Input target sequence

Length: 1216
CTCATTGACTTCCTTCCTGTTCTAACTGCCAGTACTCAGAAGTCAGAGTTGAGAGACAGAGGCACCCCGGACAGAGACGTGAAGCACTGAATAAATAGATCAGAATGACTGAAAAAGCCCCAGAGCCACATGTGGAGGAGGATGATGATGATGAGCTGGACAGCAAGCTCAATTATAAGCCTCCACCACAGAAGTCCCTGAAAGAGCTGCAGGAAATGGACAAAGATGATGAGAGTCTAATTAAGTACAAGAAAACGCTGCTGGGAGATGGTCCTGTGGTGACAGATCCGAAAGCCCCCAATGTCGTTGTCACCCGGCTCACCCTGGTTTGTGAGAGTGCCCCGGGACCAATCACCATGGACCTTACTGGAGATCTGGAAGCCCTCAAAAAGGAAACCATTGTGTTAAAGGAAGGTTCTGAATATAGAGTCAAAATTCACTTCAAAGTGAACAGGGATATTGTGTCAGGCCTGAAATACGTTCAGCACACCTACAGGACTGGGGTGAAAGTGGATAAAGCAACATTTATGGTTGGCAGCTATGGACCTCGGCCTGAGGAGTATGAGTTCCTCACTCCAGTTGAGGAGGCTCCCAAGGGCATGCTGGCGCGAGGCACGTACCACAACAAGTCCTTCTTCACCGACGATGACAAGCAAGACCACCTCAGCTGGGAGTGGAACCTGTCGATTAAGAAGGAGTGGACAGAATGAATGCATCCACCCCTTTCCCCACCCTTGCCACCTGGAAGAATTCTCTCAGGCGTGTTCAGCACCCTGTCCCTCCTCCCTGTCCACAGCTGGGTCCCTCTTCAACACTGCCACATTTCCTTATTGATGCATCTTTTCCCACCCTGTCACTCAACGTGGTCCCTAGAACAAGAGGCTTAAAACCGGGCTTTCACCCAACCTGCTCCCTCTGATCCTCCATCAGGGCCAGATCTTCCACGTCTCCATCTCAGTACACAATCATTTAATATTTCCCTGTCTTACCCCTATTCAAGCAACTAGAGGCCAGAAAATGGGCAAATTATCACTAACAGGTCTTTGACTCAGGTTCCAGTAGTTCATTCTAATGCCTAGATTCTTTTGTGGTTGTTGCTGGCCCAATGAGTCCCTAGTCACATCCCCTGCCAGAGGGAGTTCTTCTTTTGTGAGAGACACTGTAAACGACACAAGAGAACAAGAATAAAACAATAACTGTGTGTGTTCTGGCTGAG