siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 7697  
Biltr, Rnaxs 310   311   313   562   563   627   1330   1463   1758   1763   1867   1871   2191   2281   2282   2786   4060   4122   4935   5344  
5403   5404   5973   6138   6210   6364   6561   7314   7668   7669   7693   7871   7872   7962   7971   7972   8195   8984   8990   9070  
9223   9560   9565   9571   9601   9602   9607   9608   10044   10045   10046   10117   10118   10121   10169   10291   10293   10302   10303   10338  
10358   10359   10364   10366   11148   11166   11167   11176   11180   11188   11203   11383   12519   12643   12682   12977   12978   13164   13351   13352  
13353   13559   13632   13633   13808   13814   13815   13923   13969   13971   14035   14039  
Biltr, Sidirect 322   332   335   383   384   631   634   638   666   669   762   767   779   957   992   1107   1109   1117   1201   1211  
1215   1220   1237   1247   1248   1254   1256   1264   1286   1334   1676   1681   1684   1685   1768   1769   1782   1812   1816   1831  
1873   1959   2051   2053   2107   2109   2113   2116   2120   2236   2289   2384   2568   2641   2970   2972   2973   2987   3033   3034  
3264   3269   3274   3301   3342   3346   3492   3493   3508   3641   3642   4048   4061   4068   4175   4188   4246   4248   4513   5113  
5160   5163   5201   5210   5211   5213   5337   5351   5352   5357   5358   5365   5785   5795   6079   6081   6129   6345   6425   6458  
6600   6653   6786   6866   7719   7720   7802   7963   7975   8003   8005   8022   8032   8033   8039   8190   8192   8198   8209   8299  
8341   8378   8379   8430   8496   8515   8560   8563   8570   8572   8573   8612   8613   8649   8859   8875   8883   8884   8888   8972  
8985   8991   8993   8995   9017   9033   9037   9040   9045   9057   9062   9065   9071   9095   9102   9155   9168   9177   9179   9181  
9300   9352   9392   9396   9435   9438   9459   9461   9517   9527   9529   9531   9611   9613   9627   9628   9633   9636   9640   9701  
9703   9706   9717   9943   9944   9982   9986   10010   10012   10015   10019   10021   10024   10066   10068   10070   10078   10119   10166   10174  
10246   10248   10249   10256   10257   10343   10369   10372   10385   10406   10416   10420   10495   10524   10528   10635   10636   10839   10991   11000  
11001   11004   11008   11010   11135   11168   11178   11182   11189   11225   11346   11386   11558   11567   11569   11578   11589   11614   11617   11621  
11622   11627   11633   11642   11670   11680   11929   11931   11942   11946   11955   11965   11968   11971   11974   11980   11984   11988   11990   12000  
12013   12037   12045   12090   12161   12163   12214   12246   12398   12399   12405   12407   12408   12414   12441   12446   12451   12455   12490   12493  
12495   12498   12501   12510   12515   12517   12520   12576   12642   12684   12852   12897   13018   13020   13055   13062   13104   13106   13156   13232  
13235   13287   13291   13329   13332   13358   13375   13377   13387   13503   13550   13561   13610   13612   13613   13667   13668   13672   13678   13683  
13688   13692   13694   13699   13702   13705   13708   13724   13764   13765   13767   13774   13775   13776   13777   13904   13942   13943   13945   13974  
13977   13983   13996   13998   14008   14012   14017   14019   14029   14033   14036  
Biltr, Rnaxs, Sidirect 312   321   630   1872   3906   7973   7974   8037   8200   9010   9394   10122   11158   11384   11385   11930   12641   12895   13103   13560  
13914  
Biltr, Ernai, Sidirect 1214   2083   4494   6459   8562  
Biltr, Ernai 3495   4776   5997   6077  


Target Position: 12161, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12161CACAAUGAUGCCCUUUUCA83.68381873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12159-12181GTCACAATGATGCCCTTTTCAGTUGAAAAGGGCAUCAUUGUGACCACAAUGAUGCCCUUUUCAGUU18.720.5


Target Position: 9636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9636GUUACCUUUUUAAAAAAGU70.78486395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9634-9656GAGTTACCTTTTTAAAAAAGTTAACUUUUUUAAAAAGGUAACUCGUUACCUUUUUAAAAAAGUUAU-5.918.6


Target Position: 9352, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9352CUGUUCAUCAAAACAAUGA79.21183226

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9350-9372TCCTGTTCATCAAAACAATGAACUCAUUGUUUUGAUGAACAGGACUGUUCAUCAAAACAAUGAACU12.120.5


Target Position: 12446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12446GUAUGGAUUGUCAUAUAGA96.13173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12444-12466AGGTATGGATTGTCATATAGAAAUCUAUAUGACAAUCCAUACCUGUAUGGAUUGUCAUAUAGAAAU4.921.2


Target Position: 9095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9095GGUGUUACCAUUUUUUCCU77.06323948

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9093-9115TGGGTGTTACCATTTTTTCCTTGAGGAAAAAAUGGUAACACCCAGGUGUUACCAUUUUUUCCUUGU14.321.5


Target Position: 8378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8378GCACAUUUGUCAGUAUUUU83.16132015

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8376-8398GAGCACATTTGTCAGTATTTTTGAAAAUACUGACAAAUGUGCUCGCACAUUUGUCAGUAUUUUUGU4.612.122


Target Position: 1330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1330AGCAGGAAGAUACCACAAU76.83524038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181348AGCAGGAAGATACCACAATATTGTGGTATCTTCCTGCT0.275700.125500.844800.750000.956500.62500


Target Position: 7719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7719CCUUUAACAGAAACUUUCA87.81031022

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7717-7739TGCCTTTAACAGAAACTTTCAAAUGAAAGUUUCUGUUAAAGGCACCUUUAACAGAAACUUUCAAAU13.34.921


Target Position: 8859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8859CAUGUUUAGUGAAUGACUU87.1931117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8857-8879GCCATGTTTAGTGAATGACTTTTAAGUCAUUCACUAAACAUGGCCAUGUUUAGUGAAUGACUUUUU19.26.932


Target Position: 11384, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11384GGCUAAUUUUUGUAUUUUU90.1325694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
33011402GGCTAATTTTTGTATTTTTAAAAATACAAAAATTAGCC0.646400.210601.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11382-11404CCGGCTAATTTTTGTATTTTTAAAAAAAUACAAAAAUUAGCCGGGGCUAAUUUUUGUAUUUUUAAU-0.313.600


Target Position: 12214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12214GAUCAUUGUGCCAUUUGGU78.28683528

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12212-12234GTGATCATTGTGCCATTTGGTTTACCAAAUGGCACAAUGAUCACGAUCAUUGUGCCAUUUGGUUUU17.713.6


Target Position: 11946, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11946CUUUUAAAACAUUUUGAGA84.5271659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11944-11966TTCTTTTAAAACATTTTGAGACAUCUCAAAAUGUUUUAAAAGAACUUUUAAAACAUUUUGAGACAU12.2-9.1


Target Position: 5211, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5211CUGAUUUCUACAUCAAUAU82.00782367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5209-5231CCCTGATTTCTACATCAATATTTAUAUUGAUGUAGAAAUCAGGGCUGAUUUCUACAUCAAUAUUUU8.716.322


Target Position: 13291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13291GAAAUCCUGUCAUUUGUGA86.00391332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13289-13311AGGAAATCCTGTCATTTGTGACAUCACAAAUGACAGGAUUUCCUGAAAUCCUGUCAUUUGUGACAU12.118.7


Target Position: 14039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14039CGAAAAAAAAAAAAAAAAA87.60121054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39714057CGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCG0.999400.996700.793101.000001.000001.00000


Target Position: 12642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12642GUGAAAUCACAAUAGAAAA94.6836251

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12640-12662ACGTGAAATCACAATAGAAAATGUUUUCUAUUGUGAUUUCACGUGUGAAAUCACAAUAGAAAAUGU6.916.3


Target Position: 13776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13776GGUUUUUUUUUUCUGUAAA90.6746629

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13774-13796GCGGTTTTTTTTTTCTGTAAAAGUUUACAGAAAAAAAAAACCGCGGUUUUUUUUUUCUGUAAAAGU20.3-1.8


Target Position: 10015, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10015GUUACAGAUGAUAUUUUUA95.0867236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10013-10035TTGTTACAGATGATATTTTTAGGUAAAAAUAUCAUCUGUAACAAGUUACAGAUGAUAUUUUUAGGU-9.720.3


Target Position: 13699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13699CAUCAUGUUGUACAACAUA95.6234207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13697-13719AACATCATGTTGTACAACATAAGUAUGUUGUACAACAUGAUGUUCAUCAUGUUGUACAACAUAAGU19.320.5


Target Position: 11182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11182CUUUUUCCUCUUUCUUUCU71.67466028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11180-11202TCCTTTTTCCTCTTTCTTTCTTTAGAAAGAAAGAGGAAAAAGGACUUUUUCCUCUUUCUUUCUUUU14.814.3


Target Position: 1812, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812CCAUGAAAGAGAAAGGAAA92.6878412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1810-1832TCCCATGAAAGAGAAAGGAAACAUUUCCUUUCUCUUUCAUGGGACCAUGAAAGAGAAAGGAAACAU18.713.822


Target Position: 4935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4935CCCCUUGUCCCUCCAAAUC57.465311149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9234953CCCCTTGTCCCTCCAAATCGATTTGGAGGGACAAGGGG0.274400.071900.810300.750000.956500.62500


Target Position: 3495, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495GAAAGAGGACUUUCUAUUU90.6488634

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5349519GAAAGAGGACTTTCTATTT1/1/0/097.75IGF2RNM_000876.21NANANA6:160482619..160482637(+)00IGF2R(0.002)


Target Position: 638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638GACAUAUUUAAAGCAAAUA88.5045901

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
636-658AAGACATATTTAAAGCAAATAAGUAUUUGCUUUAAAUAUGUCUUGACAUAUUUAAAGCAAAUAAGU18.56.721


Target Position: 9611, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9611CUCAUUUUUAAAUUAUCCA79.97972962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9609-9631GTCTCATTTTTAAATTATCCAATUGGAUAAUUUAAAAAUGAGACCUCAUUUUUAAAUUAUCCAAUU15.47.4


Target Position: 13998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13998GUAUUUUAUUGUAAGAAUA97.2748118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13996-14018CTGTATTTTATTGTAAGAATACAUAUUCUUACAAUAAAAUACAGGUAUUUUAUUGUAAGAAUACAU6.9-7.5


Target Position: 10495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10495GGUGAUUAAAGAACACUUU85.62751422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10493-10515CTGGTGATTAAAGAACACTTTGGAAAGUGUUCUUUAAUCACCAGGGUGAUUAAAGAACACUUUGGU17.816.1


Target Position: 10044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10044CCGUGACAGCAAAUCAGAA96.1086177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56010062CCGTGACAGCAAATCAGAATTCTGATTTGCTGTCACGG0.454400.146500.741401.000000.929300.75000


Target Position: 12498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12498GUUCUGUAUGUUGUUAACA81.99142376

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12496-12518TTGTTCTGTATGTTGTTAACAGAUGUUAACAACAUACAGAACAAGUUCUGUAUGUUGUUAACAGAU14.720.3


Target Position: 12408, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12408CAAAAUCAUACUUGAACUA91.4715529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12406-12428TGCAAAATCATACTTGAACTAGAUAGUUCAAGUAUGAUUUUGCACAAAAUCAUACUUGAACUAGAU19.27.4


Target Position: 11000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11000GCAAGAUAGUCUAGAUGAA102.04424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10998-11020GAGCAAGATAGTCTAGATGAAAGUUCAUCUAGACUAUCUUGCUCGCAAGAUAGUCUAGAUGAAAGU21.413.4


Target Position: 4776, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776GCGAGAAGGGGUUGGUUUA86.5031237

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6477619GCGAGAAGGGGTTGGTTTA1/1/0/097.75IGF2RNM_000876.21NANANA6:160493854..160493872(+)00IGF2R(0.002)


Target Position: 13329, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13329GAACAUUAUGCUAAGUGAA97.6826101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13327-13349GAGAACATTATGCTAAGTGAAATUUCACUUAGCAUAAUGUUCUCGAACAUUAUGCUAAGUGAAAUU20.36.90


Target Position: 13923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13923CCUUUAUGAUGAUCCACUU88.4162917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92013941CCTTTATGATGATCCACTTAAGTGGATCATCATAAAGG0.274800.173700.706901.000000.994600.75000


Target Position: 6345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345GUGUCAUAGGUGACAAAGU81.83982418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6343-6365GGGTGTCATAGGTGACAAAGTTGACUUUGUCACCUAUGACACCCGUGUCAUAGGUGACAAAGUUGU19.221.513


Target Position: 9394, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9394GUCAAUAAAGCUUUUUUUU75.76714438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9219412GTCAATAAAGCTTTTTTTTAAAAAAAAGCTTTATTGAC0.475900.055600.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9392-9414GAGTCAATAAAGCTTTTTTTTGTAAAAAAAAGCUUUAUUGACUCGUCAAUAAAGCUUUUUUUUGUU-11.38.9


Target Position: 13332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13332CAUUAUGCUAAGUGAAAUA96.2468168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13330-13352AACATTATGCTAAGTGAAATAAGUAUUUCACUUAGCAUAAUGUUCAUUAUGCUAAGUGAAAUAAGU14.815.200


Target Position: 11614, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11614CCAGUUUGCAAAACAAAUU76.45584169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11612-11634GACCAGTTTGCAAAACAAATTGAAAUUUGUUUUGCAAACUGGUCCCAGUUUGCAAAACAAAUUGAU5.316.7


Target Position: 9717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9717CAUUAUGACCAAAGAAAGA89.3654787

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9715-9737TACATTATGACCAAAGAAAGATGUCUUUCUUUGGUCAUAAUGUACAUUAUGACCAAAGAAAGAUGU10.38.7


Target Position: 4248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4248CUGAAUGUUCAUUCAAAGA83.41061947

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4246-4268GACTGAATGTTCATTCAAAGATGUCUUUGAAUGAACAUUCAGUCCUGAAUGUUCAUUCAAAGAUGU12.220.522


Target Position: 10169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10169UGACAGAGACAUAGAAUAA94.5452257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86310187TGACAGAGACATAGAATAATTATTCTATGTCTCTGTCA0.417300.144200.689700.750001.000001.00000


Target Position: 5351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5351CCAAUAGCAAAUGAGAUUU75.29284641

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5349-5371ATCCAATAGCAAATGAGATTTACAAAUCUCAUUUGCUAUUGGAUCCAAUAGCAAAUGAGAUUUACU20.419.732


Target Position: 12045, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12045CAGACAUUUCUACAAAUGA91.3758535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12043-12065ACCAGACATTTCTACAAATGAGGUCAUUUGUAGAAAUGUCUGGUCAGACAUUUCUACAAAUGAGGU12.119.2


Target Position: 2051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2051GGGUUUUCUUUUGACUUAU83.11652027

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2049-2071CAGGGTTTTCTTTTGACTTATCAAUAAGUCAAAAGAAAACCCUGGGGUUUUCUUUUGACUUAUCAU20.321.212


Target Position: 6077, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6077GUGACAUUUGAGUGGAAAA92.5962418

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7607719GTGACATTTGAGTGGAAAA1/1/0/097.75IGF2RNM_000876.21NANANA6:160505077..160505095(+)00IGF2R(0.002)


Target Position: 11642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11642GUAAUUGAUAAUGUUGUUU74.4134970

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11640-11662AAGTAATTGATAATGTTGTTTTGAAACAACAUUAUCAAUUACUUGUAAUUGAUAAUGUUGUUUUGU19.38.9


Target Position: 1211, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211GAUGGAAAAGAAUAUUUGU86.91611162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1209-1231CAGATGGAAAAGAATATTTGTTTACAAAUAUUCUUUUCCAUCUGGAUGGAAAAGAAUAUUUGUUUU-1.820.112


