siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 652   657   1409   1412   1766   1897  
Biltr, Ernai 885  
Biltr, Rnaxs 7   8   10   28   35   36   37   57   107   108   177   179   182   184   185   186   187   239   242   243  
348   349   371   372   373   374   375   376   378   379   380   381   382   385   393   394   408   409   410   412  
469   546   547   548   549   550   553   554   559   560   563   581   589   602   603   612   613   614   615   616  
623   636   637   643   644   645   646   647   650   651   654   655   656   659   661   663   690   741   742   743  
744   745   757   758   764   765   766   767   768   777   778   779   780   781   783   787   789   790   791   812  
816   817   818   819   851   852   853   894   895   896   910   911   922   927   928   929   930   942   954   969  
982   983   984   985   986   988   1011   1012   1043   1053   1054   1064   1074   1075   1076   1077   1078   1079   1084   1088  
1090   1091   1097   1102   1103   1128   1129   1130   1131   1132   1137   1139   1140   1141   1142   1144   1150   1151   1153   1158  
1159   1160   1161   1162   1163   1164   1165   1171   1176   1177   1178   1181   1182   1183   1184   1185   1186   1190   1204   1205  
1206   1210   1211   1214   1215   1216   1224   1225   1229   1231   1232   1234   1236   1249   1250   1251   1252   1253   1254   1255  
1256   1257   1258   1259   1265   1266   1267   1268   1269   1287   1288   1334   1335   1336   1337   1338   1342   1347   1348   1349  
1351   1352   1356   1359   1360   1365   1368   1369   1371   1383   1384   1386   1410   1411   1413   1453   1454   1458   1459   1461  
1463   1464   1465   1467   1468   1471   1472   1473   1475   1476   1483   1484   1485   1486   1504   1508   1509   1512   1513   1517  
1518   1521   1522   1525   1526   1527   1594   1616   1617   1618   1619   1620   1621   1623   1624   1625   1626   1628   1630   1634  
1635   1636   1638   1640   1645   1646   1647   1648   1653   1654   1655   1659   1660   1666   1667   1668   1669   1671   1672   1673  
1674   1679   1680   1681   1682   1683   1685   1686   1690   1691   1703   1705   1712   1713   1715   1718   1719   1723   1724   1725  
1726   1727   1741   1742   1743   1744   1745   1746   1747   1748   1756   1760   1761   1764   1765   1767   1768   1769   1772   1773  
1776   1777   1778   1779   1786   1787   1790   1795   1796   1797   1798   1799   1800   1802   1803   1804   1805   1806   1809   1811  
1814   1819   1820   1824   1825   1827   1828   1836   1838   1840   1841   1845   1846   1847   1866   1867   1868   1869   1870   1874  
1880   1895   1896   1898   1899   1900   1901   1902   1907   1919   1920   1921   1924   1925   1945   1946   1947   1948   1949   1950  
1951   1952   1953   1954   1960   1961   1962   1964   1965   1966   1967   1968   1969   1975   1993   1994   2001   2002   2003   2004  
2027   2028   2055   2056   2058   2064   2065   2066   2068   2069   2072   2073   2074   2075   2076   2077   2078   2088   2089   2090  
2091   2092   2095   2098   2099   2100   2102   2103   2115   2124   2127   2128   2129   2130   2131   2132   2134   2135   2137   2142  
2143   2144   2154   2157   2160   2162  
Biltr, Sidirect 40   576   666   718   731   1087   1273   1350   1477   1593   1649   1831   1855   2016   2025   2046   2047   2123   2148  
Biltr, Ernai, Sidirect 1701  
Biltr, Ernai, Rnaxs, Sidirect 562   1714  
Biltr, Rnaxs, Sidirect 9   658   660   662   782   1089   1263   1414   1415   1416   1418   1452   1455   1462   1474   1595   1622   1627   1629   1639  
1687   1704   1774   1775   1791   1801   1810   1826   1829   1850   1851   1905   1906   1992   2079   2080   2087   2096   2101   2133  
2136   2155   2156   2158  


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484UAGGAAAAAAGACAGACAA82.057399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131502TAGGAAAAAAGACAGACAATTGTCTGTCTTTTTTCCTA0.066300.039300.525900.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231AGUGUCCAUCAGUACGAAU81.658416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121249AGTGTCCATCAGTACGAATATTCGTACTGATGGACACT0.087700.005000.698300.750000.967400.62500


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769GCUUUCCUUUGAUUUUAUA90.1556120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041787GCTTTCCTTTGATTTTATATATAAAATCAAAGGAAAGC0.328900.076700.810301.000001.000001.00000


Target Position: 2154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154UGCAGUUUACAAAUAUAGU73.4651811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502172TGCAGTTTACAAATATAGTACTATATTTGTAAACTGCA0.036400.004700.646600.500001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595GAAAAGAGGCUGUUUGUAA97.50423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611613GAAAAGAGGCTGTTTGTAATTACAAACAGCCTCTTTTC0.032200.004500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1593-1615CAGAAAAGAGGCTGTTTGTAAGAUUACAAACAGCCUCUUUUCUGGAAAAGAGGCUGUUUGUAAGAU14.710.322


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667AACAAAGUGGAAGCCUGUU67.08121174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391685AACAAAGTGGAAGCCTGTTAACAGGCTTCCACTTTGTT0.084700.012600.500000.500001.000001.00000


Target Position: 1897, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897GACUCACUCCUUAAAAAAU91.240899

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2189719GACTCACTCCTTAAAAAAT1/1/0/094.96BAG4NM_004874.21NANANA8:38068252..38068270(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681915GACTCACTCCTTAAAAAATATTTTTTAAGGAGTGAGTC0.211900.002700.810300.750001.000001.00000


Target Position: 1791, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791GAAAAACUGGCAAAGGAAU81.5338422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591809GAAAAACTGGCAAAGGAATATTCCTTTGCCAGTTTTTC0.032200.011200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1789-1811TTGAAAAACTGGCAAAGGAATGGAUUCCUUUGCCAGUUUUUCAAGAAAAACUGGCAAAGGAAUGGU18.73.222


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467AGAAGUAGAAGAAUUUGUA93.379465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501485AGAAGTAGAAGAATTTGTATACAAATTCTTCTACTTCT0.117500.034100.543100.750001.000001.00000


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674UGGAAGCCUGUUACUAACU66.98831181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971692TGGAAGCCTGTTACTAACTAGTTAGTAACAGGCTTCCA0.052400.015200.637900.500001.000001.00000


Target Position: 550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550CAGGAGCAGCCACCAUAUC68.21411107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377568CAGGAGCAGCCACCATATCGATATGGTGGCTGCTCCTG0.279000.012400.603400.500000.934800.75000


