACACUGUCAAAUGCU20.5-9.123


Target Position: 5933, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5933CUUUACUUUGCUAAAUCUA84.7581781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5931-5953TGCTTTACTTTGCTAAATCTATTUAGAUUUAGCAAAGUAAAGCACUUUACUUUGCUAAAUCUAUUU6.94.922


Target Position: 7548, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7548GUAUAUUAACUUAACUUCA92.8757449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7546-7568GAGTATATTAACTTAACTTCAGTUGAAGUUAAGUUAAUAUACUCGUAUAUUAACUUAACUUCAGUU14.6-5.932


Target Position: 2147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2147GCUGUUUAUAUACAUUUUU79.78283055

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2145-2167GTGCTGTTTATATACATTTTTAGAAAAAUGUAUAUAAACAGCACGCUGUUUAUAUACAUUUUUAGU5.311.821


Target Position: 8343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8343GAGUUUUGAAUUUUUUUAA90.8125680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8341-8363ATGAGTTTTGAATTTTTTTAAAAUUAAAAAAAUUCAAAACUCAUGAGUUUUGAAUUUUUUUAAAAU-9.110.311


Target Position: 10180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10180CGUUCUAUGAUUGUCAAAA90.4681729

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10178-10200TTCGTTCTATGATTGTCAAAAGTUUUUGACAAUCAUAGAACGAACGUUCUAUGAUUGUCAAAAGUU20.514.532


Target Position: 2432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432GGCUUAAACAGUCAUUCUU85.14781700

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2430-2452GGGGCTTAAACAGTCATTCTTTTAAGAAUGACUGUUUAAGCCCCGGCUUAAACAGUCAUUCUUUUU20.413.732


Target Position: 3080, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3080GAAUUCAGAAUUUUAAAAA91.9553540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3078-3100ATGAATTCAGAATTTTAAAAATTUUUUUAAAAUUCUGAAUUCAUGAAUUCAGAAUUUUAAAAAUUU-9.112.021


Target Position: 8831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8831CAAAAAGAGAAUACAGUAA94.2474329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8829-8851TGCAAAAAGAGAATACAGTAAAAUUACUGUAUUCUCUUUUUGCACAAAAAGAGAAUACAGUAAAAU20.25.522


Target Position: 8589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8589GCAUUGUAGGCAGAAUAAA89.2739924

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8587-8609CAGCATTGTAGGCAGAATAAAAAUUUAUUCUGCCUACAAUGCUGGCAUUGUAGGCAGAAUAAAAAU6.913.533


Target Position: 6347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6347AGCCUAGCCAUAUUUUUAU78.04413575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9496365AGCCTAGCCATATTTTTATATAAAAATATGGCTAGGCT0.308000.073100.810300.750001.000001.00000


Target Position: 10383, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10383GGUCAAUUUUUAUAUAUAU99.118279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71710401GGTCAATTTTTATATATATATATATATAAAAATTGACC0.352900.174400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10381-10403CTGGTCAATTTTTATATATATTTAUAUAUAUAAAAAUUGACCAGGGUCAAUUUUUAUAUAUAUUUU-6.414.812


Target Position: 7740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7740CUUUUACCCUCCAAACAGU77.43163766

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7738-7760TTCTTTTACCCTCCAAACAGTTAACUGUUUGGAGGGUAAAAGAACUUUUACCCUCCAAACAGUUAU16.714.022


Target Position: 839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839GAAAACUGCGAAUAUGCUU80.3012895

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
837-859TTGAAAACTGCGAATATGCTTTTAAGCAUAUUCGCAGUUUUCAAGAAAACUGCGAAUAUGCUUUUU19.710.333


Target Position: 3390, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3390CUUGUUCUUUGAAAUCAUA91.1543637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3388-3410TACTTGTTCTTTGAAATCATATCUAUGAUUUCAAAGAACAAGUACUUGUUCUUUGAAAUCAUAUCU7.219.232


Target Position: 2138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138CAGUAUUGUGCUGUUUAUA91.9714537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2136-2158CACAGTATTGTGCTGTTTATATAUAUAAACAGCACAAUACUGUGCAGUAUUGUGCUGUUUAUAUAU6.911.623


Target Position: 1823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823CCAUGAAAAGACUUAAUGU87.91441168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1821-1843TCCCATGAAAAGACTTAATGTAAACAUUAAGUCUUUUCAUGGGACCAUGAAAAGACUUAAUGUAAU3.513.822


Target Position: 6867, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6867CAUUUACGAUAAGAACUUA97.9036122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6865-6887AGCATTTACGATAAGAACTTATCUAAGUUCUUAUCGUAAAUGCUCAUUUACGAUAAGAACUUAUCU17.76.932


Target Position: 8814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8814CAAAACUGGAUUAAUUGCA77.48473747

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8812-8834TACAAAACTGGATTAATTGCAAAUGCAAUUAAUCCAGUUUUGUACAAAACUGGAUUAAUUGCAAAU15.310.323


Target Position: 9761, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9761GUAAAAGGAAACCAAUUGU74.85474573

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9759-9781TAGTAAAAGGAAACCAATTGTTGACAAUUGGUUUCCUUUUACUAGUAAAAGGAAACCAAUUGUUGU17.711.023


Target Position: 6931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6931GAAUAUUGUAGCUAACUAU98.699793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6929-6951TTGAATATTGTAGCTAACTATATAUAGUUAGCUACAAUAUUCAAGAAUAUUGUAGCUAACUAUAUU11.3-1.832


Target Position: 4260, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260CUUACUUGAGAACUUGUAA89.311917

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4258-4280TTCTTACTTGAGAACTTGTAATGUUACAAGUUCUCAAGUAAGAACUUACUUGAGAACUUGUAAUGU19.011.823


Target Position: 3031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031GUAUGUUGUAUUCAGUUUA91.956539

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3029-3051AAGTATGTTGTATTCAGTTTATAUAAACUGAAUACAACAUACUUGUAUGUUGUAUUCAGUUUAUAU19.213.522


Target Position: 6041, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6041CUUGUUUUUUGUUUUUUUU74.1624788

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6039-6061GCCTTGTTTTTTGTTTTTTTTTTAAAAAAAACAAAAAACAAGGCCUUGUUUUUUGUUUUUUUUUUU-11.35.600


Target Position: 1508, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CCUGCAACAGUGUGUAAAA94.4173316

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8150819CCTGCAACAGTGTGTAAAA1/1/0/097.75SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45372043..45372061(-)00SMAD2(0.002)


Target Position: 8365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8365CCCAACUGUUUGACAAAAU78.33333487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9198383CCCAACTGTTTGACAAAATATTTTGTCAAACAGTTGGG0.303800.076400.982801.000001.000001.00000


Target Position: 2148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148CUGUUUAUAUACAUUUUUA97.9393121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2146-2168TGCTGTTTATATACATTTTTAGTUAAAAAUGUAUAUAAACAGCACUGUUUAUAUACAUUUUUAGUU-3.36.921


Target Position: 7051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7051GUCAUUCUAACAGUUAAAA82.06532402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7049-7071GGGTCATTCTAACAGTTAAAACAUUUUAACUGUUAGAAUGACCCGUCAUUCUAACAGUUAAAACAU4.920.432


Target Position: 2968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968GCAAAAUACCUAGAAAAGU76.3674081

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2966-2988CTGCAAAATACCTAGAAAAGTGAACUUUUCUAGGUAUUUUGCAGGCAAAAUACCUAGAAAAGUGAU10.3-1.423


Target Position: 4684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4684GUCUUUAUUUAAAUUAGCA90.4545730

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4682-4704TTGTCTTTATTTAAATTAGCAACUGCUAAUUUAAAUAAAGACAAGUCUUUAUUUAAAUUAGCAACU13.66.921