Target Position: 13942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13942CCACUUAAUAUAUAAUAAA97.821298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13940-13962TTCCACTTAATATATAATAAATAUUUAUUAUAUAUUAAGUGGAACCACUUAAUAUAUAAUAAAUAU-8.011.8


Target Position: 5160, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5160GUGGUUAUGAGGCUUAUGA82.88122104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5158-5180TGGTGGTTATGAGGCTTATGATGUCAUAAGCCUCAUAACCACCAGUGGUUAUGAGGCUUAUGAUGU19.720.032


Target Position: 10012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10012GUUGUUACAGAUGAUAUUU80.22372875

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10010-10032CTGTTGTTACAGATGATATTTTTAAAUAUCAUCUGUAACAACAGGUUGUUACAGAUGAUAUUUUUU8.714.7


Target Position: 11931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11931GUUUUAUUUUUCUUUCUUU84.64721632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11929-11951GGGTTTTATTTTTCTTTCTTTTAAAAGAAAGAAAAAUAAAACCCGUUUUAUUUUUCUUUCUUUUAU10.3-9.7


Target Position: 8379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8379CACAUUUGUCAGUAUUUUU86.86221170

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8377-8399AGCACATTTGTCAGTATTTTTGCAAAAAUACUGACAAAUGUGCUCACAUUUGUCAGUAUUUUUGCU-0.312.122


Target Position: 1685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685CAUUUUUUCAUUAAUAUUU81.3122567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1683-1705AGCATTTTTTCATTAATATTTGTAAAUAUUAAUGAAAAAAUGCUCAUUUUUUCAUUAAUAUUUGUU-8.0-12.012


Target Position: 5357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5357GCAAAUGAGAUUUACUUGA83.94121803

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5355-5377TAGCAAATGAGATTTACTTGAATUCAAGUAAAUCUCAUUUGCUAGCAAAUGAGAUUUACUUGAAUU11.813.833


Target Position: 7872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7872CCCAAGUCCUCAUUUAAAA88.4644910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8197890CCCAAGTCCTCATTTAAAATTTTAAATGAGGACTTGGG0.306800.154800.991401.000001.000001.00000


Target Position: 1334, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334GGAAGAUACCACAAUCAGA100.01750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1332-1354CAGGAAGATACCACAATCAGACCUCUGAUUGUGGUAUCUUCCUGGGAAGAUACCACAAUCAGACCU18.116.032


Target Position: 12978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12978GGUGAGGAUGUGGAGAAAA90.6165638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68512996GGTGAGGATGTGGAGAAAATTTTCTCCACATCCTCACC0.358100.303100.853401.000001.000001.00000


Target Position: 12643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12643UGAAAUCACAAUAGAAAAU75.45944565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79012661TGAAATCACAATAGAAAATATTTTCTATTGTGATTTCA0.499100.086900.715500.750001.000001.00000


Target Position: 8037, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8037GAGAAAAAGGAAAAAAAAA93.1663369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7198055GAGAAAAAGGAAAAAAAAATTTTTTTTTCCTTTTTCTC0.453300.172500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8035-8057TTGAGAAAAAGGAAAAAAAAACAUUUUUUUUUCCUUUUUCUCAAGAGAAAAAGGAAAAAAAAACAU-11.35.511


Target Position: 14012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14012GAAUACAGUAUAUAAUACA98.772677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14010-14032AAGAATACAGTATATAATACATAUGUAUUAUAUACUGUAUUCUUGAAUACAGUAUAUAAUACAUAU1.111.600


Target Position: 2973, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2973GAUUUGUGUUUAAUCUUAA100.16946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2971-2993TGGATTTGTGTTTAATCTTAATCUUAAGAUUAAACACAAAUCCAGAUUUGUGUUUAAUCUUAAUCU6.912.122


Target Position: 2641, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2641GAUGAAGUAUGAAAAAGAU96.6223154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2639-2661CAGATGAAGTATGAAAAAGATCAAUCUUUUUCAUACUUCAUCUGGAUGAAGUAUGAAAAAGAUCAU5.519.213


Target Position: 10166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10166GAAUGACAGAGACAUAGAA102.83315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10164-10186ATGAATGACAGAGACATAGAATAUUCUAUGUCUCUGUCAUUCAUGAAUGACAGAGACAUAGAAUAU20.320.5


Target Position: 5365, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5365GAUUUACUUGAAUUUUGAA97.94189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5363-5385GAGATTTACTTGAATTTTGAAAGUUCAAAAUUCAAGUAAAUCUCGAUUUACUUGAAUUUUGAAAGU7.44.622


Target Position: 2972, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972GGAUUUGUGUUUAAUCUUA99.059870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2970-2992GTGGATTTGTGTTTAATCTTAATUAAGAUUAAACACAAAUCCACGGAUUUGUGUUUAAUCUUAAUU6.914.822


Target Position: 9461, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9461GAGUUUUCCAUCUUAAAUU85.73281400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9459-9481CTGAGTTTTCCATCTTAAATTACAAUUUAAGAUGGAAAACUCAGGAGUUUUCCAUCUUAAAUUACU-4.313.3


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311GCUGUUGAUACCAAAAAUA91.5481522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512329GCTGTTGATACCAAAAATATATTTTTGGTATCAACAGC0.448600.121900.810301.000001.000001.00000


Target Position: 10291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10291GUACUUCACCAACCCUAAA88.2913937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96610309GTACTTCACCAACCCTAAATTTAGGGTTGGTGAAGTAC0.822000.125900.681000.750001.000001.00000


Target Position: 8022, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8022CAAUUACUCAGGUUUGAGA90.9866583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8020-8042GACAATTACTCAGGTTTGAGAAAUCUCAAACCUGAGUAAUUGUCCAAUUACUCAGGUUUGAGAAAU19.24.622


Target Position: 9017, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9017CUCUUCAUUUUUUUUUCAA82.99452072

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9015-9037TTCTCTTCATTTTTTTTTCAATCUUGAAAAAAAAAUGAAGAGAACUCUUCAUUUUUUUUUCAAUCU7.720.411


Target Position: 9628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9628CAAUUGGAGUUACCUUUUU80.74452705

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9626-9648TCCAATTGGAGTTACCTTTTTAAAAAAAGGUAACUCCAAUUGGACAAUUGGAGUUACCUUUUUAAU17.320.1


Target Position: 5113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5113GAAUGGAAGCUCUAUUGUU93.5217347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5111-5133AGGAATGGAAGCTCTATTGTTGAAACAAUAGAGCUUCCAUUCCUGAAUGGAAGCUCUAUUGUUGAU11.620.132


Target Position: 5795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5795GUCGUUUUAAGUUACGUGA77.93273645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5793-5815CGGTCGTTTTAAGTTACGTGAATUCACGUAACUUAAAACGACCGGUCGUUUUAAGUUACGUGAAUU21.015.333


Target Position: 12517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12517GAUGUUUUGCAAAAAAUGA86.8131185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12515-12537CAGATGTTTTGCAAAAAATGAAAUCAUUUUUUGCAAAACAUCUGGAUGUUUUGCAAAAAAUGAAAU-3.35.3


Target Position: 11225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11225CUUUCUCUCUUUCUUUCGA78.31493515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11223-11245TTCTTTCTCTCTTTCTTTCGAGAUCGAAAGAAAGAGAGAAAGAACUUUCUCUCUUUCUUUCGAGAU21.019.1


Target Position: 6600, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6600GAGAUAUUUAUUUUAAGCU83.9221808

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6598-6620CGGAGATATTTATTTTAAGCTGTAGCUUAAAAUAAAUAUCUCCGGAGAUAUUUAUUUUAAGCUGUU13.76.612


Target Position: 12495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12495CUUGUUCUGUAUGUUGUUA85.09281535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12493-12515CACTTGTTCTGTATGTTGTTAACUAACAACAUACAGAACAAGUGCUUGUUCUGUAUGUUGUUAACU19.319.2


Target Position: 13377, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13377GAUGAUCUCACUUAUAUGU85.06231542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13375-13397CAGATGATCTCACTTATATGTGGACAUAUAAGUGAGAUCAUCUGGAUGAUCUCACUUAUAUGUGGU0.020.4


Target Position: 1264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264GUUCUGUAAUAAAAAACAA93.9741303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1262-1284CAGTTCTGTAATAAAAAACAAGCUUGUUUUUUAUUACAGAACUGGUUCUGUAAUAAAAAACAAGCU5.620.321


Target Position: 8972, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8972GCUUGUUUGAUUUCAACAU82.28292273

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8970-8992TGGCTTGTTTGATTTCAACATGAAUGUUGAAAUCAAACAAGCCAGCUUGUUUGAUUUCAACAUGAU20.510.322


Target Position: 1816, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816GAAAGAGAAAGGAAACAUU90.2516682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1814-1836ATGAAAGAGAAAGGAAACATTCAAAUGUUUCCUUUCUCUUUCAUGAAAGAGAAAGGAAACAUUCAU14.819.112


Target Position: 332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332GUACUUUAUAAAAUCAACA87.9922991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
330-352ATGTACTTTATAAAATCAACATCUGUUGAUUUUAUAAAGUACAUGUACUUUAUAAAAUCAACAUCU14.86.622


Target Position: 1107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107GAGAUUACCUGGAAAGUAA101.47128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1105-1127CAGAGATTACCTGGAAAGTAAAAUUACUUUCCAGGUAAUCUCUGGAGAUUACCUGGAAAGUAAAAU14.614.522


Target Position: 13983, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13983CUUAAAACUUUUUCUGUAU82.90832099

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13981-14003TTCTTAAAACTTTTTCTGTATTTAUACAGAAAAAGUUUUAAGAACUUAAAACUUUUUCUGUAUUUU20.30.0


Target Position: 4060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4060UGAAAAUGGCUUGUUAAAA78.4923461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8524078TGAAAATGGCTTGTTAAAATTTTAACAAGCCATTTTCA0.296700.137300.724100.750001.000001.00000


Target Position: 1684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684GCAUUUUUUCAUUAAUAUU86.7721197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1682-1704AAGCATTTTTTCATTAATATTTGAAUAUUAAUGAAAAAAUGCUUGCAUUUUUUCAUUAAUAUUUGU-8.0-3.312


Target Position: 12895, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12895GGGAAAUGCACAUCAUAAA96.2658167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67112913GGGAAATGCACATCATAAATTTATGATGTGCATTTCCC0.593100.084900.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12893-12915CAGGGAAATGCACATCATAAACAUUUAUGAUGUGCAUUUCCCUGGGGAAAUGCACAUCAUAAACAU8.720.1


Target Position: 10118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10118GCUUCCUUUCAACAAAAUU78.06793607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62510136GCTTCCTTTCAACAAAATTAATTTTGTTGAAAGGAAGC0.388500.364200.844801.000001.000001.00000


Target Position: 762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CUUCUCUAUUCAUCAAUGU76.01294338

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
760-782CACTTCTCTATTCATCAATGTTTACAUUGAUGAAUAGAGAAGUGCUUCUCUAUUCAUCAAUGUUUU13.620.223


Target Position: 10372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10372CAUAUAGACAUUAGAACUU85.75581390

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10370-10392AACATATAGACATTAGAACTTACAAGUUCUAAUGUCUAUAUGUUCAUAUAGACAUUAGAACUUACU18.98.2


Target Position: 1220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GAAUAUUUGUUUUAUUUGA92.4025432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1218-1240AAGAATATTTGTTTTATTTGAATUCAAAUAAAACAAAUAUUCUUGAAUAUUUGUUUUAUUUGAAUU-1.4-10.311


Target Position: 9982, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9982CUCUGAAAAAAGAGUAACU80.7152718

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9980-10002GCCTCTGAAAAAAGAGTAACTACAGUUACUCUUUUUUCAGAGGCCUCUGAAAAAAGAGUAACUACU21.420.4


Target Position: 8496, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8496CAGAGAAAAUGAAUUUUUU90.2008686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8494-8516GTCAGAGAAAATGAATTTTTTCCAAAAAAUUCAUUUUCUCUGACCAGAGAAAAUGAAUUUUUUCCU-12.019.122


Target Position: 12399, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12399GUCUAACUGCAAAAUCAUA94.7198247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12397-12419GGGTCTAACTGCAAAATCATACTUAUGAUUUUGCAGUUAGACCCGUCUAACUGCAAAAUCAUACUU7.218.9


Target Position: 4048, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4048GAAGCUAACUUAUGAAAAU94.1188288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4046-4068CAGAAGCTAACTTATGAAAATGGAUUUUCAUAAGUUAGCUUCUGGAAGCUAACUUAUGAAAAUGGU7.418.322


Target Position: 6129, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6129GCAAAUUCGUCCAGAAACA88.0082985

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6127-6149GTGCAAATTCGTCCAGAAACACAUGUUUCUGGACGAAUUUGCACGCAAAUUCGUCCAGAAACACAU19.27.422


Target Position: 4188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4188CAGAUUGUUCCUACUUGUU82.09322333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4186-4208TTCAGATTGTTCCTACTTGTTTGAACAAGUAGGAACAAUCUGAACAGAUUGUUCCUACUUGUUUGU19.019.223


Target Position: 8612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8612CCUAUAAGAAGCCUUAAUU83.25211987

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8610-8632GACCTATAAGAAGCCTTAATTTGAAUUAAGGCUUCUUAUAGGUCCCUAUAAGAAGCCUUAAUUUGU10.92.821


Target Position: 7972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7972CCCGAUAUAUUUUAGCAUU82.41762235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1457990CCCGATATATTTTAGCATTAATGCTAAAATATATCGGG0.798600.484200.982801.000001.000001.00000


Target Position: 12013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12013GAAUCAUUUGAGACUAAGU89.6849738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12011-12033CTGAATCATTTGAGACTAAGTTCACUUAGUCUCAAAUGAUUCAGGAAUCAUUUGAGACUAAGUUCU18.97.2


Target Position: 11680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11680GAAACACAAUCUAGUGAAU93.0241385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11678-11700GGGAAACACAATCTAGTGAATGGAUUCACUAGAUUGUGUUUCCCGAAACACAAUCUAGUGAAUGGU20.319.3


Target Position: 5404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5404GGACAAGCAUUUCAACUAC81.67432466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8665422GGACAAGCATTTCAACTACGTAGTTGAAATGCTTGTCC0.491300.068600.689700.750000.994600.75000


Target Position: 11621, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11621GCAAAACAAAUUGAAUAAA85.3581473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11619-11641TTGCAAAACAAATTGAATAAAAAUUUAUUCAAUUUGUUUUGCAAGCAAAACAAAUUGAAUAAAAAU8.912.2


Target Position: 12682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12682GGCAGCAAUUCCUAGACAU88.3927922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84712700GGCAGCAATTCCTAGACATATGTCTAGGAATTGCTGCC0.300400.073900.844801.000000.994600.75000


Target Position: 11968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11968CAUGUAGACAUUCAAACUU83.55611907

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11966-11988AACATGTAGACATTCAAACTTACAAGUUUGAAUGUCUACAUGUUCAUGUAGACAUUCAAACUUACU19.220.3


Target Position: 12490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12490GAACACUUGUUCUGUAUGU82.45132227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12488-12510TGGAACACTTGTTCTGTATGTTGACAUACAGAACAAGUGUUCCAGAACACUUGUUCUGUAUGUUGU17.917.8


Target Position: 1254, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CUGAAAUACAGUUCUGUAA90.0011709

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1252-1274AACTGAAATACAGTTCTGTAATAUUACAGAACUGUAUUUCAGUUCUGAAAUACAGUUCUGUAAUAU20.38.922


Target Position: 9102, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9102CCAUUUUUUCCUUGAUAGU75.12574713

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9100-9122TACCATTTTTTCCTTGATAGTGAACUAUCAAGGAAAAAAUGGUACCAUUUUUUCCUUGAUAGUGAU13.4-3.3