Target Position: 2157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157AGUUUACAAAUAUAGUAUU84.0694295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2622175AGTTTACAAATATAGTATTAATACTATATTTGTAAACT0.133100.022300.698300.750001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068ACAUUGUGACUGCUUUCAA88.1623170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3712086ACATTGTGACTGCTTTCAATTGAAAGCAGTCACAATGT0.204500.007000.560300.750001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074UGACUGCUUUCAACAUAUA88.6324162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3242092TGACTGCTTTCAACATATATATATGTTGAAAGCAGTCA0.112500.009800.681000.750001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801CAAAGGAAUGGAAGAAUAU88.4096165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821819CAAAGGAATGGAAGAATATATATTCTTCCATTCCTTTG0.178700.006400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1799-1821GGCAAAGGAATGGAAGAATATTTAUAUUCUUCCAUUCCUUUGCCCAAAGGAAUGGAAGAAUAUUUU6.918.712


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526UGCUAACCAAGGAACUUUU72.7989851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761544TGCTAACCAAGGAACTTTTAAAAGTTCCTTGGTTAGCA0.079500.006800.853400.750001.000001.00000


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185CCCCUUCGCUGCUCUCCAU78.0304574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247203CCCCTTCGCTGCTCTCCATATGGAGAGCAGCGAAGGGG0.144200.065000.836201.000001.000001.00000


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824GUCAUGAGUUGUUUUCAGU80.3428468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571842GTCATGAGTTGTTTTCAGTACTGAAAACAACTCATGAC0.092200.003500.612100.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089CUACAUGACUGAAAGUACU84.6466271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141107CTACATGACTGAAAGTACTAGTACTTTCAGTCATGTAG0.075200.011400.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1087-1109CTCTACATGACTGAAAGTACTTCAGUACUUUCAGUCAUGUAGAGCUACAUGACUGAAAGUACUUCU12.921.533


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177CGUCCGACCCCCUUCGCUG67.05431176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470195CGTCCGACCCCCTTCGCTGCAGCGAAGGGGGTCGGACG0.256000.019300.491400.750000.940200.87500


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680CCUGUUACUAACUUGACCA86.9213207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581698CCTGTTACTAACTTGACCATGGTCAAGTTAGTAACAGG0.037800.004900.500000.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GAACAAGAAGUAGAAGAAU87.4932186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661480GAACAAGAAGTAGAAGAATATTCTTCTACTTCTTGTTC0.128000.057500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1460-1482TTGAACAAGAAGTAGAAGAATTTAUUCUUCUACUUCUUGUUCAAGAACAAGAAGUAGAAGAAUUUU19.119.222


Target Position: 1742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1742GUUGAUGACAAGAAGCAAU83.6261313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391760GTTGATGACAAGAAGCAATATTGCTTCTTGTCATCAAC0.039500.008300.637900.750001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368UAGCAGUCUUCCUGAAGAA87.3832188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011386TAGCAGTCTTCCTGAAGAATTCTTCAGGAAGACTGCTA0.016400.003100.500000.500000.918500.87500


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468GAAGUAGAAGAAUUUGUAG83.1787336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471486GAAGTAGAAGAATTTGTAGCTACAAATTCTTCTACTTC0.201000.032200.500000.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108ACCUCCGUCCCUCAGCUUU63.46731360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513126ACCTCCGTCCCTCAGCTTTAAAGCTGAGGGACGGAGGT0.059200.001100.853400.750000.989101.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255GGGACAGUGAACAAUGAUG79.3044505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101273GGGACAGTGAACAATGATGCATCATTGTTCACTGTCCC0.207300.011300.836200.750001.000001.00000


Target Position: 1819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819UUUUAGUCAUGAGUUGUUU67.14221171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971837TTTTAGTCATGAGTTGTTTAAACAACTCATGACTAAAA0.031800.001600.500000.500001.000001.00000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745UAUUAUGCACCUGGUUAUA78.4411554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515763TATTATGCACCTGGTTATATATAACCAGGTGCATAATA0.012600.007800.500000.500001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383AGAAUGUGUACCUUCAGAU84.6246272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011401AGAATGTGTACCTTCAGATATCTGAAGGTACACATTCT0.050800.009400.543100.750000.989100.62500


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384GAAUGUGUACCUUCAGAUG82.3993383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941402GAATGTGTACCTTCAGATGCATCTGAAGGTACACATTC0.055500.013400.517200.500001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847AGACGAAUGAAUGUAAUAG75.0969723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101865AGACGAATGAATGTAATAGCTATTACATTCATTCGTCT0.048100.007300.551700.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885GGGGCAGGUUCCAGGAUAU87.2432195

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_388519GGGGCAGGTTCCAGGATAT1/1/0/093.44BAG4NM_004874.21NANANA8:38065254..38065272(+)00BAG4(0.002)


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522GAAAUGCUAACCAAGGAAC70.288998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651540GAAATGCTAACCAAGGAACGTTCCTTGGTTAGCATTTC0.050400.008200.525900.500001.000001.00000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646GAAUUGCAAGGCCAGAGUU82.7187358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510664GAATTGCAAGGCCAGAGTTAACTCTGGCCTTGCAATTC0.082000.001200.525900.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234GUCCAUCAGUACGAAUCCU77.0553612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921252GTCCATCAGTACGAATCCTAGGATTCGTACTGATGGAC0.089000.006600.474100.500000.967400.62500


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287GGAUUCCCAAGUCCAGUAU78.6535547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811305GGATTCCCAAGTCCAGTATATACTGGACTTGGGAATCC0.025600.005700.827601.000000.983700.62500


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073GUGACUGCUUUCAACAUAU88.6976160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392091GTGACTGCTTTCAACATATATATGTTGAAAGCAGTCAC0.095700.003900.750000.750001.000001.00000


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786UACUUGAAAAACUGGCAAA79.1224520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011804TACTTGAAAAACTGGCAAATTTGCCAGTTTTTCAAGTA0.060100.035600.681000.500001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746AUGACAAGAAGCAAUACAU82.1017396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791764ATGACAAGAAGCAATACATATGTATTGCTTCTTGTCAT0.225200.019500.500000.500001.000001.00000


Target Position: 1704, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1704CACUUGAUUUGGUUAAUUA99.90718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901722CACTTGATTTGGTTAATTATAATTAACCAAATCAAGTG0.022800.006000.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1702-1724AACACTTGATTTGGTTAATTACCUAAUUAACCAAAUCAAGUGUUCACUUGAUUUGGUUAAUUACCU-0.319.233


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654AGGCCAGAGUUUGAAUUCU74.2808770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407672AGGCCAGAGTTTGAATTCTAGAATTCAAACTCTGGCCT0.063800.014300.620700.500001.000001.00000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124CUUCUUGGACUUCUGUUUU74.8119738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5112142CTTCTTGGACTTCTGTTTTAAAACAGAAGTCCAAGAAG0.013800.002100.637900.750001.000001.00000


