siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 410   985   1030   1271   1272   1273   1353   1359   1368   1549   1554   1715   1719   1720   2061   2161   2213   2314   2370   2498  
2501   2955   2961   3116   3117   3137   3193   3236   3241   3374   3606   3747   4168   4169   4527   5327   5358   5359   5468   5476  
5477   5708   5709   5846   5851   5969   5981   6081   6162   6163   6167   6168   6169   6267   6490   6492   6595   6597   6636   6746  
6833   6834   6835   6984   7201   7243   7327   7328   7340   7360   7361   7364   7365   7367   7768   7769   7770   7900   7942   8002  
8003   8004   8244   8245   8246   8247   8251   8252   8253   8254   8255   8352   8353   8375   8409   8453   8678   8724   8738   8885  
8997   8998   9000   9169   9234   9235   9336   9394   9398   9421   9603   9624   9765   9804  
Biltr, Rnaxs, Sidirect 1306   1559   1560   2062   2072   3240   3748   3879   3880   5281   5328   5847   6489   6784   7005   7771   7846   7943   8681   8685  
8751   9212   9600  
Biltr, Sidirect 138   280   281   424   449   491   515   550   551   563   837   851   935   939   945   951   954   960   962   964  
1032   1274   1276   1296   1298   1367   1369   1395   1457   1482   1483   1505   1531   1550   1569   1574   1594   1607   1730   1898  
1905   1906   1970   1974   1991   2010   2052   2053   2069   2073   2077   2399   2452   2454   2561   2574   2589   2601   2673   2674  
2676   2683   2693   2703   2706   2820   2821   2833   2840   2844   2850   2865   2866   2889   2899   2909   3020   3041   3052   3071  
3103   3105   3168   3242   3365   3367   3368   3382   3422   3423   3425   3430   3432   3465   3470   3494   3495   3498   3506   3507  
3546   3559   3607   3610   3621   3622   3680   3790   3801   3869   3885   3893   3977   3982   4013   4081   4096   4170   4266   4294  
4298   4322   4383   4384   4387   4398   4542   4698   4785   4899   5163   5200   5202   5209   5216   5222   5226   5228   5262   5268  
5274   5277   5288   5294   5296   5302   5307   5317   5319   5338   5339   5360   5363   5386   5388   5714   5740   5760   5761   5809  
5823   5828   5838   5844   5848   5852   5857   5919   5920   6009   6073   6265   6266   6377   6378   6386   6407   6408   6411   6421  
6441   6443   6444   6449   6450   6466   6479   6491   6572   6662   6663   6671   6700   6709   6747   6755   6757   6760   6769   6792  
6807   6815   6837   6840   6841   6861   6862   6863   6868   6869   6891   6892   6895   6929   7006   7053   7054   7088   7092   7096  
7100   7101   7138   7139   7193   7222   7224   7230   7233   7270   7273   7276   7287   7289   7297   7299   7301   7309   7510   7512  
7660   7697   7698   7738   7746   7772   7776   7834   7836   7845   7847   7853   7891   7893   7894   7934   7935   7945   7956   7959  
7962   7965   7968   7971   8008   8010   8011   8030   8056   8067   8080   8084   8089   8090   8092   8163   8165   8166   8305   8313  
8315   8324   8332   8343   8368   8379   8402   8415   8445   8447   8448   8457   8538   8541   8603   8604   8625   8642   8645   8648  
8650   8656   8658   8689   8700   8743   8744   8772   8777   8793   8809   8810   8821   8835   8847   8877   8878   8879   8886   8894  
8899   8932   8934   8970   8973   9036   9127   9128   9132   9135   9148   9155   9157   9163   9170   9179   9183   9206   9207   9213  
9237   9239   9262   9263   9268   9272   9322   9324   9357   9409   9412   9422   9456   9466   9467   9472   9473   9475   9482   9483  
9506   9515   9517   9563   9565   9566   9585   9590   9593   9601   9604   9610   9616   9631   9651   9652   9653   9677   9678   9682  
9687   9691   9698   9704   9715   9719   9792   9803  


Target Position: 3893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3893CUUAAUAUCGUCAAAACCU74.59234228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3891-3913ACCTTAATATCGTCAAAACCTCAAGGUUUUGACGAUAUUAAGGUCUUAAUAUCGUCAAAACCUCAU18.8-8.033


Target Position: 8772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8772CAGAUGUACCUUUGUAAAA92.1248493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8770-8792TCCAGATGTACCTTTGTAAAATAUUUUACAAAGGUACAUCUGGACAGAUGUACCUUUGUAAAAUAU7.220.322


Target Position: 4384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4384CAAGUAACAUUUUAGUAAU93.2249397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4382-4404GGCAAGTAACATTTTAGTAATGGAUUACUAAAAUGUUACUUGCCCAAGUAACAUUUUAGUAAUGGU6.612.922


Target Position: 6760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6760CUAUAAAUUGAAAUUAUAU92.5988446

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6758-6780ATCTATAAATTGAAATTATATTTAUAUAAUUUCAAUUUAUAGAUCUAUAAAUUGAAAUUAUAUUUU-8.0-8.022


Target Position: 7367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7367ACACGUUCCAUUUCAUUUU72.38224869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6317385ACACGTTCCATTTCATTTTAAAATGAAATGGAACGTGT0.748800.741100.706900.750001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306CAGAGAAAAGUGAAACAAU92.7447439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401324CAGAGAAAAGTGAAACAATATTGTTTCACTTTTCTCTG0.220100.050900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1304-1326CCCAGAGAAAAGTGAAACAATTCAUUGUUUCACUUUUCUCUGGGCAGAGAAAAGUGAAACAAUUCU14.919.122


Target Position: 5200, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5200CUCACUAUCGGAAAUUCAU81.4622387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5198-5220TCCTCACTATCGGAAATTCATTTAUGAAUUUCCGAUAGUGAGGACUCACUAUCGGAAAUUCAUUUU7.420.332


Target Position: 1032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032CAAAGAUUGCUAAAAGAGA89.8711764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1030-1052CCCAAAGATTGCTAAAAGAGATCUCUCUUUUAGCAAUCUUUGGGCAAAGAUUGCUAAAAGAGAUCU10.35.321


Target Position: 8244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8244CGUGCAUAGGACCUCAAAA95.2518242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9588262CGTGCATAGGACCTCAAAATTTTGAGGTCCTATGCACG0.216800.055300.775901.000001.000001.00000


Target Position: 8090, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8090CUCUUUGAUGUUAGUAAAU79.16092971

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8088-8110TCCTCTTTGATGTTAGTAAATTTAUUUACUAACAUCAAAGAGGACUCUUUGAUGUUAGUAAAUUUU6.620.422


Target Position: 9601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9601CAUCUUUUAGUUAAACAUU84.19851747

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9599-9621ACCATCTTTTAGTTAAACATTTTAAUGUUUAACUAAAAGAUGGUCAUCUUUUAGUUAAACAUUUUU6.95.332


Target Position: 5981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5981GUGGGAUGGGAGUGGGUAA87.44041123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9785999GTGGGATGGGAGTGGGTAATTACCCACTCCCATCCCAC0.213100.194900.758600.750001.000001.00000


Target Position: 7053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7053GGUAAUUAUGUAAUUCUCU86.65261251

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7051-7073AGGGTAATTATGTAATTCTCTAGAGAGAAUUACAUAAUUACCCUGGUAAUUAUGUAAUUCUCUAGU14.81.422


Target Position: 5844, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5844CUUGGUAUCAUUUCAUUUU78.63623100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5842-5864TTCTTGGTATCATTTCATTTTTAAAAAUGAAAUGAUACCAAGAACUUGGUAUCAUUUCAUUUUUAU7.420.022


Target Position: 5740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5740GAAAAUGGGUGUGUUUUCU78.35493177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5738-5760TTGAAAATGGGTGTGTTTTCTTCAGAAAACACACCCAUUUUCAAGAAAAUGGGUGUGUUUUCUUCU14.911.322


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715GCAUCGCCACUAUAUCCAA95.701219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721733GCATCGCCACTATATCCAATTGGATATAGTGGCGATGC0.932700.137200.706901.000001.000001.00000


Target Position: 6636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6636GCCCACCUACUUUUAUAAA86.42311289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4196654GCCCACCTACTTTTATAAATTTATAAAAGTAGGTGGGC0.540400.122401.000001.000001.000001.00000


Target Position: 8724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8724ACUGAUCACAUUUUGAAAU75.32564004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9248742ACTGATCACATTTTGAAATATTTCAAAATGTGATCAGT0.285300.051800.698300.750001.000001.00000


Target Position: 6891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6891GGAACAAGUAAAAACCAAA98.323794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6889-6911GAGGAACAAGTAAAAACCAAATGUUUGGUUUUUACUUGUUCCUCGGAACAAGUAAAAACCAAAUGU18.819.223


Target Position: 5828, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5828CUAUAAAUUUGUUAUUCUU90.3611698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5826-5848GACTATAAATTTGTTATTCTTGGAAGAAUAACAAAUUUAUAGUCCUAUAAAUUUGUUAUUCUUGGU6.9-8.022


Target Position: 7297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7297CUCACAAUUUUUGAAUGUU77.81283312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7295-7317ATCTCACAATTTTTGAATGTTCTAACAUUCAAAAAUUGUGAGAUCUCACAAUUUUUGAAUGUUCUU20.520.522


Target Position: 9687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9687CAAACAUAUAUCUAUAUCU92.9393422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9685-9707TACAAACATATATCTATATCTATAGAUAUAGAUAUAUGUUUGUACAAACAUAUAUCUAUAUCUAUU8.26.922


Target Position: 3432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3432GAUAAAACUAUUGAUUUAU85.89421394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3430-3452GAGATAAAACTATTGATTTATACAUAAAUCAAUAGUUUUAUCUCGAUAAAACUAUUGAUUUAUACU8.9-0.322


Target Position: 8700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8700CUUUAUUAAUAAUCAUGUA96.8554152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8698-8720AACTTTATTAATAATCATGTATTUACAUGAUUAUUAAUAAAGUUCUUUAUUAAUAAUCAUGUAUUU20.5-7.522


Target Position: 7853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7853GUAACUAUGUAUUGUAUUU89.8092773

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7851-7873TTGTAACTATGTATTGTATTTCAAAAUACAAUACAUAGUUACAAGUAACUAUGUAUUGUAUUUCAU6.96.333


Target Position: 3494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494GGAUGAUAGACUGGUUUUA93.4222375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3492-3514CAGGATGATAGACTGGTTTTAAGUAAAACCAGUCUAUCAUCCUGGGAUGAUAGACUGGUUUUAAGU18.817.433


Target Position: 9610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9610GUUAAACAUUUUAAAGAUU82.88382026

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9608-9630TAGTTAAACATTTTAAAGATTAAAAUCUUUAAAAUGUUUAACUAGUUAAACAUUUUAAAGAUUAAU6.97.221


Target Position: 6421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6421GACUUUCUUUGGUUUUCCU82.4842135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6419-6441TTGACTTTCTTTGGTTTTCCTTGAGGAAAACCAAAGAAAGUCAAGACUUUCUUUGGUUUUCCUUGU21.217.722


Target Position: 5328, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5328GUAUUUGAAAGCACAUUUU80.94542519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8655346GTATTTGAAAGCACATTTTAAAATGTGCTTTCAAATAC0.384800.061400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5326-5348CCGTATTTGAAAGCACATTTTAAAAAAUGUGCUUUCAAAUACGGGUAUUUGAAAGCACAUUUUAAU12.18.922


Target Position: 6492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6492UGUAAAUUCUGUUAAUAAA91.9156514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6966510TGTAAATTCTGTTAATAAATTTATTAACAGAATTTACA0.299800.144200.706900.750001.000001.00000


Target Position: 8092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8092CUUUGAUGUUAGUAAAUUU92.9232424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8090-8112CTCTTTGATGTTAGTAAATTTGGAAAUUUACUAACAUCAAAGAGCUUUGAUGUUAGUAAAUUUGGU-0.313.823


Target Position: 2899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899GAAAUGAGACCUCUGUUAU89.9223756

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2897-2919GAGAAATGAGACCTCTGTTATCGAUAACAGAGGUCUCAUUUCUCGAAAUGAGACCUCUGUUAUCGU20.312.022


Target Position: 5363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5363GUUUUGUUUUAAUUGAGUA91.937511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5361-5383TTGTTTTGTTTTAATTGAGTAGTUACUCAAUUAAAACAAAACAAGUUUUGUUUUAAUUGAGUAGUU19.25.622


Target Position: 2833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833CAAACUUGGAAGAUAUUCU84.26071738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2831-2853TTCAAACTTGGAAGATATTCTTCAGAAUAUCUUCCAAGUUUGAACAAACUUGGAAGAUAUUCUUCU11.610.312


Target Position: 8650, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8650CUUUAACAGAAAUUGCUUU77.96723278

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8648-8670CTCTTTAACAGAAATTGCTTTTAAAAGCAAUUUCUGUUAAAGAGCUUUAACAGAAAUUGCUUUUAU18.57.222


Target Position: 5848, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5848GUAUCAUUUCAUUUUUAUA99.382374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5846-5868TGGTATCATTTCATTTTTATAATUAUAAAAAUGAAAUGAUACCAGUAUCAUUUCAUUUUUAUAAUU-9.78.711


Target Position: 138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138GGAGAUAACUUGUUUUGCU90.1112728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
136-158TGGGAGATAACTTGTTTTGCTCCAGCAAAACAAGUUAUCUCCCAGGAGAUAACUUGUUUUGCUCCU21.116.0


Target Position: 6407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6407CCUUCAAUUAUAUUGACUU85.61251445

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6405-6427CTCCTTCAATTATATTGACTTTCAAGUCAAUAUAAUUGAAGGAGCCUUCAAUUAUAUUGACUUUCU19.212.022


Target Position: 3425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425GAAUAGAGAUAAAACUAUU99.403372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3423-3445GTGAATAGAGATAAAACTATTGAAAUAGUUUUAUCUCUAUUCACGAAUAGAGAUAAAACUAUUGAU4.611.621


Target Position: 7233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7233CCAAAUAAAUUCAUAUCUA98.881686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7231-7253TTCCAAATAAATTCATATCTAGAUAGAUAUGAAUUUAUUUGGAACCAAAUAAAUUCAUAUCUAGAU13.3-1.422


Target Position: 2062, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062CCAAAAUCAAGCAAAGUAU83.75691849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382080CCAAAATCAAGCAAAGTATATACTTTGCTTGATTTTGG0.570400.362400.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2060-2082TCCCAAAATCAAGCAAAGTATGAAUACUUUGCUUGAUUUUGGGACCAAAAUCAAGCAAAGUAUGAU11.87.422


Target Position: 3622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622CUUUAUUCGUCAUUUCCAU82.41092153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3620-3642AGCTTTATTCGTCATTTCCATGTAUGGAAAUGACGAAUAAAGCUCUUUAUUCGUCAUUUCCAUGUU20.12.132


Target Position: 3607, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3607CAACAGAUAACAAAGCUUU84.13141762

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3605-3627GGCAACAGATAACAAAGCTTTATAAAGCUUUGUUAUCUGUUGCCCAACAGAUAACAAAGCUUUAUU17.019.232


Target Position: 6700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6700GUUUCUGUCCUAAAUUGAU85.24451514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6698-6720CTGTTTCTGTCCTAAATTGATCTAUCAAUUUAGGACAGAAACAGGUUUCUGUCCUAAAUUGAUCUU7.419.212


Target Position: 5386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5386GAGUUUUAGACCUUUGUCU81.86152288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5384-5406GAGAGTTTTAGACCTTTGTCTTTAGACAAAGGUCUAAAACUCUCGAGUUUUAGACCUUUGUCUUUU19.24.932


Target Position: 2674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674GACUAAAACCUUGUGAAAU85.26231508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694GGGACTAAAACCTTGTGAAATCAAUUUCACAAGGUUUUAGUCCCGACUAAAACCUUGUGAAAUCAU20.54.923


Target Position: 8885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8885AGAAAAUAAGAUUUCAAAU84.61911650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5768903AGAAAATAAGATTTCAAATATTTGAAATCTTATTTTCT0.598000.125800.715500.750000.934800.62500


Target Position: 9590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9590GUAGUUUAUACCAUCUUUU83.13061970

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9588-9610TAGTAGTTTATACCATCTTTTAGAAAAGAUGGUAUAAACUACUAGUAGUUUAUACCAUCUUUUAGU12.06.621


Target Position: 1359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359CCCUCAACCCGUAUAGCAC71.66125101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171377CCCTCAACCCGTATAGCACGTGCTATACGGGTTGAGGG0.222700.130500.698300.750001.000001.00000


Target Position: 1991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1991GAAGCAUUUGGGAGUAAAA96.7064163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1989-2011ATGAAGCATTTGGGAGTAAAAGTUUUUACUCCCAAAUGCUUCAUGAAGCAUUUGGGAGUAAAAGUU14.618.522


Target Position: 5281, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5281GAUUUAAGAAAAAGAGAAA96.3278186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8775299GATTTAAGAAAAAGAGAAATTTCTCTTTTTCTTAAATC0.292400.142600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5279-5301TAGATTTAAGAAAAAGAGAAAATUUUCUCUUUUUCUUAAAUCUAGAUUUAAGAAAAAGAGAAAAUU19.1-4.311