Target Position: 7240, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7240CAAAAUUUGUUAACAUCAA92.8907446

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7238-7260GCCAAAATTTGTTAACATCAAAGUUGAUGUUAACAAAUUUUGGCCAAAAUUUGUUAACAUCAAAGU20.5-12.021


Target Position: 4957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4957CAGAAAGUCUUUAUAACCA93.5812382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4955-4977CTCAGAAAGTCTTTATAACCACTUGGUUAUAAAGACUUUCUGAGCAGAAAGUCUUUAUAACCACUU15.317.733


Target Position: 5922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5922CCUUUCAUAUGCUUUACUU84.5571828

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5920-5942TTCCTTTCATATGCTTTACTTTGAAGUAAAGCAUAUGAAAGGAACCUUUCAUAUGCUUUACUUUGU9.812.022


Target Position: 9032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9032CCAUUAGCUAGUGAUGUAA90.4193732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9030-9052AGCCATTAGCTAGTGATGTAAAAUUACAUCACUAGCUAAUGGCUCCAUUAGCUAGUGAUGUAAAAU21.519.733


Target Position: 8598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8598GCAGAAUAAAAAAUGUUCA88.72911012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8596-8618AGGCAGAATAAAAAATGTTCATAUGAACAUUUUUUAUUCUGCCUGCAGAAUAAAAAAUGUUCAUAU14.813.421


Target Position: 5850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5850GACAUGAACAAUGAAUACU79.68463083

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5848-5870TGGACATGAACAATGAATACTTTAGUAUUCAUUGUUCAUGUCCAGACAUGAACAAUGAAUACUUUU16.120.522


Target Position: 9889, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9889CCGUGAAUGUUGUGUUAAA97.9542119

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7988919CCGTGAATGTTGTGTTAAA1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45360095..45360113(-)00SMAD2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9887-9909TTCCGTGAATGTTGTGTTAAAATUUUAACACAACAUUCACGGAACCGUGAAUGUUGUGUUAAAAUU14.721.133


Target Position: 3947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3947GUUCUACAGUUCAUAACAU91.5255594

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3945-3967TGGTTCTACAGTTCATAACATTTAUGUUAUGAACUGUAGAACCAGUUCUACAGUUCAUAACAUUUU13.520.333


Target Position: 10063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10063CUUUGUAAUGCAAUAUGAU87.48571247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10061-10083AACTTTGTAATGCAATATGATGGAUCAUAUUGCAUUACAAAGUUCUUUGUAAUGCAAUAUGAUGGU8.77.222


Target Position: 5232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5232UCUUGUAGAGGUUGUGUUU74.25664754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8465250TCTTGTAGAGGTTGTGTTTAAACACAACCTCTACAAGA0.510000.085100.724100.750001.000001.00000


Target Position: 8509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8509CUUUUAUACAAAAGAGUAA89.9212808

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8507-8529ACCTTTTATACAAAAGAGTAAAGUUACUCUUUUGUAUAAAAGGUCUUUUAUACAAAAGAGUAAAGU18.9-7.531


Target Position: 6215, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6215CUAAUUUUUUGUAUUUUUA88.56131041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6213-6235GGCTAATTTTTTGTATTTTTAGTUAAAAAUACAAAAAAUUAGCCCUAAUUUUUUGUAUUUUUAGUU-9.7-9.700


Target Position: 6032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6032CUUGUUAGCCUUGUUUUUU71.37785689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6030-6052TTCTTGTTAGCCTTGTTTTTTGTAAAAAACAAGGCUAACAAGAACUUGUUAGCCUUGUUUUUUGUU5.611.822


Target Position: 3022, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022GUUUUUAAAGUAUGUUGUA89.2247932

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3020-3042CTGTTTTTAAAGTATGTTGTATTUACAACAUACUUUAAAAACAGGUUUUUAAAGUAUGUUGUAUUU19.3-9.111


Target Position: 4526, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4526CAUUUGUGUGAAUGUGUUU84.12251929

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4524-4546TACATTTGTGTGAATGTGTTTGAAAACACAUUCACACAAAUGUACAUUUGUGUGAAUGUGUUUGAU19.312.122


Target Position: 8517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8517CAAAAGAGUAAAGAAAGAA90.7874685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8515-8537TACAAAAGAGTAAAGAAAGAAAAUUCUUUCUUUACUCUUUUGUACAAAAGAGUAAAGAAAGAAAAU19.110.321


Target Position: 8500, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8500GACACUAACCUUUUAUACA95.1671261

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8498-8520GTGACACTAACCTTTTATACAAAUGUAUAAAAGGUUAGUGUCACGACACUAACCUUUUAUACAAAU1.419.022


Target Position: 3502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3502GUAUGUGUUCAUGUAAAUU85.26651664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3500-3522ATGTATGTGTTCATGTAAATTTGAAUUUACAUGAACACAUACAUGUAUGUGUUCAUGUAAAUUUGU6.920.411


Target Position: 9623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9623CUAAGGUAACUGAUGUUAU87.70391207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9621-9643AGCTAAGGTAACTGATGTTATAAAUAACAUCAGUUACCUUAGCUCUAAGGUAACUGAUGUUAUAAU16.119.833


Target Position: 6723, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6723CCUUUUCAAUUUUUUAUUA89.6274861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3566741CCTTTTCAATTTTTTATTATAATAAAAAATTGAAAAGG0.908800.666600.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6721-6743TTCCTTTTCAATTTTTTATTACCUAAUAAAAAAUUGAAAAGGAACCUUUUCAAUUUUUUAUUACCU-9.712.221


Target Position: 6438, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6438CCUAAUUUCUUCAUCAUGA89.1952938

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6436-6458GTCCTAATTTCTTCATCATGAAGUCAUGAUGAAGAAAUUAGGACCCUAAUUUCUUCAUCAUGAAGU19.4-4.332


Target Position: 2697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697GAAUAAUUGGCUUGUAUAA98.564895

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2695-2717AGGAATAATTGGCTTGTATAATCUUAUACAAGCCAAUUAUUCCUGAAUAAUUGGCUUGUAUAAUCU8.5-10.322


Target Position: 10276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10276GUUGAAUACUGAUGUCUUU88.54631042

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10274-10296TTGTTGAATACTGATGTCTTTCTAAAGACAUCAGUAUUCAACAAGUUGAAUACUGAUGUCUUUCUU19.28.922


Target Position: 3066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066CUACACAUAAUUAUGAAUU78.78683355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086TTCTACACATAATTATGAATTCAAAUUCAUAAUUAUGUGUAGAACUACACAUAAUUAUGAAUUCAU8.720.423


Target Position: 9717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9717GUCCUUAUGGGGUUAAACU76.95163914

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9715-9737GCGTCCTTATGGGGTTAAACTTAAGUUUAACCCCAUAAGGACGCGUCCUUAUGGGGUUAAACUUAU8.219.933


Target Position: 7281, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7281GUUACUAAAUUAUUAUACA96.4733192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7279-7301CCGTTACTAAATTATTATACATCUGUAUAAUAAUUUAGUAACGGGUUACUAAAUUAUUAUACAUCU1.16.632


Target Position: 7018, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7018CAUAUACACUCAUAGACAA103.35318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7016-7038TACATATACACTCATAGACAAACUUGUCUAUGAGUGUAUAUGUACAUAUACACUCAUAGACAAACU20.38.222


Target Position: 2696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696GGAAUAAUUGGCUUGUAUA100.78544

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2694-2716CAGGAATAATTGGCTTGTATAATUAUACAAGCCAAUUAUUCCUGGGAAUAAUUGGCUUGUAUAAUU11.61.832