Target Position: 7668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7668AGCACCUCCAACCAAAUAA79.67523061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9547686AGCACCTCCAACCAAATAATTATTTGGTTGGAGGTGCT0.714900.052500.819000.750001.000001.00000


Target Position: 13055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13055GGAAGUUCCUGAAAAAAUU89.2808799

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13053-13075CAGGAAGTTCCTGAAAAAATTAAAAUUUUUUCAGGAACUUCCUGGGAAGUUCCUGAAAAAAUUAAU-12.021.5


Target Position: 10122, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10122CCUUUCAACAAAAUUUUUU72.25445799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64910140CCTTTCAACAAAATTTTTTAAAAAATTTTGTTGAAAGG0.377300.336000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10120-10142TTCCTTTCAACAAAATTTTTTGTAAAAAAUUUUGUUGAAAGGAACCUUUCAACAAAAUUUUUUGUU-12.012.2


Target Position: 10066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10066GACUCUUUUUCAGAGAAAU86.18121299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10064-10086TGGACTCTTTTTCAGAGAAATGAAUUUCUCUGAAAAAGAGUCCAGACUCUUUUUCAGAGAAAUGAU19.117.7


Target Position: 13018, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13018GUGAGAAUGUAAAUUGGUA97.0407129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13016-13038TGGTGAGAATGTAAATTGGTATAUACCAAUUUACAUUCUCACCAGUGAGAAUGUAAAUUGGUAUAU18.820.4


Target Position: 10406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10406CUUUUUCCCUGAAUCAUUU79.01893290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10404-10426CTCTTTTTCCCTGAATCATTTGAAAAUGAUUCAGGGAAAAAGAGCUUUUUCCCUGAAUCAUUUGAU7.214.3


Target Position: 4494, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4494GCAUAAUUGUCCUGAAAUA100.56441

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1449419GCATAATTGTCCTGAAATA1/1/0/0100.00IGF2RNM_000876.21NANANA6:160490993..160491011(+)00IGF2R(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4492-4514TGGCATAATTGTCCTGAAATACGUAUUUCAGGACAAUUAUGCCAGCAUAAUUGUCCUGAAAUACGU12.0-1.833


Target Position: 10070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10070CUUUUUCAGAGAAAUGAUU75.98124346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10068-10090CTCTTTTTCAGAGAAATGATTTTAAUCAUUUCUCUGAAAAAGAGCUUUUUCAGAGAAAUGAUUUUU7.27.7


Target Position: 13971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13971CCUCAUGAUUUUCUUAAAA90.7418614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15413989CCTCATGATTTTCTTAAAATTTTAAGAAAATCATGAGG0.810800.603600.844801.000001.000001.00000


Target Position: 13683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13683GAUAAGUAUCUCAAAACAU93.4945348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13681-13703ATGATAAGTATCTCAAAACATCAAUGUUUUGAGAUACUUAUCAUGAUAAGUAUCUCAAAACAUCAU12.26.3


Target Position: 7314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7314GCCAUAUUACCACCAAGUC68.65937201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9667332GCCATATTACCACCAAGTCGACTTGGTGGTAATATGGC0.259500.064300.681000.750000.989100.62500


Target Position: 5352, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5352CAAUAGCAAAUGAGAUUUA94.3139270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5350-5372TCCAATAGCAAATGAGATTTACTUAAAUCUCAUUUGCUAUUGGACAAUAGCAAAUGAGAUUUACUU14.819.722


Target Position: 312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CUGUUGAUACCAAAAAUAA93.3194358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551330CTGTTGATACCAAAAATAATTATTTTTGGTATCAACAG0.444200.133200.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
310-332AGCTGTTGATACCAAAAATAATGUUAUUUUUGGUAUCAACAGCUCUGUUGAUACCAAAAAUAAUGU-9.720.521


Target Position: 12520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12520GUUUUGCAAAAAAUGAAAA82.76842131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12518-12540ATGTTTTGCAAAAAATGAAAAGGUUUUCAUUUUUUGCAAAACAUGUUUUGCAAAAAAUGAAAAGGU7.420.0


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463GGUAACGAUGGGAAAGGAA88.4107918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131481GGTAACGATGGGAAAGGAATTCCTTTCCCATCGTTACC0.437500.166000.681001.000001.000001.00000


Target Position: 8341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8341CCUUUUUGCAUGAUAUCUU81.35612556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8339-8361CACCTTTTTGCATGATATCTTCAAAGAUAUCAUGCAAAAAGGUGCCUUUUUGCAUGAUAUCUUCAU15.92.131


Target Position: 10249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10249GAAAUCUGGUUCUUAUGAA97.0702128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10247-10269TGGAAATCTGGTTCTTATGAACAUUCAUAAGAACCAGAUUUCCAGAAAUCUGGUUCUUAUGAACAU13.412.0


Target Position: 8192, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8192CAUUCUGUCUCUUUUCUCU88.1767954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8190-8212CTCATTCTGTCTCTTTTCTCTTTAGAGAAAAGAGACAGAAUGAGCAUUCUGUCUCUUUUCUCUUUU14.819.212


Target Position: 1831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831CAUUCAACUCUCUUAUUCA100.89136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1829-1851AACATTCAACTCTCTTATTCAGAUGAAUAAGAGAGUUGAAUGUUCAUUCAACUCUCUUAUUCAGAU6.914.832


Target Position: 8200, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8200CUCUUUUCUCUUUUGCUUU74.52334927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8538218CTCTTTTCTCTTTTGCTTTAAAGCAAAAGAGAAAAGAG0.295800.077300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8198-8220GTCTCTTTTCTCTTTTGCTTTCTAAAGCAAAAGAGAAAAGAGACCUCUUUUCUCUUUUGCUUUCUU18.614.812


Target Position: 14036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14036CAUCGAAAAAAAAAAAAAA91.1266567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14034-14056AACATCGAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUCGAUGUUCAUCGAAAAAAAAAAAAAAAAU-11.316.701


Target Position: 4068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068GCUUGUUAAAAAUGAACUU81.67642465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4066-4088TGGCTTGTTAAAAATGAACTTCAAAGUUCAUUUUUAACAAGCCAGCUUGUUAAAAAUGAACUUCAU19.211.822


Target Position: 5997, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5997CAUCCAGCAUCAUAUUUAA102.4519

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2599719CATCCAGCATCATATTTAA1/1/0/0100.00IGF2RNM_000876.21NANANA6:160504997..160505015(+)00IGF2R(0.002)


Target Position: 13351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13351AGCCAGACACAGAAAGAAA91.9386479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94913369AGCCAGACACAGAAAGAAATTTCTTTCTGTGTCTGGCT0.875300.482900.853400.750001.000001.00000


Target Position: 11929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11929GGGUUUUAUUUUUCUUUCU81.24862581

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11927-11949CAGGGTTTTATTTTTCTTTCTTTAGAAAGAAAAAUAAAACCCUGGGGUUUUAUUUUUCUUUCUUUU14.814.0


Target Position: 11984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11984CUUACAGAACAAAGAACUA91.8595488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11982-12004AACTTACAGAACAAAGAACTATTUAGUUCUUUGUUCUGUAAGUUCUUACAGAACAAAGAACUAUUU17.720.3


Target Position: 8430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8430GAUUGAUUUGUGUGUUUGU85.2331499

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8428-8450AAGATTGATTTGTGTGTTTGTGTACAAACACACAAAUCAAUCUUGAUUGAUUUGUGUGUUUGUGUU19.37.222


Target Position: 8990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8990UGAGUGUAUUUUUUAAAAU79.91292985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9069008TGAGTGTATTTTTTAAAATATTTTAAAAAATACACTCA0.333900.057300.715500.750001.000001.00000


Target Position: 11180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11180UCCUUUUUCCUCUUUCUUU68.30047328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60911198TCCTTTTTCCTCTTTCTTTAAAGAAAGAGGAAAAAGGA0.999900.999600.870700.750001.000001.00000


Target Position: 13156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13156CUGUUCAUUGCAGCAUUAU73.69685222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13154-13176CCCTGTTCATTGCAGCATTATTCAUAAUGCUGCAAUGAACAGGGCUGUUCAUUGCAGCAUUAUUCU19.720.5


Target Position: 10024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10024GAUAUUUUUAGGAAAACAU86.87321168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10022-10044ATGATATTTTTAGGAAAACATCCAUGUUUUCCUAAAAAUAUCAUGAUAUUUUUAGGAAAACAUCCU14.9-10.3


Target Position: 8039, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8039GAAAAAGGAAAAAAAAACA87.36731091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8037-8059GAGAAAAAGGAAAAAAAAACAGCUGUUUUUUUUUCCUUUUUCUCGAAAAAGGAAAAAAAAACAGCU-1.89.511


Target Position: 10636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10636GAUUUCUGGAAAUAUCCUU81.3572555

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10634-10656TGGATTTCTGGAAATATCCTTTAAAGGAUAUUUCCAGAAAUCCAGAUUUCUGGAAAUAUCCUUUAU19.912.0


Target Position: 1201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201CUAUAUUUCAGAUGGAAAA89.6095751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1199-1221TCCTATATTTCAGATGGAAAAGAUUUUCCAUCUGAAAUAUAGGACUAUAUUUCAGAUGGAAAAGAU20.1-8.022


Target Position: 13705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13705GUUGUACAACAUAAGUAUA96.1183176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13703-13725ATGTTGTACAACATAAGTATACAUAUACUUAUGUUGUACAACAUGUUGUACAACAUAAGUAUACAU6.320.4


Target Position: 12977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12977GGGUGAGGAUGUGGAGAAA95.9729186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91412995GGGTGAGGATGTGGAGAAATTTCTCCACATCCTCACCC0.327600.056400.991401.000001.000001.00000


Target Position: 10117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10117AGCUUCCUUUCAACAAAAU74.76124844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92210135AGCTTCCTTTCAACAAAATATTTTGTTGAAAGGAAGCT0.387500.365300.844800.750001.000001.00000


Target Position: 11008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11008GUCUAGAUGAAAGUAAAGA82.33582257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11006-11028TAGTCTAGATGAAAGTAAAGAGAUCUUUACUUUCAUCUAGACUAGUCUAGAUGAAAGUAAAGAGAU9.820.2


Target Position: 10385, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10385GAACUUACAGGACAAAGAA97.197123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10383-10405TAGAACTTACAGGACAAAGAACTUUCUUUGUCCUGUAAGUUCUAGAACUUACAGGACAAAGAACUU19.212.9


Target Position: 7693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7693CACUCGAUGAUGCUUCUAU87.63551047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9447711CACTCGATGATGCTTCTATATAGAAGCATCATCGAGTG0.266800.168900.750000.750001.000001.00000


Target Position: 12407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12407GCAAAAUCAUACUUGAACU88.2015951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12405-12427CTGCAAAATCATACTTGAACTAGAGUUCAAGUAUGAUUUUGCAGGCAAAAUCAUACUUGAACUAGU19.27.4


Target Position: 9300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9300CUUUCUAGAUCCGAUUUCU80.21092880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9298-9320CTCTTTCTAGATCCGATTTCTTTAGAAAUCGGAUCUAGAAAGAGCUUUCUAGAUCCGAUUUCUUUU16.711.7


Target Position: 1768, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768GGAUAAAAAUGGAAGUAAA106.3883

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1766-1788GTGGATAAAAATGGAAGTAAAAAUUUACUUCCAUUUUUAUCCACGGAUAAAAAUGGAAGUAAAAAU14.62.112


Target Position: 13106, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13106GUAUAUCCAAAAGAAAUGA82.06352345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13104-13126GTGTATATCCAAAAGAAATGAAGUCAUUUCUUUUGGAUAUACACGUAUAUCCAAAAGAAAUGAAGU12.016.7


Target Position: 13104, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13104GUGUAUAUCCAAAAGAAAU88.3454931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13102-13124GGGTGTATATCCAAAAGAAATGAAUUUCUUUUGGAUAUACACCCGUGUAUAUCCAAAAGAAAUGAU5.58.2


Target Position: 13996, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13996CUGUAUUUUAUUGUAAGAA85.1161531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13994-14016TTCTGTATTTTATTGTAAGAATAUUCUUACAAUAAAAUACAGAACUGUAUUUUAUUGUAAGAAUAU20.36.9


Target Position: 9706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9706CUAAAAGUUUACAUUAUGA91.8848484

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9704-9726TTCTAAAAGTTTACATTATGACCUCAUAAUGUAAACUUUUAGAACUAAAAGUUUACAUUAUGACCU5.64.9


Target Position: 13765, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13765CACUUACAUGCGGUUUUUU77.58593769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13763-13785TCCACTTACATGCGGTTTTTTTTAAAAAACCGCAUGUAAGUGGACACUUACAUGCGGUUUUUUUUU12.619.0


Target Position: 9943, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9943CGUUUGAGUGCAUUUGCUU83.24761988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9941-9963CACGTTTGAGTGCATTTGCTTTGAAGCAAAUGCACUCAAACGUGCGUUUGAGUGCAUUUGCUUUGU18.519.2


Target Position: 11988, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11988CAGAACAAAGAACUAUUUU80.3432835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11986-12008TACAGAACAAAGAACTATTTTTTAAAAUAGUUCUUUGUUCUGUACAGAACAAAGAACUAUUUUUUU4.619.2


Target Position: 11971, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11971GUAGACAUUCAAACUUACA87.8491015

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11969-11991ATGTAGACATTCAAACTTACAGAUGUAAGUUUGAAUGUCUACAUGUAGACAUUCAAACUUACAGAU12.920.3


Target Position: 5973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5973GCAGACACUCAAACAGCUA91.3225540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9795991GCAGACACTCAAACAGCTATAGCTGTTTGAGTGTCTGC0.588100.100600.681001.000000.978300.75000


Target Position: 13375, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13375CAGAUGAUCUCACUUAUAU93.8499318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13373-13395ACCAGATGATCTCACTTATATGTAUAUAAGUGAGAUCAUCUGGUCAGAUGAUCUCACUUAUAUGUU6.320.4


Target Position: 9435, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9435GAUGUUUUCUCUUGAGUAA97.4748110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9433-9455GAGATGTTTTCTCTTGAGTAAACUUACUCAAGAGAAAACAUCUCGAUGUUUUCUCUUGAGUAAACU20.35.3


Target Position: 7974, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7974CGAUAUAUUUUAGCAUUUU86.29411273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3737992CGATATATTTTAGCATTTTAAAATGCTAAAATATATCG0.759200.549800.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7972-7994CCCGATATATTTTAGCATTTTAAAAAAUGCUAAAAUAUAUCGGGCGAUAUAUUUUAGCAUUUUAAU18.53.222


Target Position: 9640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9640CCUUUUUAAAAAAGUUAUU74.71394865

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9638-9660TACCTTTTTAAAAAAGTTATTCTAAUAACUUUUUUAAAAAGGUACCUUUUUAAAAAAGUUAUUCUU4.6-3.8


Target Position: 9392, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9392GAGUCAAUAAAGCUUUUUU88.3751927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9390-9412GTGAGTCAATAAAGCTTTTTTTTAAAAAAGCUUUAUUGACUCACGAGUCAAUAAAGCUUUUUUUUU12.319.2


Target Position: 9177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9177GACUGAAUUUGGGUUUUAA98.238284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9175-9197GTGACTGAATTTGGGTTTTAACTUUAAAACCCAAAUUCAGUCACGACUGAAUUUGGGUUUUAACUU14.019.2


Target Position: 13688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13688GUAUCUCAAAACAUCAUGU82.73122147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13686-13708AAGTATCTCAAAACATCATGTTGACAUGAUGUUUUGAGAUACUUGUAUCUCAAAACAUCAUGUUGU19.421.4


Target Position: 9396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9396CAAUAAAGCUUUUUUUUGU83.1612016

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9394-9416GTCAATAAAGCTTTTTTTTGTGCACAAAAAAAAGCUUUAUUGACCAAUAAAGCUUUUUUUUGUGCU-2.9-4.3