Target Position: 2213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2213CCCUAAGCACUUAUCCACA86.99691197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362231CCCTAAGCACTTATCCACATGTGGATAAGTGCTTAGGG0.410200.259800.784500.750001.000001.00000


Target Position: 5852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5852CAUUUCAUUUUUAUAAUUA94.341306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5850-5872ATCATTTCATTTTTATAATTATAUAAUUAUAAAAAUGAAAUGAUCAUUUCAUUUUUAUAAUUAUAU-8.07.221


Target Position: 6491, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6491CUGUAAAUUCUGUUAAUAA100.11657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6489-6511GTCTGTAAATTCTGTTAATAAACUUAUUAACAGAAUUUACAGACCUGUAAAUUCUGUUAAUAAACU1.46.922


Target Position: 5222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5222GAUUCAGAAUAAAAACCAA103.41916

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5220-5242TTGATTCAGAATAAAAACCAAATUUGGUUUUUAUUCUGAAUCAAGAUUCAGAAUAAAAACCAAAUU18.820.422


Target Position: 6769, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6769GAAAUUAUAUUUUUAGUCA96.3591182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6767-6789TTGAAATTATATTTTTAGTCATAUGACUAAAAAUAUAAUUUCAAGAAAUUAUAUUUUUAGUCAUAU14.6-10.312


Target Position: 8003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8003GAGAAGUCCAUUUAAAAAU84.25481739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8588021GAGAAGTCCATTTAAAAATATTTTTAAATGGACTTCTC0.233500.142000.801700.750001.000001.00000


Target Position: 7139, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7139CUUAGUAAUUAUUUGCUUU85.28041504

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7137-7159TCCTTAGTAATTATTTGCTTTCCAAAGCAAAUAAUUACUAAGGACUUAGUAAUUAUUUGCUUUCCU18.66.622


Target Position: 1974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974GUUAUUCUCAUGUAUAUGA88.0061029

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1972-1994ATGTTATTCTCATGTATATGAAGUCAUAUACAUGAGAAUAACAUGUUAUUCUCAUGUAUAUGAAGU8.26.922


Target Position: 8010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8010CCAUUUAAAAAUUAUUUUU79.9492771

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8008-8030GTCCATTTAAAAATTATTTTTAGAAAAAUAAUUUUUAAAUGGACCCAUUUAAAAAUUAUUUUUAGU-9.7-1.421


Target Position: 7088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7088GCUUGUAGGUUAGCAAAAU84.90071592

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7086-7108AAGCTTGTAGGTTAGCAAAATTTAUUUUGCUAACCUACAAGCUUGCUUGUAGGUUAGCAAAAUUUU18.616.432


Target Position: 3423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3423GUGAAUAGAGAUAAAACUA96.0479197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3421-3443AGGTGAATAGAGATAAAACTATTUAGUUUUAUCUCUAUUCACCUGUGAAUAGAGAUAAAACUAUUU4.913.432


Target Position: 9398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9398UCUUCACAUACCAACAUUU76.3993701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6459416TCTTCACATACCAACATTTAAATGTTGGTATGTGAAGA0.291600.193700.724100.750001.000001.00000


Target Position: 6834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6834GCAGAAGCUAAUAUAUAAA98.547490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7876852GCAGAAGCTAATATATAAATTTATATATTAGCTTCTGC0.577600.063300.853401.000000.994600.75000


Target Position: 2703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703GAAGUGAUUAAUGAAUUGU78.55493118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2701-2723AGGAAGTGATTAATGAATTGTTCACAAUUCAUUAAUCACUUCCUGAAGUGAUUAAUGAAUUGUUCU13.819.223


Target Position: 515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515GAGUAGAUCCGAGAUAUAU93.9472329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
513-535GAGAGTAGATCCGAGATATATGGAUAUAUCUCGGAUCUACUCUCGAGUAGAUCCGAGAUAUAUGGU8.218.933


Target Position: 5277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5277CUUAGAUUUAAGAAAAAGA86.52421274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5275-5297TACTTAGATTTAAGAAAAAGAGAUCUUUUUCUUAAAUCUAAGUACUUAGAUUUAAGAAAAAGAGAU5.56.922


Target Position: 7891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7891GAGCUUUUUGGCUUUCUUU82.26752191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7889-7911ATGAGCTTTTTGGCTTTCTTTTTAAAGAAAGCCAAAAAGCUCAUGAGCUUUUUGGCUUUCUUUUUU10.317.021


Target Position: 8415, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8415CCUUUUGCCUUAUUCCUUA88.3489981

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8413-8435TTCCTTTTGCCTTATTCCTTATGUAAGGAAUAAGGCAAAAGGAACCUUUUGCCUUAUUCCUUAUGU18.718.632


Target Position: 449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449CAUUGCAUCACAUGAUUUU82.70042079

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
447-469CGCATTGCATCACATGATTTTGAAAAAUCAUGUGAUGCAAUGCGCAUUGCAUCACAUGAUUUUGAU7.219.932


Target Position: 6868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6868GGAACUUUCUGUAUCUCUU92.2428485

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6866-6888TTGGAACTTTCTGTATCTCTTAGAAGAGAUACAGAAAGUUCCAAGGAACUUUCUGUAUCUCUUAGU20.213.322


Target Position: 2840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840GGAAGAUAUUCUUCAACUU94.5993283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2838-2860TTGGAAGATATTCTTCAACTTCAAAGUUGAAGAAUAUCUUCCAAGGAAGAUAUUCUUCAACUUCAU19.216.022


Target Position: 3365, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365CAGGAAUUUGGAUUUAACA90.2451711

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3363-3385CTCAGGAATTTGGATTTAACAAAUGUUAAAUCCAAAUUCCUGAGCAGGAAUUUGGAUUUAACAAAU-0.318.722


Target Position: 7301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7301CAAUUUUUGAAUGUUCUUU75.89023849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7299-7321CACAATTTTTGAATGTTCTTTTTAAAGAACAUUCAAAAAUUGUGCAAUUUUUGAAUGUUCUUUUUU19.2-12.031


Target Position: 5360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5360CUUGUUUUGUUUUAAUUGA80.40422658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5358-5380GCCTTGTTTTGTTTTAATTGAGTUCAAUUAAAACAAAACAAGGCCUUGUUUUGUUUUAAUUGAGUU-1.45.622


Target Position: 9412, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9412CAUUUCUGUGCUUUUACCA81.46842384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9410-9432AACATTTCTGTGCTTTTACCAACUGGUAAAAGCACAGAAAUGUUCAUUUCUGUGCUUUUACCAACU14.012.021


Target Position: 1607, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607GUUUCAUCAGUUCUUUCUA90.5411679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1605-1627GAGTTTCATCAGTTCTTTCTAGAUAGAAAGAACUGAUGAAACUCGUUUCAUCAGUUCUUUCUAGAU19.116.322


Target Position: 7968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7968GUUGUUUAUUUGAUUUUGA85.33051495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7966-7988TTGTTGTTTATTTGATTTTGAGTUCAAAAUCAAAUAAACAACAAGUUGUUUAUUUGAUUUUGAGUU7.47.202


Target Position: 6466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6466GUAUUUUUGCCAACUAAAA88.01641028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6464-6486AAGTATTTTTGCCAACTAAAATGUUUUAGUUGGCAAAAAUACUUGUAUUUUUGCCAACUAAAAUGU4.9-9.722


Target Position: 9600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9600CCAUCUUUUAGUUAAACAU85.98771384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8249618CCATCTTTTAGTTAAACATATGTTTAACTAAAAGATGG0.549800.091400.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9598-9620TACCATCTTTTAGTTAAACATTTAUGUUUAACUAAAAGAUGGUACCAUCUUUUAGUUAAACAUUUU7.212.022


Target Position: 8777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8777GUACCUUUGUAAAAUAGCU80.79912561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8775-8797ATGTACCTTTGTAAAATAGCTCTAGCUAUUUUACAAAGGUACAUGUACCUUUGUAAAAUAGCUCUU13.618.622


Target Position: 2961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2961GGAGAGGAGAAAUUGAAAC74.68794197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322979GGAGAGGAGAAATTGAAACGTTTCAATTTCTCCTCTCC0.577000.210900.724100.750001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272GGCCCAAAAGAGAGAAUUU86.41251293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711290GGCCCAAAAGAGAGAATTTAAATTCTCTCTTTTGGGCC0.383800.094001.000001.000000.956500.75000


Target Position: 5209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5209GGAAAUUCAUUUUGAUUCA91.7686527

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5207-5229TCGGAAATTCATTTTGATTCAGAUGAAUCAAAAUGAAUUUCCGAGGAAAUUCAUUUUGAUUCAGAU16.310.422


Target Position: 2676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676CUAAAACCUUGUGAAAUCA84.6711637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2674-2696GACTAAAACCTTGTGAAATCAAAUGAUUUCACAAGGUUUUAGUCCUAAAACCUUGUGAAAUCAAAU16.314.032


Target Position: 9482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9482GGUUUUGAAAUACUUGUAA91.2032593

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9480-9502TTGGTTTTGAAATACTTGTAATTUUACAAGUAUUUCAAAACCAAGGUUUUGAAAUACUUGUAAUUU19.014.912


Target Position: 6663, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6663CAACUUAACAAGUUUAUUU87.41561130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6661-6683TGCAACTTAACAAGTTTATTTATAAAUAAACUUGUUAAGUUGCACAACUUAACAAGUUUAUUUAUU-0.34.931


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370GGAGGGAAAGAGAAUGAUA100.69649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952388GGAGGGAAAGAGAATGATATATCATTCTCTTTCCCTCC0.247000.109800.827601.000001.000001.00000


Target Position: 2073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073CAAAGUAUGAAGAAAGAUA98.281996

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2071-2093AGCAAAGTATGAAGAAAGATAAAUAUCUUUCUUCAUACUUUGCUCAAAGUAUGAAGAAAGAUAAAU14.84.621


Target Position: 2601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2601GAACAAUUUGAAAAUGACU85.26941506

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2599-2621ATGAACAATTTGAAAATGACTTAAGUCAUUUUCAAAUUGUUCAUGAACAAUUUGAAAAUGACUUAU14.85.322


Target Position: 6833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6833AGCAGAAGCUAAUAUAUAA102.71923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9296851AGCAGAAGCTAATATATAATTATATATTAGCTTCTGCT0.561100.051400.819000.750000.907600.62500


Target Position: 4698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4698CAACAUUCUCCUCAGAAUA93.8565336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4696-4718AGCAACATTCTCCTCAGAATACTUAUUCUGAGGAGAAUGUUGCUCAACAUUCUCCUCAGAAUACUU20.414.823


Target Position: 9585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9585GCUUAGUAGUUUAUACCAU91.3992572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9583-9605ATGCTTAGTAGTTTATACCATCTAUGGUAUAAACUACUAAGCAUGCUUAGUAGUUUAUACCAUCUU21.111.322


Target Position: 3117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3117GAUAUUAUUCCCACUCAAA98.574288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473135GATATTATTCCCACTCAAATTTGAGTGGGAATAATATC0.368300.122500.681000.750001.000001.00000


Target Position: 1730, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1730CCAAACUAUGCAAGAAAGA78.03363262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1728-1750ATCCAAACTATGCAAGAAAGAGTUCUUUCUUGCAUAGUUUGGAUCCAAACUAUGCAAGAAAGAGUU10.311.822


Target Position: 8970, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8970CAAGUUAUAUUAGAAAAGU81.58382353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8968-8990TCCAAGTTATATTAGAAAAGTTGACUUUUCUAAUAUAACUUGGACAAGUUAUAUUAGAAAAGUUGU10.34.622


Target Position: 7510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7510GACUAGAAGUUGAAAUCUA102.76122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7508-7530GTGACTAGAAGTTGAAATCTACTUAGAUUUCAACUUCUAGUCACGACUAGAAGUUGAAAUCUACUU14.818.922


Target Position: 8751, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8751GACUUUAUUGUUCUAAUUA95.2831239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8508769GACTTTATTGTTCTAATTATAATTAGAACAATAAAGTC0.235200.128300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8749-8771AAGACTTTATTGTTCTAATTATCUAAUUAGAACAAUAAAGUCUUGACUUUAUUGUUCUAAUUAUCU6.94.622


Target Position: 6862, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6862GGAUUUGGAACUUUCUGUA94.4546294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6860-6882TGGGATTTGGAACTTTCTGTATCUACAGAAAGUUCCAAAUCCCAGGAUUUGGAACUUUCUGUAUCU19.220.122


Target Position: 5477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5477GGUUAAGAAGAGGAGGAAG75.82743869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5795495GGTTAAGAAGAGGAGGAAGCTTCCTCCTCTTCTTAACC0.635600.429300.715500.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CCAAAAUUGAAGAAGUAUU81.78362308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1904-1926TGCCAAAATTGAAGAAGTATTGAAAUACUUCUUCAAUUUUGGCACCAAAAUUGAAGAAGUAUUGAU14.5-3.321


Target Position: 5307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5307GUAUUUAUUUGACUUCAUU87.91851049

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5305-5327ATGTATTTATTTGACTTCATTCCAAUGAAGUCAAAUAAAUACAUGUAUUUAUUUGACUUCAUUCCU19.2-8.022


Target Position: 8305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8305GUUUUUCCCCCUUAUAUUA87.35271138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8303-8325TAGTTTTTCCCCCTTATATTACAUAAUAUAAGGGGGAAAAACUAGUUUUUCCCCCUUAUAUUACAU-8.014.322


Target Position: 935, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935GGUUCAUAACCAGAAAGUA97.5679120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
933-955GTGGTTCATAACCAGAAAGTAGAUACUUUCUGGUUAUGAACCACGGUUCAUAACCAGAAAGUAGAU17.716.123


Target Position: 2683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683CUUGUGAAAUCAAAAGACA87.60711091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2681-2703ACCTTGTGAAATCAAAAGACAGGUGUCUUUUGAUUUCACAAGGUCUUGUGAAAUCAAAAGACAGGU13.320.522


Target Position: 7834, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7834GGCUUUUAGAACCGAAAUU77.16533478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7832-7854TTGGCTTTTAGAACCGAAATTGTAAUUUCGGUUCUAAAAGCCAAGGCUUUUAGAACCGAAAUUGUU20.713.723


Target Position: 3680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3680GACAGUUUCUGAAAAGACU86.51571275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3678-3700CAGACAGTTTCTGAAAAGACTGTAGUCUUUUCAGAAACUGUCUGGACAGUUUCUGAAAAGACUGUU13.317.822


Target Position: 5857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5857CAUUUUUAUAAUUAUACAU89.1216852

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5855-5877TTCATTTTTATAATTATACATTAAUGUAUAAUUAUAAAAAUGAACAUUUUUAUAAUUAUACAUUAU8.5-9.711


Target Position: 9682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9682GUUUACAAACAUAUAUCUA94.523289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9680-9702TTGTTTACAAACATATATCTATAUAGAUAUAUGUUUGUAAACAAGUUUACAAACAUAUAUCUAUAU8.27.222


Target Position: 7943, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7943CCCUUUUUAAAAAGUUGUU70.72555377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5447961CCCTTTTTAAAAAGTTGTTAACAACTTTTTAAAAAGGG0.324200.120700.844801.000000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7941-7963TCCCCTTTTTAAAAAGTTGTTGTAACAACUUUUUAAAAAGGGGACCCUUUUUAAAAAGUUGUUGUU17.89.521


Target Position: 6597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6597AGUCCAAAGAUGAUUUUUU81.08482479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9026615AGTCCAAAGATGATTTTTTAAAAAATCATCTTTGGACT0.225000.075400.706900.750001.000001.00000


Target Position: 6449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6449GGUAUAUAUUUUUUGAAGU85.67861427

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6447-6469TAGGTATATATTTTTTGAAGTATACUUCAAAAAAUAUAUACCUAGGUAUAUAUUUUUUGAAGUAUU12.22.822


Target Position: 3368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3368GAAUUUGGAUUUAACAAAA97.2041135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3366-3388AGGAATTTGGATTTAACAAAAAGUUUUGUUAAAUCCAAAUUCCUGAAUUUGGAUUUAACAAAAAGU7.211.322


Target Position: 9234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9234GUGGUGAAAUAUAUAUAUA101.50635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6249252GTGGTGAAATATATATATATATATATATATTTCACCAC0.397300.083500.750000.750001.000001.00000


Target Position: 3879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3879GGAUUAGAAUCUACCUUAA104.4439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873897GGATTAGAATCTACCTTAATTAAGGTAGATTCTAATCC0.292500.048000.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3877-3899TGGGATTAGAATCTACCTTAATAUUAAGGUAGAUUCUAAUCCCAGGAUUAGAAUCUACCUUAAUAU19.816.033


Target Position: 951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951GUAGAAAUUCUGAGAAAAA97.1173140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971AAGTAGAAATTCTGAGAAAAATGUUUUUCUCAGAAUUUCUACUUGUAGAAAUUCUGAGAAAAAUGU14.86.922


Target Position: 8541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8541GAUAUAUUCCAAAAAUGGU81.15242463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8539-8561CAGATATATTCCAAAAATGGTAAACCAUUUUUGGAAUAUAUCUGGAUAUAUUCCAAAAAUGGUAAU11.3-8.622


Target Position: 3495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495GAUGAUAGACUGGUUUUAA97.8412108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3493-3515AGGATGATAGACTGGTTTTAAGGUUAAAACCAGUCUAUCAUCCUGAUGAUAGACUGGUUUUAAGGU14.013.333