Target Position: 4420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4420GUUCUGAUGCGAUUUUUCU78.69343378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4418-4440CAGTTCTGATGCGATTTTTCTGTAGAAAAAUCGCAUCAGAACUGGUUCUGAUGCGAUUUUUCUGUU0.420.432


Target Position: 7859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7859GGACAAAAGUGAAGUUUUA100.21158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7857-7879AAGGACAAAAGTGAAGTTTTAGAUAAAACUUCACUUUUGUCCUUGGACAAAAGUGAAGUUUUAGAU3.214.922


Target Position: 2301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301GAUUUUCAAAUUAUUUAGA86.17221480

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2299-2321AAGATTTTCAAATTATTTAGAAGUCUAAAUAAUUUGAAAAUCUUGAUUUUCAAAUUAUUUAGAAGU-2.37.421


Target Position: 7788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7788CUUUGAUUUACUUAUUUUU81.21632631

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7786-7808CTCTTTGATTTACTTATTTTTAAAAAAAUAAGUAAAUCAAAGAGCUUUGAUUUACUUAUUUUUAAU-9.77.422


Target Position: 4981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4981CAACGAUUAGAAAAAUAUA100.20159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4979-5001GTCAACGATTAGAAAAATATAACUAUAUUUUUCUAAUCGUUGACCAACGAUUAGAAAAAUAUAACU-10.315.222


Target Position: 7940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7940GGCUUUAAAGUUUUUGACU78.90173328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7938-7960GTGGCTTTAAAGTTTTTGACTATAGUCAAAAACUUUAAAGCCACGGCUUUAAAGUUUUUGACUAUU14.913.732


Target Position: 5322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5322GUAAGUUUUUACAAAUUGU82.41472323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5320-5342TTGTAAGTTTTTACAAATTGTTTACAAUUUGUAAAAACUUACAAGUAAGUUUUUACAAAUUGUUUU4.24.922


Target Position: 1813, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813CAAUCAAGUCCCAUGAAAA102.05931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1811-1833ACCAATCAAGTCCCATGAAAAGAUUUUCAUGGGACUUGAUUGGUCAAUCAAGUCCCAUGAAAAGAU13.812.021


Target Position: 6625, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6625GGCAUAUUGGAUUGUUGUA92.1698520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6623-6645GGGGCATATTGGATTGTTGTATTUACAACAAUCCAAUAUGCCCCGGCAUAUUGGAUUGUUGUAUUU19.315.232


Target Position: 1957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957GUUUCCUAUAUUUGAAUAU80.41942855

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1955-1977CTGTTTCCTATATTTGAATATTAAUAUUCAAAUAUAGGAAACAGGUUUCCUAUAUUUGAAUAUUAU8.919.922


Target Position: 3045, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045GUUUAUAAAUUGAUUGUUA96.5722184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3043-3065CAGTTTATAAATTGATTGTTATTUAACAAUCAAUUUAUAAACUGGUUUAUAAAUUGAUUGUUAUUU14.8-7.512


Target Position: 7179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7179GCCAUUUGGCAGUUCAUUU80.1432950

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7177-7199CTGCCATTTGGCAGTTCATTTAAAAAUGAACUGCCAAAUGGCAGGCCAUUUGGCAGUUCAUUUAAU14.817.723


Target Position: 7475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7475GAUCUUUGCUCAAUAUAAA101.8237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7473-7495CAGATCTTTGCTCAATATAAATGUUUAUAUUGAGCAAAGAUCUGGAUCUUUGCUCAAUAUAAAUGU-8.012.032


Target Position: 9773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9773CAAUUGUUGCAGAUUUCUU86.32491452

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9771-9793ACCAATTGTTGCAGATTTCTTTTAAGAAAUCUGCAACAAUUGGUCAAUUGUUGCAGAUUUCUUUUU14.85.322


Target Position: 2464, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464GUUUUUUUUUGUUUUUUUU75.32294420

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2462-2484TTGTTTTTTTTTGTTTTTTTTTTAAAAAAAACAAAAAAAAACAAGUUUUUUUUUGUUUUUUUUUUU-11.3-11.300


Target Position: 7190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7190GUUCAUUUAAUAUACCAUU82.07392400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7188-7210CAGTTCATTTAATATACCATTTTAAUGGUAUAUUAAAUGAACUGGUUCAUUUAAUAUACCAUUUUU20.07.422


Target Position: 2444, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2444CAUUCUUUUUGUGGUUUUU77.66213686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2442-2464GTCATTCTTTTTGTGGTTTTTTGAAAAACCACAAAAAGAAUGACCAUUCUUUUUGUGGUUUUUUGU18.85.322


Target Position: 9548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9548GGAACAUGAGAUUUAUAAC85.4911605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6109566GGAACATGAGATTTATAACGTTATAAATCTCATGTTCC0.571700.276600.724100.750001.000001.00000


Target Position: 5619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5619CUUUUUUCUUUAACUACUA88.24351101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5617-5639CTCTTTTTTCTTTAACTACTAAAUAGUAGUUAAAGAAAAAAGAGCUUUUUUCUUUAACUACUAAAU17.60.722


Target Position: 666, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CACCAAAUACGAUAGAUCA96.1989208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
664-686TACACCAAATACGATAGATCAGTUGAUCUAUCGUAUUUGGUGUACACCAAAUACGAUAGAUCAGUU15.918.833


Target Position: 5919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5919CUUCCUUUCAUAUGCUUUA84.18471913

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5917-5939TTCTTCCTTTCATATGCTTTACTUAAAGCAUAUGAAAGGAAGAACUUCCUUUCAUAUGCUUUACUU18.518.722


Target Position: 5858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5858CAAUGAAUACUUUUUUCUU90.6378710

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5856-5878AACAATGAATACTTTTTTCTTACAAGAAAAAAGUAUUCAUUGUUCAAUGAAUACUUUUUUCUUACU5.57.222


Target Position: 8462, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8462GCAUAUUUGUAUCUUUUUA95.9389218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3748480GCATATTTGTATCTTTTTATAAAAAGATACAAATATGC0.516300.205400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8460-8482AGGCATATTTGTATCTTTTTATTUAAAAAGAUACAAAUAUGCCUGCAUAUUUGUAUCUUUUUAUUU5.5-1.822


Target Position: 2784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2784GGGAUAUGCUAGAAUUACU93.8661361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2782-2804CAGGGATATGCTAGAATTACTTCAGUAAUUCUAGCAUAUCCCUGGGGAUAUGCUAGAAUUACUUCU10.021.232


Target Position: 1228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GAUAGCAUAUUAUGAAUUA100.37650

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1226-1248TCGATAGCATATTATGAATTAAAUAAUUCAUAAUAUGCUAUCGAGAUAGCAUAUUAUGAAUUAAAU7.219.732


Target Position: 9355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9355CUUGUAAAGUUUUUGCUAA90.864670

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9353-9375ATCTTGTAAAGTTTTTGCTAAACUUAGCAAAAACUUUACAAGAUCUUGUAAAGUUUUUGCUAAACU19.77.222


Target Position: 2433, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433GCUUAAACAGUCAUUCUUU88.8247997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2431-2453GGGCTTAAACAGTCATTCTTTTTAAAGAAUGACUGUUUAAGCCCGCUUAAACAGUCAUUCUUUUUU12.04.932


Target Position: 8183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8183CUGAAAAAAAAUUUGAUGA80.35472877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8181-8203AGCTGAAAAAAAATTTGATGAGAUCAUCAAAUUUUUUUUCAGCUCUGAAAAAAAAUUUGAUGAGAU13.87.722


Target Position: 7156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7156GAGUACAUUAAUUUUCUUA95.0511270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7154-7176TGGAGTACATTAATTTTCTTAATUAAGAAAAUUAAUGUACUCCAGAGUACAUUAAUUUUCUUAAUU5.519.012