Target Position: 3346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3346CACUUACUUUGAGUUUGAA93.475349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3344-3366AACACTTACTTTGAGTTTGAAACUUCAAACUCAAAGUAAGUGUUCACUUACUUUGAGUUUGAAACU19.217.623


Target Position: 10246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10246GUGGAAAUCUGGUUCUUAU91.9704477

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10244-10266AAGTGGAAATCTGGTTCTTATGAAUAAGAACCAGAUUUCCACUUGUGGAAAUCUGGUUCUUAUGAU14.620.1


Target Position: 8032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8032GGUUUGAGAAAAAGGAAAA90.6699631

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8030-8052CAGGTTTGAGAAAAAGGAAAAAAUUUUCCUUUUUCUCAAACCUGGGUUUGAGAAAAAGGAAAAAAU18.719.212


Target Position: 9608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9608CGUCUCAUUUUUAAAUUAU86.29061274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6569626CGTCTCATTTTTAAATTATATAATTTAAAAATGAGACG0.375200.304600.732801.000001.000001.00000


Target Position: 9607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9607CCGUCUCAUUUUUAAAUUA93.3916353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2739625CCGTCTCATTTTTAAATTATAATTTAAAAATGAGACGG0.727600.574200.879301.000001.000001.00000


Target Position: 10248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10248GGAAAUCUGGUUCUUAUGA86.09861313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10246-10268GTGGAAATCTGGTTCTTATGAACUCAUAAGAACCAGAUUUCCACGGAAAUCUGGUUCUUAUGAACU13.414.8


Target Position: 12414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12414CAUACUUGAACUAGAAAAU86.00351333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12412-12434ATCATACTTGAACTAGAAAATCCAUUUUCUAGUUCAAGUAUGAUCAUACUUGAACUAGAAAAUCCU7.111.6


Target Position: 11178, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11178CUUCCUUUUUCCUCUUUCU76.52884145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11176-11198TCCTTCCTTTTTCCTCTTTCTTTAGAAAGAGGAAAAAGGAAGGACUUCCUUUUUCCUCUUUCUUUU19.118.7


Target Position: 13235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13235GAAAAUGCAUGUAUGUAUA100.18645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13233-13255AAGAAAATGCATGTATGTATACAUAUACAUACAUGCAUUUUCUUGAAAAUGCAUGUAUGUAUACAU8.214.0


Target Position: 6364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6364UGUUGUCACGUACUCCAAA85.16311517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9806382TGTTGTCACGTACTCCAAATTTGGAGTACGTGACAACA0.253900.053400.706900.750001.000001.00000


Target Position: 9065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9065CAAUUUCAAUAAAAGAUAA99.162568

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9063-9085AACAATTTCAATAAAAGATAAATUUAUCUUUUAUUGAAAUUGUUCAAUUUCAAUAAAAGAUAAAUU6.97.422


Target Position: 322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CAAAAAUAAUGUACUUUAU92.1053467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342ACCAAAAATAATGTACTTTATAAAUAAAGUACAUUAUUUUUGGUCAAAAAUAAUGUACUUUAUAAU6.6-9.722


Target Position: 13667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13667GCAAUGAUUUUGUAAUGAU92.1269459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13665-13687GGGCAATGATTTTGTAATGATAAAUCAUUACAAAAUCAUUGCCCGCAAUGAUUUUGUAAUGAUAAU16.113.6


Target Position: 13613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13613CAAAUAAAAGGAAAUUAUU86.3351264

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13611-13633TCCAAATAAAAGGAAATTATTTGAAUAAUUUCCUUUUAUUUGGACAAAUAAAAGGAAAUUAUUUGU-10.3-9.7


Target Position: 9627, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9627CCAAUUGGAGUUACCUUUU75.2054682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9625-9647ATCCAATTGGAGTTACCTTTTTAAAAAGGUAACUCCAAUUGGAUCCAAUUGGAGUUACCUUUUUAU18.617.7


Target Position: 7802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7802GUUUACAGUCAUUGGAAUA89.9896711

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7800-7822TTGTTTACAGTCATTGGAATAAGUAUUCCAAUGACUGUAAACAAGUUUACAGUCAUUGGAAUAAGU20.111.821


Target Position: 1109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109GAUUACCUGGAAAGUAAAA89.4115779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1107-1129GAGATTACCTGGAAAGTAAAACTUUUUACUUUCCAGGUAAUCUCGAUUACCUGGAAAGUAAAACUU4.918.522


Target Position: 7720, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7720CUUUAACAGAAACUUUCAA86.07951319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7718-7740GCCTTTAACAGAAACTTTCAAAAUUGAAAGUUUCUGUUAAAGGCCUUUAACAGAAACUUUCAAAAU19.27.221


Target Position: 3264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3264GCUUUGUUUGCAAUGAUGA83.97431793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3262-3284CCGCTTTGTTTGCAATGATGATGUCAUCAUUGCAAACAAAGCGGGCUUUGUUUGCAAUGAUGAUGU13.610.322


Target Position: 383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCAUCAAGUGCUGUUUGUA92.1104465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
381-403GGCCATCAAGTGCTGTTTGTATGUACAAACAGCACUUGAUGGCCCCAUCAAGUGCUGUUUGUAUGU19.318.123


Target Position: 2116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116GUAUGACUUUUAUAUAAAU96.6949151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2114-2136AAGTATGACTTTTATATAAATGTAUUUAUAUAAAAGUCAUACUUGUAUGACUUUUAUAUAAAUGUU-8.020.312


Target Position: 10420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10420CAUUUGAGAUGAAGUUUCU86.77891195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10418-10440ATCATTTGAGATGAAGTTTCTTCAGAAACUUCAUCUCAAAUGAUCAUUUGAGAUGAAGUUUCUUCU13.312.0


Target Position: 11974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11974GACAUUCAAACUUACAGAA92.5387421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11972-11994TAGACATTCAAACTTACAGAACAUUCUGUAAGUUUGAAUGUCUAGACAUUCAAACUUACAGAACAU20.320.5


Target Position: 13103, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13103GGUGUAUAUCCAAAAGAAA99.558161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64213121GGTGTATATCCAAAAGAAATTTCTTTTGGATATACACC0.381000.090300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13101-13123TGGGTGTATATCCAAAAGAAATGUUUCUUUUGGAUAUACACCCAGGUGUAUAUCCAAAAGAAAUGU5.515.8


Target Position: 13503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13503CUAUGCAACAUGAAUGAAU83.1182026

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13501-13523AGCTATGCAACATGAATGAATTCAUUCAUUCAUGUUGCAUAGCUCUAUGCAACAUGAAUGAAUUCU16.321.1


Target Position: 11346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11346CCUAGUAGCUGGGAUUAAA94.162287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11344-11366TCCCTAGTAGCTGGGATTAAAGGUUUAAUCCCAGCUACUAGGGACCUAGUAGCUGGGAUUAAAGGU15.516.1


Target Position: 13550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13550CUAUGAUACUGCUUUGUGU87.8671008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13548-13570GACTATGATACTGCTTTGTGTATACACAAAGCAGUAUCAUAGUCCUAUGAUACUGCUUUGUGUAUU16.710.2


Target Position: 12090, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12090CAUCAGAACCACAAUAUGU87.50411067

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12088-12110ACCATCAGAACCACAATATGTGGACAUAUUGUGGUUCUGAUGGUCAUCAGAACCACAAUAUGUGGU5.620.4


Target Position: 4061, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061GAAAAUGGCUUGUUAAAAA97.6698102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4059-4081ATGAAAATGGCTTGTTAAAAATGUUUUUAACAAGCCAUUUUCAUGAAAAUGGCUUGUUAAAAAUGU0.011.321


Target Position: 12515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12515CAGAUGUUUUGCAAAAAAU87.1911118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12513-12535AACAGATGTTTTGCAAAAAATGAAUUUUUUGCAAAACAUCUGUUCAGAUGUUUUGCAAAAAAUGAU-2.919.2


Target Position: 11627, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11627CAAAUUGAAUAAAAAGUAA96.1519171

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11625-11647AACAAATTGAATAAAAAGTAATTUUACUUUUUAUUCAAUUUGUUCAAAUUGAAUAAAAAGUAAUUU4.97.4


Target Position: 1247, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247GGAGAAACUGAAAUACAGU88.9307837

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1245-1267GTGGAGAAACTGAAATACAGTTCACUGUAUUUCAGUUUCUCCACGGAGAAACUGAAAUACAGUUCU11.621.522


Target Position: 5337, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5337CACCAAUACUCAAUCCAAU90.9739585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5335-5357ACCACCAATACTCAATCCAATAGAUUGGAUUGAGUAUUGGUGGUCACCAAUACUCAAUCCAAUAGU20.120.032


Target Position: 13702, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13702CAUGUUGUACAACAUAAGU81.09392612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13700-13722ATCATGTTGTACAACATAAGTATACUUAUGUUGUACAACAUGAUCAUGUUGUACAACAUAAGUAUU11.619.3


Target Position: 12163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12163CAAUGAUGCCCUUUUCAGU84.26521719

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12161-12183CACAATGATGCCCTTTTCAGTAGACUGAAAAGGGCAUCAUUGUGCAAUGAUGCCCUUUUCAGUAGU12.213.6


Target Position: 13560, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13560GCUUUGUGUAUUUAAAAUU81.86522407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72713578GCTTTGTGTATTTAAAATTAATTTTAAATACACAAAGC0.788400.076600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13558-13580CTGCTTTGTGTATTTAAAATTTTAAUUUUAAAUACACAAAGCAGGCUUUGUGUAUUUAAAAUUUUU-9.716.7


Target Position: 6459, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6459CAUUCAAGAGGUUUGAUAU94.0677293

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8645919CATTCAAGAGGTTTGATAT1/1/0/097.75IGF2RNM_000876.21NANANANA00IGF2R(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6457-6479TGCATTCAAGAGGTTTGATATCGAUAUCAAACCUCUUGAAUGCACAUUCAAGAGGUUUGAUAUCGU8.912.022


Target Position: 9560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9560CCUAUUCUCCAUCCCUUUU74.15775044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1379578CCTATTCTCCATCCCTTTTAAAAGGGATGGAGAATAGG0.934000.674700.844801.000001.000001.00000


Target Position: 13559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13559UGCUUUGUGUAUUUAAAAU78.19193565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82513577TGCTTTGTGTATTTAAAATATTTTAAATACACAAAGCA0.827900.065500.844800.750001.000001.00000


Target Position: 12037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12037CCUAUCACCAGACAUUUCU72.29375786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12035-12057CTCCTATCACCAGACATTTCTACAGAAAUGUCUGGUGAUAGGAGCCUAUCACCAGACAUUUCUACU14.820.3


Target Position: 8883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8883GCAUUGUAGAAUUGUAUAU87.61051052

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8881-8903TCGCATTGTAGAATTGTATATAGAUAUACAAUUCUACAAUGCGAGCAUUGUAGAAUUGUAUAUAGU8.513.522


Target Position: 9062, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9062CAACAAUUUCAAUAAAAGA92.7815401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9060-9082TTCAACAATTTCAATAAAAGATAUCUUUUAUUGAAAUUGUUGAACAACAAUUUCAAUAAAAGAUAU-4.35.322


Target Position: 12000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12000CUAUUUUUUCCCUGAAUCA85.9371354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11998-12020AACTATTTTTTCCCTGAATCATTUGAUUCAGGGAAAAAAUAGUUCUAUUUUUUCCCUGAAUCAUUU20.4-9.7


Target Position: 14017, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14017CAGUAUAUAAUACAUACAA99.668358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14015-14037TACAGTATATAATACATACAACAUUGUAUGUAUUAUAUACUGUACAGUAUAUAAUACAUACAACAU20.46.1


Target Position: 10416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10416GAAUCAUUUGAGAUGAAGU89.6905737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10414-10436CTGAATCATTTGAGATGAAGTTTACUUCAUCUCAAAUGAUUCAGGAAUCAUUUGAGAUGAAGUUUU20.47.2


Target Position: 14029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14029CAUACAACAUCGAAAAAAA101.30531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14027-14049TACATACAACATCGAAAAAAAAAUUUUUUUCGAUGUUGUAUGUACAUACAACAUCGAAAAAAAAAU0.714.6


Target Position: 6079, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6079GACAUUUGAGUGGAAAACA85.67621415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6077-6099GTGACATTTGAGTGGAAAACAAAUGUUUUCCACUCAAAUGUCACGACAUUUGAGUGGAAAACAAAU21.212.112


Target Position: 10174, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10174GAGACAUAGAAUAAGAACU87.19751115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10172-10194CAGAGACATAGAATAAGAACTGGAGUUCUUAUUCUAUGUCUCUGGAGACAUAGAAUAAGAACUGGU14.620.3


Target Position: 779, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GUUUGUAGAGACAUAGACA97.5638108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
777-799ATGTTTGTAGAGACATAGACACAUGUCUAUGUCUCUACAAACAUGUUUGUAGAGACAUAGACACAU20.311.823


Target Position: 13678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13678GUAAUGAUAAGUAUCUCAA94.6848250

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13676-13698TTGTAATGATAAGTATCTCAAAAUUGAGAUACUUAUCAUUACAAGUAAUGAUAAGUAUCUCAAAAU21.48.7


Target Position: 10045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10045CGUGACAGCAAAUCAGAAU83.56131904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
52610063CGTGACAGCAAATCAGAATATTCTGATTTGCTGTCACG0.440300.156800.767201.000000.929300.75000


Target Position: 9155, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9155CUGUCUUUUCUUUCUGUUA88.0031989

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9153-9175GCCTGTCTTTTCTTTCTGTTAAGUAACAGAAAGAAAAGACAGGCCUGUCUUUUCUUUCUGUUAAGU19.219.2


Target Position: 9223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9223AGGCAGCACUUUCAUUUUU75.66574479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6679241AGGCAGCACTTTCATTTTTAAAAATGAAAGTGCTGCCT0.651200.085400.844800.750001.000001.00000


Target Position: 9179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9179CUGAAUUUGGGUUUUAACU71.38046146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9177-9199GACTGAATTTGGGTTTTAACTCTAGUUAAAACCCAAAUUCAGUCCUGAAUUUGGGUUUUAACUCUU0.07.4


Target Position: 9045, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9045CUGUAAUAUAAAGUAUUCA87.83671017

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9043-9065TACTGTAATATAAAGTATTCAACUGAAUACUUUAUAUUACAGUACUGUAAUAUAAAGUAUUCAACU14.58.522


Target Position: 8563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8563CUUUACUGUGCUUAUUUUU75.96364353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8561-8583ACCTTTACTGTGCTTATTTTTTTAAAAAUAAGCACAGUAAAGGUCUUUACUGUGCUUAUUUUUUUU-9.711.822


Target Position: 8991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8991GAGUGUAUUUUUUAAAAUU92.8626397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8989-9011ATGAGTGTATTTTTTAAAATTGAAAUUUUAAAAAAUACACUCAUGAGUGUAUUUUUUAAAAUUGAU-9.719.011


Target Position: 2970, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2970GUGGAUUUGUGUUUAAUCU81.82782424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2968-2990CAGTGGATTTGTGTTTAATCTTAAGAUUAAACACAAAUCCACUGGUGGAUUUGUGUUUAAUCUUAU2.120.121


Target Position: 13774, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13774GCGGUUUUUUUUUUCUGUA85.82511374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13772-13794ATGCGGTTTTTTTTTTCTGTAAAUACAGAAAAAAAAAACCGCAUGCGGUUUUUUUUUUCUGUAAAU19.219.4


Target Position: 1782, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1782GUAAAAAUCUGGGAAAAUU83.07612041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1780-1802AAGTAAAAATCTGGGAAAATTTAAAUUUUCCCAGAUUUUUACUUGUAAAAAUCUGGGAAAAUUUAU14.2-9.722


Target Position: 1237, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237GAAUGUCUGUGGAGAAACU91.3349539

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1235-1257TTGAATGTCTGTGGAGAAACTGAAGUUUCUCCACAGACAUUCAAGAAUGUCUGUGGAGAAACUGAU21.519.222