Target Position: 1296, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GAGGAAAACCCAGAGAAAA90.8923644

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1294-1316TAGAGGAAAACCCAGAGAAAAGTUUUUCUCUGGGUUUUCCUCUAGAGGAAAACCCAGAGAAAAGUU19.118.722


Target Position: 9324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9324GAAGAUAACUUUGGUUUUA91.4928562

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9322-9344CTGAAGATAACTTTGGTTTTAATUAAAACCAAAGUUAUCUUCAGGAAGAUAACUUUGGUUUUAAUU18.86.922


Target Position: 424, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424CAGAUAAGAAGCAGAAAGU82.4292146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
422-444AACAGATAAGAAGCAGAAAGTTGACUUUCUGCUUCUUAUCUGUUCAGAUAAGAAGCAGAAAGUUGU16.611.622


Target Position: 6757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6757CAUCUAUAAAUUGAAAUUA91.0498616

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6755-6777CTCATCTATAAATTGAAATTATAUAAUUUCAAUUUAUAGAUGAGCAUCUAUAAAUUGAAAUUAUAU7.48.222


Target Position: 9765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9765UCCCACUUGCUCUUUGAUA73.52934529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8289783TCCCACTTGCTCTTTGATATATCAAAGAGCAAGTGGGA0.246600.161300.827600.750001.000001.00000


Target Position: 6815, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6815GGGAUUAAAAAUUUUAGAA92.8785430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6813-6835ATGGGATTAAAAATTTTAGAAGCUUCUAAAAUUUUUAAUCCCAUGGGAUUAAAAAUUUUAGAAGCU7.115.522


Target Position: 8352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8352CCUGAUAUUUCCACCACUU84.2931733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6358370CCTGATATTTCCACCACTTAAGTGGTGGAAATATCAGG0.772200.090000.706901.000000.907600.62500


Target Position: 9804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9804ACAAUAAAACUCUGUAUUU81.94732263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7319822ACAATAAAACTCTGTATTTAAATACAGAGTTTTATTGT0.376900.365700.706900.750001.000001.00000


Target Position: 6840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6840GCUAAUAUAUAAAUGAAGU86.33741311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6838-6860AAGCTAATATATAAATGAAGTTTACUUCAUUUAUAUAUUAGCUUGCUAAUAUAUAAAUGAAGUUUU12.0-2.723


Target Position: 7769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7769CACCUUCGAAGCUAUAUAU88.11071017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5957787CACCTTCGAAGCTATATATATATATAGCTTCGAAGGTG0.307300.179800.750000.750001.000001.00000


Target Position: 3606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606GCAACAGAUAACAAAGCUU85.73561416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813624GCAACAGATAACAAAGCTTAAGCTTTGTTATCTGTTGC0.443600.269200.715501.000001.000001.00000


Target Position: 7770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7770ACCUUCGAAGCUAUAUAUU72.15984935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4887788ACCTTCGAAGCTATATATTAATATATAGCTTCGAAGGT0.682400.169600.844800.750001.000001.00000


Target Position: 3982, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3982CAAAGGAACAACAUACAGA92.8376432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3980-4002TGCAAAGGAACAACATACAGATGUCUGUAUGUUGUUCCUUUGCACAAAGGAACAACAUACAGAUGU17.918.722


Target Position: 4387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4387GUAACAUUUUAGUAAUGGA92.4168465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4385-4407AAGTAACATTTTAGTAATGGACCUCCAUUACUAAAAUGUUACUUGUAACAUUUUAGUAAUGGACCU20.06.923


Target Position: 6489, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6489GUCUGUAAAUUCUGUUAAU90.4432687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9626507GTCTGTAAATTCTGTTAATATTAACAGAATTTACAGAC0.306700.049600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6487-6509AAGTCTGTAAATTCTGTTAATAAAUUAACAGAAUUUACAGACUUGUCUGUAAAUUCUGUUAAUAAU11.820.322


Target Position: 2889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889GUUCGAAAGAGAAAUGAGA86.14531354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2887-2909CTGTTCGAAAGAGAAATGAGACCUCUCAUUUCUCUUUCGAACAGGUUCGAAAGAGAAAUGAGACCU12.016.822


Target Position: 8084, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8084GUUUUCCUCUUUGAUGUUA80.68572589

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8082-8104TTGTTTTCCTCTTTGATGTTAGTUAACAUCAAAGAGGAAAACAAGUUUUCCUCUUUGAUGUUAGUU20.518.721


Target Position: 8089, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8089CCUCUUUGAUGUUAGUAAA95.7331214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8087-8109TTCCTCTTTGATGTTAGTAAATTUUUACUAACAUCAAAGAGGAACCUCUUUGAUGUUAGUAAAUUU6.616.622


Target Position: 8252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8252GGACCUCAAAAUACAAAAU87.57761097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3158270GGACCTCAAAATACAAAATATTTTGTATTTTGAGGTCC0.633200.150000.862101.000001.000001.00000


Target Position: 3748, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3748CCACAAAGCCAAUUCCAUU85.17791527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513766CCACAAAGCCAATTCCATTAATGGAATTGGCTTTGTGG0.388800.097700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3746-3768ATCCACAAAGCCAATTCCATTACAAUGGAAUUGGCUUUGUGGAUCCACAAAGCCAAUUCCAUUACU20.116.722


Target Position: 5216, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5216CAUUUUGAUUCAGAAUAAA93.5684362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5214-5236TTCATTTTGATTCAGAATAAAAAUUUAUUCUGAAUCAAAAUGAACAUUUUGAUUCAGAAUAAAAAU6.97.422


Target Position: 3747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3747UCCACAAAGCCAAUUCCAU70.64025393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443765TCCACAAAGCCAATTCCATATGGAATTGGCTTTGTGGA0.218800.100600.715500.750001.000001.00000


Target Position: 9653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9653GAAAUUAACCUGUUUGUAU90.9341639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9651-9673CGGAAATTAACCTGTTTGTATGCAUACAAACAGGUUAAUUUCCGGAAAUUAACCUGUUUGUAUGCU14.7-9.723


Target Position: 2574, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574GCUUUUGGAGAAAGUCAAA89.8286770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2572-2594TAGCTTTTGGAGAAAGTCAAAGTUUUGACUUUCUCCAAAAGCUAGCUUUUGGAGAAAGUCAAAGUU19.216.122


Target Position: 7934, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7934GGAUGAAUCCCCUUUUUAA102.93321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7932-7954AAGGATGAATCCCCTTTTTAAAAUUAAAAAGGGGAUUCAUCCUUGGAUGAAUCCCCUUUUUAAAAU-3.816.223


Target Position: 4899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4899GAAAGUUACACCAUUCUUU87.61061088

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4897-4919AGGAAAGTTACACCATTCTTTGCAAAGAAUGGUGUAACUUUCCUGAAAGUUACACCAUUCUUUGCU12.04.922


Target Position: 7092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7092GUAGGUUAGCAAAAUUUCA88.7549918

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7090-7112TTGTAGGTTAGCAAAATTTCAGTUGAAAUUUUGCUAACCUACAAGUAGGUUAGCAAAAUUUCAGUU0.419.832


Target Position: 7361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7361CCUCCCACACGUUCCAUUU74.76134177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2417379CCTCCCACACGTTCCATTTAAATGGAACGTGTGGGAGG0.718500.750200.844801.000001.000001.00000


Target Position: 8877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8877GGGAAAAUAGAAAAUAAGA92.4079467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8875-8897CTGGGAAAATAGAAAATAAGATTUCUUAUUUUCUAUUUUCCCAGGGGAAAAUAGAAAAUAAGAUUU-4.314.221


Target Position: 3020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3020GGAAAUGAUCAAAUCUCGU82.61852109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3018-3040CTGGAAATGATCAAATCTCGTCAACGAGAUUUGAUCAUUUCCAGGGAAAUGAUCAAAUCUCGUCAU21.016.333


Target Position: 9652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9652GGAAAUUAACCUGUUUGUA89.9124759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9650-9672GCGGAAATTAACCTGTTTGTATGUACAAACAGGUUAAUUUCCGCGGAAAUUAACCUGUUUGUAUGU19.32.132


Target Position: 3498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498GAUAGACUGGUUUUAAGGU79.72032821

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3496-3518ATGATAGACTGGTTTTAAGGTGTACCUUAAAACCAGUCUAUCAUGAUAGACUGGUUUUAAGGUGUU11.018.933


Target Position: 9422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9422CUUUUACCAACAGCAUUUU70.185525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9420-9442TGCTTTTACCAACAGCATTTTAGAAAAUGCUGUUGGUAAAAGCACUUUUACCAACAGCAUUUUAGU18.514.022


Target Position: 8247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8247GCAUAGGACCUCAAAAUAC79.64172845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9488265GCATAGGACCTCAAAATACGTATTTTGAGGTCCTATGC0.339400.115000.672400.750001.000001.00000


Target Position: 6163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6163CCAAGGGUGGAGUGGAAAA84.81581608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4426181CCAAGGGTGGAGTGGAAAATTTTCCACTCCACCCTTGG0.710400.117100.844801.000000.994600.62500


Target Position: 7273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7273GAUGAAGUCUAAUUCUGAA104.7926

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7271-7293AAGATGAAGTCTAATTCTGAAAAUUCAGAAUUAGACUUCAUCUUGAUGAAGUCUAAUUCUGAAAAU20.419.232


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501GGAGGAGGAAUGUGAAGUA99.393973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252519GGAGGAGGAATGTGAAGTATACTTCACATTCCTCCTCC0.592000.168100.689701.000001.000001.00000


Target Position: 6490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6490UCUGUAAAUUCUGUUAAUA83.31141932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8856508TCTGTAAATTCTGTTAATATATTAACAGAATTTACAGA0.308000.144100.681000.750001.000001.00000


Target Position: 4542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4542GAAGAGAAGGAUGUUAAUU84.35421720

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4540-4562AGGAAGAGAAGGATGTTAATTTAAAUUAACAUCCUUCUCUUCCUGAAGAGAAGGAUGUUAAUUUAU6.919.112


Target Position: 6377, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6377GGUAAGUUUCAGAAUUGUA99.0682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6375-6397AGGGTAAGTTTCAGAATTGTAATUACAAUUCUGAAACUUACCCUGGUAAGUUUCAGAAUUGUAAUU14.812.933


Target Position: 2399, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399GCAAGUUGGAGAAACAUCA89.2234839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2397-2419AAGCAAGTTGGAGAAACATCAGCUGAUGUUUCUCCAACUUGCUUGCAAGUUGGAGAAACAUCAGCU14.816.722


Target Position: 6746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6746UCUUUAGACCUCAUCUAUA89.0085867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9526764TCTTTAGACCTCATCTATATATAGATGAGGTCTAAAGA0.305400.109700.681000.750000.913000.75000


Target Position: 6895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6895CAAGUAAAAACCAAAUGGU76.67163622

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6893-6915AACAAGTAAAAACCAAATGGTTAACCAUUUGGUUUUUACUUGUUCAAGUAAAAACCAAAUGGUUAU17.74.922


Target Position: 8008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8008GUCCAUUUAAAAAUUAUUU76.78183585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8006-8028AAGTCCATTTAAAAATTATTTTTAAAUAAUUUUUAAAUGGACUUGUCCAUUUAAAAAUUAUUUUUU-10.320.121


Target Position: 4081, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4081CAUUGGAUGCACUAAGAAA101.15940

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4079-4101GGCATTGGATGCACTAAGAAATTUUUCUUAGUGCAUCCAAUGCCCAUUGGAUGCACUAAGAAAUUU11.720.132


Target Position: 8810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8810CUGAUAAGGCUGUAUGUUU84.70691630

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8808-8830AGCTGATAAGGCTGTATGTTTCTAAACAUACAGCCUUAUCAGCUCUGAUAAGGCUGUAUGUUUCUU14.613.433


Target Position: 3790, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3790GAGAUAAUGAUGAAGAAGA92.9747419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3788-3810AGGAGATAATGATGAAGAAGATCUCUUCUUCAUCAUUAUCUCCUGAGAUAAUGAUGAAGAAGAUCU19.16.622


Target Position: 9603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9603UCUUUUAGUUAAACAUUUU75.85693858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8619621TCTTTTAGTTAAACATTTTAAAATGTTTAACTAAAAGA0.260200.056500.724100.750001.000001.00000


Target Position: 8353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8353CUGAUAUUUCCACCACUUU78.30183190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6918371CTGATATTTCCACCACTTTAAAGTGGTGGAAATATCAG0.756800.103500.784500.750000.907600.62500


Target Position: 8011, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8011CAUUUAAAAAUUAUUUUUA91.7229530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8009-8031TCCATTTAAAAATTATTTTTAGAUAAAAAUAAUUUUUAAAUGGACAUUUAAAAAUUAUUUUUAGAU-9.7-9.712


Target Position: 9262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9262GCUAUUGUAACUAUUUUUA89.5904802

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9260-9282TTGCTATTGTAACTATTTTTAAGUAAAAAUAGUUACAAUAGCAAGCUAUUGUAACUAUUUUUAAGU-9.711.622


Target Position: 8847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8847CAUCUAAAAACUUUCUGUU85.00671570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8845-8867GTCATCTAAAAACTTTCTGTTTTAACAGAAAGUUUUUAGAUGACCAUCUAAAAACUUUCUGUUUUU19.26.933


Target Position: 1559, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559CCUGUAUAAACAUACCAAU86.1071367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451577CCTGTATAAACATACCAATATTGGTATGTTTATACAGG0.432700.229500.836201.000000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1557-1579GACCTGTATAAACATACCAATTCAUUGGUAUGUUUAUACAGGUCCCUGUAUAAACAUACCAAUUCU20.013.131


Target Position: 7512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7512CUAGAAGUUGAAAUCUACU82.77772057

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7510-7532GACTAGAAGTTGAAATCTACTTCAGUAGAUUUCAACUUCUAGUCCUAGAAGUUGAAAUCUACUUCU14.518.922


Target Position: 5809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5809GCAAAUUUUAUUUUCUUGA80.38832665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5807-5829AAGCAAATTTTATTTTCTTGACTUCAAGAAAAUAAAAUUUGCUUGCAAAUUUUAUUUUCUUGACUU12.2-3.322


Target Position: 7847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7847GAAAUUGUAACUAUGUAUU85.36431488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7845-7867CCGAAATTGTAACTATGTATTGTAAUACAUAGUUACAAUUUCGGGAAAUUGUAACUAUGUAUUGUU8.25.332


Target Position: 5262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5262GGAUAUGAAAUUGUACUUA94.7242271

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5260-5282TAGGATATGAAATTGTACTTAGAUAAGUACAAUUUCAUAUCCUAGGAUAUGAAAUUGUACUUAGAU19.017.422


Target Position: 8246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8246UGCAUAGGACCUCAAAAUA83.03011993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7518264TGCATAGGACCTCAAAATATATTTTGAGGTCCTATGCA0.259400.115100.810300.750001.000001.00000


Target Position: 5327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5327CGUAUUUGAAAGCACAUUU81.62352345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8465345CGTATTTGAAAGCACATTTAAATGTGCTTTCAAATACG0.236000.066200.775901.000001.000001.00000


Target Position: 8645, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8645GUACUCUUUAACAGAAAUU78.56673113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8643-8665ATGTACTCTTTAACAGAAATTGCAAUUUCUGUUAAAGAGUACAUGUACUCUUUAACAGAAAUUGCU12.018.932


Target Position: 9169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9169UCAUAUAAUUCAUCCAUUU80.58932613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9749187TCATATAATTCATCCATTTAAATGGATGAATTATATGA0.213900.160400.724100.750001.000001.00000


Target Position: 4096, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4096GAAAUUUGGGUUUGUUGAA87.30831145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4094-4116AAGAAATTTGGGTTTGTTGAAGCUUCAACAAACCCAAAUUUCUUGAAAUUUGGGUUUGUUGAAGCU20.5-3.322


Target Position: 4294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4294GUGACAUUGCAACUUGUUA90.6525664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4292-4314TGGTGACATTGCAACTTGTTACAUAACAAGUUGCAAUGUCACCAGUGACAUUGCAACUUGUUACAU17.820.523


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137GCAAAGGCUUACUAAGUAC78.89593038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283155GCAAAGGCTTACTAAGTACGTACTTAGTAAGCCTTTGC0.227900.054900.672400.750001.000001.00000


Target Position: 7962, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7962GUUGUUGUUGUUUAUUUGA80.75572569

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7960-7982TTGTTGTTGTTGTTTATTTGATTUCAAAUAAACAACAACAACAAGUUGUUGUUGUUUAUUUGAUUU-1.419.302


Target Position: 7738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7738CCAAAGUGCUGUAAUUUAA94.6134282

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7736-7758CCCCAAAGTGCTGTAATTTAACAUUAAAUUACAGCACUUUGGGGCCAAAGUGCUGUAAUUUAACAU-7.516.712


Target Position: 9155, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9155GAGAUAUUCACAUAUCAUA101.90733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9153-9175TTGAGATATTCACATATCATATAUAUGAUAUGUGAAUAUCUCAAGAGAUAUUCACAUAUCAUAUAU8.56.623


Target Position: 6709, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6709CUAAAUUGAUCUGUGUUUU77.60543370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6707-6729TCCTAAATTGATCTGTGTTTTTAAAAACACAGAUCAAUUUAGGACUAAAUUGAUCUGUGUUUUUAU19.3-1.422