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760UACAUUCCAGCUUUCCUUU66.98891180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801778TACATTCCAGCTTTCCTTTAAAGGAAAGCTGGAATGTA0.175400.109700.681000.500001.000001.00000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803AAGGAAUGGAAGAAUAUUU80.4317462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081821AAGGAATGGAAGAATATTTAAATATTCTTCCATTCCTT0.154600.007000.637900.500001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817AGCCCAACUCCAGUCUCUC63.77851344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415835AGCCCAACTCCAGTCTCTCGAGAGACTGGAGTTGGGCT0.144700.009400.543100.500001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518GGAAGAAAUGCUAACCAAG82.0413400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451536GGAAGAAATGCTAACCAAGCTTGGTTAGCATTTCTTCC0.037200.016400.732800.750001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554AGCAGCCACCAUAUCCUAG67.37911152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319572AGCAGCCACCATATCCTAGCTAGGATATGGTGGCTGCT0.148900.027800.681000.500001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176UUCAUACCCCUAUAGCCAA74.6146751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781194TTCATACCCCTATAGCCAATTGGCTATAGGGGTATGAA0.367700.320900.525900.500000.994600.87500


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393UCCUCUUCGCCCUGAACCU61.39761448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513411TCCTCTTCGCCCTGAACCTAGGTTCAGGGCGAAGAGGA0.153800.150800.525900.500001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483GUAGGAAAAAAGACAGACA91.623388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981501GTAGGAAAAAAGACAGACATGTCTGTCTTTTTTCCTAC0.076900.044900.474100.500001.000001.00000


Target Position: 1452, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452CCAGUAUCUUGAACAAGAA97.734621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881470CCAGTATCTTGAACAAGAATTCTTGTTCAAGATACTGG0.160700.001800.672401.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1450-1472GTCCAGTATCTTGAACAAGAAGTUUCUUGUUCAAGAUACUGGACCCAGUAUCUUGAACAAGAAGUU19.220.322


Target Position: 1766, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766CCAGCUUUCCUUUGAUUUU77.3767601

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10176619CCAGCTTTCCTTTGATTTT1/1/0/091.46BAG4NM_004874.21NANANA8:38068121..38068139(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2201784CCAGCTTTCCTTTGATTTTAAAATCAAAGGAAAGCTGG0.161100.080400.844801.000001.000001.00000


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838UCAGUUUUCAGACGAAUGA70.4025988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241856TCAGTTTTCAGACGAATGATCATTCGTCTGAAAACTGA0.110200.008300.500000.500001.000001.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418GUAUUAAAAAAAUCAUACA91.870984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011436GTATTAAAAAAATCATACATGTATGATTTTTTTAATAC0.609400.111500.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1416-1438GAGTATTAAAAAAATCATACATGUGUAUGAUUUUUUUAAUACUCGUAUUAAAAAAAUCAUACAUGU16.0-7.522


Target Position: 1831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831GUUGUUUUCAGUUUUCAGA80.4629461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1829-1851GAGTTGTTTTCAGTTTTCAGACGUCUGAAAACUGAAAACAACUCGUUGUUUUCAGUUUUCAGACGU12.25.621


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841GUUUUCAGACGAAUGAAUG70.8992958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671859GTTTTCAGACGAATGAATGCATTCATTCGTCTGAAAAC0.111100.009100.491400.500000.967400.62500


Target Position: 546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
546CCACCAGGAGCAGCCACCA77.2076607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436564CCACCAGGAGCAGCCACCATGGTGGCTGCTCCTGGTGG0.409500.006800.500000.750000.934800.75000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845UCAGACGAAUGAAUGUAAU74.7084746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641863TCAGACGAATGAATGTAATATTACATTCATTCGTCTGA0.070400.043000.715500.750001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969CAACAGGCUUAUCAGAAAC75.4025710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341987CAACAGGCTTATCAGAAACGTTTCTGATAAGCCTGTTG0.047500.045500.500000.500001.000001.00000


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268AUGAUGAUUCAGAUCUUUU79.5141494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961286ATGATGATTCAGATCTTTTAAAAGATCTGAATCATCAT0.052700.005700.655200.500001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508ACUGGCUUCUGGAAGAAAU76.8394625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011526ACTGGCTTCTGGAAGAAATATTTCTTCCAGAAGCCAGT0.309500.001500.698300.750000.989100.62500


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UGAACAAGAAGUAGAAGAA89.3029142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431479TGAACAAGAAGTAGAAGAATTCTTCTACTTCTTGTTCA0.189500.082000.551700.750001.000001.00000


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371UACACCCACCUCCACCCUU61.34941449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375389TACACCCACCTCCACCCTTAAGGGTGGAGGTGGGTGTA0.233300.079000.543100.500001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CCCCUAUAGCCAAUCAGAU81.9946402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801200CCCCTATAGCCAATCAGATATCTGATTGGCTATAGGGG0.395200.236700.810301.000001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691CUUGACCAAAGAACACUUG62.79141385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741709CTTGACCAAAGAACACTTGCAAGTGTTCTTTGGTCAAG0.580800.005200.491400.500001.000001.00000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638AGAAAAAAAAGGAUUAUGA85.3651248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751656AGAAAAAAAAGGATTATGATCATAATCCTTTTTTTTCT0.707900.570800.500000.500001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656GCCAGAGUUUGAAUUCUUA96.387536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276674GCCAGAGTTTGAATTCTTATAAGAATTCAAACTCTGGC0.142900.015800.965501.000000.994600.62500


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779GAUUUUAUACUUGAAAAAC74.0831781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651797GATTTTATACTTGAAAAACGTTTTTCAAGTATAAAATC0.304600.207200.534500.500001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186UAUAGCCAAUCAGAUCAAA80.4242464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511204TATAGCCAATCAGATCAAATTTGATCTGATTGGCTATA0.400800.227000.543100.500001.000001.00000


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338CAGUGACCAUCCCAACAAU92.808672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291356CAGTGACCATCCCAACAATATTGTTGGGATGGTCACTG0.728500.153200.775900.750001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679GCCUGUUACUAACUUGACC70.3471993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921697GCCTGTTACTAACTTGACCGGTCAAGTTAGTAACAGGC0.020600.001800.646600.500001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622CCAUACUGGAAAAAUUAGA81.2904427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711640CCATACTGGAAAAATTAGATCTAATTTTTCCAGTATGG0.677900.072900.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1620-1642GGCCATACTGGAAAAATTAGAAAUCUAAUUUUUCCAGUAUGGCCCCAUACUGGAAAAAUUAGAAAU-4.317.921


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CACUCCUUAAAAAAUUUAU80.0991477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981919CACTCCTTAAAAAATTTATATAAATTTTTTAAGGAGTG0.180600.005700.750000.750001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662GUUUGAAUUCUUAUACAAA99.096514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209680GTTTGAATTCTTATACAAATTTGTATAAGAATTCAAAC0.521700.062200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
660-682GAGTTTGAATTCTTATACAAATGUUUGUAUAAGAAUUCAAACUCGUUUGAAUUCUUAUACAAAUGU8.57.422