Target Position: 3112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3112CAUUUAUUUAGCAAGUUUU84.66691801

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3110-3132GCCATTTATTTAGCAAGTTTTTTAAAACUUGCUAAAUAAAUGGCCAUUUAUUUAGCAAGUUUUUUU10.3-10.322


Target Position: 9039, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9039CUAGUGAUGUAAAAAUAUU88.34181082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9037-9059AGCTAGTGATGTAAAAATATTTTAAUAUUUUUACAUCACUAGCUCUAGUGAUGUAAAAAUAUUUUU-10.320.322


Target Position: 3921, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3921CAAAUCCAAACUUGAAGAU76.80023954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3919-3941TACAAATCCAAACTTGAAGATCAAUCUUCAAGUUUGGAUUUGUACAAAUCCAAACUUGAAGAUCAU20.420.121


Target Position: 5282, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5282GGAAAUCUGCCUAAUUUUU83.28052120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5280-5302AAGGAAATCTGCCTAATTTTTCTAAAAAUUAGGCAGAUUUCCUUGGAAAUCUGCCUAAUUUUUCUU-9.714.812


Target Position: 7792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7792GAUUUACUUAUUUUUAAUU86.52811421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7790-7812TTGATTTACTTATTTTTAATTAAAAUUAAAAAUAAGUAAAUCAAGAUUUACUUAUUUUUAAUUAAU-9.74.621


Target Position: 8601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8601GAAUAAAAAAUGUUCAUAU95.3114255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8599-8621CAGAATAAAAAATGTTCATATCTAUAUGAACAUUUUUUAUUCUGGAAUAAAAAAUGUUCAUAUCUU16.1-9.722


Target Position: 8331, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8331GGUAACAUGCAUGAGUUUU78.813346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8329-8351TAGGTAACATGCATGAGTTTTGAAAAACUCAUGCAUGUUACCUAGGUAACAUGCAUGAGUUUUGAU19.214.633


Target Position: 8508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8508CCUUUUAUACAAAAGAGUA94.0391349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8506-8528AACCTTTTATACAAAAGAGTAAAUACUCUUUUGUAUAAAAGGUUCCUUUUAUACAAAAGAGUAAAU17.7-4.332


Target Position: 3253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253GCAAAUAAUUAUUAUGUCU88.06491139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3251-3273CAGCAAATAATTATTATGTCTGAAGACAUAAUAAUUAUUUGCUGGCAAAUAAUUAUUAUGUCUGAU16.1-1.422


Target Position: 5301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5301CUUGAAAGCUAAAUUUUCU82.08092398

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5299-5321TTCTTGAAAGCTAAATTTTCTTTAGAAAAUUUAGCUUUCAAGAACUUGAAAGCUAAAUUUUCUUUU0.412.222


Target Position: 5733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5733CUGUACAUAAAAUAUGUCU78.07423566

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5731-5753CACTGTACATAAAATATGTCTTCAGACAUAUUUUAUGUACAGUGCUGUACAUAAAAUAUGUCUUCU16.020.412


Target Position: 3946, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3946GGUUCUACAGUUCAUAACA95.142265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3944-3966ATGGTTCTACAGTTCATAACATTUGUUAUGAACUGUAGAACCAUGGUUCUACAGUUCAUAACAUUU16.121.432


Target Position: 7798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7798CUUAUUUUUAAUUAAAGAU79.48753150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7796-7818TACTTATTTTTAATTAAAGATGGAUCUUUAAUUAAAAAUAAGUACUUAUUUUUAAUUAAAGAUGGU7.1-9.711


Target Position: 5821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5821CAAGUAUCUCUUUAGAUAU94.1654334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5819-5841ACCAAGTATCTCTTTAGATATCTAUAUCUAAAGAGAUACUUGGUCAAGUAUCUCUUUAGAUAUCUU8.414.522


Target Position: 10532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10532UGUUAAAAAAAAAAAAAAA81.20772633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86110550TGTTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAACA0.984000.236300.706900.750001.000001.00000


Target Position: 4773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4773CAUGCUUUCUAUCACAUUU88.20871116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4771-4793GCCATGCTTTCTATCACATTTCTAAAUGUGAUAGAAAGCAUGGCCAUGCUUUCUAUCACAUUUCUU20.518.522


Target Position: 9742, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9742GAAAUUUACAUUUUUCAUA91.9011550

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9740-9762CTGAAATTTACATTTTTCATAGTUAUGAAAAAUGUAAAUUUCAGGAAAUUUACAUUUUUCAUAGUU7.4-9.722


Target Position: 3251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251CAGCAAAUAAUUAUUAUGU82.08522396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3249-3271TGCAGCAAATAATTATTATGTCTACAUAAUAAUUAUUUGCUGCACAGCAAAUAAUUAUUAUGUCUU0.018.522


Target Position: 8454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8454CUUGAAAGGCAUAUUUGUA91.7587565

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8452-8474GACTTGAAAGGCATATTTGTATCUACAAAUAUGCCUUUCAAGUCCUUGAAAGGCAUAUUUGUAUCU6.912.222


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549CCCAUUUUUGUCCUCAUAA84.41071870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2592567CCCATTTTTGTCCTCATAATTATGAGGACAAAAATGGG0.649700.227400.956901.000001.000001.00000


Target Position: 7459, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7459GAUUGAAGGUGAUUCAGAU100.36951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7457-7479CTGATTGAAGGTGATTCAGATCTAUCUGAAUCACCUUCAAUCAGGAUUGAAGGUGAUUCAGAUCUU20.412.023


Target Position: 8972, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8972GUUAACACGUUUAAGGUAU77.85663637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8970-8992AAGTTAACACGTTTAAGGTATTTAUACCUUAAACGUGUUAACUUGUUAACACGUUUAAGGUAUUUU19.814.733


Target Position: 4560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4560GAUGAUGUUUUUUGUAUUU86.37641442

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4558-4580GAGATGATGTTTTTTGTATTTTAAAAUACAAAAAACAUCAUCUCGAUGAUGUUUUUUGUAUUUUAU6.920.521


Target Position: 4791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4791UCUAAGAUGAGUAAUAUUU74.78214594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7934809TCTAAGATGAGTAATATTTAAATATTACTCATCTTAGA0.487200.091100.724100.750001.000001.00000


Target Position: 8732, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8732CCUUUGUUUUAAUAUAUAA98.2664106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8730-8752AGCCTTTGTTTTAATATATAATGUUAUAUAUUAAAACAAAGGCUCCUUUGUUUUAAUAUAUAAUGU-6.410.322


Target Position: 7101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7101GGUAAAAUGUUCUUAAUUU93.6801375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7099-7121CTGGTAAAATGTTCTTAATTTGTAAAUUAAGAACAUUUUACCAGGGUAAAAUGUUCUUAAUUUGUU-4.3-0.322


Target Position: 5943, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5943CUAAAUCUAUUAUAUUCAU89.8717817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5941-5963TGCTAAATCTATTATATTCATTGAUGAAUAUAAUAGAUUUAGCACUAAAUCUAUUAUAUUCAUUGU8.76.922


Target Position: 2140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140GUAUUGUGCUGUUUAUAUA100.55147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2138-2160CAGTATTGTGCTGTTTATATACAUAUAUAAACAGCACAAUACUGGUAUUGUGCUGUUUAUAUACAU-8.013.532


Target Position: 8728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8728GCAGCCUUUGUUUUAAUAU80.63412773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7998746GCAGCCTTTGTTTTAATATATATTAAAACAAAGGCTGC0.500200.090700.810301.000001.000001.00000


Target Position: 3953, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3953CAGUUCAUAACAUUUUGAA90.6209713