Target Position: 1367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367CCGUAUAGCACCUCAUAUU86.00161383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1365-1387ACCCGTATAGCACCTCATATTATAAUAUGAGGUGCUAUACGGGUCCGUAUAGCACCUCAUAUUAUU13.313.333


Target Position: 851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851CAUGACAUCUCCUCAUUCA94.699276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
849-871ATCATGACATCTCCTCATTCACCUGAAUGAGGAGAUGUCAUGAUCAUGACAUCUCCUCAUUCACCU20.420.522


Target Position: 9132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9132GUUGUUUUUUUAAUAGCUU78.38953168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9130-9152TTGTTGTTTTTTTAATAGCTTTAAAGCUAUUAAAAAAACAACAAGUUGUUUUUUUAAUAGCUUUAU18.35.621


Target Position: 9409, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9409CAACAUUUCUGUGCUUUUA89.8579768

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9407-9429ACCAACATTTCTGTGCTTTTACCUAAAAGCACAGAAAUGUUGGUCAACAUUUCUGUGCUUUUACCU18.65.322


Target Position: 6009, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6009GAAGGUUAUCUAACUGAAU91.0403617

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6007-6029GGGAAGGTTATCTAACTGAATCAAUUCAGUUAGAUAACCUUCCCGAAGGUUAUCUAACUGAAUCAU19.218.632


Target Position: 962, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962GAGAAAAAUGUUACAGAAA96.0442198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
960-982CTGAGAAAAATGTTACAGAAAGAUUUCUGUAACAUUUUUCUCAGGAGAAAAAUGUUACAGAAAGAU20.35.521


Target Position: 9624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9624AGAUUAAGACUAUUCAAAU92.3258475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8379642AGATTAAGACTATTCAAATATTTGAATAGTCTTAATCT0.430500.083700.715500.750001.000001.00000


Target Position: 1905, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GCCAAAAUUGAAGAAGUAU80.52272630

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1903-1925TTGCCAAAATTGAAGAAGTATTGAUACUUCUUCAAUUUUGGCAAGCCAAAAUUGAAGAAGUAUUGU18.911.312


Target Position: 9475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9475GUAUUUUGGUUUUGAAAUA90.4819683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9473-9495CTGTATTTTGGTTTTGAAATACTUAUUUCAAAACCAAAAUACAGGUAUUUUGGUUUUGAAAUACUU7.4-1.422


Target Position: 2820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820CGGAAAAUUUUUUCAAACU80.23822699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2818-2840TACGGAAAATTTTTTCAAACTTGAGUUUGAAAAAAUUUUCCGUACGGAAAAUUUUUUCAAACUUGU14.914.222


Target Position: 3559, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3559CGUUUAGCCCUGUCAUUAA96.6989165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3557-3579CACGTTTAGCCCTGTCATTAAGTUUAAUGACAGGGCUAAACGUGCGUUUAGCCCUGUCAUUAAGUU16.120.922


Target Position: 9466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9466GCAUUUGCUGUAUUUUGGU75.25534028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9464-9486GGGCATTTGCTGTATTTTGGTTTACCAAAAUACAGCAAAUGCCCGCAUUUGCUGUAUUUUGGUUUU11.320.022


Target Position: 5358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5358GCCUUGUUUUGUUUUAAUU81.20612444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5575376GCCTTGTTTTGTTTTAATTAATTAAAACAAAACAAGGC0.321100.201000.991401.000001.000001.00000


Target Position: 7776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7776GAAGCUAUAUAUUUUGCAU95.3083237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7774-7796TCGAAGCTATATATTTTGCATACAUGCAAAAUAUAUAGCUUCGAGAAGCUAUAUAUUUUGCAUACU20.018.323


Target Position: 7340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7340CUCUUUUCCCUCCCAACUU70.40545459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9367358CTCTTTTCCCTCCCAACTTAAGTTGGGAGGGAAAAGAG0.254100.231000.672400.750001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072GCAAAGUAUGAAGAAAGAU83.0661985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822090GCAAAGTATGAAGAAAGATATCTTTCTTCATACTTTGC0.610500.354300.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2070-2092AAGCAAAGTATGAAGAAAGATAAAUCUUUCUUCAUACUUUGCUUGCAAAGUAUGAAGAAAGAUAAU19.111.812


Target Position: 3168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168GAUAAUAUUGCCAAAUACA95.7432213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3166-3188TGGATAATATTGCCAAATACACAUGUAUUUGGCAAUAUUAUCCAGAUAAUAUUGCCAAAUACACAU6.9-8.622


Target Position: 9357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9357GAAGCAUAUGCCUCUAUUU91.9156515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9355-9377ATGAAGCATATGCCTCTATTTTTAAAUAGAGGCAUAUGCUUCAUGAAGCAUAUGCCUCUAUUUUUU11.619.722


Target Position: 9128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9128GUUUGUUGUUUUUUUAAUA92.4786457

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9126-9148AGGTTTGTTGTTTTTTTAATAGCUAUUAAAAAAACAACAAACCUGUUUGUUGUUUUUUUAAUAGCU-9.712.221


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554UCAGACCUGUAUAAACAUA84.08061774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641572TCAGACCTGTATAAACATATATGTTTATACAGGTCTGA0.370100.065600.681000.750001.000001.00000


Target Position: 8886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8886GAAAAUAAGAUUUCAAAUA93.3595381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8884-8906TAGAAAATAAGATTTCAAATATTUAUUUGAAAUCUUAUUUUCUAGAAAAUAAGAUUUCAAAUAUUU7.4-9.711


Target Position: 7289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7289GAAAAUAUCUCACAAUUUU90.3336701

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7287-7309CTGAAAATATCTCACAATTTTTGAAAAUUGUGAGAUAUUUUCAGGAAAAUAUCUCACAAUUUUUGU5.3-10.322


Target Position: 1560, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1560CUGUAUAAACAUACCAAUU85.20711521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441578CTGTATAAACATACCAATTAATTGGTATGTTTATACAG0.535200.244300.775900.750000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1558-1580ACCTGTATAAACATACCAATTCCAAUUGGUAUGUUUAUACAGGUCUGUAUAAACAUACCAAUUCCU20.08.522


Target Position: 4322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4322GACUUCAACUGAAUCUUUU86.71921243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4320-4342CGGACTTCAACTGAATCTTTTGCAAAAGAUUCAGUUGAAGUCCGGACUUCAACUGAAUCUUUUGCU5.319.232


Target Position: 8932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8932GUGACUUUUUAUUUGUAUU84.1261764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8930-8952ATGTGACTTTTTATTTGTATTCTAAUACAAAUAAAAAGUCACAUGUGACUUUUUAUUUGUAUUCUU6.919.2


Target Position: 9127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9127GGUUUGUUGUUUUUUUAAU85.85331400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9125-9147CAGGTTTGTTGTTTTTTTAATAGAUUAAAAAAACAACAAACCUGGGUUUGUUGUUUUUUUAAUAGU-9.113.311


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368CGUAUAGCACCUCAUAUUA96.5209173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631386CGTATAGCACCTCATATTATAATATGAGGTGCTATACG0.434100.077200.741401.000001.000001.00000


Target Position: 5709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5709GAAUCCUCAACAUACUAAA95.4554233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9675727GAATCCTCAACATACTAAATTTAGTATGTTGAGGATTC0.336500.156800.672400.750001.000001.00000


Target Position: 5339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5339CACAUUUUAAUUUUUAUUU76.65723625

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5337-5359AGCACATTTTAATTTTTATTTGCAAAUAAAAAUUAAAAUGUGCUCACAUUUUAAUUUUUAUUUGCU-9.75.321


Target Position: 8165, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8165CGAUAUAUGGUUUUGAAUU86.8951214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8163-8185GTCGATATATGGTTTTGAATTACAAUUCAAAACCAUAUAUCGACCGAUAUAUGGUUUUGAAUUACU7.43.232


Target Position: 9467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9467CAUUUGCUGUAUUUUGGUU83.29911935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9465-9487GGCATTTGCTGTATTTTGGTTTTAACCAAAAUACAGCAAAUGCCCAUUUGCUGUAUUUUGGUUUUU18.818.512


Target Position: 7364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7364CCCACACGUUCCAUUUCAU84.76681618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1947382CCCACACGTTCCATTTCATATGAAATGGAACGTGTGGG0.732500.745200.836201.000001.000001.00000


Target Position: 5317, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5317GACUUCAUUCCGUAUUUGA88.3223983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5315-5337TTGACTTCATTCCGTATTTGAAAUCAAAUACGGAAUGAAGUCAAGACUUCAUUCCGUAUUUGAAAU6.919.233


Target Position: 6408, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6408CUUCAAUUAUAUUGACUUU86.60351263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6406-6428TCCTTCAATTATATTGACTTTCTAAAGUCAAUAUAAUUGAAGGACUUCAAUUAUAUUGACUUUCUU19.27.422


Target Position: 7942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7942CCCCUUUUUAAAAAGUUGU64.91996936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5807960CCCCTTTTTAAAAAGTTGTACAACTTTTTAAAAAGGGG0.311400.104000.784500.750000.967400.62500


Target Position: 1898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898GAUUGUUGCCAAAAUUGAA97.7225113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1896-1918CAGATTGTTGCCAAAATTGAAGAUUCAAUUUUGGCAACAAUCUGGAUUGUUGCCAAAAUUGAAGAU7.412.123


Target Position: 1483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483CUCAUUUGGCUGUUUUCUU74.94194129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1481-1503GGCTCATTTGGCTGTTTTCTTACAAGAAAACAGCCAAAUGAGCCCUCAUUUGGCUGUUUUCUUACU13.313.822


Target Position: 9036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9036GACAUCUUCCUGCUUAUUA89.6602793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9034-9056CAGACATCTTCCTGCTTATTAGAUAAUAAGCAGGAAGAUGUCUGGACAUCUUCCUGCUUAUUAGAU13.619.222


Target Position: 954, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954GAAAUUCUGAGAAAAAUGU78.42633158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
952-974TAGAAATTCTGAGAAAAATGTTAACAUUUUUCUCAGAAUUUCUAGAAAUUCUGAGAAAAAUGUUAU-3.35.322


Target Position: 7965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7965GUUGUUGUUUAUUUGAUUU81.56782357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7963-7985TTGTTGTTGTTTATTTGATTTTGAAAUCAAAUAAACAACAACAAGUUGUUGUUUAUUUGAUUUUGU7.419.302


Target Position: 7894, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7894CUUUUUGGCUUUCUUUUUU72.19134917

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7892-7914AGCTTTTTGGCTTTCTTTTTTCCAAAAAAGAAAGCCAAAAAGCUCUUUUUGGCUUUCUUUUUUCCU5.511.521


Target Position: 7956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7956GUUGUUGUUGUUGUUGUUU70.835344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7954-7976AAGTTGTTGTTGTTGTTGTTTATAAACAACAACAACAACAACUUGUUGUUGUUGUUGUUGUUUAUU19.319.300


Target Position: 3071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071GCAAGAUGCUGAAAGUAAU93.4256374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3069-3091GTGCAAGATGCTGAAAGTAATCCAUUACUUUCAGCAUCUUGCACGCAAGAUGCUGAAAGUAAUCCU4.918.122


Target Position: 9631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9631GACUAUUCAAAUGUACUUU82.67852085

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9629-9651AAGACTATTCAAATGTACTTTGCAAAGUACAUUUGAAUAGUCUUGACUAUUCAAAUGUACUUUGCU19.014.522


Target Position: 1369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369GUAUAGCACCUCAUAUUAU93.6088353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1367-1389CCGTATAGCACCTCATATTATTGAUAAUAUGAGGUGCUAUACGGGUAUAGCACCUCAUAUUAUUGU0.020.933


Target Position: 3506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3506GGUUUUAAGGUGUCAUAGU83.78791842

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3504-3526CTGGTTTTAAGGTGTCATAGTAAACUAUGACACCUUAAAACCAGGGUUUUAAGGUGUCAUAGUAAU20.30.032


Target Position: 6869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6869GAACUUUCUGUAUCUCUUA96.8155154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6867-6889TGGAACTTTCTGTATCTCTTAGGUAAGAGAUACAGAAAGUUCCAGAACUUUCUGUAUCUCUUAGGU19.113.322


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CCCAAAGAUUGCUAAAAGA87.39581133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951048CCCAAAGATTGCTAAAAGATCTTTTAGCAATCTTTGGG0.270400.083600.767200.750001.000001.00000


Target Position: 8678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8678UCUGGAACUAUCUUUAAAA85.82251405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7578696TCTGGAACTATCTTTAAAATTTTAAAGATAGTTCCAGA0.555600.159100.724100.750001.000001.00000


Target Position: 5851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5851UCAUUUCAUUUUUAUAAUU75.62543919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8755869TCATTTCATTTTTATAATTAATTATAAAAATGAAATGA0.229900.180600.715500.750001.000001.00000


Target Position: 3801, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801GAAGAAGAUCCUUCAAAAU91.3121579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3799-3821ATGAAGAAGATCCTTCAAAATTAAUUUUGAAGGAUCUUCUUCAUGAAGAAGAUCCUUCAAAAUUAU7.719.112


Target Position: 8409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8409AGAGUUCCUUUUGCCUUAU73.70184474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9228427AGAGTTCCTTTTGCCTTATATAAGGCAAAAGGAACTCT0.222200.125200.681000.750001.000001.00000


Target Position: 8656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8656CAGAAAUUGCUUUUAAAAA91.5712551

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8654-8676AACAGAAATTGCTTTTAAAAAATUUUUUAAAAGCAAUUUCUGUUCAGAAAUUGCUUUUAAAAAAUU-9.15.321


Target Position: 6572, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6572GGAUGUAAUUUUAAUGCUU92.4198463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6570-6592TAGGATGTAATTTTAATGCTTCCAAGCAUUAAAAUUACAUCCUAGGAUGUAAUUUUAAUGCUUCCU19.716.133


Target Position: 3240, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3240CAGAUCUUAAAUUAUGUAA90.2432712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253258CAGATCTTAAATTATGTAATTACATAATTTAAGATCTG0.636400.225400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3238-3260GTCAGATCTTAAATTATGTAAATUUACAUAAUUUAAGAUCUGACCAGAUCUUAAAUUAUGUAAAUU8.519.133


Target Position: 8821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8821GUAUGUUUCUGGAACAAAA99.549668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8819-8841CTGTATGTTTCTGGAACAAAATAUUUUGUUCCAGAAACAUACAGGUAUGUUUCUGGAACAAAAUAU14.96.922


Target Position: 9183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9183CAUUUAAAGUGUAUAAUCA100.3953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9181-9203TCCATTTAAAGTGTATAATCAGAUGAUUAUACACUUUAAAUGGACAUUUAAAGUGUAUAAUCAGAU3.5-9.722


Target Position: 8625, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8625CUUGUUCACCAUACAAUCA86.40591295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8623-8645TCCTTGTTCACCATACAATCATGUGAUUGUAUGGUGAACAAGGACUUGUUCACCAUACAAUCAUGU16.120.522


Target Position: 491, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491GAAGACAAAGUCUAGUUCA92.7228440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
489-511AAGAAGACAAAGTCTAGTTCAGAUGAACUAGACUUUGUCUUCUUGAAGACAAAGUCUAGUUCAGAU18.919.232


Target Position: 1274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274CCCAAAAGAGAGAAUUUAU86.61111262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1272-1294GGCCCAAAAGAGAGAATTTATCTAUAAAUUCUCUCUUUUGGGCCCCCAAAAGAGAGAAUUUAUCUU2.116.121


Target Position: 6386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6386CAGAAUUGUAAUUUGAGAA93.0206416

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6384-6406TTCAGAATTGTAATTTGAGAACTUUCUCAAAUUACAAUUCUGAACAGAAUUGUAAUUUGAGAACUU20.412.022


Target Position: 6378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6378GUAAGUUUCAGAAUUGUAA91.7165531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6376-6398GGGTAAGTTTCAGAATTGTAATTUUACAAUUCUGAAACUUACCCGUAAGUUUCAGAAUUGUAAUUU6.94.932


Target Position: 3610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610CAGAUAACAAAGCUUUAUU84.95151580

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3608-3630AACAGATAACAAAGCTTTATTCGAAUAAAGCUUUGUUAUCUGUUCAGAUAACAAAGCUUUAUUCGU13.614.532


Target Position: 2161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161GUCAUGACAACAGUGCAAU75.88013852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912179GTCATGACAACAGTGCAATATTGCACTGTTGTCATGAC0.320100.231100.810300.750001.000001.00000


Target Position: 7772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7772CUUCGAAGCUAUAUAUUUU90.9559632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7770-7792ACCTTCGAAGCTATATATTTTGCAAAAUAUAUAGCUUCGAAGGUCUUCGAAGCUAUAUAUUUUGCU-8.021.032


Target Position: 945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945CAGAAAGUAGAAAUUCUGA90.7269657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
943-965ACCAGAAAGTAGAAATTCTGAGAUCAGAAUUUCUACUUUCUGGUCAGAAAGUAGAAAUUCUGAGAU12.017.722


Target Position: 9704, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9704CUAUAUAUAUAGAUACAGA104.21312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9702-9724ATCTATATATATAGATACAGATAUCUGUAUCUAUAUAUAUAGAUCUAUAUAUAUAGAUACAGAUAU20.3-6.411


Target Position: 6444, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6444CAUUAGGUAUAUAUUUUUU91.4959561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6442-6464TGCATTAGGTATATATTTTTTGAAAAAAAUAUAUACCUAAUGCACAUUAGGUAUAUAUUUUUUGAU-9.718.522