Target Position: 6653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6653GACAACUACCUGUAUGAGA88.3131933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6651-6673GGGACAACTACCTGTATGAGATCUCUCAUACAGGUAGUUGUCCCGACAACUACCUGUAUGAGAUCU20.319.022


Target Position: 10021, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10021GAUGAUAUUUUUAGGAAAA96.5368156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10019-10041CAGATGATATTTTTAGGAAAACAUUUUCCUAAAAAUAUCAUCUGGAUGAUAUUUUUAGGAAAACAU19.98.5


Target Position: 11589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11589CCUUUUAUGCUAUCUUGUA91.8476491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11587-11609TACCTTTTATGCTATCTTGTAGTUACAAGAUAGCAUAAAAGGUACCUUUUAUGCUAUCUUGUAGUU19.2-4.3


Target Position: 5403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5403CGGACAAGCAUUUCAACUA93.2363362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8265421CGGACAAGCATTTCAACTATAGTTGAAATGCTTGTCCG0.493900.065500.741401.000000.994600.62500


Target Position: 1681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GAAGCAUUUUUUCAUUAAU89.6905736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1679-1701AAGAAGCATTTTTTCATTAATATAUUAAUGAAAAAAUGCUUCUUGAAGCAUUUUUUCAUUAAUAUU8.918.522


Target Position: 14035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14035ACAUCGAAAAAAAAAAAAA83.1072029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69314053ACATCGAAAAAAAAAAAAATTTTTTTTTTTTTCGATGT0.998800.983600.706900.750001.000001.00000


Target Position: 1769, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769GAUAAAAAUGGAAGUAAAA96.4394159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1767-1789TGGATAAAAATGGAAGTAAAAATUUUUACUUCCAUUUUUAUCCAGAUAAAAAUGGAAGUAAAAAUU4.9-9.712


Target Position: 10528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10528CAUUGUACAAGUUAAAGCA90.7287619

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10526-10548TCCATTGTACAAGTTAAAGCACTUGCUUUAACUUGUACAAUGGACAUUGUACAAGUUAAAGCACUU13.714.6


Target Position: 12852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12852CCAAACAGGUAUAUCAAAA92.4476429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12850-12872GCCCAAACAGGTATATCAAAAAAUUUUGAUAUACCUGUUUGGGCCCAAACAGGUAUAUCAAAAAAU8.916.7


Target Position: 5210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5210CCUGAUUUCUACAUCAAUA98.602378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5208-5230ACCCTGATTTCTACATCAATATTUAUUGAUGUAGAAAUCAGGGUCCUGAUUUCUACAUCAAUAUUU13.612.032


Target Position: 1215, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GAAAAGAAUAUUUGUUUUA90.9667586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1213-1235TGGAAAAGAATATTTGTTTTATTUAAAACAAAUAUUCUUUUCCAGAAAAGAAUAUUUGUUUUAUUU5.65.522


Target Position: 3508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508CUAUUUGAGCGUUUGCAAU80.00342953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3506-3528TTCTATTTGAGCGTTTGCAATCCAUUGCAAACGCUCAAAUAGAACUAUUUGAGCGUUUGCAAUCCU20.08.922


Target Position: 3906, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906GCGAAUACACUUAUUACUU84.84941591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5213924GCGAATACACTTATTACTTAAGTAATAAGTGTATTCGC0.443500.299300.784501.000000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3904-3926TGGCGAATACACTTATTACTTCCAAGUAAUAAGUGUAUUCGCCAGCGAAUACACUUAUUACUUCCU6.316.533


Target Position: 8033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8033GUUUGAGAAAAAGGAAAAA83.69041870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8031-8053AGGTTTGAGAAAAAGGAAAAAAAUUUUUCCUUUUUCUCAAACCUGUUUGAGAAAAAGGAAAAAAAU18.720.411


Target Position: 2053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2053GUUUUCUUUUGACUUAUCA84.02421778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2051-2073GGGTTTTCTTTTGACTTATCACCUGAUAAGUCAAAAGAAAACCCGUUUUCUUUUGACUUAUCACCU14.55.522


Target Position: 13814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13814GCCCCUUCUUCUACCUCUU77.84723677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
25013832GCCCCTTCTTCTACCTCTTAAGAGGTAGAAGAAGGGGC0.883800.798400.862101.000001.000001.00000


Target Position: 3269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GUUUGCAAUGAUGAUGUUU75.51034532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3267-3289TTGTTTGCAATGATGATGTTTACAAACAUCAUCAUUGCAAACAAGUUUGCAAUGAUGAUGUUUACU20.520.023


Target Position: 9057, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9057GUAUUCAACAAUUUCAAUA89.2417806

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9055-9077AAGTATTCAACAATTTCAATAAAUAUUGAAAUUGUUGAAUACUUGUAUUCAACAAUUUCAAUAAAU7.48.932


Target Position: 10046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10046GUGACAGCAAAUCAGAAUU79.57163102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97810064GTGACAGCAAATCAGAATTAATTCTGATTTGCTGTCAC0.254300.059400.784500.750000.929300.62500


Target Position: 12641, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12641CGUGAAAUCACAAUAGAAA96.9755135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54912659CGTGAAATCACAATAGAAATTTCTATTGTGATTTCACG0.753800.107400.775901.000000.907600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12639-12661CACGTGAAATCACAATAGAAAATUUUCUAUUGUGAUUUCACGUGCGUGAAAUCACAAUAGAAAAUU6.914.8


Target Position: 2107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107GACAAAGAAGUAUGACUUU86.74191202

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2105-2127GAGACAAAGAAGTATGACTTTTAAAAGUCAUACUUCUUUGUCUCGACAAAGAAGUAUGACUUUUAU19.219.232


Target Position: 9070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9070UCAAUAAAAGAUAAAUUAU79.90322991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9429088TCAATAAAAGATAAATTATATAATTTATCTTTTATTGA0.344700.241800.681000.750001.000001.00000


Target Position: 13668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13668CAAUGAUUUUGUAAUGAUA103.48313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13666-13688GGCAATGATTTTGTAATGATAAGUAUCAUUACAAAAUCAUUGCCCAAUGAUUUUGUAAUGAUAAGU8.77.2


Target Position: 634, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634GAAAGACAUAUUUAAAGCA91.4804528

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
632-654AAGAAAGACATATTTAAAGCAAAUGCUUUAAAUAUGUCUUUCUUGAAAGACAUAUUUAAAGCAAAU13.719.221


Target Position: 992, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992GUGACUAUUACAUUUGUUU82.06642344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
990-1012CGGTGACTATTACATTTGTTTGCAAACAAAUGUAAUAGUCACCGGUGACUAUUACAUUUGUUUGCU5.320.333


Target Position: 11176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11176UCCUUCCUUUUUCCUCUUU58.922410721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71011194TCCTTCCTTTTTCCTCTTTAAAGAGGAAAAAGGAAGGA0.999800.999300.870700.750001.000001.00000


Target Position: 11670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11670GUGUUUGAGGGAAACACAA88.3004935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11668-11690CAGTGTTTGAGGGAAACACAATCUUGUGUUUCCCUCAAACACUGGUGUUUGAGGGAAACACAAUCU19.320.5


Target Position: 10303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10303CCCUAAAAUAAUACGUAAC71.1996216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69310321CCCTAAAATAATACGTAACGTTACGTATTATTTTAGGG0.537300.458300.844800.750000.994600.75000


Target Position: 8299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8299GAGAGUUUGCCUGUUCUAU84.40531684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8297-8319TGGAGAGTTTGCCTGTTCTATGCAUAGAACAGGCAAACUCUCCAGAGAGUUUGCCUGUUCUAUGCU20.317.733


Target Position: 10524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10524GAUCCAUUGUACAAGUUAA104.8867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10522-10544CCGATCCATTGTACAAGTTAAAGUUAACUUGUACAAUGGAUCGGGAUCCAUUGUACAAGUUAAAGU11.820.1


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758UGUGUGCAGUGGAUAAAAA88.9237840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631776TGTGTGCAGTGGATAAAAATTTTTATCCACTGCACACA0.421500.068700.706900.750001.000001.00000


Target Position: 12576, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12576GAAGUGAAACAGCUUUUCU85.38731466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12574-12596TTGAAGTGAAACAGCTTTTCTTGAGAAAAGCUGUUUCACUUCAAGAAGUGAAACAGCUUUUCUUGU21.019.2


Target Position: 3034, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034GAAGAUUUUUAUGUUUAAU87.19841113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3032-3054GGGAAGATTTTTATGTTTAATGTAUUAAACAUAAAAAUCUUCCCGAAGAUUUUUAUGUUUAAUGUU7.25.322


Target Position: 13977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13977GAUUUUCUUAAAACUUUUU80.08872921

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13975-13997ATGATTTTCTTAAAACTTTTTCTAAAAAGUUUUAAGAAAAUCAUGAUUUUCUUAAAACUUUUUCUU3.25.3


Target Position: 767, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767CUAUUCAUCAAUGUUUGUA82.72272151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
765-787CTCTATTCATCAATGTTTGTAGAUACAAACAUUGAUGAAUAGAGCUAUUCAUCAAUGUUUGUAGAU19.38.722


Target Position: 8993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8993GUGUAUUUUUUAAAAUUGA86.32011266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8991-9013GAGTGTATTTTTTAAAATTGATTUCAAUUUUAAAAAAUACACUCGUGUAUUUUUUAAAAUUGAUUU-3.36.901


Target Position: 335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335CUUUAUAAAAUCAACAUCU80.39052813

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
333-355TACTTTATAAAATCAACATCTGTAGAUGUUGAUUUUAUAAAGUACUUUAUAAAAUCAACAUCUGUU20.5-7.522


Target Position: 6786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6786CCAAGUACUACCUUCAAGA88.1127963

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6784-6806GACCAAGTACTACCTTCAAGACGUCUUGAAGGUAGUACUUGGUCCCAAGUACUACCUUCAAGACGU16.619.022


Target Position: 13020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13020GAGAAUGUAAAUUGGUAUA92.4713425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13018-13040GTGAGAATGTAAATTGGTATAGCUAUACCAAUUUACAUUCUCACGAGAAUGUAAAUUGGUAUAGCU20.019.2


Target Position: 13232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13232CAAGAAAAUGCAUGUAUGU83.23251992

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13230-13252ATCAAGAAAATGCATGTATGTATACAUACAUGCAUUUUCUUGAUCAAGAAAAUGCAUGUAUGUAUU13.35.5


Target Position: 6138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6138UCCAGAAACACAAAACCUA79.5833097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8116156TCCAGAAACACAAAACCTATAGGTTTTGTGTTTCTGGA0.640400.101400.698300.750001.000001.00000


Target Position: 11980, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11980CAAACUUACAGAACAAAGA86.89141165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11978-12000TTCAAACTTACAGAACAAAGAACUCUUUGUUCUGUAAGUUUGAACAAACUUACAGAACAAAGAACU10.34.9


Target Position: 13974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13974CAUGAUUUUCUUAAAACUU83.59111894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13972-13994CTCATGATTTTCTTAAAACTTTTAAGUUUUAAGAAAAUCAUGAGCAUGAUUUUCUUAAAACUUUUU4.97.2


Target Position: 13352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13352GCCAGACACAGAAAGAAAA91.5422523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
13113370GCCAGACACAGAAAGAAAATTTTCTTTCTGTGTCTGGC0.914600.525701.000001.000001.000001.00000


Target Position: 2987, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987CUUAAUCCGCUAAACAGUU75.0914726

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2985-3007ATCTTAATCCGCTAAACAGTTCGAACUGUUUAGCGGAUUAAGAUCUUAAUCCGCUAAACAGUUCGU17.815.533


Target Position: 10635, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10635GGAUUUCUGGAAAUAUCCU83.87631822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10633-10655CTGGATTTCTGGAAATATCCTTTAGGAUAUUUCCAGAAAUCCAGGGAUUUCUGGAAAUAUCCUUUU15.414.8


Target Position: 13904, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13904GUAAAGACAAGGAUGAAGA85.90831358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13902-13924GGGTAAAGACAAGGATGAAGACCUCUUCAUCCUUGUCUUUACCCGUAAAGACAAGGAUGAAGACCU20.414.6


Target Position: 11383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11383CGGCUAAUUUUUGUAUUUU81.49492510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86911401CGGCTAATTTTTGTATTTTAAAATACAAAAATTAGCCG0.643400.060500.913801.000001.000001.00000


Target Position: 8562, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8562CCUUUACUGUGCUUAUUUU88.2695939

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4856219CCTTTACTGTGCTTATTTT1/1/0/0100.00IGF2RNM_000876.21NANANA6:160527054..160527072(+)00IGF2R(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8560-8582CACCTTTACTGTGCTTATTTTTTAAAAUAAGCACAGUAAAGGUGCCUUUACUGUGCUUAUUUUUUU-4.39.821


Target Position: 13914, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13914GGAUGAAGACCUUUAUGAU100.47543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90813932GGATGAAGACCTTTATGATATCATAAAGGTCTTCATCC0.530500.056900.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13912-13934AAGGATGAAGACCTTTATGATGAAUCAUAAAGGUCUUCAUCCUUGGAUGAAGACCUUUAUGAUGAU8.920.400


Target Position: 13387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13387CUUAUAUGUGGAAUCUAAA94.0582295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13385-13407CACTTATATGTGGAATCTAAAAAUUUAGAUUCCACAUAUAAGUGCUUAUAUGUGGAAUCUAAAAAU6.90.0


Target Position: 562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
562GGGAACUCCUGAAUUUGUA91.5972517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949580GGGAACTCCTGAATTTGTATACAAATTCAGGAGTTCCC0.352600.052800.810301.000000.989100.75000


Target Position: 14033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14033CAACAUCGAAAAAAAAAAA89.5655754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14031-14053TACAACATCGAAAAAAAAAAAAAUUUUUUUUUUUCGAUGUUGUACAACAUCGAAAAAAAAAAAAAU-11.321.101


Target Position: 666, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CAUGCUAUGUGUUUGAUGA94.398263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
664-686GCCATGCTATGTGTTTGATGAAGUCAUCAAACACAUAGCAUGGCCAUGCUAUGUGUUUGAUGAAGU13.819.723


Target Position: 13358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13358CACAGAAAGAAAAAUACCA89.4148778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13356-13378GACACAGAAAGAAAAATACCAGAUGGUAUUUUUCUUUCUGUGUCCACAGAAAGAAAAAUACCAGAU13.919.2


Target Position: 10068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10068CUCUUUUUCAGAGAAAUGA76.00364339

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10066-10088GACTCTTTTTCAGAGAAATGATTUCAUUUCUCUGAAAAAGAGUCCUCUUUUUCAGAGAAAUGAUUU12.05.5


Target Position: 11990, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11990GAACAAAGAACUAUUUUUU87.9579996

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11988-12010CAGAACAAAGAACTATTTTTTCCAAAAAAUAGUUCUUUGUUCUGGAACAAAGAACUAUUUUUUCCU-9.710.3


Target Position: 8573, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8573CUUAUUUUUUUAAGAAAAA84.57341651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8571-8593TGCTTATTTTTTTAAGAAAAAAGUUUUUCUUAAAAAAAUAAGCACUUAUUUUUUUAAGAAAAAAGU5.5-9.711


Target Position: 5163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5163GUUAUGAGGCUUAUGAUGA85.74881392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5161-5183TGGTTATGAGGCTTATGATGAGAUCAUCAUAAGCCUCAUAACCAGUUAUGAGGCUUAUGAUGAGAU14.913.422


Target Position: 7871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7871CCCCAAGUCCUCAUUUAAA89.3866782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8387889CCCCAAGTCCTCATTTAAATTTAAATGAGGACTTGGGG0.303300.160500.991401.000001.000001.00000


Target Position: 11617, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11617GUUUGCAAAACAAAUUGAA84.52831658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11615-11637CAGTTTGCAAAACAAATTGAATAUUCAAUUUGUUUUGCAAACUGGUUUGCAAAACAAAUUGAAUAU7.420.0