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3951-3973TACAGTTCATAACATTTTGAAGGUUCAAAAUGUUAUGAACUGUACAGUUCAUAACAUUUUGAAGGU7.419.222


Target Position: 10294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10294UCUCCCACCUACACCAAAU72.39645361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66610312TCTCCCACCTACACCAAATATTTGGTGTAGGTGGGAGA0.370500.358600.715500.750001.000001.00000


Target Position: 10530, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10530CAUGUUAAAAAAAAAAAAA88.38791070

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10528-10550ACCATGTTAAAAAAAAAAAAAAAUUUUUUUUUUUUUAACAUGGUCAUGUUAAAAAAAAAAAAAAAU-11.36.900


Target Position: 4676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4676GAAUUUUUGUCUUUAUUUA97.7175131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4674-4696TTGAATTTTTGTCTTTATTTAAAUAAAUAAAGACAAAAAUUCAAGAAUUUUUGUCUUUAUUUAAAU-9.7-12.012


Target Position: 5852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5852CAUGAACAAUGAAUACUUU93.0124441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5850-5872GACATGAACAATGAATACTTTTTAAAGUAUUCAUUGUUCAUGUCCAUGAACAAUGAAUACUUUUUU4.620.522


Target Position: 6753, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6753GUUUAGACUACACUUUGUA90.2965749

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6751-6773TTGTTTAGACTACACTTTGTAGGUACAAAGUGUAGUCUAAACAAGUUUAGACUACACUUUGUAGGU17.814.632


Target Position: 6044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6044GUUUUUUGUUUUUUUUUUU75.03674516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6042-6064TTGTTTTTTGTTTTTTTTTTTTTAAAAAAAAAAACAAAAAACAAGUUUUUUGUUUUUUUUUUUUUU-11.3-2.900


Target Position: 8470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8470GUAUCUUUUUAUUAGUGAU92.2005515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8468-8490TTGTATCTTTTTATTAGTGATAGAUCACUAAUAAAAAGAUACAAGUAUCUUUUUAUUAGUGAUAGU20.36.923


Target Position: 6862, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6862GAUAGCAUUUACGAUAAGA90.2291763

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6860-6882ATGATAGCATTTACGATAAGAACUCUUAUCGUAAAUGCUAUCAUGAUAGCAUUUACGAUAAGAACU13.719.732


Target Position: 4979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4979GUCAACGAUUAGAAAAAUA89.8241825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9074997GTCAACGATTAGAAAAATATATTTTTCTAATCGTTGAC0.290400.113500.775900.750001.000001.00000


Target Position: 10362, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10362CUUACAUGUCCUGUGAUUU79.16293241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10360-10382TGCTTACATGTCCTGTGATTTCTAAAUCACAGGACAUGUAAGCACUUACAUGUCCUGUGAUUUCUU20.513.531


Target Position: 7473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7473CAGAUCUUUGCUCAAUAUA88.32631089

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7471-7493TTCAGATCTTTGCTCAATATAAAUAUAUUGAGCAAAGAUCUGAACAGAUCUUUGCUCAAUAUAAAU8.719.113


Target Position: 3578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578GGAACUUUUCUUAGUCUUU85.72211555

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3576-3598CAGGAACTTTTCTTAGTCTTTGGAAAGACUAAGAAAAGUUCCUGGGAACUUUUCUUAGUCUUUGGU18.913.322


Target Position: 5588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5588AGCUUCCCAUAUAUACCUU78.16733534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8805606AGCTTCCCATATATACCTTAAGGTATATATGGGAAGCT0.335400.238600.715500.750001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496GCAGAAUGGGCAGGAAGAA85.14761701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997514GCAGAATGGGCAGGAAGAATTCTTCCTGCCCATTCTGC0.603200.306800.681001.000001.000001.00000


Target Position: 7786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7786CUCUUUGAUUUACUUAUUU79.97873002

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7784-7806TGCTCTTTGATTTACTTATTTTTAAAUAAGUAAAUCAAAGAGCACUCUUUGAUUUACUUAUUUUUU4.620.422


Target Position: 6391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6391CUUUGAACUUAUUAACAAA99.531371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6389-6411TCCTTTGAACTTATTAACAAAAAUUUGUUAAUAAGUUCAAAGGACUUUGAACUUAUUAACAAAAAU7.214.922


Target Position: 2355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355CUUUUACCAAAAAUAAACU74.9914532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2353-2375GCCTTTTACCAAAAATAAACTCTAGUUUAUUUUUGGUAAAAGGCCUUUUACCAAAAAUAAACUCUU-0.314.022


Target Position: 6468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6468CAAAUUGAUCAAUCAUUUU85.37881633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6466-6488TTCAAATTGATCAATCATTTTAAAAAAUGAUUGAUCAAUUUGAACAAAUUGAUCAAUCAUUUUAAU7.27.422


Target Position: 4264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4264CUUGAGAACUUGUAAUGGU78.19533523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4262-4284TACTTGAGAACTTGTAATGGTGTACCAUUACAAGUUCUCAAGUACUUGAGAACUUGUAAUGGUGUU20.020.423


Target Position: 8340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8340CAUGAGUUUUGAAUUUUUU84.73481786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8338-8360TGCATGAGTTTTGAATTTTTTTAAAAAAAUUCAAAACUCAUGCACAUGAGUUUUGAAUUUUUUUAU-12.019.221


Target Position: 7878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7878GAAUUAUAAAAGUACUUAA104.05614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7876-7898TAGAATTATAAAAGTACTTAAATUUAAGUACUUUUAUAAUUCUAGAAUUAUAAAAGUACUUAAAUU14.3-8.032


Target Position: 4591, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4591CCUGAUUUUUUUUUUGUUU76.23574131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4364609CCTGATTTTTTTTTTGTTTAAACAAAAAAAAAATCAGG0.706100.157400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4589-4611GGCCTGATTTTTTTTTTGTTTTCAAACAAAAAAAAAAUCAGGCCCCUGAUUUUUUUUUUGUUUUCU5.612.011


Target Position: 7028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7028CAUAGACAAACUUAACAGU83.46112077

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7026-7048CTCATAGACAAACTTAACAGTTGACUGUUAAGUUUGUCUAUGAGCAUAGACAAACUUAACAGUUGU11.820.322


Target Position: 5339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5339GUUUAAUACCUAGUUGUAU84.46451849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5337-5359TTGTTTAATACCTAGTTGTATTTAUACAACUAGGUAUUAAACAAGUUUAAUACCUAGUUGUAUUUU19.0-7.523


Target Position: 9490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9490GUCAACAUUUCUGAUACUU75.84364248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9488-9510CTGTCAACATTTCTGATACTTATAAGUAUCAGAAAUGUUGACAGGUCAACAUUUCUGAUACUUAUU20.320.523


Target Position: 2817, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2817CCUUUUUAAAAAAGCUAAU75.81624259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2622835CCTTTTTAAAAAAGCTAATATTAGCTTTTTTAAAAAGG0.602600.508800.836201.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2815-2837TCCCTTTTTAAAAAAGCTAATCTAUUAGCUUUUUUAAAAAGGGACCUUUUUAAAAAAGCUAAUCUU18.3-3.821


Target Position: 8345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8345GUUUUGAAUUUUUUUAAAA89.1232946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8343-8365GAGTTTTGAATTTTTTTAAAAACUUUUAAAAAAAUUCAAAACUCGUUUUGAAUUUUUUUAAAAACU-9.17.711


Target Position: 9891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9891GUGAAUGUUGUGUUAAAAU84.22581905

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9889-9911CCGTGAATGTTGTGTTAAAATGAAUUUUAACACAACAUUCACGGGUGAAUGUUGUGUUAAAAUGAU0.020.533