Target Position: 5969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5969GCUAAGGAAAGGGUGGGAU70.47545437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9745987GCTAAGGAAAGGGTGGGATATCCCACCCTTTCCTTAGC0.606600.220800.672401.000001.000001.00000


Target Position: 7101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7101CAAAAUUUCAGUUUCUCUA90.5454677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7099-7121AGCAAAATTTCAGTTTCTCTAGTUAGAGAAACUGAAAUUUUGCUCAAAAUUUCAGUUUCUCUAGUU19.1-12.012


Target Position: 5476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476AGGUUAAGAAGAGGAGGAA83.65231872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9415494AGGTTAAGAAGAGGAGGAATTCCTCCTCTTCTTAACCT0.717700.474600.672400.750001.000001.00000


Target Position: 6169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6169GUGGAGUGGAAAAAGAUAU81.0512491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9256187GTGGAGTGGAAAAAGATATATATCTTTTTCCACTCCAC0.292500.130400.750000.750001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985AGGAACGGCUACAGUUAUU76.97773545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131003AGGAACGGCTACAGTTATTAATAACTGTAGCCGTTCCT0.268700.114200.836200.750001.000001.00000


Target Position: 7959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7959GUUGUUGUUGUUGUUUAUU72.3914866

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7957-7979TTGTTGTTGTTGTTGTTTATTTGAAUAAACAACAACAACAACAAGUUGUUGUUGUUGUUUAUUUGU6.919.301


Target Position: 3470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3470CAUUCUUGUAUUGUUACAA90.4652684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3468-3490GACATTCTTGTATTGTTACAAAAUUGUAACAAUACAAGAAUGUCCAUUCUUGUAUUGUUACAAAAU20.412.022


Target Position: 2561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561GUUUGACAGUGUAGCUUUU86.16221349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2559-2581AAGTTTGACAGTGTAGCTTTTGGAAAAGCUACACUGUCAAACUUGUUUGACAGUGUAGCUUUUGGU18.320.522


Target Position: 5761, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5761CAUUGUCGUCUUUUCUAUU88.2376995

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5759-5781TCCATTGTCGTCTTTTCTATTGAAAUAGAAAAGACGACAAUGGACAUUGUCGUCUUUUCUAUUGAU6.921.122


Target Position: 9565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9565GCUAAUAAGCGUAAUAAAA94.3655302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9563-9585GAGCTAATAAGCGTAATAAAATGUUUUAUUACGCUUAUUAGCUCGCUAAUAAGCGUAAUAAAAUGU-7.5-2.322


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507GUUUUAAGGUGUCAUAGUA97.1691137

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527TGGTTTTAAGGTGTCATAGTAAGUACUAUGACACCUUAAAACCAGUUUUAAGGUGUCAUAGUAAGU20.3-3.832


Target Position: 6266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6266CGUGAUUGACCCUAAAAAU89.4379815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6264-6286GCCGTGATTGACCCTAAAAATTGAUUUUUAGGGUCAAUCACGGCCGUGAUUGACCCUAAAAAUUGU-3.820.523


Target Position: 9803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9803GACAAUAAAACUCUGUAUU82.68082084

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9801-9823GAGACAATAAAACTCTGTATTTGAAUACAGAGUUUUAUUGUCUCGACAAUAAAACUCUGUAUUUGU20.36.922


Target Position: 6162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6162GCCAAGGGUGGAGUGGAAA77.37193419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5946180GCCAAGGGTGGAGTGGAAATTTCCACTCCACCCTTGGC0.706400.088901.000001.000000.972800.62500


Target Position: 3869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3869CAGAGAUUUGGGAUUAGAA98.901885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3867-3889GACAGAGATTTGGGATTAGAATCUUCUAAUCCCAAAUCUCUGUCCAGAGAUUUGGGAUUAGAAUCU16.019.122


Target Position: 6792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6792CCAAGUACAAUCUAACUCA93.2459394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6790-6812AGCCAAGTACAATCTAACTCAGAUGAGUUAGAUUGUACUUGGCUCCAAGUACAAUCUAACUCAGAU18.919.033


Target Position: 7201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7201GGAAAAAUACUUUGACCAU90.1685721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6157219GGAAAAATACTTTGACCATATGGTCAAAGTATTTTTCC0.300200.120900.715501.000001.000001.00000


Target Position: 1574, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574CAAUUCCAAAGAAACUCGU68.20986093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1572-1594ACCAATTCCAAAGAAACTCGTCGACGAGUUUCUUUGGAAUUGGUCAAUUCCAAAGAAACUCGUCGU19.720.132


Target Position: 8685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8685CUAUCUUUAAAAAAACUUU80.79132563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9348703CTATCTTTAAAAAAACTTTAAAGTTTTTTTAAAGATAG0.609300.462500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8683-8705AACTATCTTTAAAAAAACTTTATAAAGUUUUUUUAAAGAUAGUUCUAUCUUUAAAAAAACUUUAUU3.26.922


Target Position: 3374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3374GGAUUUAACAAAAAGGAAG75.78973874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463392GGATTTAACAAAAAGGAAGCTTCCTTTTTGTTAAATCC0.419600.193500.732800.750001.000001.00000


Target Position: 3105, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105CUUCAACUGAAGGAUAUUA87.08681184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3103-3125GTCTTCAACTGAAGGATATTATTUAAUAUCCUUCAGUUGAAGACCUUCAACUGAAGGAUAUUAUUU15.419.222


Target Position: 9239, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9239GAAAUAUAUAUAUAACAAA103.61915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9237-9259GTGAAATATATATATAACAAAATUUUGUUAUAUAUAUAUUUCACGAAAUAUAUAUAUAACAAAAUU6.9-8.021


Target Position: 8793, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8793GCUCUUUUAUGAAUUAGCU83.65011873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8791-8813TAGCTCTTTTATGAATTAGCTGAAGCUAAUUCAUAAAAGAGCUAGCUCUUUUAUGAAUUAGCUGAU13.610.322


Target Position: 7893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7893GCUUUUUGGCUUUCUUUUU75.00014108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7891-7913GAGCTTTTTGGCTTTCTTTTTTCAAAAAGAAAGCCAAAAAGCUCGCUUUUUGGCUUUCUUUUUUCU5.52.121


Target Position: 280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280GGUGUUACUGUAAAAUGCA92.4944453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
278-300GAGGTGTTACTGTAAAATGCAAGUGCAUUUUACAGUAACACCUCGGUGUUACUGUAAAAUGCAAGU14.021.5


Target Position: 4169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4169GCAACAUUUCCCAAGAUAC77.54083387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9564187GCAACATTTCCCAAGATACGTATCTTGGGAAATGTTGC0.604500.387200.672400.750001.000001.00000


Target Position: 8448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8448GUAUUGAGGGUUUUGAUAA92.3301474

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8446-8468TGGTATTGAGGGTTTTGATAATAUUAUCAAAACCCUCAAUACCAGUAUUGAGGGUUUUGAUAAUAU8.913.432


Target Position: 5468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5468GGGUAGAGAGGUUAAGAAG82.71242075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3095486GGGTAGAGAGGTTAAGAAGCTTCTTAACCTCTCTACCC0.707100.289400.853400.750001.000001.00000


Target Position: 8934, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8934GACUUUUUAUUUGUAUUCU80.43752648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8932-8954GTGACTTTTTATTTGTATTCTGGAGAAUACAAAUAAAAAGUCACGACUUUUUAUUUGUAUUCUGGU16.13.2


Target Position: 7900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7900GGCUUUCUUUUUUCCCACA85.02321562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5777918GGCTTTCTTTTTTCCCACATGTGGGAAAAAAGAAAGCC0.560100.282700.793100.750001.000001.00000


Target Position: 8973, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8973GUUAUAUUAGAAAAGUUGA86.31911314

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8971-8993AAGTTATATTAGAAAAGTTGAGGUCAACUUUUCUAAUAUAACUUGUUAUAUUAGAAAAGUUGAGGU10.3-8.023


Target Position: 3041, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041GAAAAAGGAUUCUCGAUUU88.7627914

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3039-3061CAGAAAAAGGATTCTCGATTTCAAAAUCGAGAAUCCUUUUUCUGGAAAAAGGAUUCUCGAUUUCAU21.09.522


Target Position: 4398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4398GUAAUGGACCACAUGAUUA94.2454312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4396-4418TAGTAATGGACCACATGATTATGUAAUCAUGUGGUCCAUUACUAGUAAUGGACCACAUGAUUAUGU13.621.233


Target Position: 1457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1457CAUUGAAUUACUAAAAUCU88.423969

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1455-1477AGCATTGAATTACTAAAATCTCGAGAUUUUAGUAAUUCAAUGCUCAUUGAAUUACUAAAAUCUCGU2.17.223


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271UGGCCCAAAAGAGAGAAUU61.59187707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451289TGGCCCAAAAGAGAGAATTAATTCTCTCTTTTGGGCCA0.301700.079600.836200.750000.956500.87500


Target Position: 2673, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673GGACUAAAACCUUGUGAAA97.5423123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2671-2693TGGGACTAAAACCTTGTGAAATCUUUCACAAGGUUUUAGUCCCAGGACUAAAACCUUGUGAAAUCU20.514.632


Target Position: 8689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8689CUUUAAAAAAACUUUAUUA91.6399540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8687-8709ATCTTTAAAAAAACTTTATTAATUAAUAAAGUUUUUUUAAAGAUCUUUAAAAAAACUUUAUUAAUU-4.3-9.112


Target Position: 9473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9473CUGUAUUUUGGUUUUGAAA86.34751306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9471-9493TGCTGTATTTTGGTTTTGAAATAUUUCAAAACCAAAAUACAGCACUGUAUUUUGGUUUUGAAAUAU7.76.932


Target Position: 5920, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5920GAAGUAAAAACAAAUGGAA94.4517295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5918-5940AGGAAGTAAAAACAAATGGAAATUUCCAUUUGUUUUUACUUCCUGAAGUAAAAACAAAUGGAAAUU20.14.912


Target Position: 8379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8379CAUCUACAAAAUUUUUCUU83.0081995

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8377-8399GTCATCTACAAAATTTTTCTTTCAAGAAAAAUUUUGUAGAUGACCAUCUACAAAAUUUUUCUUUCU5.520.321


Target Position: 8402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8402CAAGAAAAGAGUUCCUUUU82.63952097

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8400-8422CTCAAGAAAAGAGTTCCTTTTGCAAAAGGAACUCUUUUCUUGAGCAAGAAAAGAGUUCCUUUUGCU18.75.522


Target Position: 8447, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8447GGUAUUGAGGGUUUUGAUA91.5584554

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8445-8467CTGGTATTGAGGGTTTTGATAATUAUCAAAACCCUCAAUACCAGGGUAUUGAGGGUUUUGAUAAUU7.416.123


Target Position: 2866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2866GAUUGAAUGAACAAAUGAA103.16217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2864-2886TGGATTGAATGAACAAATGAAGGUUCAUUUGUUCAUUCAAUCCAGAUUGAAUGAACAAAUGAAGGU13.87.222


Target Position: 6081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6081GGCCAGUAAAAUUUUAGUA91.599547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8536099GGCCAGTAAAATTTTAGTATACTAAAATTTTACTGGCC0.234300.070700.819001.000001.000001.00000


Target Position: 7270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7270CAAGAUGAAGUCUAAUUCU87.33781139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7268-7290CCCAAGATGAAGTCTAATTCTGAAGAAUUAGACUUCAUCUUGGGCAAGAUGAAGUCUAAUUCUGAU6.920.432


Target Position: 6837, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6837GAAGCUAAUAUAUAAAUGA96.5443172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6835-6857CAGAAGCTAATATATAAATGAAGUCAUUUAUAUAUUAGCUUCUGGAAGCUAAUAUAUAAAUGAAGU-1.818.322


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955GGACCAGGAGAGGAGAAAU87.88091055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652973GGACCAGGAGAGGAGAAATATTTCTCCTCTCCTGGTCC0.306600.065600.862101.000000.962000.87500


Target Position: 8080, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8080CUUUGUUUUCCUCUUUGAU79.09792980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8078-8100ATCTTTGTTTTCCTCTTTGATGTAUCAAAGAGGAAAACAAAGAUCUUUGUUUUCCUCUUUGAUGUU20.45.622


Target Position: 6755, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6755CUCAUCUAUAAAUUGAAAU76.01193811

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6753-6775ACCTCATCTATAAATTGAAATTAAUUUCAAUUUAUAGAUGAGGUCUCAUCUAUAAAUUGAAAUUAU7.421.422


Target Position: 9170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9170CAUAUAAUUCAUCCAUUUA97.4608127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9168-9190ATCATATAATTCATCCATTTAAAUAAAUGGAUGAAUUAUAUGAUCAUAUAAUUCAUCCAUUUAAAU20.1-8.621


Target Position: 5226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5226CAGAAUAAAAACCAAAUGU77.57013376

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5224-5246TTCAGAATAAAAACCAAATGTATACAUUUGGUUUUUAUUCUGAACAGAAUAAAAACCAAAUGUAUU17.76.912


Target Position: 9322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9322CUGAAGAUAACUUUGGUUU75.1034074

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9320-9342ACCTGAAGATAACTTTGGTTTTAAAACCAAAGUUAUCUUCAGGUCUGAAGAUAACUUUGGUUUUAU18.820.422


Target Position: 3621, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621GCUUUAUUCGUCAUUUCCA88.4736959

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3619-3641AAGCTTTATTCGTCATTTCCATGUGGAAAUGACGAAUAAAGCUUGCUUUAUUCGUCAUUUCCAUGU20.1-4.332


Target Position: 7222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7222CUCUAGUACUUCCAAAUAA95.1064252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7220-7242AGCTCTAGTACTTCCAAATAAATUUAUUUGGAAGUACUAGAGCUCUCUAGUACUUCCAAAUAAAUU12.820.133


Target Position: 4266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4266GGACAUAUGCCCUUUAGAA100.83447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4264-4286AAGGACATATGCCCTTTAGAACTUUCUAAAGGGCAUAUGUCCUUGGACAUAUGCCCUUUAGAACUU11.716.033


Target Position: 1594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GCAUCUUCCUUGAGUUUCA92.7488438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1592-1614TCGCATCTTCCTTGAGTTTCATCUGAAACUCAAGGAAGAUGCGAGCAUCUUCCUUGAGUUUCAUCU21.520.432


Target Position: 5338, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5338GCACAUUUUAAUUUUUAUU81.09422478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5336-5358AAGCACATTTTAATTTTTATTTGAAUAAAAAUUAAAAUGUGCUUGCACAUUUUAAUUUUUAUUUGU-9.712.121


Target Position: 6073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6073GAUUAUAAGGCCAGUAAAA96.843153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6071-6093CTGATTATAAGGCCAGTAAAATTUUUUACUGGCCUUAUAAUCAGGAUUAUAAGGCCAGUAAAAUUU11.8-8.023


Target Position: 7836, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7836CUUUUAGAACCGAAAUUGU76.37253709

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7834-7856GGCTTTTAGAACCGAAATTGTAAACAAUUUCGGUUCUAAAAGCCCUUUUAGAACCGAAAUUGUAAU7.47.132


Target Position: 5268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5268GAAAUUGUACUUAGAUUUA95.2603241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5266-5288ATGAAATTGTACTTAGATTTAAGUAAAUCUAAGUACAAUUUCAUGAAAUUGUACUUAGAUUUAAGU6.95.322


Target Position: 9268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9268GUAACUAUUUUUAAGUAUA97.2943133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9266-9288TTGTAACTATTTTTAAGTATAAAUAUACUUAAAAAUAGUUACAAGUAACUAUUUUUAAGUAUAAAU6.36.322


Target Position: 7005, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7005GGAGAAAAGUAAAUAUAAA106.9512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5637023GGAGAAAAGTAAATATAAATTTATATTTACTTTTCTCC0.937100.095100.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7003-7025CAGGAGAAAAGTAAATATAAAAAUUUAUAUUUACUUUUCUCCUGGGAGAAAAGUAAAUAUAAAAAU-8.014.821


Target Position: 3052, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3052CUCGAUUUCAGACUUUUGU67.96766153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3050-3072TTCTCGATTTCAGACTTTTGTGCACAAAAGUCUGAAAUCGAGAACUCGAUUUCAGACUUUUGUGCU10.316.722


Target Position: 3103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103GUCUUCAACUGAAGGAUAU82.7712059

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3101-3123TCGTCTTCAACTGAAGGATATTAAUAUCCUUCAGUUGAAGACGAGUCUUCAACUGAAGGAUAUUAU19.920.433


Target Position: 7054, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7054GUAAUUAUGUAAUUCUCUA98.350993

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7052-7074GGGTAATTATGTAATTCTCTAGCUAGAGAAUUACAUAAUUACCCGUAAUUAUGUAAUUCUCUAGCU19.1-8.032


Target Position: 8030, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8030GAAGCUAAAGAAAGUAAUU88.432965

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8028-8050TAGAAGCTAAAGAAAGTAATTATAAUUACUUUCUUUAGCUUCUAGAAGCUAAAGAAAGUAAUUAUU4.618.322


Target Position: 6267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6267GUGAUUGACCCUAAAAAUU79.40072903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4886285GTGATTGACCCTAAAAATTAATTTTTAGGGTCAATCAC0.361500.108700.784500.750001.000001.00000