Target Position: 7697, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7697CGAUGAUGCUUCUAUAAUU99.707957

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3769719CGATGATGCTTCTATAATT1/1/0/0100.00IGF2RNM_000876.21NANANA6:160526189..160526207(+)00IGF2R(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4007715CGATGATGCTTCTATAATTAATTATAGAAGCATCATCG0.566600.174700.784501.000001.000001.00000


Target Position: 11633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11633GAAUAAAAAGUAAUUGAUA100.77639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11631-11653TTGAATAAAAAGTAATTGATAATUAUCAAUUACUUUUUAUUCAAGAAUAAAAAGUAAUUGAUAAUU7.2-9.7


Target Position: 8995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8995GUAUUUUUUAAAAUUGAUU78.24323541

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8993-9015GTGTATTTTTTAAAATTGATTTTAAUCAAUUUUAAAAAAUACACGUAUUUUUUAAAAUUGAUUUUU7.2-9.712


Target Position: 13610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13610CUCCAAAUAAAAGGAAAUU71.02136287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13608-13630CTCTCCAAATAAAAGGAAATTATAAUUUCCUUUUAUUUGGAGAGCUCCAAAUAAAAGGAAAUUAUU18.720.1


Target Position: 384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CAUCAAGUGCUGUUUGUAU90.9038599

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
382-404GCCATCAAGTGCTGTTTGTATGCAUACAAACAGCACUUGAUGGCCAUCAAGUGCUGUUUGUAUGCU14.719.223


Target Position: 13353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13353CCAGACACAGAAAGAAAAA87.6691042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
18413371CCAGACACAGAAAGAAAAATTTTTCTTTCTGTGTCTGG0.908700.614300.844801.000001.000001.00000


Target Position: 9040, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9040CUUUACUGUAAUAUAAAGU75.05854735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9038-9060AACTTTACTGTAATATAAAGTATACUUUAUAUUACAGUAAAGUUCUUUACUGUAAUAUAAAGUAUU-2.311.821


Target Position: 4246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4246GACUGAAUGUUCAUUCAAA105.7235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4244-4266CTGACTGAATGTTCATTCAAAGAUUUGAAUGAACAUUCAGUCAGGACUGAAUGUUCAUUCAAAGAU13.819.232


Target Position: 9181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9181GAAUUUGGGUUUUAACUCU85.27911491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9179-9201CTGAATTTGGGTTTTAACTCTGGAGAGUUAAAACCCAAAUUCAGGAAUUUGGGUUUUAACUCUGGU14.611.3


Target Position: 13164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13164UGCAGCAUUAUUCACAAUA76.97663980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63313182TGCAGCATTATTCACAATATATTGTGAATAATGCTGCA0.384700.156000.810300.750001.000001.00000


Target Position: 11385, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11385GCUAAUUUUUGUAUUUUUA92.2717447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32011403GCTAATTTTTGTATTTTTATAAAAATACAAAAATTAGC0.579400.265200.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11383-11405CGGCTAATTTTTGTATTTTTAATUAAAAAUACAAAAAUUAGCCGGCUAAUUUUUGUAUUUUUAAUU-9.7-4.300


Target Position: 1286, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286GCAGUUUGCCAAGUGAAAA86.78431191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1284-1306CTGCAGTTTGCCAAGTGAAAAAGUUUUCACUUGGCAAACUGCAGGCAGUUUGCCAAGUGAAAAAGU19.216.723


Target Position: 8005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8005CUAUUUAUUGACUUUGACA90.906598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8003-8025CCCTATTTATTGACTTTGACAATUGUCAAAGUCAAUAAAUAGGGCUAUUUAUUGACUUUGACAAUU19.2-8.033


Target Position: 1959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959GUUGCUUUUAUGAGUUUGA80.47952786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1957-1979CGGTTGCTTTTATGAGTTTGAGTUCAAACUCAUAAAAGCAACCGGUUGCUUUUAUGAGUUUGAGUU19.218.632


Target Position: 8649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8649CAGAAACUGCAUGAAAAAU82.66812169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8647-8669TACAGAAACTGCATGAAAAATCAAUUUUUCAUGCAGUUUCUGUACAGAAACUGCAUGAAAAAUCAU7.717.722


Target Position: 12451, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12451GAUUGUCAUAUAGAAACAU88.1833952

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12449-12471TGGATTGTCATATAGAAACATTTAUGUUUCUAUAUGACAAUCCAGAUUGUCAUAUAGAAACAUUUU19.220.5


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871GGCAAGAAAAUUAAAACUA89.6944735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631889GGCAAGAAAATTAAAACTATAGTTTTAATTTTCTTGCC0.550300.321400.827601.000001.000001.00000


Target Position: 13692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13692CUCAAAACAUCAUGUUGUA91.7267503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13690-13712ATCTCAAAACATCATGTTGTACAUACAACAUGAUGUUUUGAGAUCUCAAAACAUCAUGUUGUACAU19.314.9


Target Position: 10343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10343GAACAUAUAGACAUACAGA101.50327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10341-10363AGGAACATATAGACATACAGACAUCUGUAUGUCUAUAUGUUCCUGAACAUAUAGACAUACAGACAU17.96.7


Target Position: 9459, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9459CUGAGUUUUCCAUCUUAAA89.1162817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9457-9479CACTGAGTTTTCCATCTTAAATTUUUAAGAUGGAAAACUCAGUGCUGAGUUUUCCAUCUUAAAUUU6.919.2


Target Position: 5785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5785GGAUGAAGCGGUCGUUUUA95.4347217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5783-5805CAGGATGAAGCGGTCGTTTTAAGUAAAACGACCGCUUCAUCCUGGGAUGAAGCGGUCGUUUUAAGU15.320.433


Target Position: 9986, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9986GAAAAAAGAGUAACUACUU89.2128809

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9984-10006CTGAAAAAAGAGTAACTACTTGCAAGUAGUUACUCUUUUUUCAGGAAAAAAGAGUAACUACUUGCU17.6-5.9


Target Position: 11203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11203CCUUUUCUCUCUCUCUCUU81.72182452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76711221CCTTTTCTCTCTCTCTCTTAAGAGAGAGAGAGAAAAGG0.782600.772300.706901.000001.000001.00000


Target Position: 6210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6210GAGUCUCGUACUAUAUAAA102.47118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7446228GAGTCTCGTACTATATAAATTTATATAGTACGAGACTC0.517800.074900.810300.750001.000001.00000


Target Position: 13062, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13062CCUGAAAAAAUUAAGAACA84.54291655

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13060-13082TTCCTGAAAAAATTAAGAACAGCUGUUCUUAAUUUUUUCAGGAACCUGAAAAAAUUAAGAACAGCU14.612.2


Target Position: 10359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10359AGACAGGAGACAACAUAUA90.5069650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91010377AGACAGGAGACAACATATATATATGTTGTCTCCTGTCT0.881500.690600.681000.750001.000001.00000


Target Position: 9571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9571UCCCUUUUUUUUUCCUGUA71.73895996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9299589TCCCTTTTTTTTTCCTGTATACAGGAAAAAAAAAGGGA0.272600.247800.689700.750001.000001.00000


Target Position: 11965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11965CAACAUGUAGACAUUCAAA100.10548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11963-11985GACAACATGTAGACATTCAAACTUUUGAAUGUCUACAUGUUGUCCAACAUGUAGACAUUCAAACUU13.819.3


Target Position: 8198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8198GUCUCUUUUCUCUUUUGCU79.29373198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8196-8218CTGTCTCTTTTCTCTTTTGCTTTAGCAAAAGAGAAAAGAGACAGGUCUCUUUUCUCUUUUGCUUUU18.619.122


Target Position: 5358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5358CAAAUGAGAUUUACUUGAA97.1738125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5356-5378AGCAAATGAGATTTACTTGAATTUUCAAGUAAAUCUCAUUUGCUCAAAUGAGAUUUACUUGAAUUU20.312.023


Target Position: 11567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11567GUCAGUUAUUUGUAUUUCU84.35931699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11565-11587TGGTCAGTTATTTGTATTTCTTTAGAAAUACAAAUAACUGACCAGUCAGUUAUUUGUAUUUCUUUU10.020.3


Target Position: 8875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8875CUUUUCUCGCAUUGUAGAA82.58682193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8873-8895GACTTTTCTCGCATTGTAGAATTUUCUACAAUGCGAGAAAAGUCCUUUUCUCGCAUUGUAGAAUUU20.314.832


Target Position: 10010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10010CUGUUGUUACAGAUGAUAU89.1095818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10008-10030AGCTGTTGTTACAGATGATATTTAUAUCAUCUGUAACAACAGCUCUGUUGUUACAGAUGAUAUUUU17.419.3


Target Position: 10338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10338GGAAGGAACAUAUAGACAU92.2756446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68410356GGAAGGAACATATAGACATATGTCTATATGTTCCTTCC0.733300.100300.715501.000001.000001.00000


Target Position: 8570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8570GUGCUUAUUUUUUUAAGAA92.2264451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8568-8590CTGTGCTTATTTTTTTAAGAAAAUUCUUAAAAAAAUAAGCACAGGUGCUUAUUUUUUUAAGAAAAU7.119.722


Target Position: 12493, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12493CACUUGUUCUGUAUGUUGU82.29312270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12491-12513AACACTTGTTCTGTATGTTGTTAACAACAUACAGAACAAGUGUUCACUUGUUCUGUAUGUUGUUAU13.517.8


Target Position: 9517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9517GAAGUUACUCCAGUGUUAU86.88541166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9515-9537AGGAAGTTACTCCAGTGTTATAAAUAACACUGGAGUAACUUCCUGAAGUUACUCCAGUGUUAUAAU19.012.9


Target Position: 13632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13632UGAGGUGAUGGAUAUGUUU79.30973193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88513650TGAGGTGATGGATATGTTTAAACATATCCATCACCTCA0.439500.063600.724100.750001.000001.00000


Target Position: 2083, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083GAAAAAUGGUGCCUAUAAA99.942252

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9208319GAAAAATGGTGCCTATAAA1/1/0/097.21IGF2RNM_000876.21NANANA18:169721..169739(-)|6:160467561..160467579(+)|4:79752520..79752538(+)00IGF2R(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2081-2103AAGAAAAATGGTGCCTATAAAGTUUUAUAGGCACCAUUUUUCUUGAAAAAUGGUGCCUAUAAAGUU12.3-3.313


Target Position: 9529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9529GUGUUAUAAACAAACUUCU79.9432971

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9527-9549CAGTGTTATAAACAAACTTCTTAAGAAGUUUGUUUAUAACACUGGUGUUAUAAACAAACUUCUUAU13.38.5


Target Position: 9701, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9701GUCUUCUAAAAGUUUACAU79.78633024

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9699-9721AGGTCTTCTAAAAGTTTACATTAAUGUAAACUUUUAGAAGACCUGUCUUCUAAAAGUUUACAUUAU14.720.2


Target Position: 9531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9531GUUAUAAACAAACUUCUUA90.285674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9529-9551GTGTTATAAACAAACTTCTTAGAUAAGAAGUUUGUUUAUAACACGUUAUAAACAAACUUCUUAGAU17.7-7.5


Target Position: 9438, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9438GUUUUCUCUUGAGUAAACU73.96655116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9436-9458ATGTTTTCTCTTGAGTAAACTCAAGUUUACUCAAGAGAAAACAUGUUUUCUCUUGAGUAAACUCAU12.914.8


Target Position: 11189, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11189CUCUUUCUUUCUUUCCUUU77.96783637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11187-11209TCCTCTTTCTTTCTTTCCTTTTCAAAGGAAAGAAAGAAAGAGGACUCUUUCUUUCUUUCCUUUUCU18.719.1


Target Position: 9633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9633GGAGUUACCUUUUUAAAAA98.045687

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9631-9653TTGGAGTTACCTTTTTAAAAAAGUUUUUAAAAAGGUAACUCCAAGGAGUUACCUUUUUAAAAAAGU-9.121.4


Target Position: 11386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11386CUAAUUUUUGUAUUUUUAA86.5821225

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11384-11406GGCTAATTTTTGTATTTTTAATAUUAAAAAUACAAAAAUUAGCCCUAAUUUUUGUAUUUUUAAUAU-9.7-9.700


Target Position: 11004, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11004GAUAGUCUAGAUGAAAGUA97.0209131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11002-11024AAGATAGTCTAGATGAAAGTAAAUACUUUCAUCUAGACUAUCUUGAUAGUCUAGAUGAAAGUAAAU19.218.9


Target Position: 6458, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6458GCAUUCAAGAGGUUUGAUA90.2636678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6456-6478CTGCATTCAAGAGGTTTGATATCUAUCAAACCUCUUGAAUGCAGGCAUUCAAGAGGUUUGAUAUCU14.813.823


Target Position: 13808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13808GCGUCAGCCCCUUCUUCUA89.1429815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54013826GCGTCAGCCCCTTCTTCTATAGAAGAAGGGGCTGACGC0.918900.109700.750001.000001.000001.00000


Target Position: 10256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10256GGUUCUUAUGAACAUUUUA96.9695136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10254-10276CTGGTTCTTATGAACATTTTAAGUAAAAUGUUCAUAAGAACCAGGGUUCUUAUGAACAUUUUAAGU5.314.6


Target Position: 12455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12455GUCAUAUAGAAACAUUUUU78.56893433

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12453-12475TTGTCATATAGAAACATTTTTCGAAAAAUGUUUCUAUAUGACAAGUCAUAUAGAAACAUUUUUCGU5.310.2


Target Position: 13815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13815CCCCUUCUUCUACCUCUUC61.77999825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43013833CCCCTTCTTCTACCTCTTCGAAGAGGTAGAAGAAGGGG0.786500.736000.819000.750001.000001.00000


Target Position: 3342, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3342GAAACACUUACUUUGAGUU86.63391220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3340-3362CCGAAACACTTACTTTGAGTTTGAACUCAAAGUAAGUGUUUCGGGAAACACUUACUUUGAGUUUGU19.217.832


Target Position: 10839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10839CAAGAUAGCCACAUUGAGU85.93721353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10837-10859GGCAAGATAGCCACATTGAGTTGACUCAAUGUGGCUAUCUUGCCCAAGAUAGCCACAUUGAGUUGU18.111.6


Target Position: 5213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5213GAUUUCUACAUCAAUAUUU85.59011428

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5211-5233CTGATTTCTACATCAATATTTGTAAAUAUUGAUGUAGAAAUCAGGAUUUCUACAUCAAUAUUUGUU-1.86.922


Target Position: 2109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109CAAAGAAGUAUGACUUUUA98.406380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2107-2129GACAAAGAAGTATGACTTTTATAUAAAAGUCAUACUUCUUUGUCCAAAGAAGUAUGACUUUUAUAU13.310.322


Target Position: 2289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289CCUAUAACAAUGAAAGACA89.4212774

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2287-2309ACCCTATAACAATGAAAGACACAUGUCUUUCAUUGUUAUAGGGUCCUAUAACAAUGAAAGACACAU21.56.322


Target Position: 5344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5344ACUCAAUCCAAUAGCAAAU76.26694250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9335362ACTCAATCCAATAGCAAATATTTGCTATTGGATTGAGT0.271200.100500.698300.750001.000001.00000


Target Position: 9033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9033CAAUCAACUUUACUGUAAU93.9339309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9031-9053TTCAATCAACTTTACTGTAATATAUUACAGUAAAGUUGAUUGAACAAUCAACUUUACUGUAAUAUU19.014.822


Target Position: 4122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4122GCUCCACAGCCAUCUUCUU83.14452020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7934140GCTCCACAGCCATCTTCTTAAGAAGATGGCTGTGGAGC0.909300.068900.715501.000000.923900.62500


Target Position: 5201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5201GAUACCAACCCUGAUUUCU75.47744557