Target Position: 7889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7889GUACUUAAAUAUUAUAUAU98.0268117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7887-7909AAGTACTTAAATATTATATATTTAUAUAUAAUAUUUAAGUACUUGUACUUAAAUAUUAUAUAUUUU-5.96.611


Target Position: 5077, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5077GAUUUGAGCUAUAUCAGUU95.8091224

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5075-5097TAGATTTGAGCTATATCAGTTATAACUGAUAUAGCUCAAAUCUAGAUUUGAGCUAUAUCAGUUAUU20.312.033


Target Position: 6398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6398CUUAUUAACAAAAAAGGAA84.89291756

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6396-6418AACTTATTAACAAAAAAGGAACAUUCCUUUUUUGUUAAUAAGUUCUUAUUAACAAAAAAGGAACAU18.7-7.522


Target Position: 5649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5649CAUUUAUUCAGUGUUAGAU85.20951685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5647-5669AGCATTTATTCAGTGTTAGATACAUCUAACACUGAAUAAAUGCUCAUUUAUUCAGUGUUAGAUACU20.3-10.332


Target Position: 6634, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6634GAUUGUUGUAUUUAAGACA94.3427323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6632-6654TGGATTGTTGTATTTAAGACAGTUGUCUUAAAUACAACAAUCCAGAUUGUUGUAUUUAAGACAGUU14.612.132


Target Position: 3350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350CUUUUCAUAAAUUUUCAUA84.49061843

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3348-3370GTCTTTTCATAAATTTTCATATTUAUGAAAAUUUAUGAAAAGACCUUUUCAUAAAUUUUCAUAUUU7.47.422


Target Position: 10213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10213CUUUUUUAUUUUUAUUAAA88.8476992

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10211-10233TCCTTTTTTATTTTTATTAAACAUUUAAUAAAAAUAAAAAAGGACUUUUUUAUUUUUAUUAAACAU-7.5-9.111


Target Position: 10521, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10521GUUGUUUACCAUGUUAAAA85.47281609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10519-10541GAGTTGTTTACCATGTTAAAAAAUUUUAACAUGGUAAACAACUCGUUGUUUACCAUGUUAAAAAAU7.27.2


Target Position: 5903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5903GACAUAUCAAACAUUUCUU86.49881427

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5901-5923TAGACATATCAAACATTTCTTCCAAGAAAUGUUUGAUAUGUCUAGACAUAUCAAACAUUUCUUCCU12.016.022


Target Position: 7941, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7941GCUUUAAAGUUUUUGACUA94.4796312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7939-7961TGGCTTTAAAGTTTTTGACTATTUAGUCAAAAACUUUAAAGCCAGCUUUAAAGUUUUUGACUAUUU19.2-3.832


Target Position: 689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689GAUACAACAGGCCUUUACA94.0593346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
687-709GGGATACAACAGGCCTTTACAGCUGUAAAGGCCUGUUGUAUCCCGAUACAACAGGCCUUUACAGCU18.614.632


Target Position: 7097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7097UCCUGGUAAAAUGUUCUUA74.11044803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9137115TCCTGGTAAAATGTTCTTATAAGAACATTTTACCAGGA0.363000.077100.836200.750001.000001.00000


Target Position: 10211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10211UCCUUUUUUAUUUUUAUUA73.72164950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73310229TCCTTTTTTATTTTTATTATAATAAAAATAAAAAAGGA0.528000.361900.836200.750001.000001.00000


Target Position: 3071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071CAUAAUUAUGAAUUCAGAA97.4578141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3069-3091CACATAATTATGAATTCAGAATTUUCUGAAUUCAUAAUUAUGUGCAUAAUUAUGAAUUCAGAAUUU20.4-8.022


Target Position: 7755, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7755CAGUUAACAGCUCUUAGUU86.73981370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7753-7775AACAGTTAACAGCTCTTAGTTTCAACUAAGAGCUGUUAACUGUUCAGUUAACAGCUCUUAGUUUCU18.912.932


Target Position: 5890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5890GCAUUGAUACUUAGACAUA99.06683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5888-5910AGGCATTGATACTTAGACATATCUAUGUCUAAGUAUCAAUGCCUGCAUUGAUACUUAGACAUAUCU20.313.633


Target Position: 6688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6688GUCAGAAUCCUGCUAUUGA89.4942881

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6686-6708TAGTCAGAATCCTGCTATTGAGTUCAAUAGCAGGAUUCUGACUAGUCAGAAUCCUGCUAUUGAGUU19.720.432


Target Position: 9324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9324CUUAAGAAAUUCAUUUGCU76.34014091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9322-9344AACTTAAGAAATTCATTTGCTCTAGCAAAUGAAUUUCUUAAGUUCUUAAGAAAUUCAUUUGCUCUU20.07.123


Target Position: 6214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6214GCUAAUUUUUUGUAUUUUU83.76662004

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6212-6234CGGCTAATTTTTTGTATTTTTAGAAAAAUACAAAAAAUUAGCCGGCUAAUUUUUUGUAUUUUUAGU-0.3-4.300


Target Position: 10381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10381CUGGUCAAUUUUUAUAUAU83.17442146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69510399CTGGTCAATTTTTATATATATATATAAAAATTGACCAG0.359300.154600.741400.750001.000001.00000


Target Position: 6039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6039GCCUUGUUUUUUGUUUUUU71.24915741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1146057GCCTTGTTTTTTGTTTTTTAAAAAACAAAAAACAAGGC0.735700.473501.000001.000001.000001.00000


Target Position: 3312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3312CAUCUUAGUAGAAAUGGAA95.8079225

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3310-3332TGCATCTTAGTAGAAATGGAAAAUUCCAUUUCUACUAAGAUGCACAUCUUAGUAGAAAUGGAAAAU20.111.622


Target Position: 3122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3122GCAAGUUUUUUAGCUUAUA88.33971083

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3120-3142TAGCAAGTTTTTTAGCTTATAAGUAUAAGCUAAAAAACUUGCUAGCAAGUUUUUUAGCUUAUAAGU18.310.322


Target Position: 3890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3890GGUAUUAAUGCUUUAUACA95.4931245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3888-3910TAGGTATTAATGCTTTATACAGAUGUAUAAAGCAUUAAUACCUAGGUAUUAAUGCUUUAUACAGAU1.41.432


Target Position: 4590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4590GCCUGAUUUUUUUUUUGUU82.11052390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4414608GCCTGATTTTTTTTTTGTTAACAAAAAAAAAATCAGGC0.739000.156600.853401.000001.000001.00000


Target Position: 824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824GAACUCAAGGCAAUUGAAA89.3471910

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
822-844ATGAACTCAAGGCAATTGAAAACUUUCAAUUGCCUUGAGUUCAUGAACUCAAGGCAAUUGAAAACU7.419.222


Target Position: 8791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8791CUAAAAAAGAAAGAAAAGA77.57093721

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8789-8811ACCTAAAAAAGAAAGAAAAGACAUCUUUUCUUUCUUUUUUAGGUCUAAAAAAGAAAGAAAAGACAU10.3-9.121


Target Position: 7700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7700CUUUUAGAUUUUUCUUCAA89.9799800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7698-7720GGCTTTTAGATTTTTCTTCAAAAUUGAAGAAAAAUCUAAAAGCCCUUUUAGAUUUUUCUUCAAAAU20.47.121


Target Position: 8000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8000GUUCUAUAUUAAGUUCUAU89.8326823

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7998-8020TGGTTCTATATTAAGTTCTATCCAUAGAACUUAAUAUAGAACCAGUUCUAUAUUAAGUUCUAUCCU18.98.432


Target Position: 863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863CUUAAAAAGGAUGAAGUAU78.75973361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
861-883ATCTTAAAAAGGATGAAGTATGTAUACUUCAUCCUUUUUAAGAUCUUAAAAAGGAUGAAGUAUGUU20.3-9.122