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353GGAAGUCCCUCAACCCGUA92.1104494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911371GGAAGTCCCTCAACCCGTATACGGGTTGAGGGACTTCC0.384000.047900.689701.000000.907600.62500


Target Position: 5708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5708GGAAUCCUCAACAUACUAA95.9305200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5555726GGAATCCTCAACATACTAATTAGTATGTTGAGGATTCC0.321500.105500.836201.000001.000001.00000


Target Position: 7287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7287CUGAAAAUAUCUCACAAUU84.96021579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7285-7307TTCTGAAAATATCTCACAATTTTAAUUGUGAGAUAUUUUCAGAACUGAAAAUAUCUCACAAUUUUU20.57.432


Target Position: 8324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8324CAAUUUUUGUUUUAUAAGU80.31282682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8322-8344TACAATTTTTGTTTTATAAGTCAACUUAUAAAACAAAAAUUGUACAAUUUUUGUUUUAUAAGUCAU-2.3-12.031


Target Position: 7243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7243UCAUAUCUAGAUUUUCAAA87.02051196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6897261TCATATCTAGATTTTCAAATTTGAAAATCTAGATATGA0.274500.121700.724100.750001.000001.00000


Target Position: 1569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CAUACCAAUUCCAAAGAAA93.9049330

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1567-1589AACATACCAATTCCAAAGAAACTUUUCUUUGGAAUUGGUAUGUUCAUACCAAUUCCAAAGAAACUU12.220.022


Target Position: 1298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298GGAAAACCCAGAGAAAAGU73.89694423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1296-1318GAGGAAAACCCAGAGAAAAGTGAACUUUUCUCUGGGUUUUCCUCGGAAAACCCAGAGAAAAGUGAU10.321.211


Target Position: 9456, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9456CUUACUUUGGGCAUUUGCU69.01745845

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9454-9476CGCTTACTTTGGGCATTTGCTGTAGCAAAUGCCCAAAGUAAGCGCUUACUUUGGGCAUUUGCUGUU20.04.932


Target Position: 6168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6168GGUGGAGUGGAAAAAGAUA96.6749167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2796186GGTGGAGTGGAAAAAGATATATCTTTTTCCACTCCACC0.540900.231000.810301.000001.000001.00000


Target Position: 7193, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7193GACUAACUGGAAAAAUACU86.30481319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7191-7213AGGACTAACTGGAAAAATACTTTAGUAUUUUUCCAGUUAGUCCUGACUAACUGGAAAAAUACUUUU-0.317.623


Target Position: 9506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9506CUUAUUCUUGGGAUAAUAU84.66371639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9504-9526GACTTATTCTTGGGATAATATTTAUAUUAUCCCAAGAAUAAGUCCUUAUUCUUGGGAUAAUAUUUU3.56.922


Target Position: 2454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454CUCAAUACUGUCUUUGAUU80.58822615

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474CTCTCAATACTGTCTTTGATTTCAAUCAAAGACAGUAUUGAGAGCUCAAUACUGUCUUUGAUUUCU12.016.122


Target Position: 5319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5319CUUCAUUCCGUAUUUGAAA84.93781585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5317-5339GACTTCATTCCGTATTTGAAAGCUUUCAAAUACGGAAUGAAGUCCUUCAUUCCGUAUUUGAAAGCU7.416.333


Target Position: 1531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531CGACUUUGCUCUGUUAUCU82.38952160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1529-1551TGCGACTTTGCTCTGTTATCTCTAGAUAACAGAGCAAAGUCGCACGACUUUGCUCUGUUAUCUCUU16.119.233


Target Position: 7276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7276GAAGUCUAAUUCUGAAAAU89.0519863

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7274-7296ATGAAGTCTAATTCTGAAAATATAUUUUCAGAAUUAGACUUCAUGAAGUCUAAUUCUGAAAAUAUU12.218.922


Target Position: 4013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013GGAAGUUGGAGAAGAUUAU88.8951889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4011-4033AAGGAAGTTGGAGAAGATTATCAAUAAUCUUCUCCAACUUCCUUGGAAGUUGGAGAAGAUUAUCAU6.919.222


Target Position: 9272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9272CUAUUUUUAAGUAUAAAGU77.12563492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9270-9292AACTATTTTTAAGTATAAAGTTCACUUUAUACUUAAAAAUAGUUCUAUUUUUAAGUAUAAAGUUCU-2.3-9.722


Target Position: 9263, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9263CUAUUGUAACUAUUUUUAA94.2043317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9261-9283TGCTATTGTAACTATTTTTAAGTUUAAAAAUAGUUACAAUAGCACUAUUGUAACUAUUUUUAAGUU-9.78.522


Target Position: 8457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8457GUUUUGAUAAUAAAUUGGU71.05065281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8455-8477GGGTTTTGATAATAAATTGGTAGACCAAUUUAUUAUCAAAACCCGUUUUGAUAAUAAAUUGGUAGU11.37.422


Target Position: 2865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865GGAUUGAAUGAACAAAUGA93.2764388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2863-2885TTGGATTGAATGAACAAATGAAGUCAUUUGUUCAUUCAAUCCAAGGAUUGAAUGAACAAAUGAAGU12.116.321


Target Position: 6167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6167GGGUGGAGUGGAAAAAGAU90.8598649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4076185GGGTGGAGTGGAAAAAGATATCTTTTTCCACTCCACCC0.544900.124900.810301.000001.000001.00000


Target Position: 3367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367GGAAUUUGGAUUUAACAAA91.9559505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3365-3387CAGGAATTTGGATTTAACAAAAAUUUGUUAAAUCCAAAUUCCUGGGAAUUUGGAUUUAACAAAAAU7.27.422


Target Position: 8343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8343CAUUUUUUUCCUGAUAUUU78.59363104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8341-8363GTCATTTTTTTCCTGATATTTCCAAAUAUCAGGAAAAAAAUGACCAUUUUUUUCCUGAUAUUUCCU8.7-12.011


Target Position: 5714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5714CUCAACAUACUAAAUAGCA83.5121891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5712-5734TCCTCAACATACTAAATAGCAGGUGCUAUUUAGUAUGUUGAGGACUCAACAUACUAAAUAGCAGGU13.620.522


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061CCCAAAAUCAAGCAAAGUA87.07241189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852079CCCAAAATCAAGCAAAGTATACTTTGCTTGATTTTGGG0.595400.352800.810301.000001.000001.00000


Target Position: 7660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7660GCUAUGAAGUGGCAAAUUA95.178245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7658-7680TTGCTATGAAGTGGCAAATTACAUAAUUUGCCACUUCAUAGCAAGCUAUGAAGUGGCAAAUUACAU14.013.423


Target Position: 7327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7327ACCGACCUAACUUCUCUUU64.88236947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5097345ACCGACCTAACTTCTCTTTAAAGAGAAGTTAGGTCGGT0.894300.723300.853400.750001.000001.00000


Target Position: 8067, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8067CUUUUACUGGCAUCUUUGU72.08064970

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8065-8087GTCTTTTACTGGCATCTTTGTTTACAAAGAUGCCAGUAAAAGACCUUUUACUGGCAUCUUUGUUUU12.04.912


Target Position: 6807, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6807CUCAGAAUGGGAUUAAAAA91.184598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6805-6827AACTCAGAATGGGATTAAAAATTUUUUUAAUCCCAUUCUGAGUUCUCAGAAUGGGAUUAAAAAUUU-9.720.412


Target Position: 7299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7299CACAAUUUUUGAAUGUUCU80.292685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7297-7319CTCACAATTTTTGAATGTTCTTTAGAACAUUCAAAAAUUGUGAGCACAAUUUUUGAAUGUUCUUUU14.85.322


Target Position: 9566, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9566CUAAUAAGCGUAAUAAAAU86.00331382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9564-9586AGCTAATAAGCGTAATAAAATGCAUUUUAUUACGCUUAUUAGCUCUAAUAAGCGUAAUAAAAUGCU-9.7-2.321


Target Position: 9213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9213GUAUAUUAUUGAUUUUUAA100.55951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9211-9233TGGTATATTATTGATTTTTAATTUUAAAAAUCAAUAAUAUACCAGUAUAUUAUUGAUUUUUAAUUU-9.7-5.922


Target Position: 8603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8603CCUACUAGAACAUUUUAUU85.01911565

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8601-8623TTCCTACTAGAACATTTTATTTTAAUAAAAUGUUCUAGUAGGAACCUACUAGAACAUUUUAUUUUU-10.316.122


Target Position: 3241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3241AGAUCUUAAAUUAUGUAAA92.0771496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5303259AGATCTTAAATTATGTAAATTTACATAATTTAAGATCT0.610400.244400.724100.750001.000001.00000


Target Position: 9148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9148CUUUAUUGAGAUAUUCACA90.2781708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9146-9168AGCTTTATTGAGATATTCACATAUGUGAAUAUCUCAAUAAAGCUCUUUAUUGAGAUAUUCACAUAU16.1-1.401


Target Position: 6892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6892GAACAAGUAAAAACCAAAU86.29451324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6890-6912AGGAACAAGTAAAAACCAAATGGAUUUGGUUUUUACUUGUUCCUGAACAAGUAAAAACCAAAUGGU18.817.822


Target Position: 2693, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693CAAAAGACAGGAAGUGAUU82.35542168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2691-2713ATCAAAAGACAGGAAGTGATTAAAAUCACUUCCUGUCUUUUGAUCAAAAGACAGGAAGUGAUUAAU19.213.322


Target Position: 964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GAAAAAUGUUACAGAAAGA96.3348185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
962-984GAGAAAAATGTTACAGAAAGAACUCUUUCUGUAACAUUUUUCUCGAAAAAUGUUACAGAAAGAACU16.6-3.322


Target Position: 8997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8997CGAGGAGCCUGUAAUUAAU93.0547413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5929015CGAGGAGCCTGTAATTAATATTAATTACAGGCTCCTCG0.370500.089500.784501.000001.000001.00000


Target Position: 2077, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077GUAUGAAGAAAGAUAAAGA96.8044155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2075-2097AAGTATGAAGAAAGATAAAGAAGUCUUUAUCUUUCUUCAUACUUGUAUGAAGAAAGAUAAAGAAGU6.913.411


Target Position: 7845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7845CCGAAAUUGUAACUAUGUA93.6307349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7843-7865AACCGAAATTGTAACTATGTATTUACAUAGUUACAAUUUCGGUUCCGAAAUUGUAACUAUGUAUUU19.07.432


Target Position: 7360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7360GCCUCCCACACGUUCCAUU74.39774276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
667378GCCTCCCACACGTTCCATTAATGGAACGTGTGGGAGGC0.710500.755600.991401.000001.000001.00000


Target Position: 4170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4170CAACAUUUCCCAAGAUACA89.9419753

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4168-4190GGCAACATTTCCCAAGATACAGAUGUAUCUUGGGAAAUGUUGCCCAACAUUUCCCAAGAUACAGAU14.55.322


Target Position: 8254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8254ACCUCAAAAUACAAAAUUA94.7516270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5758272ACCTCAAAATACAAAATTATAATTTTGTATTTTGAGGT0.496200.176600.819000.750001.000001.00000


Target Position: 8166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8166GAUAUAUGGUUUUGAAUUA99.2677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8164-8186TCGATATATGGTTTTGAATTACTUAAUUCAAAACCAUAUAUCGAGAUAUAUGGUUUUGAAUUACUU7.4-0.322


Target Position: 2850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CUUCAACUUCAUAUUGGAU84.37951711

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2848-2870TTCTTCAACTTCATATTGGATTGAUCCAAUAUGAAGUUGAAGAACUUCAACUUCAUAUUGGAUUGU21.219.222


Target Position: 6863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6863GAUUUGGAACUUUCUGUAU86.93481206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6861-6883GGGATTTGGAACTTTCTGTATCTAUACAGAAAGUUCCAAAUCCCGAUUUGGAACUUUCUGUAUCUU20.320.132


Target Position: 7328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7328CCGACCUAACUUCUCUUUU72.77214753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2087346CCGACCTAACTTCTCTTTTAAAAGAGAAGTTAGGTCGG0.892200.742700.913801.000001.000001.00000


Target Position: 6411, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6411CAAUUAUAUUGACUUUCUU91.1088610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6409-6431TTCAATTATATTGACTTTCTTTGAAGAAAGUCAAUAUAAUUGAACAAUUAUAUUGACUUUCUUUGU17.7-8.022


Target Position: 939, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939CAUAACCAGAAAGUAGAAA82.83312041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
937-959TTCATAACCAGAAAGTAGAAATTUUUCUACUUUCUGGUUAUGAACAUAACCAGAAAGUAGAAAUUU18.920.022


Target Position: 8738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8738GAAAUGCCUAAAAGACUUU80.42152651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9388756GAAATGCCTAAAAGACTTTAAAGTCTTTTAGGCATTTC0.225700.118900.672400.750000.907600.87500


Target Position: 281, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GUGUUACUGUAAAAUGCAA94.958260

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
279-301AGGTGTTACTGTAAAATGCAAGTUUGCAUUUUACAGUAACACCUGUGUUACUGUAAAAUGCAAGUU20.019.0


Target Position: 8368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8368CUUUUCAGAGUCAUCUACA86.72751241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8366-8388CACTTTTCAGAGTCATCTACAAAUGUAGAUGACUCUGAAAAGUGCUUUUCAGAGUCAUCUACAAAU20.312.222


Target Position: 5919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5919GGAAGUAAAAACAAAUGGA91.513558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5917-5939CAGGAAGTAAAAACAAATGGAAAUCCAUUUGUUUUUACUUCCUGGGAAGUAAAAACAAAUGGAAAU17.714.622


Target Position: 3546, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3546GAUAGCAAACACACGUUUA94.3601304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3544-3566CTGATAGCAAACACACGTTTAGCUAAACGUGUGUUUGCUAUCAGGAUAGCAAACACACGUUUAGCU19.819.723


Target Position: 9472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9472GCUGUAUUUUGGUUUUGAA96.8766150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9470-9492TTGCTGTATTTTGGTTTTGAAATUUCAAAACCAAAAUACAGCAAGCUGUAUUUUGGUUUUGAAAUU14.911.622


Target Position: 9517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9517GAUAAUAUUUUAGUUUUCA91.151604

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9515-9537GGGATAATATTTTAGTTTTCAGTUGAAAACUAAAAUAUUAUCCCGAUAAUAUUUUAGUUUUCAGUU13.3-8.622


Target Position: 3430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3430GAGAUAAAACUAUUGAUUU91.4681564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3428-3450TAGAGATAAAACTATTGATTTATAAAUCAAUAGUUUUAUCUCUAGAGAUAAAACUAUUGAUUUAUU7.26.912


Target Position: 837, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837CAUAUGUCUCCCAUCAUGA91.1967594

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
835-857GACATATGTCTCCCATCATGACAUCAUGAUGGGAGACAUAUGUCCAUAUGUCUCCCAUCAUGACAU19.416.033


Target Position: 9163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9163CACAUAUCAUAUAAUUCAU94.1731319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9161-9183TTCACATATCATATAATTCATCCAUGAAUUAUAUGAUAUGUGAACACAUAUCAUAUAAUUCAUCCU8.916.012


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CCGAGAGUCACCAACAGAU85.54391457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586428CCGAGAGTCACCAACAGATATCTGTTGGTGACTCTCGG0.310100.102100.732801.000001.000001.00000


Target Position: 6929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6929GAAAUAAUGUCAUUCUCAA103.08419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6927-6949TAGAAATAATGTCATTCTCAATTUUGAGAAUGACAUUAUUUCUAGAAAUAAUGUCAUUCUCAAUUU20.4-10.322


Target Position: 6841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6841CUAAUAUAUAAAUGAAGUU84.61871651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6839-6861AGCTAATATATAAATGAAGTTTGAACUUCAUUUAUAUAUUAGCUCUAAUAUAUAAAUGAAGUUUGU19.2-5.932


Target Position: 9593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9593GUUUAUACCAUCUUUUAGU79.02673003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9591-9613TAGTTTATACCATCTTTTAGTTAACUAAAAGAUGGUAUAAACUAGUUUAUACCAUCUUUUAGUUAU1.31.421


Target Position: 9206, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9206GGUUUUGGUAUAUUAUUGA90.6282665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9204-9226TGGGTTTTGGTATATTATTGATTUCAAUAAUAUACCAAAACCCAGGUUUUGGUAUAUUAUUGAUUU-1.818.822


Target Position: 5294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5294GAGAAAAUCAGAUGUAUUU89.1914842

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5292-5314AAGAGAAAATCAGATGTATTTATAAAUACAUCUGAUUUUCUCUUGAGAAAAUCAGAUGUAUUUAUU6.75.322


Target Position: 8313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8313CCCUUAUAUUACAAUUUUU87.96931036

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8311-8333CCCCCTTATATTACAATTTTTGTAAAAAUUGUAAUAUAAGGGGGCCCUUAUAUUACAAUUUUUGUU-3.312.332


Target Position: 9212, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9212GGUAUAUUAUUGAUUUUUA103.08618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7219230GGTATATTATTGATTTTTATAAAAATCAATAATATACC0.267000.086900.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9210-9232TTGGTATATTATTGATTTTTAATUAAAAAUCAAUAAUAUACCAAGGUAUAUUAUUGAUUUUUAAUU0.41.122