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5199-5221CCGATACCAACCCTGATTTCTACAGAAAUCAGGGUUGGUAUCGGGAUACCAACCCUGAUUUCUACU16.320.032


Target Position: 14008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14008GUAAGAAUACAGUAUAUAA108.31

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14006-14028TTGTAAGAATACAGTATATAATAUUAUAUACUGUAUUCUUACAAGUAAGAAUACAGUAUAUAAUAU2.86.900


Target Position: 1873, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873CAAGAAAAUUAAAACUAAU93.8182323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1871-1893GGCAAGAAAATTAAAACTAATATAUUAGUUUUAAUUUUCUUGCCCAAGAAAAUUAAAACUAAUAUU4.95.521


Target Position: 10119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10119CUUCCUUUCAACAAAAUUU77.61433763

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10117-10139AGCTTCCTTTCAACAAAATTTTTAAAUUUUGUUGAAAGGAAGCUCUUCCUUUCAACAAAAUUUUUU-3.318.7


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563GGAACUCCUGAAUUUGUAA96.6059155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735581GGAACTCCTGAATTTGTAATTACAAATTCAGGAGTTCC0.335500.085800.836201.000001.000001.00000


Target Position: 10293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10293ACUUCACCAACCCUAAAAU76.52114146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79410311ACTTCACCAACCCTAAAATATTTTAGGGTTGGTGAAGT0.824000.168100.698300.750001.000001.00000


Target Position: 3641, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641GGAUCUUUGAGCAUCAUGU86.07291322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3639-3661ATGGATCTTTGAGCATCATGTATACAUGAUGCUCAAAGAUCCAUGGAUCUUUGAGCAUCAUGUAUU19.414.832


Target Position: 1248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248GAGAAACUGAAAUACAGUU87.54451062

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1246-1268TGGAGAAACTGAAATACAGTTCTAACUGUAUUUCAGUUUCUCCAGAGAAACUGAAAUACAGUUCUU19.017.722


Target Position: 13612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13612CCAAAUAAAAGGAAAUUAU84.46641668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13610-13632CTCCAAATAAAAGGAAATTATTTAUAAUUUCCUUUUAUUUGGAGCCAAAUAAAAGGAAAUUAUUUU2.1-1.4


Target Position: 7973, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7973CCGAUAUAUUUUAGCAUUU82.18282305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1487991CCGATATATTTTAGCATTTAAATGCTAAAATATATCGG0.793600.539300.913801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7971-7993CCCCGATATATTTTAGCATTTTAAAAUGCUAAAAUAUAUCGGGGCCGAUAUAUUUUAGCAUUUUAU19.710.332


Target Position: 12519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12519UGUUUUGCAAAAAAUGAAA76.83274040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70512537TGTTTTGCAAAAAATGAAATTTCATTTTTTGCAAAACA0.570200.123400.706900.750001.000001.00000


Target Position: 9037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9037CAACUUUACUGUAAUAUAA102.56317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9035-9057ATCAACTTTACTGTAATATAAAGUUAUAUUACAGUAAAGUUGAUCAACUUUACUGUAAUAUAAAGU-5.94.922


Target Position: 9613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9613CAUUUUUAAAUUAUCCAAU82.57182197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9611-9633CTCATTTTTAAATTATCCAATTGAUUGGAUAAUUUAAAAAUGAGCAUUUUUAAAUUAUCCAAUUGU21.2-9.7


Target Position: 10991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10991GGCUUUUGAGCAAGAUAGU78.37993488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10989-11011TGGGCTTTTGAGCAAGATAGTCTACUAUCUUGCUCAAAAGCCCAGGCUUUUGAGCAAGAUAGUCUU11.618.6


Target Position: 12510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12510GUUAACAGAUGUUUUGCAA89.324793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12508-12530TTGTTAACAGATGTTTTGCAAAAUUGCAAAACAUCUGUUAACAAGUUAACAGAUGUUUUGCAAAAU20.011.8


Target Position: 9601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9601CCUCAACCGUCUCAUUUUU79.44793150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3299619CCTCAACCGTCTCATTTTTAAAAATGAGACGGTTGAGG0.642400.367000.844801.000001.000001.00000


Target Position: 2568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568GGAAAUACUACAUUAACGU83.07162046

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2566-2588GAGGAAATACTACATTAACGTGTACGUUAAUGUAGUAUUUCCUCGGAAAUACUACAUUAACGUGUU6.910.033


Target Position: 3274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274CAAUGAUGAUGUUUACUCA104.9436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3272-3294TGCAATGATGATGTTTACTCAGGUGAGUAAACAUCAUCAUUGCACAAUGAUGAUGUUUACUCAGGU14.613.622


Target Position: 10019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10019CAGAUGAUAUUUUUAGGAA97.4536114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10017-10039TACAGATGATATTTTTAGGAAAAUUCCUAAAAAUAUCAUCUGUACAGAUGAUAUUUUUAGGAAAAU19.920.4


Target Position: 9010, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9010GAUUUUUCUCUUCAUUUUU82.10862329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9249028GATTTTTCTCTTCATTTTTAAAAATGAAGAGAAAAATC0.570100.312500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9008-9030TTGATTTTTCTCTTCATTTTTTTAAAAAUGAAGAGAAAAAUCAAGAUUUUUCUCUUCAUUUUUUUU7.40.411


Target Position: 6425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6425GAAUUGACCUGUACAAAGA95.2884222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6423-6445TAGAATTGACCTGTACAAAGACGUCUUUGUACAGGUCAAUUCUAGAAUUGACCUGUACAAAGACGU11.814.822


Target Position: 13724, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13724CAAUUGACCCUUGAACAAU82.89242102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13722-13744TACAATTGACCCTTGAACAATACAUUGUUCAAGGGUCAAUUGUACAAUUGACCCUUGAACAAUACU20.514.8


Target Position: 957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GAAAGCUAGACUUUUGUGA83.04862054

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
955-977AGGAAAGCTAGACTTTTGTGATGUCACAAAAGUCUAGCUUUCCUGAAAGCUAGACUUUUGUGAUGU12.218.322


Target Position: 10257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10257GUUCUUAUGAACAUUUUAA92.0287473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10255-10277TGGTTCTTATGAACATTTTAAGAUUAAAAUGUUCAUAAGAACCAGUUCUUAUGAACAUUUUAAGAU-1.46.9


Target Position: 3642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642GAUCUUUGAGCAUCAUGUA97.6671103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3640-3662TGGATCTTTGAGCATCATGTATGUACAUGAUGCUCAAAGAUCCAGAUCUUUGAGCAUCAUGUAUGU20.512.032


Target Position: 310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
310AGCUGUUGAUACCAAAAAU87.0831139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868328AGCTGTTGATACCAAAAATATTTTTGGTATCAACAGCT0.423100.075200.844800.750001.000001.00000


Target Position: 13561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13561CUUUGUGUAUUUAAAAUUU83.31041970

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13559-13581TGCTTTGTGTATTTAAAATTTTCAAAUUUUAAAUACACAAAGCACUUUGUGUAUUUAAAAUUUUCU-9.719.31


Target Position: 3033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033GGAAGAUUUUUAUGUUUAA100.87637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3031-3053TGGGAAGATTTTTATGTTTAATGUUAAACAUAAAAAUCUUCCCAGGAAGAUUUUUAUGUUUAAUGU6.914.821


Target Position: 11622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11622CAAAACAAAUUGAAUAAAA93.1851367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11620-11642TGCAAAACAAATTGAATAAAAAGUUUUAUUCAAUUUGUUUUGCACAAAACAAAUUGAAUAAAAAGU2.15.6


Target Position: 1256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GAAAUACAGUUCUGUAAUA102.02425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1254-1276CTGAAATACAGTTCTGTAATAAAUAUUACAGAACUGUAUUUCAGGAAAUACAGUUCUGUAAUAAAU11.66.922


Target Position: 11188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11188CCUCUUUCUUUCUUUCCUU80.78022692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68911206CCTCTTTCTTTCTTTCCTTAAGGAAAGAAAGAAAGAGG0.999900.999800.706901.000001.000001.00000


Target Position: 11930, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11930GGUUUUAUUUUUCUUUCUU84.24191726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64711948GGTTTTATTTTTCTTTCTTAAGAAAGAAAAATAAAACC0.581300.334100.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11928-11950AGGGTTTTATTTTTCTTTCTTTTAAGAAAGAAAAAUAAAACCCUGGUUUUAUUUUUCUUUCUUUUU19.1-0.3


Target Position: 13775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13775CGGUUUUUUUUUUCUGUAA89.0897819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13773-13795TGCGGTTTTTTTTTTCTGTAAAAUUACAGAAAAAAAAAACCGCACGGUUUUUUUUUUCUGUAAAAU20.312.6


Target Position: 2120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120GACUUUUAUAUAAAUGUGU79.45163148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2118-2140ATGACTTTTATATAAATGTGTGTACACAUUUAUAUAAAAGUCAUGACUUUUAUAUAAAUGUGUGUU12.14.913


Target Position: 13708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13708GUACAACAUAAGUAUACAA100.16547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13706-13728TTGTACAACATAAGTATACAATTUUGUAUACUUAUGUUGUACAAGUACAACAUAAGUAUACAAUUU15.820.4


Target Position: 12398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12398GGUCUAACUGCAAAAUCAU91.6523512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12396-12418TGGGTCTAACTGCAAAATCATACAUGAUUUUGCAGUUAGACCCAGGUCUAACUGCAAAAUCAUACU7.421.4


Target Position: 13777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13777GUUUUUUUUUUCUGUAAAA88.2687940

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13775-13797CGGTTTTTTTTTTCTGTAAAAGTUUUUACAGAAAAAAAAAACCGGUUUUUUUUUUCUGUAAAAGUU11.8-11.3


Target Position: 4175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4175CUAAAGGAGACUUCAGAUU76.40284193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4173-4195TTCTAAAGGAGACTTCAGATTGTAAUCUGAAGUCUCCUUUAGAACUAAAGGAGACUUCAGAUUGUU20.419.932


Target Position: 11167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11167CCUUUCCUUUCCUUCCUUU75.1894691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
21011185CCTTTCCTTTCCTTCCTTTAAAGGAAGGAAAGGAAAGG0.999500.995900.844801.000001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321CCAAAAAUAAUGUACUUUA93.8601316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
689339CCAAAAATAATGTACTTTATAAAGTACATTATTTTTGG0.357600.306500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
319-341TACCAAAAATAATGTACTTTATAUAAAGUACAUUAUUUUUGGUACCAAAAAUAAUGUACUUUAUAU12.9-3.321


Target Position: 1214, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GGAAAAGAAUAUUUGUUUU89.9276718

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10121419GGAAAAGAATATTTGTTTT1/1/0/096.22IGF2RNM_000876.21NANANA6:160453994..160454012(+)00IGF2R(0.002)&LOC100290075(0.029)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1212-1234ATGGAAAAGAATATTTGTTTTATAAAACAAAUAUUCUUUUCCAUGGAAAAGAAUAUUUGUUUUAUU5.614.822


Target Position: 2384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2384GAUAACUCCACCUACAACU79.87842998

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2382-2404AGGATAACTCCACCTACAACTTCAGUUGUAGGUGGAGUUAUCCUGAUAACUCCACCUACAACUUCU19.014.522


Target Position: 1676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676GAGAAGAAGCAUUUUUUCA91.3993534

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1674-1696CAGAGAAGAAGCATTTTTTCATTUGAAAAAAUGCUUCUUCUCUGGAGAAGAAGCAUUUUUUCAUUU0.719.122


Target Position: 2113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113GAAGUAUGACUUUUAUAUA104.7478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2111-2133AAGAAGTATGACTTTTATATAAAUAUAUAAAAGUCAUACUUCUUGAAGUAUGACUUUUAUAUAAAU-8.011.612


Target Position: 8190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8190CUCAUUCUGUCUCUUUUCU74.05415078

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8188-8210AGCTCATTCTGTCTCTTTTCTCTAGAAAAGAGACAGAAUGAGCUCUCAUUCUGUCUCUUUUCUCUU14.820.422


Target Position: 9527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9527CAGUGUUAUAAACAAACUU85.48481451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9525-9547TCCAGTGTTATAAACAAACTTCTAAGUUUGUUUAUAACACUGGACAGUGUUAUAAACAAACUUCUU17.819.0


Target Position: 13672, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13672GAUUUUGUAAUGAUAAGUA97.934291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13670-13692ATGATTTTGTAATGATAAGTATCUACUUAUCAUUACAAAAUCAUGAUUUUGUAAUGAUAAGUAUCU14.55.3


Target Position: 12501, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12501CUGUAUGUUGUUAACAGAU84.00931780

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12499-12521TTCTGTATGTTGTTAACAGATGTAUCUGUUAACAACAUACAGAACUGUAUGUUGUUAACAGAUGUU20.320.4


Target Position: 8984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8984UCAACAUGAGUGUAUUUUU78.36323494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9729002TCAACATGAGTGTATTTTTAAAAATACACTCATGTTGA0.652300.064000.724100.750001.000001.00000


Target Position: 8515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8515CCAGAUUUGGGGUAUAGGU75.15594702

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8513-8535TTCCAGATTTGGGGTATAGGTCTACCUAUACCCCAAAUCUGGAACCAGAUUUGGGGUAUAGGUCUU19.812.022


Target Position: 12441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12441CAUAGGUAUGGAUUGUCAU89.2258808

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12439-12461GGCATAGGTATGGATTGTCATATAUGACAAUCCAUACCUAUGCCCAUAGGUAUGGAUUGUCAUAUU20.519.8


Target Position: 10302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10302ACCCUAAAAUAAUACGUAA90.9443588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93510320ACCCTAAAATAATACGTAATTACGTATTATTTTAGGGT0.553000.468400.819000.750000.994600.75000


Target Position: 3301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301CAAAUUCCUGCAUCAAGAU83.61281891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3299-3321CTCAAATTCCTGCATCAAGATATAUCUUGAUGCAGGAAUUUGAGCAAAUUCCUGCAUCAAGAUAUU20.414.222


Target Position: 8884, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8884CAUUGUAGAAUUGUAUAUA96.6755153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8882-8904CGCATTGTAGAATTGTATATAGAUAUAUACAAUUCUACAAUGCGCAUUGUAGAAUUGUAUAUAGAU8.211.613


Target Position: 11955, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11955CAUUUUGAGACAACAUGUA91.5055527

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11953-11975AACATTTTGAGACAACATGTAGAUACAUGUUGUCUCAAAAUGUUCAUUUUGAGACAACAUGUAGAU19.37.4


Target Position: 12684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12684CAGCAAUUCCUAGACAUUU82.67322166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12682-12704GGCAGCAATTCCTAGACATTTGCAAAUGUCUAGGAAUUGCUGCCCAGCAAUUCCUAGACAUUUGCU19.218.5


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281CGGCACACCCUAUAACAAU84.00521782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792299CGGCACACCCTATAACAATATTGTTATAGGGTGTGCCG0.642400.070200.905201.000000.934800.75000


Target Position: 12897, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12897GAAAUGCACAUCAUAAACA92.3339440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12895-12917GGGAAATGCACATCATAAACACAUGUUUAUGAUGUGCAUUUCCCGAAAUGCACAUCAUAAACACAU6.920.0


Target Position: 8003, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8003CCCUAUUUAUUGACUUUGA86.24421279

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8001-8023CCCCCTATTTATTGACTTTGACAUCAAAGUCAAUAAAUAGGGGGCCCUAUUUAUUGACUUUGACAU19.210.922


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313UGUUGAUACCAAAAAUAAU84.76781605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789331TGTTGATACCAAAAATAATATTATTTTTGGTATCAACA0.459200.159700.698300.750001.000001.00000


Target Position: 8209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8209CUUUUGCUUUCUGUUUCUU72.24215806

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8207-8229CTCTTTTGCTTTCTGTTTCTTAAAAGAAACAGAAAGCAAAAGAGCUUUUGCUUUCUGUUUCUUAAU19.218.612