Target Position: 28, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28UGGCGAGGAAACGUAUACU70.13061002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
49246TGGCGAGGAAACGTATACTAGTATACGTTTCCTCGCCA0.470200.001700.637900.500001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951AGGGAAACACACUUCACAC75.7725686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731969AGGGAAACACACTTCACACGTGTGAAGTGTGTTTCCCT0.163700.030900.551700.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GAAUUCUUAUACAAAUGGA90.9248101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
664-686TTGAATTCTTATACAAATGGAGCUCCAUUUGUAUAAGAAUUCAAGAAUUCUUAUACAAAUGGAGCU17.75.333


Target Position: 650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650UGCAAGGCCAGAGUUUGAA71.0297951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471668TGCAAGGCCAGAGTTTGAATTCAAACTCTGGCCTTGCA0.054100.002600.681000.750001.000001.00000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181ACCCCUAUAGCCAAUCAGA78.9969524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081199ACCCCTATAGCCAATCAGATCTGATTGGCTATAGGGGT0.396100.254200.629300.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686ACUAACUUGACCAAAGAAC59.19581563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701704ACTAACTTGACCAAAGAACGTTCTTTGGTCAAGTTAGT0.037400.003700.560300.500001.000001.00000


Target Position: 1975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975GCUUAUCAGAAACCUACCA83.8174308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101993GCTTATCAGAAACCTACCATGGTAGGTTTCTGATAAGC0.137200.012200.508600.750001.000001.00000


Target Position: 2055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055GUCACAUUUUUGUACAUUG78.1284569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962073GTCACATTTTTGTACATTGCAATGTACAAAAATGTGAC0.074000.008700.672400.500000.983700.75000


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623CAAGUACAUAUCCUGUAAG78.8002534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471641CAAGTACATATCCTGTAAGCTTACAGGATATGTACTTG0.037100.016000.508600.500000.929300.75000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661AGUUUGAAUUCUUAUACAA95.888544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336679AGTTTGAATTCTTATACAATTGTATAAGAATTCAAACT0.259600.047800.560300.750001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CAGAAGUUCCAAGUACUUA91.371495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
244800CAGAAGTTCCAAGTACTTATAAGTACTTGGAACTTCTG0.232400.069900.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
780-802CACAGAAGTTCCAAGTACTTACCUAAGUACUUGGAACUUCUGUGCAGAAGUUCCAAGUACUUACCU17.617.723


Target Position: 2047, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2047GAUAUCUUGUCACAUUUUU82.5964368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2045-2067TGGATATCTTGTCACATTTTTGTAAAAAUGUGACAAGAUAUCCAGAUAUCUUGUCACAUUUUUGUU5.36.622


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077CUGCUUUCAACAUAUACUU78.3085559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3502095CTGCTTTCAACATATACTTAAGTATATGTTGAAAGCAG0.077400.040800.646600.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090AUACUUCAUGUGUAAUUAU82.9555348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372108ATACTTCATGTGTAATTATATAATTACACATGAAGTAT0.060400.012700.500000.500001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949GGAGGGAAACACACUUCAC80.9985437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361967GGAGGGAAACACACTTCACGTGAAGTGTGTTTCCCTCC0.137100.008900.577600.750001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743CUUAUUAUGCACCUGGUUA86.4307218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499761CTTATTATGCACCTGGTTATAACCAGGTGCATAATAAG0.017600.012200.603400.750001.000001.00000


Target Position: 1666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666GAACAAAGUGGAAGCCUGU82.5033373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161684GAACAAAGTGGAAGCCTGTACAGGCTTCCACTTTGTTC0.084500.010800.465500.500001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954GAAACACACUUCACACAAC84.8626261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3791972GAAACACACTTCACACAACGTTGTGTGAAGTGTGTTTC0.091200.040300.525900.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619AGGCCAUACUGGAAAAAUU85.4472246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551637AGGCCATACTGGAAAAATTAATTTTTCCAGTATGGCCT0.187200.008000.836200.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204AGCAUGAACCGGCACAACU73.2572824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421222AGCATGAACCGGCACAACTAGTTGTGCCGGTTCATGCT0.083300.019000.646600.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812GCAACAGCCCAACUCCAGU76.5946641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410830GCAACAGCCCAACTCCAGTACTGGAGTTGGGCTGTTGC0.105500.005100.646600.750001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968ACAACAGGCUUAUCAGAAA90.8987102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171986ACAACAGGCTTATCAGAAATTTCTGATAAGCCTGTTGT0.095100.058900.706900.750001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463AACAAGAAGUAGAAGAAUU82.9953345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301481AACAAGAAGTAGAAGAATTAATTCTTCTACTTCTTGTT0.077200.042500.637900.500001.000001.00000


Target Position: 9, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9GGAAACUCCAUUGGAUAAA81.3036426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44827GGAAACTCCATTGGATAAATTTATCCAATGGAGTTTCC0.143600.003300.870701.000000.967401.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7-29GAGGAAACTCCATTGGATAAATGUUUAUCCAAUGGAGUUUCCUCGGAAACUCCAUUGGAUAAAUGU21.221.520


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900UCACUCCUUAAAAAAUUUA73.8768790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001918TCACTCCTTAAAAAATTTATAAATTTTTTAAGGAGTGA0.216800.005400.689700.750001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371CAGUCUUCCUGAAGAAUGU84.0395297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071389CAGTCTTCCTGAAGAATGTACATTCTTCAGGAAGACTG0.014700.002300.577600.500000.940200.62500


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373CACCCACCUCCACCCUUAU78.319558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124391CACCCACCTCCACCCTTATATAAGGGTGGAGGTGGGTG0.278200.109400.750000.750001.000001.00000


Target Position: 1992, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992CAGAUGAAACUGGAUAUAA95.390150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082010CAGATGAAACTGGATATAATTATATCCAGTTTCATCTG0.048900.010100.750000.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1990-2012ACCAGATGAAACTGGATATAATCUUAUAUCCAGUUUCAUCUGGUCAGAUGAAACUGGAUAUAAUCU16.720.432


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084AAUCUCUACAUGACUGAAA84.1061294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931102AATCTCTACATGACTGAAATTTCAGTCATGTAGAGATT0.028100.022000.508600.500001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348CCCAACAAUCAAGAUCAAA82.6338365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581366CCCAACAATCAAGATCAAATTTGATCTTGATTGTTGGG0.447600.382300.991401.000001.000001.00000


Target Position: 1825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1825UCAUGAGUUGUUUUCAGUU76.7351633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571843TCATGAGTTGTTTTCAGTTAACTGAAAACAACTCATGA0.094100.007900.577600.750001.000001.00000


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003GGAUAUAAUCUGAGACAAA106.4232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4732021GGATATAATCTGAGACAAATTTGTCTCAGATTATATCC0.027600.013200.870701.000001.000001.00000