Target Position: 6595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6595GCAGUCCAAAGAUGAUUUU76.41733697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9076613GCAGTCCAAAGATGATTTTAAAATCATCTTTGGACTGC0.224000.068100.853401.000001.000001.00000


Target Position: 8744, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8744CCUAAAAGACUUUAUUGUU85.28141503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8742-8764TGCCTAAAAGACTTTATTGTTCTAACAAUAAAGUCUUUUAGGCACCUAAAAGACUUUAUUGUUCUU6.91.322


Target Position: 9698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9698CUAUAUCUAUAUAUAUAGA102.33627

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9696-9718ATCTATATCTATATATATAGATAUCUAUAUAUAUAGAUAUAGAUCUAUAUCUAUAUAUAUAGAUAU-0.88.211


Target Position: 2053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2053GAUUUCUUCCCAAAAUCAA89.9703748

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2051-2073TGGATTTCTTCCCAAAATCAAGCUUGAUUUUGGGAAGAAAUCCAGAUUUCUUCCCAAAAUCAAGCU7.45.332


Target Position: 9000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9000GGAGCCUGUAAUUAAUUUU83.77371845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6949018GGAGCCTGTAATTAATTTTAAAATTAATTACAGGCTCC0.273000.128500.870701.000001.000001.00000


Target Position: 8648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8648CUCUUUAACAGAAAUUGCU74.63864217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8646-8668TACTCTTTAACAGAAATTGCTTTAGCAAUUUCUGUUAAAGAGUACUCUUUAACAGAAAUUGCUUUU14.07.132


Target Position: 5302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5302CAGAUGUAUUUAUUUGACU84.80661610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5300-5322ATCAGATGTATTTATTTGACTTCAGUCAAAUAAAUACAUCUGAUCAGAUGUAUUUAUUUGACUUCU14.820.312


Target Position: 2452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2452CUCUCAAUACUGUCUUUGA90.5846670

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2450-2472TACTCTCAATACTGTCTTTGATTUCAAAGACAGUAUUGAGAGUACUCUCAAUACUGUCUUUGAUUU19.220.423


Target Position: 1505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505CCAUGUAGUUUCACAAUUU91.9507507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1503-1525CACCATGTAGTTTCACAATTTGAAAAUUGUGAAACUACAUGGUGCCAUGUAGUUUCACAAUUUGAU12.117.922


Target Position: 7100, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7100GCAAAAUUUCAGUUUCUCU85.46891472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7098-7120TAGCAAAATTTCAGTTTCTCTAGAGAGAAACUGAAAUUUUGCUAGCAAAAUUUCAGUUUCUCUAGU21.5-3.322


Target Position: 6747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6747CUUUAGACCUCAUCUAUAA97.9112107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6745-6767ATCTTTAGACCTCATCTATAAATUUAUAGAUGAGGUCUAAAGAUCUUUAGACCUCAUCUAUAAAUU8.214.622


Target Position: 6835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6835CAGAAGCUAAUAUAUAAAU88.2989986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7796853CAGAAGCTAATATATAAATATTTATATATTAGCTTCTG0.479800.064300.775900.750001.000001.00000


Target Position: 5228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5228GAAUAAAAACCAAAUGUAU93.8827333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5226-5248CAGAATAAAAACCAAATGTATAGAUACAUUUGGUUUUUAUUCUGGAAUAAAAACCAAAUGUAUAGU6.9-9.723


Target Position: 7846, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7846CGAAAUUGUAACUAUGUAU91.2059592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8167864CGAAATTGTAACTATGTATATACATAGTTACAATTTCG0.316600.059900.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7844-7866ACCGAAATTGTAACTATGTATTGAUACAUAGUUACAAUUUCGGUCGAAAUUGUAACUAUGUAUUGU13.17.423


Target Position: 5359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5359CCUUGUUUUGUUUUAAUUG70.72135378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7775377CCTTGTTTTGTTTTAATTGCAATTAAAACAAAACAAGG0.251200.151800.698300.750001.000001.00000


Target Position: 2010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010GUGAAAGAGCCUCGAAAUU76.14083769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2008-2030AAGTGAAAGAGCCTCGAAATTTGAAUUUCGAGGCUCUUUCACUUGUGAAAGAGCCUCGAAAUUUGU16.720.422


Target Position: 7138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7138CCUUAGUAAUUAUUUGCUU83.94141803

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7136-7158GTCCTTAGTAATTATTTGCTTTCAAGCAAAUAAUUACUAAGGACCCUUAGUAAUUAUUUGCUUUCU18.511.322


Target Position: 9616, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9616CAUUUUAAAGAUUAAGACU84.71631

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9614-9636AACATTTTAAAGATTAAGACTATAGUCUUAAUCUUUAAAAUGUUCAUUUUAAAGAUUAAGACUAUU14.6-9.722


Target Position: 8315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8315CUUAUAUUACAAUUUUUGU77.79743321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8313-8335CCCTTATATTACAATTTTTGTTTACAAAAAUUGUAAUAUAAGGGCUUAUAUUACAAUUUUUGUUUU-3.3-8.022


Target Position: 9394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9394GGCUUCUUCACAUACCAAC70.31985486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6569412GGCTTCTTCACATACCAACGTTGGTATGTGAAGAAGCC0.511300.408300.853400.750001.000001.00000


Target Position: 8743, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8743GCCUAAAAGACUUUAUUGU78.50663132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8741-8763ATGCCTAAAAGACTTTATTGTTCACAAUAAAGUCUUUUAGGCAUGCCUAAAAGACUUUAUUGUUCU-1.411.033


Target Position: 8879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8879GAAAAUAGAAAAUAAGAUU89.2141841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8877-8899GGGAAAATAGAAAATAAGATTTCAAUCUUAUUUUCUAUUUUCCCGAAAAUAGAAAAUAAGAUUUCU6.6-4.311


Target Position: 5838, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5838GUUAUUCUUGGUAUCAUUU80.6952583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5836-5858TTGTTATTCTTGGTATCATTTCAAAAUGAUACCAAGAAUAACAAGUUAUUCUUGGUAUCAUUUCAU8.76.922


Target Position: 4785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4785GAGUAUUCCUGUUUUGAGA93.1202404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4783-4805TGGAGTATTCCTGTTTTGAGATCUCUCAAAACAGGAAUACUCCAGAGUAUUCCUGUUUUGAGAUCU12.214.523


Target Position: 6984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6984ACCAUCGAGGGCAAUUAAU67.37596320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9337002ACCATCGAGGGCAATTAATATTAATTGCCCTCGATGGT0.346200.051200.844800.750000.951100.62500


Target Position: 7698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7698CUUUUCAGAGAACAGUUAA86.12821359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7696-7718TCCTTTTCAGAGAACAGTTAATCUUAACUGUUCUCUGAAAAGGACUUUUCAGAGAACAGUUAAUCU19.012.212


Target Position: 9135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9135GUUUUUUUAAUAGCUUUAU72.71284778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9133-9155TTGTTTTTTTAATAGCTTTATTGAUAAAGCUAUUAAAAAAACAAGUUUUUUUAAUAGCUUUAUUGU18.3-11.320


Target Position: 7096, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7096GUUAGCAAAAUUUCAGUUU72.77314752

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7094-7116AGGTTAGCAAAATTTCAGTTTCTAAACUGAAAUUUUGCUAACCUGUUAGCAAAAUUUCAGUUUCUU19.219.722


Target Position: 6671, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6671CAAGUUUAUUUAUCUAUGU84.35731717

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6669-6691AACAAGTTTATTTATCTATGTCCACAUAGAUAAAUAAACUUGUUCAAGUUUAUUUAUCUAUGUCCU13.34.922


Target Position: 3382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3382CAAAAAGGAAGAUGAUUCA89.7788

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3380-3402AACAAAAAGGAAGATGATTCATGUGAAUCAUCUUCCUUUUUGUUCAAAAAGGAAGAUGAUUCAUGU16.29.522


Target Position: 8453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8453GAGGGUUUUGAUAAUAAAU88.9945873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7588471GAGGGTTTTGATAATAAATATTTATTATCAAAACCCTC0.767900.066200.801700.750001.000001.00000


Target Position: 9237, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9237GUGAAAUAUAUAUAUAACA93.5878359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9235-9257TGGTGAAATATATATATAACAAAUGUUAUAUAUAUAUUUCACCAGUGAAAUAUAUAUAUAACAAAU1.18.922


Target Position: 3242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242GAUCUUAAAUUAUGUAAAU93.442373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3240-3262CAGATCTTAAATTATGTAAATCAAUUUACAUAAUUUAAGAUCUGGAUCUUAAAUUAUGUAAAUCAU6.96.922


Target Position: 9179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9179CAUCCAUUUAAAGUGUAUA91.5071559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9177-9199TTCATCCATTTAAAGTGTATAATUAUACACUUUAAAUGGAUGAACAUCCAUUUAAAGUGUAUAAUU19.020.111


Target Position: 1970, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970GUAUGUUAUUCUCAUGUAU92.4205462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1968-1990CAGTATGTTATTCTCATGTATATAUACAUGAGAAUAACAUACUGGUAUGUUAUUCUCAUGUAUAUU21.58.532


Target Position: 7771, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7771CCUUCGAAGCUAUAUAUUU86.82461224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2527789CCTTCGAAGCTATATATTTAAATATATAGCTTCGAAGG0.677400.167000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7769-7791CACCTTCGAAGCTATATATTTTGAAAUAUAUAGCUUCGAAGGUGCCUUCGAAGCUAUAUAUUUUGU-8.621.032


Target Position: 5823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5823CUUGACUAUAAAUUUGUUA83.99081793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5821-5843TTCTTGACTATAAATTTGTTATTUAACAAAUUUAUAGUCAAGAACUUGACUAUAAAUUUGUUAUUU5.320.322


Target Position: 5163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5163GUUUGUGAGGGAAUAUCCA84.6121654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5161-5183CTGTTTGTGAGGGAATATCCATTUGGAUAUUCCCUCACAAACAGGUUUGUGAGGGAAUAUCCAUUU15.420.522


Target Position: 551, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551CGUAAUCAUCCAGAAAGAU84.28961734

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
549-571TGCGTAATCATCCAGAAAGATGAAUCUUUCUGGAUGAUUACGCACGUAAUCAUCCAGAAAGAUGAU19.116.122


Target Position: 5288, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5288GAAAAAGAGAAAAUCAGAU88.2329997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5286-5308AAGAAAAAGAGAAAATCAGATGTAUCUGAUUUUCUCUUUUUCUUGAAAAAGAGAAAAUCAGAUGUU20.45.521


Target Position: 960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CUGAGAAAAAUGUUACAGA88.6339932

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
958-980TTCTGAGAAAAATGTTACAGAAAUCUGUAACAUUUUUCUCAGAACUGAGAAAAAUGUUACAGAAAU19.020.420


Target Position: 8056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8056CUGUGAAUUGUCUUUUACU84.72741626

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8054-8076TCCTGTGAATTGTCTTTTACTGGAGUAAAAGACAAUUCACAGGACUGUGAAUUGUCUUUUACUGGU4.920.522


Target Position: 6784, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6784GUCAUAAGCCAAGUACAAU84.00981787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8876802GTCATAAGCCAAGTACAATATTGTACTTGGCTTATGAC0.296800.218700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6782-6804TAGTCATAAGCCAAGTACAATCTAUUGUACUUGGCUUAUGACUAGUCAUAAGCCAAGUACAAUCUU19.013.432


Target Position: 7365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7365CCACACGUUCCAUUUCAUU78.01083269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2047383CCACACGTTCCATTTCATTAATGAAATGGAACGTGTGG0.735600.752000.836201.000001.000001.00000


Target Position: 8251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8251AGGACCUCAAAAUACAAAA82.62712104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7738269AGGACCTCAAAATACAAAATTTTGTATTTTGAGGTCCT0.698400.154100.844800.750001.000001.00000


Target Position: 1550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550CUAUUCAGACCUGUAUAAA89.1251851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1548-1570CTCTATTCAGACCTGTATAAACAUUUAUACAGGUCUGAAUAGAGCUAUUCAGACCUGUAUAAACAU8.513.432


Target Position: 9719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9719CAGAUACAGAUACAUAUCU85.00961569

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9717-9739TACAGATACAGATACATATCTGGAGAUAUGUAUCUGUAUCUGUACAGAUACAGAUACAUAUCUGGU16.020.322


Target Position: 3236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3236UCGUCAGAUCUUAAAUUAU80.57822619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573254TCGTCAGATCTTAAATTATATAATTTAAGATCTGACGA0.510000.056300.750000.750001.000001.00000


Target Position: 7746, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7746CUGUAAUUUAACAUCAUGA88.9801877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7744-7766TGCTGTAATTTAACATCATGATTUCAUGAUGUUAAAUUACAGCACUGUAAUUUAACAUCAUGAUUU19.46.922


Target Position: 9515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9515GGGAUAAUAUUUUAGUUUU90.9526633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9513-9535TTGGGATAATATTTTAGTTTTCAAAAACUAAAAUAUUAUCCCAAGGGAUAAUAUUUUAGUUUUCAU4.915.422


Target Position: 2844, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844GAUAUUCUUCAACUUCAUA96.7472157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2842-2864AAGATATTCTTCAACTTCATATTUAUGAAGUUGAAGAAUAUCUUGAUAUUCUUCAACUUCAUAUUU19.26.632


Target Position: 2706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2706GUGAUUAAUGAAUUGUUCU79.99882758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2704-2726AAGTGATTAATGAATTGTTCTACAGAACAAUUCAUUAAUCACUUGUGAUUAAUGAAUUGUUCUACU14.88.932


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UCUAUUCAGACCUGUAUAA81.4582388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681567TCTATTCAGACCTGTATAATTATACAGGTCTGAATAGA0.218700.049100.689700.750001.000001.00000


Target Position: 8681, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8681GGAACUAUCUUUAAAAAAA100.93445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1248699GGAACTATCTTTAAAAAAATTTTTTTAAAGATAGTTCC0.630100.478700.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8679-8701CTGGAACTATCTTTAAAAAAACTUUUUUUUAAAGAUAGUUCCAGGGAACUAUCUUUAAAAAAACUU-9.114.522


Target Position: 9336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9336GGUUUUAAUCCUACCCUAA96.4279179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3029354GGTTTTAATCCTACCCTAATTAGGGTAGGATTAAAACC0.469400.345900.819001.000001.000001.00000


Target Position: 8004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8004AGAAGUCCAUUUAAAAAUU81.96562255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8748022AGAAGTCCATTTAAAAATTAATTTTTAAATGGACTTCT0.230000.131700.715500.750001.000001.00000


Target Position: 1276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276CAAAAGAGAGAAUUUAUCU86.79561229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1274-1296CCCAAAAGAGAGAATTTATCTAGAGAUAAAUUCUCUCUUUUGGGCAAAAGAGAGAAUUUAUCUAGU1.810.322


Target Position: 7697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7697CCUUUUCAGAGAACAGUUA86.72341242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7695-7717TTCCTTTTCAGAGAACAGTTAATUAACUGUUCUCUGAAAAGGAACCUUUUCAGAGAACAGUUAAUU17.812.222


Target Position: 4298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4298CAUUGCAACUUGUUACAGU85.26711507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4296-4318GACATTGCAACTTGTTACAGTCCACUGUAACAAGUUGCAAUGUCCAUUGCAACUUGUUACAGUCCU19.020.023


Target Position: 4168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4168GGCAACAUUUCCCAAGAUA89.814771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2494186GGCAACATTTCCCAAGATATATCTTGGGAAATGTTGCC0.523500.404500.956901.000001.000001.00000


Target Position: 8375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8375GAGUCAUCUACAAAAUUUU90.0937734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9758393GAGTCATCTACAAAATTTTAAAATTTTGTAGATGACTC0.213500.167200.810300.750001.000001.00000


Target Position: 550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550GCGUAAUCAUCCAGAAAGA92.1433492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
548-570TTGCGTAATCATCCAGAAAGATGUCUUUCUGGAUGAUUACGCAAGCGUAAUCAUCCAGAAAGAUGU16.616.522


Target Position: 6479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6479CUAAAAUGAAGUCUGUAAA89.179843

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6477-6499AACTAAAATGAAGTCTGTAAATTUUUACAGACUUCAUUUUAGUUCUAAAAUGAAGUCUGUAAAUUU20.3-1.422


Target Position: 7230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7230CUUCCAAAUAAAUUCAUAU86.55271270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7228-7250TACTTCCAAATAAATTCATATCTAUAUGAAUUUAUUUGGAAGUACUUCCAAAUAAAUUCAUAUCUU8.720.112


Target Position: 2069, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069CAAGCAAAGUAUGAAGAAA96.7388159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2067-2089ATCAAGCAAAGTATGAAGAAAGAUUUCUUCAUACUUUGCUUGAUCAAGCAAAGUAUGAAGAAAGAU20.418.622


Target Position: 5202, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5202CACUAUCGGAAAUUCAUUU82.55522122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5200-5222CTCACTATCGGAAATTCATTTTGAAAUGAAUUUCCGAUAGUGAGCACUAUCGGAAAUUCAUUUUGU7.220.932


Target Position: 8332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8332GUUUUAUAAGUCAUUUUUU83.3041934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8330-8352TTGTTTTATAAGTCATTTTTTTCAAAAAAUGACUUAUAAAACAAGUUUUAUAAGUCAUUUUUUUCU-3.3-7.521