Target Position: 3492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492GUGUGUAUAUGUAUGUGUU92.8294454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3490-3512TTGTGTGTATATGTATGTGTTCAAACACAUACAUAUACACACAAGUGUGUAUAUGUAUGUGUUCAU20.420.401


Target Position: 3448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448CAUUUGGUGGUUUUCUAUU80.11112960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3446-3468AACATTTGGTGGTTTTCTATTGGAAUAGAAAACCACCAAAUGUUCAUUUGGUGGUUUUCUAUUGGU6.918.822


Target Position: 4673, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4673GUUGAAUUUUUGUCUUUAU86.72071373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4671-4693TTGTTGAATTTTTGTCTTTATTTAUAAAGACAAAAAUUCAACAAGUUGAAUUUUUGUCUUUAUUUU14.67.411


Target Position: 5348, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5348CUAGUUGUAUUUUUUACCU75.99414204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5346-5368ACCTAGTTGTATTTTTTACCTTAAGGUAAAAAAUACAACUAGGUCUAGUUGUAUUUUUUACCUUAU14.019.021


Target Position: 9422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9422GUUCUUGUGAUUUAUCCUU77.14913852

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9420-9442GTGTTCTTGTGATTTATCCTTACAAGGAUAAAUCACAAGAACACGUUCUUGUGAUUUAUCCUUACU19.919.222


Target Position: 9218, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9218CUUUUAGCAGAGUUUUGUA91.4368603

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9216-9238AACTTTTAGCAGAGTTTTGTATAUACAAAACUCUGCUAAAAGUUCUUUUAGCAGAGUUUUGUAUAU13.313.722


Target Position: 2795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2795GAAUUACUUCCACAUAUUU90.8236677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2793-2815TAGAATTACTTCCACATATTTATAAAUAUGUGGAAGUAAUUCUAGAAUUACUUCCACAUAUUUAUU6.74.622


Target Position: 8895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8895GUCUGAAAACAGAUUUCAA99.124378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8893-8915TTGTCTGAAAACAGATTTCAAGAUUGAAAUCUGUUUUCAGACAAGUCUGAAAACAGAUUUCAAGAU16.320.412


Target Position: 2076, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076CAAAGGUUUAUUAAUAACA88.37941073

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2074-2096CCCAAAGGTTTATTAATAACAGTUGUUAUUAAUAAACCUUUGGGCAAAGGUUUAUUAAUAACAGUU1.417.332


Target Position: 6213, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6213GGCUAAUUUUUUGUAUUUU83.13952158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9666231GGCTAATTTTTTGTATTTTAAAATACAAAAAATTAGCC0.274100.110401.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6211-6233TCGGCTAATTTTTTGTATTTTTAAAAAUACAAAAAAUUAGCCGAGGCUAAUUUUUUGUAUUUUUAU6.913.600


Target Position: 7155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7155GGAGUACAUUAAUUUUCUU93.9425355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5947173GGAGTACATTAATTTTCTTAAGAAAATTAATGTACTCC0.465600.178100.732801.000001.000001.00000


Target Position: 4074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4074CUUAAUUUAACAAGCUUUU71.43855677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4072-4094TACTTAATTTAACAAGCTTTTGTAAAAGCUUGUUAAAUUAAGUACUUAAUUUAACAAGCUUUUGUU17.0-9.722


Target Position: 7990, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7990CAUAUUUCUGGUUCUAUAU87.85331180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7988-8010GCCATATTTCTGGTTCTATATTAAUAUAGAACCAGAAAUAUGGCCAUAUUUCUGGUUCUAUAUUAU8.41.822


Target Position: 5530, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5530GCUAGUUGAAAUCAAAUAA93.428393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5528-5550TTGCTAGTTGAAATCAAATAAAAUUAUUUGAUUUCAACUAGCAAGCUAGUUGAAAUCAAAUAAAAU8.916.422


Target Position: 10376, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10376GAUUUCUGGUCAAUUUUUA92.3833495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10374-10396GTGATTTCTGGTCAATTTTTATAUAAAAAUUGACCAGAAAUCACGAUUUCUGGUCAAUUUUUAUAU-12.012.022


Target Position: 6477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6477CAAUCAUUUUAAUUUUACA98.3209104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6475-6497ATCAATCATTTTAATTTTACAAAUGUAAAAUUAAAAUGAUUGAUCAAUCAUUUUAAUUUUACAAAU-0.37.222


Target Position: 5160, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5160CAGCCACUGUGAUGGAUAU91.4275604

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5516019CAGCCACTGTGATGGATAT1/1/0/0100.00SMAD2NM_001135937.1+NM_001003652.2+NM_005901.41+1+1NANANA18:45364824..45364842(-)00SMAD2(0.002)


Target Position: 1824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824CAUGAAAAGACUUAAUGUA96.5238189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1822-1844CCCATGAAAAGACTTAATGTAACUACAUUAAGUCUUUUCAUGGGCAUGAAAAGACUUAAUGUAACU6.97.422


Target Position: 3103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103GGGAAAAGCCAUUUAUUUA97.389146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3101-3123GGGGGAAAAGCCATTTATTTAGCUAAAUAAAUGGCUUUUCCCCCGGGAAAAGCCAUUUAUUUAGCU-9.718.722


Target Position: 10529, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10529CCAUGUUAAAAAAAAAAAA88.8705986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
33010547CCATGTTAAAAAAAAAAAATTTTTTTTTTTTAACATGG0.970800.193500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10527-10549TACCATGTTAAAAAAAAAAAAAAUUUUUUUUUUUUAACAUGGUACCAUGUUAAAAAAAAAAAAAAU-11.313.510


Target Position: 9967, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9967GCAGUUUCUCUCAAUUGUA94.94277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9965-9987GAGCAGTTTCTCTCAATTGTAGCUACAAUUGAGAGAAACUGCUCGCAGUUUCUCUCAAUUGUAGCU12.119.222


Target Position: 10445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10445GCUCUUACCUGUGUUAACA88.68081021

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10443-10465TTGCTCTTACCTGTGTTAACAGCUGUUAACACAGGUAAGAGCAAGCUCUUACCUGUGUUAACAGCU14.718.922


Target Position: 4474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4474CACCUAUUGAGCAGUUAUA93.1713426

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4472-4494AACACCTATTGAGCAGTTATACCUAUAACUGCUCAAUAGGUGUUCACCUAUUGAGCAGUUAUACCU11.618.523


Target Position: 5411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5411UGUCAAAUGCUUUCCCUUU73.03715164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7465429TGTCAAATGCTTTCCCTTTAAAGGGAAAGCATTTGACA0.828000.247300.706900.750001.000001.00000


Target Position: 7831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7831CAAUGAAAUCCGUAAUAUA106.2554

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7829-7851AACAATGAAATCCGTAATATATTUAUAUUACGGAUUUCAUUGUUCAAUGAAAUCCGUAAUAUAUUU1.17.422


Target Position: 6626, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6626GCAUAUUGGAUUGUUGUAU80.52632815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6624-6646GGGCATATTGGATTGTTGTATTTAUACAACAAUCCAAUAUGCCCGCAUAUUGGAUUGUUGUAUUUU20.45.622


Target Position: 10514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10514CAUUUGAGUUGUUUACCAU92.7399461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10512-10534GCCATTTGAGTTGTTTACCATGTAUGGUAAACAACUCAAAUGGCCAUUUGAGUUGUUUACCAUGUU20.012.032


Target Position: 4190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4190GUAAAUGUCCUAGGUAAUA86.511424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4188-4210GAGTAAATGTCCTAGGTAATACCUAUUACCUAGGACAUUUACUCGUAAAUGUCCUAGGUAAUACCU18.56.933