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165CCCAAGGAUUCUUCAUACC63.8121342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971183CCCAAGGATTCTTCATACCGGTATGAAGAATCCTTGGG0.854400.018300.637900.500001.000001.00000


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129UGGACUUCUGUUUUGUUUU69.94971015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822147TGGACTTCTGTTTTGTTTTAAAACAAAACAGAAGTCCA0.035300.002200.844800.750001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618CAGGCCAUACUGGAAAAAU78.759538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871636CAGGCCATACTGGAAAAATATTTTTCCAGTATGGCCTG0.130400.006200.775900.750000.994600.62500


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870CUAUGGAGUUACCAAUAUU92.422476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051888CTATGGAGTTACCAATATTAATATTGGTAACTCCATAG0.107700.005400.663800.750000.913000.87500


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964UCACACAACAGGCUUAUCA75.6197698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551982TCACACAACAGGCTTATCATGATAAGCCTGTTGTGTGA0.106400.103400.500000.500001.000001.00000


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683GUUACUAACUUGACCAAAG77.9298581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241701GTTACTAACTTGACCAAAGCTTTGGTCAAGTTAGTAAC0.054700.004600.508600.500001.000001.00000


Target Position: 2158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158GUUUACAAAUAUAGUAUUA94.929753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2812176GTTTACAAATATAGTATTATAATACTATATTTGTAAAC0.223200.023800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2156-2178CAGTTTACAAATATAGTATTATTUAAUACUAUAUUUGUAAACUGGUUUACAAAUAUAGUAUUAUUU6.37.222


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818GCCCAACUCCAGUCUCUCG70.7967964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458836GCCCAACTCCAGTCTCTCGCGAGAGACTGGAGTTGGGC0.033000.017200.706900.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087CAUAUACUUCAUGUGUAAU87.5159184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772105CATATACTTCATGTGTAATATTACACATGAAGTATATG0.027100.004300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2085-2107AACATATACTTCATGTGTAATTAAUUACACAUGAAGUAUAUGUUCAUAUACUUCAUGUGUAAUUAU20.46.132


Target Position: 562, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
562CCAUAUCCUAGCUACAAUU86.7401211

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_556219CCATATCCTAGCTACAATT1/1/0/091.46BAG4NM_004874.21NANANA8:38050215..38050233(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320580CCATATCCTAGCTACAATTAATTGTAGCTAGGATATGG0.094400.055500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
560-582CACCATATCCTAGCTACAATTCTAAUUGUAGCUAGGAUAUGGUGCCAUAUCCUAGCUACAAUUCUU11.621.232


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984GACUGUACGACCACAAGAA97.891420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421002GACTGTACGACCACAAGAATTCTTGTGGTCGTACAGTC0.148800.008600.646600.750000.907600.62500


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907UUAAAAAAUUUAUGGAUAU74.6515749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611925TTAAAAAATTTATGGATATATATCCATAAATTTTTTAA0.102700.054300.491400.500001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795AACUGGCAAAGGAAUGGAA83.0816341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021813AACTGGCAAAGGAATGGAATTCCATTCCTTTGCCAGTT0.020500.005000.474100.500001.000001.00000


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715GUUAAUUACCCUCUUUUUG66.89281186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951733GTTAATTACCCTCTTTTTGCAAAAAGAGGGTAATTAAC0.357000.051000.500000.500001.000001.00000


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802AAAGGAAUGGAAGAAUAUU79.0104522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621820AAAGGAATGGAAGAATATTAATATTCTTCCATTCCTTT0.166400.006200.491400.500001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459CUUGAACAAGAAGUAGAAG69.57091038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441477CTTGAACAAGAAGTAGAAGCTTCTACTTCTTGTTCAAG0.171000.034500.500000.500001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685UACUAACUUGACCAAAGAA86.7076212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541703TACTAACTTGACCAAAGAATTCTTTGGTCAAGTTAGTA0.042400.005000.508600.500001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349CCUGGGGGUGGAGAUGUGC52.80551830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465367CCTGGGGGTGGAGATGTGCGCACATCTCCACCCCCAGG0.039600.005200.491400.500001.000001.00000


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827AUGAGUUGUUUUCAGUUUU72.8928844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911845ATGAGTTGTTTTCAGTTTTAAAACTGAAAACAACTCAT0.045200.001800.655200.500001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986CUGUACGACCACAAGAAGA82.8287353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321004CTGTACGACCACAAGAAGATCTTCTTGTGGTCGTACAG0.194300.013800.560300.500000.929300.62500


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250CCUCGGGGACAGUGAACAA91.392893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041268CCTCGGGGACAGTGAACAATTGTTCACTGTCCCCGAGG0.118300.001400.698301.000001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669CAAAGUGGAAGCCUGUUAC71.9734896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051687CAAAGTGGAAGCCTGTTACGTAACAGGCTTCCACTTTG0.104500.016500.465500.500001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525AUGCUAACCAAGGAACUUU70.3196996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511543ATGCTAACCAAGGAACTTTAAAGTTCCTTGGTTAGCAT0.081900.006100.655200.500001.000001.00000


Target Position: 1946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1946GCAGGAGGGAAACACACUU81.2317429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171964GCAGGAGGGAAACACACTTAAGTGTGTTTCCCTCCTGC0.096800.001000.715501.000001.000001.00000


Target Position: 2102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102UAAUUAUAGCUUAGACUUU79.676492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442120TAATTATAGCTTAGACTTTAAAGTCTAAGCTATAATTA0.408000.039400.534500.500001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164GCCCAAGGAUUCUUCAUAC77.7371587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701182GCCCAAGGATTCTTCATACGTATGAAGAATCCTTGGGC0.865200.016400.819000.750001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216CACAACUUUCCUUGCAGUG65.49351260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061234CACAACTTTCCTTGCAGTGCACTGCAAGGAAAGTTGTG0.015000.016400.500000.500000.918500.62500


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472UAGAAGAAUUUGUAGGAAA87.3321190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661490TAGAAGAATTTGTAGGAAATTTCCTACAAATTCTTCTA0.227800.042100.672400.500001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745GAUGACAAGAAGCAAUACA89.8397127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911763GATGACAAGAAGCAATACATGTATTGCTTCTTGTCATC0.093200.017600.474100.500001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636UUAGAAAAAAAAGGAUUAU65.95951233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631654TTAGAAAAAAAAGGATTATATAATCCTTTTTTTTCTAA0.726100.542500.491400.500001.000001.00000


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725CUCUUUUUGAAAUGCCUGU66.07581227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681743CTCTTTTTGAAATGCCTGTACAGGCATTTCAAAAAGAG0.140900.101200.603400.500001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627CUGGAAAAAUUAGAAAAAA87.2129196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2091645CTGGAAAAATTAGAAAAAATTTTTTCTAATTTTTCCAG0.708700.197400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1625-1647TACTGGAAAAATTAGAAAAAAAAUUUUUUCUAAUUUUUCCAGUACUGGAAAAAUUAGAAAAAAAAU5.520.111