Target Position: 7224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7224CUAGUACUUCCAAAUAAAU86.74081237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7222-7244CTCTAGTACTTCCAAATAAATTCAUUUAUUUGGAAGUACUAGAGCUAGUACUUCCAAAUAAAUUCU-9.718.822


Target Position: 1395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395GAAGAUGAUGAUUUUGGUA96.2987188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1393-1415CAGAAGATGATGATTTTGGTACTUACCAAAAUCAUCAUCUUCUGGAAGAUGAUGAUUUUGGUACUU18.820.412


Target Position: 5274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5274GUACUUAGAUUUAAGAAAA97.1362139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5272-5294TTGTACTTAGATTTAAGAAAAAGUUUUCUUAAAUCUAAGUACAAGUACUUAGAUUUAAGAAAAAGU7.111.322


Target Position: 8445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8445CUGGUAUUGAGGGUUUUGA75.00174106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8443-8465CACTGGTATTGAGGGTTTTGATAUCAAAACCCUCAAUACCAGUGCUGGUAUUGAGGGUUUUGAUAU18.820.033


Target Position: 9604, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9604CUUUUAGUUAAACAUUUUA86.22771336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9602-9624ATCTTTTAGTTAAACATTTTAAAUAAAAUGUUUAACUAAAAGAUCUUUUAGUUAAACAUUUUAAAU5.34.922


Target Position: 9235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9235UGGUGAAAUAUAUAUAUAA96.7223162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9049253TGGTGAAATATATATATAATTATATATATATTTCACCA0.373700.052800.810300.750001.000001.00000


Target Position: 8809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8809GCUGAUAAGGCUGUAUGUU80.05792745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8807-8829TAGCTGATAAGGCTGTATGTTTCAACAUACAGCCUUAUCAGCUAGCUGAUAAGGCUGUAUGUUUCU20.413.432


Target Position: 5846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5846UGGUAUCAUUUCAUUUUUA88.5726941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4605864TGGTATCATTTCATTTTTATAAAAATGAAATGATACCA0.560000.160800.810300.750001.000001.00000


Target Position: 9678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9678CUUUGUUUACAAACAUAUA93.1334403

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9676-9698GGCTTTGTTTACAAACATATATCUAUAUGUUUGUAAACAAAGCCCUUUGUUUACAAACAUAUAUCU6.75.622


Target Position: 8878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8878GGAAAAUAGAAAAUAAGAU91.1926595

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8876-8898TGGGAAAATAGAAAATAAGATTTAUCUUAUUUUCUAUUUUCCCAGGAAAAUAGAAAAUAAGAUUUU6.92.112


Target Position: 9715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9715GAUACAGAUACAGAUACAU90.6781663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9713-9735TAGATACAGATACAGATACATATAUGUAUCUGUAUCUGUAUCUAGAUACAGAUACAGAUACAUAUU20.320.311


Target Position: 3116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3116GGAUAUUAUUCCCACUCAA101.9132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223134GGATATTATTCCCACTCAATTGAGTGGGAATAATATCC0.266900.088200.724101.000000.967400.62500


Target Position: 9792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9792CUAGGAAUGGAGACAAUAA98.0599104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9790-9812TCCTAGGAATGGAGACAATAAAAUUAUUGUCUCCAUUCCUAGGACUAGGAAUGGAGACAAUAAAAU16.119.922


Target Position: 8002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8002AGAGAAGUCCAUUUAAAAA94.4652293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7918020AGAGAAGTCCATTTAAAAATTTTTAAATGGACTTCTCT0.247600.154700.724100.750001.000001.00000


Target Position: 8899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8899CAAAUAUUAAAUAAGCUUA93.9935327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8897-8919TTCAAATATTAAATAAGCTTAAAUAAGCUUAUUUAAUAUUUGAACAAAUAUUAAAUAAGCUUAAAU18.3-10.322


Target Position: 7006, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7006GAGAAAAGUAAAUAUAAAA101.01643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7004-7026AGGAGAAAAGTAAATATAAAAACUUUUAUAUUUACUUUUCUCCUGAGAAAAGUAAAUAUAAAAACU-8.010.311


Target Position: 8255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8255CCUCAAAAUACAAAAUUAG76.22233745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9728273CCTCAAAATACAAAATTAGCTAATTTTGTATTTTGAGG0.369200.231100.672400.750001.000001.00000


Target Position: 5388, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5388GUUUUAGACCUUUGUCUUU81.01072499

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5386-5408GAGTTTTAGACCTTTGTCTTTAGAAAGACAAAGGUCUAAAACUCGUUUUAGACCUUUGUCUUUAGU19.27.122


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193GGCCAACAGAAAGGGAGAA81.73592322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173211GGCCAACAGAAAGGGAGAATTCTCCCTTTCTGTTGGCC0.230700.052100.827601.000000.967400.75000


Target Position: 8253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8253GACCUCAAAAUACAAAAUU77.28573440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5138271GACCTCAAAATACAAAATTAATTTTGTATTTTGAGGTC0.609700.164600.810300.750001.000001.00000


Target Position: 5760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5760CCAUUGUCGUCUUUUCUAU86.63111258

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5758-5780TTCCATTGTCGTCTTTTCTATTGAUAGAAAAGACGACAAUGGAACCAUUGUCGUCUUUUCUAUUGU7.120.522


Target Position: 8245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8245GUGCAUAGGACCUCAAAAU83.62861878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8348263GTGCATAGGACCTCAAAATATTTTGAGGTCCTATGCAC0.238700.060900.784500.750001.000001.00000


Target Position: 9563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9563GAGCUAAUAAGCGUAAUAA96.9552145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9561-9583CGGAGCTAATAAGCGTAATAAAAUUAUUACGCUUAUUAGCUCCGGAGCUAAUAAGCGUAAUAAAAU8.518.333


Target Position: 6861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6861GGGAUUUGGAACUUUCUGU77.83673307

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6859-6881TTGGGATTTGGAACTTTCTGTATACAGAAAGUUCCAAAUCCCAAGGGAUUUGGAACUUUCUGUAUU16.620.122


Target Position: 3885, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885GAAUCUACCUUAAUAUCGU87.18341168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3883-3905TAGAATCTACCTTAATATCGTCAACGAUAUUAAGGUAGAUUCUAGAAUCUACCUUAAUAUCGUCAU8.814.523


Target Position: 7945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7945CUUUUUAAAAAGUUGUUGU71.87145035

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7943-7965CCCTTTTTAAAAAGTTGTTGTTGACAACAACUUUUUAAAAAGGGCUUUUUAAAAAGUUGUUGUUGU19.3-9.122


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720GCCACUAUAUCCAAACUAU93.3791377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881738GCCACTATATCCAAACTATATAGTTTGGATATAGTGGC0.276200.208300.956901.000001.000001.00000


Target Position: 3465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3465GAAGACAUUCUUGUAUUGU77.31263431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3463-3485TGGAAGACATTCTTGTATTGTTAACAAUACAAGAAUGUCUUCCAGAAGACAUUCUUGUAUUGUUAU13.519.222


Target Position: 2314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2314ACCUGCCUGCCAAUUCCAU67.60446248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922332ACCTGCCTGCCAATTCCATATGGAATTGGCAGGCAGGT0.337100.047800.698300.750001.000001.00000


Target Position: 3422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3422GGUGAAUAGAGAUAAAACU88.7287919

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3420-3442AAGGTGAATAGAGATAAAACTATAGUUUUAUCUCUAUUCACCUUGGUGAAUAGAGAUAAAACUAUU-0.316.132


Target Position: 9677, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9677GCUUUGUUUACAAACAUAU83.96221797

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9675-9697TGGCTTTGTTTACAAACATATATAUAUGUUUGUAAACAAAGCCAGCUUUGUUUACAAACAUAUAUU6.910.322


Target Position: 8604, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8604CUACUAGAACAUUUUAUUU87.17171169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8602-8624TCCTACTAGAACATTTTATTTTCAAAUAAAAUGUUCUAGUAGGACUACUAGAACAUUUUAUUUUCU-9.720.112


Target Position: 5847, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5847GGUAUCAUUUCAUUUUUAU89.1447847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3185865GGTATCATTTCATTTTTATATAAAAATGAAATGATACC0.565600.212100.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5845-5867TTGGTATCATTTCATTTTTATAAAUAAAAAUGAAAUGAUACCAAGGUAUCAUUUCAUUUUUAUAAU-9.716.021


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273GCCCAAAAGAGAGAAUUUA85.3811485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171291GCCCAAAAGAGAGAATTTATAAATTCTCTCTTTTGGGC0.384500.231100.965501.000000.956500.62500


Target Position: 7309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7309GAAUGUUCUUUUUAUCUUA101.91930

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7307-7329TTGAATGTTCTTTTTATCTTACCUAAGAUAAAAAGAACAUUCAAGAAUGUUCUUUUUAUCUUACCU6.914.832


Target Position: 6450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6450GUAUAUAUUUUUUGAAGUA97.7499112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6448-6470AGGTATATATTTTTTGAAGTATTUACUUCAAAAAAUAUAUACCUGUAUAUAUUUUUUGAAGUAUUU19.2-6.421


Target Position: 8894, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8894GAUUUCAAAUAUUAAAUAA100.63750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8892-8914AAGATTTCAAATATTAAATAAGCUUAUUUAAUAUUUGAAAUCUUGAUUUCAAAUAUUAAAUAAGCU-7.57.421


Target Position: 8658, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8658GAAAUUGCUUUUAAAAAAU84.49761683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8656-8678CAGAAATTGCTTTTAAAAAATATAUUUUUUAAAAGCAAUUUCUGGAAAUUGCUUUUAAAAAAUAUU-9.114.011


Target Position: 6265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6265CCGUGAUUGACCCUAAAAA89.3915820

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6263-6285GGCCGTGATTGACCCTAAAAATTUUUUUAGGGUCAAUCACGGCCCCGUGAUUGACCCUAAAAAUUU11.021.123


Target Position: 5296, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5296GAAAAUCAGAUGUAUUUAU90.3784694

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5294-5316GAGAAAATCAGATGTATTTATTTAUAAAUACAUCUGAUUUUCUCGAAAAUCAGAUGUAUUUAUUUU1.47.421


Target Position: 2909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2909CUCUGUUAUCGAUCAGAUU84.71691629

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2907-2929ACCTCTGTTATCGATCAGATTGGAAUCUGAUCGAUAACAGAGGUCUCUGUUAUCGAUCAGAUUGGU20.420.322


Target Position: 8998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8998GAGGAGCCUGUAAUUAAUU84.11741766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6799016GAGGAGCCTGTAATTAATTAATTAATTACAGGCTCCTC0.381100.108600.801700.750001.000001.00000


Target Position: 7971, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7971GUUUAUUUGAUUUUGAGUU76.57653654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7969-7991TTGTTTATTTGATTTTGAGTTAGAACUCAAAAUCAAAUAAACAAGUUUAUUUGAUUUUGAGUUAGU19.2-9.712


Target Position: 9207, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9207GUUUUGGUAUAUUAUUGAU88.7562917

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9205-9227GGGTTTTGGTATATTATTGATTTAUCAAUAAUAUACCAAAACCCGUUUUGGUAUAUUAUUGAUUUU8.918.822


Target Position: 7768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7768CCACCUUCGAAGCUAUAUA90.3048705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5837786CCACCTTCGAAGCTATATATATATAGCTTCGAAGGTGG0.310900.146900.801701.000001.000001.00000


Target Position: 1482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GCUCAUUUGGCUGUUUUCU70.61135404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1480-1502CGGCTCATTTGGCTGTTTTCTTAAGAAAACAGCCAAAUGAGCCGGCUCAUUUGGCUGUUUUCUUAU14.912.022


Target Position: 7935, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7935GAUGAAUCCCCUUUUUAAA94.3237307

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7933-7955AGGATGAATCCCCTTTTTAAAAAUUUAAAAAGGGGAUUCAUCCUGAUGAAUCCCCUUUUUAAAAAU-9.116.222


Target Position: 2589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589CAAAGUGAGGAUGAACAAU83.88381813

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2587-2609GTCAAAGTGAGGATGAACAATTTAUUGUUCAUCCUCACUUUGACCAAAGUGAGGAUGAACAAUUUU20.519.232


Target Position: 8538, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8538GCAGAUAUAUUCCAAAAAU91.5657552

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8536-8558AAGCAGATATATTCCAAAAATGGAUUUUUGGAAUAUAUCUGCUUGCAGAUAUAUUCCAAAAAUGGU11.513.322


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719CGCCACUAUAUCCAAACUA86.15751350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001737CGCCACTATATCCAAACTATAGTTTGGATATAGTGGCG0.342700.269800.750001.000001.000001.00000


Target Position: 8835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8835CAAAAUAUUGGUCAUCUAA95.8839205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8833-8855AACAAAATATTGGTCATCTAAAAUUAGAUGACCAAUAUUUUGUUCAAAAUAUUGGUCAUCUAAAAU21.4-10.332


Target Position: 8642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8642CAUGUACUCUUUAACAGAA99.929561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8640-8662ATCATGTACTCTTTAACAGAAATUUCUGUUAAAGAGUACAUGAUCAUGUACUCUUUAACAGAAAUU20.319.032


Target Position: 9651, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9651CGGAAAUUAACCUGUUUGU74.99714110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9649-9671TGCGGAAATTAACCTGTTTGTATACAAACAGGUUAAUUUCCGCACGGAAAUUAACCUGUUUGUAUU16.714.232


Target Position: 4527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4527GGAGCAGUUAACAAGGAAG79.65232842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6664545GGAGCAGTTAACAAGGAAGCTTCCTTGTTAACTGCTCC0.283100.114800.732800.750001.000001.00000


Target Position: 3977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3977GUUUGCAAAGGAACAACAU79.4762884

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3975-3997CAGTTTGCAAAGGAACAACATACAUGUUGUUCCUUUGCAAACUGGUUUGCAAAGGAACAACAUACU19.320.032


Target Position: 6662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6662GCAACUUAACAAGUUUAUU80.94242520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6660-6682CTGCAACTTAACAAGTTTATTTAAAUAAACUUGUUAAGUUGCAGGCAACUUAACAAGUUUAUUUAU4.611.822


Target Position: 9691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9691CAUAUAUCUAUAUCUAUAU96.7361160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9689-9711AACATATATCTATATCTATATATAUAUAGAUAUAGAUAUAUGUUCAUAUAUCUAUAUCUAUAUAUU8.23.211


Target Position: 9421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9421GCUUUUACCAACAGCAUUU80.27772687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2139439GCTTTTACCAACAGCATTTAAATGCTGTTGGTAAAAGC0.554200.538700.853401.000000.967400.62500


Target Position: 2052, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052GGAUUUCUUCCCAAAAUCA93.471370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2050-2072TTGGATTTCTTCCCAAAATCAAGUGAUUUUGGGAAGAAAUCCAAGGAUUUCUUCCCAAAAUCAAGU7.414.822


Target Position: 6443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6443GCAUUAGGUAUAUAUUUUU88.8525898

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6441-6463GTGCATTAGGTATATATTTTTTGAAAAAUAUAUACCUAAUGCACGCAUUAGGUAUAUAUUUUUUGU-10.317.412


Target Position: 563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563GAAAGAUGACAAUGGAUUU91.236586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
561-583CAGAAAGATGACAATGGATTTGGAAAUCCAUUGUCAUCUUUCUGGAAAGAUGACAAUGGAUUUGGU20.112.022


Target Position: 8163, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8163GUCGAUAUAUGGUUUUGAA96.8689151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8161-8183AAGTCGATATATGGTTTTGAATTUUCAAAACCAUAUAUCGACUUGUCGAUAUAUGGUUUUGAAUUU14.917.833


Target Position: 3880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3880GAUUAGAAUCUACCUUAAU91.8922518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623898GATTAGAATCTACCTTAATATTAAGGTAGATTCTAATC0.372100.079100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3878-3900GGGATTAGAATCTACCTTAATATAUUAAGGUAGAUUCUAAUCCCGAUUAGAAUCUACCUUAAUAUU18.66.923


Target Position: 9157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9157GAUAUUCACAUAUCAUAUA99.008583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9155-9177GAGATATTCACATATCATATAATUAUAUGAUAUGUGAAUAUCUCGAUAUUCACAUAUCAUAUAAUU8.58.721


Target Position: 6441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6441GUGCAUUAGGUAUAUAUUU84.60031658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6439-6461TTGTGCATTAGGTATATATTTTTAAAUAUAUACCUAAUGCACAAGUGCAUUAGGUAUAUAUUUUUU-8.621.132


Target Position: 9483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9483GUUUUGAAAUACUUGUAAU90.0019741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9481-9503TGGTTTTGAAATACTTGTAATTTAUUACAAGUAUUUCAAAACCAGUUUUGAAAUACUUGUAAUUUU11.87.722


Target Position: 4383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383GCAAGUAACAUUUUAGUAA95.1415249

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4381-4403AGGCAAGTAACATTTTAGTAATGUUACUAAAAUGUUACUUGCCUGCAAGUAACAUUUUAGUAAUGU6.611.822


Target Position: 2821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821GGAAAAUUUUUUCAAACUU84.19351748

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2819-2841ACGGAAAATTTTTTCAAACTTGGAAGUUUGAAAAAAUUUUCCGUGGAAAAUUUUUUCAAACUUGGU19.20.422


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498GCAGGAGGAGGAAUGUGAA95.5777228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612516GCAGGAGGAGGAATGTGAATTCACATTCCTCCTCCTGC0.403900.112800.681001.000001.000001.00000