Target Position: 7150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7150CCAUUGGAGUACAUUAAUU88.75231008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9057168CCATTGGAGTACATTAATTAATTAATGTACTCCAATGG0.455400.078100.836201.000001.000001.00000


Target Position: 5040, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5040CUCUUUUUAUCCUACUUUA92.8393453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5038-5060TGCTCTTTTTATCCTACTTTAAAUAAAGUAGGAUAAAAAGAGCACUCUUUUUAUCCUACUUUAAAU9.85.532


Target Position: 4921, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4921CUUUUGGAAAGAGUUUCAU71.73995576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4919-4941TTCTTTTGGAAAGAGTTTCATTGAUGAAACUCUUUCCAAAAGAACUUUUGGAAAGAGUUUCAUUGU19.220.122


Target Position: 5465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5465CUUGUCAAUUUAAGACUAA88.71491015

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5463-5485CCCTTGTCAATTTAAGACTAAGAUUAGUCUUAAAUUGACAAGGGCUUGUCAAUUUAAGACUAAGAU18.920.533


Target Position: 7336, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7336CUUUGUUGUUGUUGAUAAU87.05351321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7334-7356AACTTTGTTGTTGTTGATAATACAUUAUCAACAACAACAAAGUUCUUUGUUGUUGUUGAUAAUACU8.912.221


Target Position: 10384, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10384GUCAAUUUUUAUAUAUAUU87.08291316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
85410402GTCAATTTTTATATATATTAATATATATAAAAATTGAC0.349200.205200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10382-10404TGGTCAATTTTTATATATATTTGAAUAUAUAUAAAAAUUGACCAGUCAAUUUUUAUAUAUAUUUGU-6.47.421


Target Position: 2508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508GAAACCAUACUGAAAACCU80.25032907

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2506-2528AGGAAACCATACTGAAAACCTTTAGGUUUUCAGUAUGGUUUCCUGAAACCAUACUGAAAACCUUUU21.218.821


Target Position: 10264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10264CAAGUUAAAAUUGUUGAAU77.43183765

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10262-10284TTCAAGTTAAAATTGTTGAATACAUUCAACAAUUUUAACUUGAACAAGUUAAAAUUGUUGAAUACU20.54.912


Target Position: 5923, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5923CUUUCAUAUGCUUUACUUU84.81821768

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5921-5943TCCTTTCATATGCTTTACTTTGCAAAGUAAAGCAUAUGAAAGGACUUUCAUAUGCUUUACUUUGCU4.98.922


Target Position: 2525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525CUUUCCAAGCCUCUUUUUU69.91376129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2523-2545ACCTTTCCAAGCCTCTTTTTTCCAAAAAAGAGGCUUGGAAAGGUCUUUCCAAGCCUCUUUUUUCCU5.520.122


Target Position: 8963, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8963CUUCUUAAAGUUAACACGU69.51556246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8961-8983CTCTTCTTAAAGTTAACACGTTTACGUGUUAACUUUAAGAAGAGCUUCUUAAAGUUAACACGUUUU21.07.132


Target Position: 5386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5386CUUGAUUUGUCUGUCUUUU75.3094424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5384-5406TGCTTGATTTGTCTGTCTTTTAAAAAAGACAGACAAAUCAAGCACUUGAUUUGUCUGUCUUUUAAU19.27.431


Target Position: 10259, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10259GUUUUCAAGUUAAAAUUGU73.34395070

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10257-10279TGGTTTTCAAGTTAAAATTGTTGACAAUUUUAACUUGAAAACCAGUUUUCAAGUUAAAAUUGUUGU-3.37.731


Target Position: 7482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7482GCUCAAUAUAAAUGGAUUU83.6632021

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7480-7502TTGCTCAATATAAATGGATTTTCAAAUCCAUUUAUAUUGAGCAAGCUCAAUAUAAAUGGAUUUUCU20.113.432


Target Position: 10152, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10152GAUAUUAAAUGUGUUCUUU86.81051360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10150-10172GAGATATTAAATGTGTTCTTTGTAAAGAACACAUUUAAUAUCUCGAUAUUAAAUGUGUUCUUUGUU19.2-8.022


Target Position: 5470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5470CAAUUUAAGACUAAGACUU84.73891784

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5468-5490GTCAATTTAAGACTAAGACTTTGAAGUCUUAGUCUUAAAUUGACCAAUUUAAGACUAAGACUUUGU18.9-9.722


Target Position: 7545, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7545GGAGUAUAUUAACUUAACU93.2832414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7543-7565CTGGAGTATATTAACTTAACTTCAGUUAAGUUAAUAUACUCCAGGGAGUAUAUUAACUUAACUUCU12.915.822


Target Position: 5173, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5173GGAUAUUGAAUAAUAAAAA100.3452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3945191GGATATTGAATAATAAAAATTTTTATTATTCAATATCC0.503400.296100.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5171-5193ATGGATATTGAATAATAAAAAGAUUUUUAUUAUUCAAUAUCCAUGGAUAUUGAAUAAUAAAAAGAU-9.78.722


Target Position: 8054, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8054GCAUUUGUCUGUAGCAAUA96.2941199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8052-8074TAGCATTTGTCTGTAGCAATAGAUAUUGCUACAGACAAAUGCUAGCAUUUGUCUGUAGCAAUAGAU19.712.122


Target Position: 7005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7005GAAUUUAUAUAUACAUAUA109.7381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7003-7025ATGAATTTATATATACATATACAUAUAUGUAUAUAUAAAUUCAUGAAUUUAUAUAUACAUAUACAU8.2-10.312


Target Position: 5493, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5493GGUAAAACAAACAAACAAA97.5842134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3455511GGTAAAACAAACAAACAAATTTGTTTGTTTGTTTTACC0.538300.400500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5491-5513AAGGTAAAACAAACAAACAAACAUUUGUUUGUUUGUUUUACCUUGGUAAAACAAACAAACAAACAU12.28.210


Target Position: 9321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9321GAACUUAAGAAAUUCAUUU86.84711350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9319-9341TTGAACTTAAGAAATTCATTTGCAAAUGAAUUUCUUAAGUUCAAGAACUUAAGAAAUUCAUUUGCU7.24.922


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231AGCAUAUUAUGAAUUAAAU87.42561257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631249AGCATATTATGAATTAAATATTTAATTCATAATATGCT0.375000.160300.844800.750001.000001.00000


Target Position: 5412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5412GUCAAAUGCUUUCCCUUUU75.06124505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7195430GTCAAATGCTTTCCCTTTTAAAAGGGAAAGCATTTGAC0.805200.249000.819000.750001.000001.00000


Target Position: 5882, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5882GAUCGAAGGCAUUGAUACU89.8917815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5880-5902CTGATCGAAGGCATTGATACTTAAGUAUCAAUGCCUUCGAUCAGGAUCGAAGGCAUUGAUACUUAU16.121.033


Target Position: 2028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028GAUUUUAAAGACUUAAUGA95.5718241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2026-2048AAGATTTTAAAGACTTAATGATGUCAUUAAGUCUUUAAAAUCUUGAUUUUAAAGACUUAAUGAUGU3.5-9.722


Target Position: 2638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638GGAUACAGUAAGAAUUCAU93.2218421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2636-2658TGGGATACAGTAAGAATTCATATAUGAAUUCUUACUGUAUCCCAGGAUACAGUAAGAAUUCAUAUU16.320.322


Target Position: 2353, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353GCCUUUUACCAAAAAUAAA89.7914829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112371GCCTTTTACCAAAAATAAATTTATTTTTGGTAAAAGGC0.354500.213001.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2351-2373CTGCCTTTTACCAAAAATAAACTUUUAUUUUUGGUAAAAGGCAGGCCUUUUACCAAAAAUAAACUU-9.711.002