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724CCUCUUUUUGAAAUGCCUG65.55231258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221742CCTCTTTTTGAAATGCCTGCAGGCATTTCAAAAAGAGG0.158000.106100.560300.750001.000001.00000


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636UGUAAGACCAGAAUUGCAA81.5928418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461654TGTAAGACCAGAATTGCAATTGCAATTCTGGTCTTACA0.042800.003000.560300.750001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758GUUAUACUCAGACCAGUUA88.9238152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284776GTTATACTCAGACCAGTTATAACTGGTCTGAGTATAAC0.123100.054300.612100.750000.951100.75000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896AGACUCACUCCUUAAAAAA88.9175153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731914AGACTCACTCCTTAAAAAATTTTTTAAGGAGTGAGTCT0.211700.002600.724100.750001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151CCCCAGUCCAGCAGCCCAA76.5664642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1671169CCCCAGTCCAGCAGCCCAATTGGGCTGCTGGACTGGGG0.757900.042000.844801.000000.978300.62500


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131UCCCCAGUCACCCCCUUCA64.05171325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161149TCCCCAGTCACCCCCTTCATGAAGGGGGTGACTGGGGA0.677700.120800.646600.500001.000001.00000


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139CACCCCCUUCACCCCCAGU61.17711460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941157CACCCCCTTCACCCCCAGTACTGGGGGTGAAGGGGGTG0.246100.205400.586200.500001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809UGGAAGAAUAUUUUAGUCA79.4864497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871827TGGAAGAATATTTTAGTCATGACTAAAATATTCTTCCA0.056300.051700.620700.500001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252UCGGGGACAGUGAACAAUG62.17281412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421270TCGGGGACAGTGAACAATGCATTGTTCACTGTCCCCGA0.084600.003500.637900.500001.000001.00000


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948AGGAGGGAAACACACUUCA79.2758507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411966AGGAGGGAAACACACTTCATGAAGTGTGTTTCCCTCCT0.122700.005300.620700.500001.000001.00000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648GGAUUAUGAAAGGAUUUAG80.4022466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951666GGATTATGAAAGGATTTAGCTAAATCCTTTCATAATCC0.182100.183900.698300.750001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962CUUCACACAACAGGCUUAU69.29051050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971980CTTCACACAACAGGCTTATATAAGCCTGTTGTGTGAAG0.170000.021700.594800.750001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620GGCCAUACUGGAAAAAUUA93.987561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661638GGCCATACTGGAAAAATTATAATTTTTCCAGTATGGCC0.325100.016800.965501.000001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349CCAACAAUCAAGAUCAAAG78.8566531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581367CCAACAATCAAGATCAAAGCTTTGATCTTGATTGTTGG0.371100.323800.706900.750001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254GGGGACAGUGAACAAUGAU85.6853239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531272GGGGACAGTGAACAATGATATCATTGTTCACTGTCCCC0.240700.008100.810301.000001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911CACAGAACCCUGGAAUGAC73.2878821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495929CACAGAACCCTGGAATGACGTCATTCCAGGGTTCTGTG0.034700.006500.474100.500000.940200.75000


Target Position: 616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616CCUUACCCAAGUACAUAUC65.46961262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198634CCTTACCCAAGTACATATCGATATGTACTTGGGTAAGG0.290700.034200.663800.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CCCAACUCCAGUCUCUCGU61.90111429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474837CCCAACTCCAGTCTCTCGTACGAGAGACTGGAGTTGGG0.027400.011800.715500.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899CUCACUCCUUAAAAAAUUU79.778484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151917CTCACTCCTTAAAAAATTTAAATTTTTTAAGGAGTGAG0.221200.004900.810300.750001.000001.00000


Target Position: 2162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162ACAAAUAUAGUAUUAUUCU81.0096436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812180ACAAATATAGTATTATTCTAGAATAATACTATATTTGT0.868400.059900.482800.500001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074ACCACCCGGCAAUCUCUAC56.87561676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031092ACCACCCGGCAATCTCTACGTAGAGATTGCCGGGTGGT0.282300.041600.672400.500000.923900.62500


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471GUAGAAGAAUUUGUAGGAA91.677486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161489GTAGAAGAATTTGTAGGAATTCCTACAAATTCTTCTAC0.200600.038600.508600.750001.000001.00000


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089UAUACUUCAUGUGUAAUUA86.2915220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4352107TATACTTCATGTGTAATTATAATTACACATGAAGTATA0.040800.010000.508600.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AGAAGUUCCAAGUACUUAC73.8554794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349801AGAAGTTCCAAGTACTTACGTAAGTACTTGGAACTTCT0.236300.081600.543100.500001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553GAGCAGCCACCAUAUCCUA94.527656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
262571GAGCAGCCACCATATCCTATAGGATATGGTGGCTGCTC0.256400.017600.637900.750001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767AGACCAGUUACUCCACAGA83.3458328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438785AGACCAGTTACTCCACAGATCTGTGGAGTAACTGGTCT0.264600.043600.500000.500001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CCAGGAUAUCCGCCUUCAC70.3709991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476913CCAGGATATCCGCCTTCACGTGAAGGCGGATATCCTGG0.375200.002400.551700.750000.962000.62500


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GGAUAUCUACAAGCUGCUU84.5724275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841938GGATATCTACAAGCTGCTTAAGCAGCTTGTAGATATCC0.102400.006200.732801.000001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790CCAAGUACUUACCGUUCAU86.0764226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141808CCAAGTACTTACCGTTCATATGAACGGTAAGTACTTGG0.403500.128400.689701.000001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703ACACUUGAUUUGGUUAAUU75.0374729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171721ACACTTGATTTGGTTAATTAATTAACCAAATCAAGTGT0.011800.005300.698300.750001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982CCGACUGUACGACCACAAG71.8265901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091000CCGACTGTACGACCACAAGCTTGTGGTCGTACAGTCGG0.048400.008100.775900.750000.907600.62500


Target Position: 2101, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101GUAAUUAUAGCUUAGACUU84.8544263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522119GTAATTATAGCTTAGACTTAAGTCTAAGCTATAATTAC0.203500.043800.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2099-2121GTGTAATTATAGCTTAGACTTTAAAGUCUAAGCUAUAAUUACACGUAAUUAUAGCUUAGACUUUAU18.9-8.033


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269UGAUGAUUCAGAUCUUUUG71.7188911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031287TGATGATTCAGATCTTTTGCAAAAGATCTGAATCATCA0.024600.001400.577600.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CCCUUAUAUCCUCUUCGCC62.05161419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468403CCCTTATATCCTCTTCGCCGGCGAAGAGGATATAAGGG0.505500.241600.491400.500001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GUACAUUGUGACUGCUUUC74.2402773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872084GTACATTGTGACTGCTTTCGAAAGCAGTCACAATGTAC0.049800.012200.508600.500000.983700.75000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655GAAAGGAUUUAGAACAAAG85.8191234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471673GAAAGGATTTAGAACAAAGCTTTGTTCTAAATCCTTTC0.229900.062600.534500.500001.000001.00000