Target Position: 9565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9565UCUCCAUCCCUUUUUUUUU67.96147471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7669583TCTCCATCCCTTTTTTTTTAAAAAAAAAGGGATGGAGA0.890900.732500.724100.750001.000001.00000


Target Position: 1763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1763GCAGUGGAUAAAAAUGGAA88.8737846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911781GCAGTGGATAAAAATGGAATTCCATTTTTATCCACTGC0.252000.075400.681001.000001.000001.00000


Target Position: 10078, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10078GAGAAAUGAUUUUAUUGAU94.0202298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10076-10098CAGAGAAATGATTTTATTGATGGAUCAAUAAAAUCAUUUCUCUGGAGAAAUGAUUUUAUUGAUGGU8.912.0


Target Position: 8888, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8888GUAGAAUUGUAUAUAGACU90.313668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8886-8908TTGTAGAATTGTATATAGACTCTAGUCUAUAUACAAUUCUACAAGUAGAAUUGUAUAUAGACUCUU15.86.923


Target Position: 7962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7962GGUAUUUGACCCCGAUAUA92.7755402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7367980GGTATTTGACCCCGATATATATATCGGGGTCAAATACC0.334600.096600.810301.000000.983700.75000


Target Position: 11010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11010CUAGAUGAAAGUAAAGAGA84.46831666

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11008-11030GTCTAGATGAAAGTAAAGAGATGUCUCUUUACUUUCAUCUAGACCUAGAUGAAAGUAAAGAGAUGU11.721.4


Target Position: 11569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11569CAGUUAUUUGUAUUUCUUU87.50761065

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11567-11589GTCAGTTATTTGTATTTCTTTACAAAGAAAUACAAAUAACUGACCAGUUAUUUGUAUUUCUUUACU5.34.6


Target Position: 9168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9168CUGUUAAGUGACUGAAUUU87.43261080

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9166-9188TTCTGTTAAGTGACTGAATTTGGAAAUUCAGUCACUUAACAGAACUGUUAAGUGACUGAAUUUGGU12.011.8


Target Position: 11166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11166UCCUUUCCUUUCCUUCCUU63.89619041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56311184TCCTTTCCTTTCCTTCCTTAAGGAAGGAAAGGAAAGGA0.999500.992500.732800.750001.000001.00000


Target Position: 10364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10364GGAGACAACAUAUAGACAU89.4552772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66410382GGAGACAACATATAGACATATGTCTATATGTTGTCTCC0.882200.718800.715501.000001.000001.00000


Target Position: 13287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13287GAAGGAAAUCCUGUCAUUU87.05311142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13285-13307AAGAAGGAAATCCTGTCATTTGTAAAUGACAGGAUUUCCUUCUUGAAGGAAAUCCUGUCAUUUGUU20.518.7


Target Position: 4513, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4513CGUUGAUGGCGACUUAUGU83.53661918

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4511-4533TACGTTGATGGCGACTTATGTCCACAUAAGUCGCCAUCAACGUACGUUGAUGGCGACUUAUGUCCU11.620.533


Target Position: 7669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7669GCACCUCCAACCAAAUAAG73.67655231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8947687GCACCTCCAACCAAATAAGCTTATTTGGTTGGAGGTGC0.676800.067500.715500.750001.000001.00000


Target Position: 3493, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493GAGAAAGAGGACUUUCUAU93.1808368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3491-3513GGGAGAAAGAGGACTTTCTATTTAUAGAAAGUCCUCUUUCUCCCGAGAAAGAGGACUUUCUAUUUU11.719.122


Target Position: 630, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GCAAGAAAGACAUAUUUAA97.792599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997648GCAAGAAAGACATATTTAATTAAATATGTCTTTCTTGC0.247900.232000.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
628-650CTGCAAGAAAGACATATTTAAAGUUAAAUAUGUCUUUCUUGCAGGCAAGAAAGACAUAUUUAAAGU-8.012.222


Target Position: 7975, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7975GAUAUAUUUUAGCAUUUUA101.39129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7973-7995CCGATATATTTTAGCATTTTAATUAAAAUGCUAAAAUAUAUCGGGAUAUAUUUUAGCAUUUUAAUU14.0-8.621


Target Position: 11942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11942CUUUCUUUUAAAACAUUUU75.34744617

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11940-11962TTCTTTCTTTTAAAACATTTTGAAAAAUGUUUUAAAAGAAAGAACUUUCUUUUAAAACAUUUUGAU5.35.5


Target Position: 8985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8985CAACAUGAGUGUAUUUUUU88.4733907

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8983-9005TTCAACATGAGTGTATTTTTTAAAAAAAAUACACUCAUGUUGAACAACAUGAGUGUAUUUUUUAAU-9.720.522


Target Position: 13764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13764CCACUUACAUGCGGUUUUU76.9154006

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13762-13784GTCCACTTACATGCGGTTTTTTTAAAAACCGCAUGUAAGUGGACCCACUUACAUGCGGUUUUUUUU19.419.0


Target Position: 3492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492GGAGAAAGAGGACUUUCUA98.844975

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3490-3512TGGGAGAAAGAGGACTTTCTATTUAGAAAGUCCUCUUUCUCCCAGGAGAAAGAGGACUUUCUAUUU17.719.122


Target Position: 2786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2786GGCAGACAGACCACAUAUA97.934490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782804GGCAGACAGACCACATATATATATGTGGTCTGTCTGCC0.311200.051000.956901.000000.945700.62500


Target Position: 7971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7971CCCCGAUAUAUUUUAGCAU80.37592820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2407989CCCCGATATATTTTAGCATATGCTAAAATATATCGGGG0.783300.448800.836201.000001.000001.00000


Target Position: 6081, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6081CAUUUGAGUGGAAAACAAA96.1508172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6079-6101GACATTTGAGTGGAAAACAAAAGUUUGUUUUCCACUCAAAUGUCCAUUUGAGUGGAAAACAAAAGU5.612.021


Target Position: 12405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12405CUGCAAAAUCAUACUUGAA93.3532355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12403-12425AACTGCAAAATCATACTTGAACTUUCAAGUAUGAUUUUGCAGUUCUGCAAAAUCAUACUUGAACUU20.320.0


Target Position: 11135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11135GUCUUUCUUUCCUUCGUUU79.65333069

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11133-11155AGGTCTTTCTTTCCTTCGTTTCCAAACGAAGGAAAGAAAGACCUGUCUUUCUUUCCUUCGUUUCCU19.719.1


Target Position: 14019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14019GUAUAUAAUACAUACAACA96.287165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
14017-14039CAGTATATAATACATACAACATCUGUUGUAUGUAUUAUAUACUGGUAUAUAAUACAUACAACAUCU14.6-5.9


Target Position: 9944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9944GUUUGAGUGCAUUUGCUUU83.7051867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9942-9964ACGTTTGAGTGCATTTGCTTTGAAAAGCAAAUGCACUCAAACGUGUUUGAGUGCAUUUGCUUUGAU18.619.2


Target Position: 10358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10358CAGACAGGAGACAACAUAU95.2038227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72210376CAGACAGGAGACAACATATATATGTTGTCTCCTGTCTG0.811900.695800.741400.750001.000001.00000


Target Position: 8613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8613CUAUAAGAAGCCUUAAUUU87.1511127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8611-8633ACCTATAAGAAGCCTTAATTTGCAAAUUAAGGCUUCUUAUAGGUCUAUAAGAAGCCUUAAUUUGCU-4.38.422


Target Position: 10369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10369CAACAUAUAGACAUUAGAA104.2199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10367-10389GACAACATATAGACATTAGAACTUUCUAAUGUCUAUAUGUUGUCCAACAUAUAGACAUUAGAACUU13.46.7


Target Position: 6561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6561CCAUCACCAACCCUAUAAA92.3816434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9096579CCATCACCAACCCTATAAATTTATAGGGTTGGTGATGG0.462000.056900.844801.000001.000001.00000


Target Position: 10366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10366AGACAACAUAUAGACAUUA90.5276648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87310384AGACAACATATAGACATTATAATGTCTATATGTTGTCT0.870300.750800.689700.750001.000001.00000


Target Position: 13694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13694CAAAACAUCAUGUUGUACA87.79071026

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13692-13714CTCAAAACATCATGTTGTACAACUGUACAACAUGAUGUUUUGAGCAAAACAUCAUGUUGUACAACU21.55.3


Target Position: 11168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11168CUUUCCUUUCCUUCCUUUU69.90976747

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11166-11188TCCTTTCCTTTCCTTCCTTTTTCAAAAGGAAGGAAAGGAAAGGACUUUCCUUUCCUUCCUUUUUCU18.718.7


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867UCAUGGCAAGAAAAUUAAA82.42642233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641885TCATGGCAAGAAAATTAAATTTAATTTTCTTGCCATGA0.692900.052000.724100.750001.000001.00000


Target Position: 8560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8560CACCUUUACUGUGCUUAUU79.42833158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8558-8580ACCACCTTTACTGTGCTTATTTTAAUAAGCACAGUAAAGGUGGUCACCUUUACUGUGCUUAUUUUU19.718.622


Target Position: 13969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13969CUCCUCAUGAUUUUCUUAA81.70632458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47113987CTCCTCATGATTTTCTTAATTAAGAAAATCATGAGGAG0.835600.616300.775900.750001.000001.00000


Target Position: 7963, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7963GUAUUUGACCCCGAUAUAU83.03762056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7961-7983GGGTATTTGACCCCGATATATTTAUAUAUCGGGGUCAAAUACCCGUAUUUGACCCCGAUAUAUUUU10.38.943


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627CCUGCAAGAAAGACAUAUU87.09541135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984645CCTGCAAGAAAGACATATTAATATGTCTTTCTTGCAGG0.257100.050400.836201.000001.000001.00000


Target Position: 2236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236GAAGCUUUCAUAUUAUGAU91.0202579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2234-2256GCGAAGCTTTCATATTATGATGGAUCAUAAUAUGAAAGCUUCGCGAAGCUUUCAUAUUAUGAUGGU8.717.033


Target Position: 9071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9071CAAUAAAAGAUAAAUUAUU88.9791828

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9069-9091TTCAATAAAAGATAAATTATTAAAAUAAUUUAUCUUUUAUUGAACAAUAAAAGAUAAAUUAUUAAU-10.3-9.722


Target Position: 631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CAAGAAAGACAUAUUUAAA102.13623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
629-651TGCAAGAAAGACATATTTAAAGCUUUAAAUAUGUCUUUCUUGCACAAGAAAGACAUAUUUAAAGCU-7.510.322


Target Position: 6866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6866GUUUCUUCCACCAUCUUCU77.74123721

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6864-6886CTGTTTCTTCCACCATCTTCTTCAGAAGAUGGUGGAAGAAACAGGUUUCUUCCACCAUCUUCUUCU20.414.812


Target Position: 8572, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8572GCUUAUUUUUUUAAGAAAA91.4617530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8570-8592GTGCTTATTTTTTTAAGAAAAAAUUUUCUUAAAAAAAUAAGCACGCUUAUUUUUUUAAGAAAAAAU7.1-4.311


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GGCACACCCUAUAACAAUG80.36792826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782300GGCACACCCTATAACAATGCATTGTTATAGGGTGTGCC0.609500.079500.844800.750001.000001.00000


Target Position: 13945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13945CUUAAUAUAUAAUAAAUAU95.8963192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13943-13965CACTTAATATATAATAAATATATAUAUUUAUUAUAUAUUAAGUGCUUAAUAUAUAAUAAAUAUAUU-8.0-8.0


Target Position: 1117, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117GGAAAGUAAAACUUGUUCU83.17052011

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1115-1137CTGGAAAGTAAAACTTGTTCTCTAGAACAAGUUUUACUUUCCAGGGAAAGUAAAACUUGUUCUCUU19.214.622


Target Position: 13943, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13943CACUUAAUAUAUAAUAAAU98.961571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13941-13963TCCACTTAATATATAATAAATATAUUUAUUAUAUAUUAAGUGGACACUUAAUAUAUAAUAAAUAUU-7.54.6


Target Position: 2191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2191GGCAAAAAGUGAUGAGAAG80.25362862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432209GGCAAAAAGTGATGAGAAGCTTCTCATCACTTTTTGCC0.267200.073600.862100.750001.000001.00000


Target Position: 11148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11148UCGUUUCCUUCCUUUCAUU71.46826106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
49011166TCGTTTCCTTCCTTTCATTAATGAAAGGAAGGAAACGA0.462000.335100.784500.750001.000001.00000


Target Position: 10121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10121UCCUUUCAACAAAAUUUUU66.79897937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61510139TCCTTTCAACAAAATTTTTAAAAATTTTGTTGAAAGGA0.393200.333100.870700.750001.000001.00000


Target Position: 11158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11158CCUUUCAUUCCUUUCCUUU75.34024624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17311176CCTTTCATTCCTTTCCTTTAAAGGAAAGGAATGAAAGG0.993600.964000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11156-11178TTCCTTTCATTCCTTTCCTTTCCAAAGGAAAGGAAUGAAAGGAACCUUUCAUUCCUUUCCUUUCCU18.712.0


Target Position: 669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669GCUAUGUGUUUGAUGAAGA91.0544575

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
667-689ATGCTATGTGTTTGATGAAGAGTUCUUCAUCAAACACAUAGCAUGCUAUGUGUUUGAUGAAGAGUU20.417.933


Target Position: 13767, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13767CUUACAUGCGGUUUUUUUU76.54724135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
13765-13787CACTTACATGCGGTTTTTTTTTTAAAAAAAACCGCAUGUAAGUGCUUACAUGCGGUUUUUUUUUUU-11.313.5


Target Position: 8195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8195UCUGUCUCUUUUCUCUUUU65.57338417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7688213TCTGTCTCTTTTCTCTTTTAAAAGAGAAAAGAGACAGA0.323600.077900.724100.750001.000001.00000


Target Position: 13633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13633GAGGUGAUGGAUAUGUUUA95.8908193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67213651GAGGTGATGGATATGTTTATAAACATATCCATCACCTC0.557000.084800.775900.750001.000001.00000


Target Position: 9703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9703CUUCUAAAAGUUUACAUUA91.8487490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9701-9723GTCTTCTAAAAGTTTACATTATGUAAUGUAAACUUUUAGAAGACCUUCUAAAAGUUUACAUUAUGU6.97.1


Target Position: 12246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12246GAAAGUUUCUCCUUUCUGU86.19481290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
12244-12266TGGAAAGTTTCTCCTTTCTGTAAACAGAAAGGAGAAACUUUCCAGAAAGUUUCUCCUUUCUGUAAU16.63.2


Target Position: 9602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9602CUCAACCGUCUCAUUUUUA82.3792247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5119620CTCAACCGTCTCATTTTTATAAAAATGAGACGGTTGAG0.645400.439600.775900.750001.000001.00000


Target Position: 11558, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11558CUGUGAAUGGUCAGUUAUU85.17451511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11556-11578GGCTGTGAATGGTCAGTTATTTGAAUAACUGACCAUUCACAGCCCUGUGAAUGGUCAGUUAUUUGU11.620.5


Target Position: 1872, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872GCAAGAAAAUUAAAACUAA100.64640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721890GCAAGAAAATTAAAACTAATTAGTTTTAATTTTCTTGC0.539900.314400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1870-1892TGGCAAGAAAATTAAAACTAATAUUAGUUUUAAUUUUCUUGCCAGCAAGAAAAUUAAAACUAAUAU4.912.221


Target Position: 11001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11001CAAGAUAGUCUAGAUGAAA96.9109141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10999-11021AGCAAGATAGTCTAGATGAAAGTUUUCAUCUAGACUAUCUUGCUCAAGAUAGUCUAGAUGAAAGUU20.411.6


Target Position: 11578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11578GUAUUUCUUUACCUUUUAU87.90911004

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
11576-11598TTGTATTTCTTTACCTTTTATGCAUAAAAGGUAAAGAAAUACAAGUAUUUCUUUACCUUUUAUGCU11.06.9