Target Position: 852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852GCAGGACUGUCAGACUGAA96.615932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281870GCAGGACTGTCAGACTGAATTCAGTCTGACAGTCCTGC0.274800.014500.681001.000001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096CAUGUGUAAUUAUAGCUUA98.906216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662114CATGTGTAATTATAGCTTATAAGCTATAATTACACATG0.106400.007300.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2094-2116TTCATGTGTAATTATAGCTTAGAUAAGCUAUAAUUACACAUGAACAUGUGUAAUUAUAGCUUAGAU18.320.423


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CAAUGAUGAUUCAGAUCUU96.843530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231284CAATGATGATTCAGATCTTAAGATCTGAATCATCATTG0.044700.032600.508600.750001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225CCUUGCAGUGUCCAUCAGU76.0578671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831243CCTTGCAGTGTCCATCAGTACTGATGGACACTGCAAGG0.024300.003100.637900.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GACCAGUUACUCCACAGAA95.852845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220786GACCAGTTACTCCACAGAATTCTGTGGAGTAACTGGTC0.261400.047000.646600.750001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UGUUACUAACUUGACCAAA77.9358580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571700TGTTACTAACTTGACCAAATTTGGTCAAGTTAGTAACA0.033700.004100.706900.750001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CUCCACAGAAGUUCCAAGU67.33981153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346795CTCCACAGAAGTTCCAAGTACTTGGAACTTCTGTGGAG0.163300.086800.603400.500001.000001.00000


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719AUUACCCUCUUUUUGAAAU69.33831047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311737ATTACCCTCTTTTTGAAATATTTCAAAAAGAGGGTAAT0.235200.195800.500000.500001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952GGGAAACACACUUCACACA91.599990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011970GGGAAACACACTTCACACATGTGTGAAGTGTGTTTCCC0.177800.048500.784500.750001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910UCACAGAACCCUGGAAUGA70.3491992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466928TCACAGAACCCTGGAATGATCATTCCAGGGTTCTGTGA0.030400.003900.500000.500000.907600.62500


Target Position: 657, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CCAGAGUUUGAAUUCUUAU85.854233

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_765719CCAGAGTTTGAATTCTTAT1/1/0/091.46BAG4NM_004874.21NANANA11:89923143..89923161(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247675CCAGAGTTTGAATTCTTATATAAGAATTCAAACTCTGG0.182600.020800.801701.000000.994600.62500


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960CACUUCACACAACAGGCUU77.1951608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881978CACTTCACACAACAGGCTTAAGCCTGTTGTGTGAAGTG0.380900.053100.655200.750001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768AGCUUUCCUUUGAUUUUAU81.0438434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301786AGCTTTCCTTTGATTTTATATAAAATCAAAGGAAAGCT0.154800.083400.810300.750001.000001.00000


Target Position: 2115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2115GACUUUAGCCUUCUUGGAC72.2208881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892133GACTTTAGCCTTCTTGGACGTCCAAGAAGGCTAAAGTC0.046000.008400.500000.500000.956500.62500


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365AAGUAGCAGUCUUCCUGAA90.0089126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151383AAGTAGCAGTCTTCCTGAATTCAGGAAGACTGCTACTT0.014400.005600.465500.500000.918500.75000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351AACAAUCAAGAUCAAAGUA85.0892255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041369AACAATCAAGATCAAAGTATACTTTGATCTTGATTGTT0.399600.319000.465500.500001.000001.00000


Target Position: 2103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2103AAUUAUAGCUUAGACUUUA91.499992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902121AATTATAGCTTAGACTTTATAAAGTCTAAGCTATAATT0.136800.025100.474100.500001.000001.00000


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764UUCCAGCUUUCCUUUGAUU66.13311224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911782TTCCAGCTTTCCTTTGATTAATCAAAGGAAAGCTGGAA0.164800.084900.663800.500001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983CGACUGUACGACCACAAGA90.1162122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471001CGACTGTACGACCACAAGATCTTGTGGTCGTACAGTCG0.158500.008300.569000.750000.907600.62500


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171GAUUCUUCAUACCCCUAUA100.0616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291189GATTCTTCATACCCCTATATATAGGGGTATGAAGAATC0.727800.288100.637900.750001.000001.00000


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761ACAUUCCAGCUUUCCUUUG58.04681621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441779ACATTCCAGCTTTCCTTTGCAAAGGAAAGCTGGAATGT0.160600.117400.560300.500001.000001.00000


Target Position: 2132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2132ACUUCUGUUUUGUUUUGUU79.2867506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4492150ACTTCTGTTTTGTTTTGTTAACAAAACAAAACAGAAGT0.154800.003300.560300.750001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475AAGAAUUUGUAGGAAAAAA84.8601262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381493AAGAATTTGTAGGAAAAAATTTTTTCCTACAAATTCTT0.366800.092600.637900.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UCCGAGUAUUAAAAAAAUC60.91791470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161431TCCGAGTATTAAAAAAATCGATTTTTTTAATACTCGGA0.743400.037100.689700.500001.000001.00000


Target Position: 8, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8AGGAAACUCCAUUGGAUAA88.2796168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45526AGGAAACTCCATTGGATAATTATCCAATGGAGTTTCCT0.120000.003100.810300.750000.945700.62500


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128UUGGACUUCUGUUUUGUUU64.1021324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072146TTGGACTTCTGTTTTGTTTAAACAAAACAGAAGTCCAA0.023300.001300.646600.500001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787ACUUGAAAAACUGGCAAAG60.96281466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221805ACTTGAAAAACTGGCAAAGCTTTGCCAGTTTTTCAAGT0.044700.024800.569000.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744UUAUUAUGCACCUGGUUAU72.7744852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505762TTATTATGCACCTGGTTATATAACCAGGTGCATAATAA0.015200.009500.491400.500001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144UUUUGUUAUUUGCAGUUUA78.4953550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172162TTTTGTTATTTGCAGTTTATAAACTGCAAATAACAAAA0.037200.030900.465500.500001.000001.00000


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369AGCAGUCUUCCUGAAGAAU75.7463688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161387AGCAGTCTTCCTGAAGAATATTCTTCAGGAAGACTGCT0.012500.003000.844800.750000.918500.75000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521AGAAAUGCUAACCAAGGAA84.5377277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801539AGAAATGCTAACCAAGGAATTCCTTGGTTAGCATTTCT0.060000.021800.551700.750001.000001.00000


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713UGGUUAAUUACCCUCUUUU73.5898805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371731TGGTTAATTACCCTCTTTTAAAAGAGGGTAATTAACCA0.401300.022800.844800.750000.902200.75000


Target Position: 2002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002UGGAUAUAAUCUGAGACAA86.0077230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3902020TGGATATAATCTGAGACAATTGTCTCAGATTATATCCA0.055400.047700.698300.750001.000001.00000


Target Position: 1350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350CAACAAUCAAGAUCAAAGU81.6938411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1348-1370CCCAACAATCAAGATCAAAGTAGACUUUGAUCUUGAUUGUUGGGCAACAAUCAAGAUCAAAGUAGU12.014.822


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GUGGAAGCCUGUUACUAAC75.7088691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171691GTGGAAGCCTGTTACTAACGTTAGTAACAGGCTTCCAC0.149000.040700.646600.500000.989100.62500


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GAAACUAUGGAGUUACCAA101.2085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851884GAAACTATGGAGTTACCAATTGGTAACTCCATAGTTTC0.042800.002000.525900.750000.913000.62500


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335CACCAGUGACCAUCCCAAC72.0742890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011353CACCAGTGACCATCCCAACGTTGGGATGGTCACTGGTG0.548100.079300.646600.500001.000001.00000


Target Position: 1714, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714GGUUAAUUACCCUCUUUUU89.0462150

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1171419GGTTAATTACCCTCTTTTT1/1/0/097.75BAG4NM_004874.21NANANA8:70771423..70771441(-)|8:38068069..38068087(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961732GGTTAATTACCCTCTTTTTAAAAAGAGGGTAATTAACC0.388000.034400.853401.000000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1712-1734TTGGTTAATTACCCTCTTTTTGAAAAAAGAGGGUAAUUAACCAAGGUUAAUUACCCUCUUUUUGAU10.3-0.323


Target Position: 2142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142UGUUUUGUUAUUUGCAGUU68.28771104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452160TGTTTTGTTATTTGCAGTTAACTGCAAATAACAAAACA0.081200.025800.560300.750001.000001.00000


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637GUAAGACCAGAAUUGCAAG76.3561651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488655GTAAGACCAGAATTGCAAGCTTGCAATTCTGGTCTTAC0.023200.003400.543100.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011GGCUUCUCCUGGUGCUUAU83.7133311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061029GGCTTCTCCTGGTGCTTATATAAGCACCAGGAGAAGCC0.040500.001300.956901.000001.000001.00000


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928ACCCUGCCCCAUUAUCCUU66.4381208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402946ACCCTGCCCCATTATCCTTAAGGATAATGGGGCAGGGT0.050700.049900.715500.750001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CAAGUACUUACCGUUCAUC70.621975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512809CAAGTACTTACCGTTCATCGATGAACGGTAAGTACTTG0.366500.124900.465500.500001.000001.00000


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232GUGUCCAUCAGUACGAAUC67.70681135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261250GTGTCCATCAGTACGAATCGATTCGTACTGATGGACAC0.506600.004500.612100.500000.967400.62500


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150CCCCCAGUCCAGCAGCCCA75.6222697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951168CCCCCAGTCCAGCAGCCCATGGGCTGCTGGACTGGGGG0.789700.068200.646600.750000.913000.75000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091UACUUCAUGUGUAAUUAUA86.1968223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992109TACTTCATGTGTAATTATATATAATTACACATGAAGTA0.072200.012300.637900.500001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777UUGAUUUUAUACUUGAAAA81.3881424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111795TTGATTTTATACTTGAAAATTTTCAAGTATAAAATCAA0.308900.198100.646600.500001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453CAGUAUCUUGAACAAGAAG77.7327588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871471CAGTATCTTGAACAAGAAGCTTCTTGTTCAAGATACTG0.174400.001900.646600.500000.978300.75000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705ACUUGAUUUGGUUAAUUAC72.1212885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891723ACTTGATTTGGTTAATTACGTAATTAACCAAATCAAGT0.060300.006700.525900.500001.000001.00000


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337CCAGUGACCAUCCCAACAA85.7991236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1251355CCAGTGACCATCCCAACAATTGTTGGGATGGTCACTGG0.670700.134300.698301.000001.000001.00000


Target Position: 1772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1772UUCCUUUGAUUUUAUACUU69.00821065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641790TTCCTTTGATTTTATACTTAAGTATAAAATCAAAGGAA0.336100.086300.534500.500001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654UGAAAGGAUUUAGAACAAA82.3628384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2111672TGAAAGGATTTAGAACAAATTTGTTCTAAATCCTTTCA0.164900.076800.724100.750001.000001.00000


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386AUGUGUACCUUCAGAUGAA92.151580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801404ATGTGTACCTTCAGATGAATTCATCTGAAGGTACACAT0.071800.022600.482800.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UAGACUCACUCCUUAAAAA90.3639114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851913TAGACTCACTCCTTAAAAATTTTTAAGGAGTGAGTCTA0.023400.002100.672400.500000.978300.62500


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064CGCCCUCAGCACCACCCGG56.1231703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061082CGCCCTCAGCACCACCCGGCCGGGTGGTGCTGAGGGCG0.084600.007900.508600.500000.902200.62500


Target Position: 658, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658CAGAGUUUGAAUUCUUAUA92.589275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
231676CAGAGTTTGAATTCTTATATATAAGAATTCAAACTCTG0.191500.024700.741400.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
656-678GCCAGAGTTTGAATTCTTATACAUAUAAGAAUUCAAACUCUGGCCAGAGUUUGAAUUCUUAUACAU6.917.733


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559CCACCAUAUCCUAGCUACA91.1511100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329577CCACCATATCCTAGCTACATGTAGCTAGGATATGGTGG0.091400.018600.637900.750000.940200.75000


Target Position: 1088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088UCUACAUGACUGAAAGUAC70.8274961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271106TCTACATGACTGAAAGTACGTACTTTCAGTCATGTAGA0.042800.012700.543100.500001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476AGAAUUUGUAGGAAAAAAG71.3863931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241494AGAATTTGTAGGAAAAAAGCTTTTTTCCTACAAATTCT0.425600.163400.586200.500001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773UCCUUUGAUUUUAUACUUG63.73391347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431791TCCTTTGATTTTATACTTGCAAGTATAAAATCAAAGGA0.309600.054400.724100.500001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645AGAAUUGCAAGGCCAGAGU66.2351216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500663AGAATTGCAAGGCCAGAGTACTCTGGCCTTGCAATTCT0.031000.001500.517200.500001.000001.00000


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137UGUUUUGUUUUGUUAUUUG67.6081139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3402155TGTTTTGTTTTGTTATTTGCAAATAACAAAACAAAACA0.124900.008700.560300.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634AAUUAGAAAAAAAAGGAUU74.5692753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411652AATTAGAAAAAAAAGGATTAATCCTTTTTTTTCTAATT0.781000.554400.500000.500001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127CUUGGACUUCUGUUUUGUU82.7882355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142145CTTGGACTTCTGTTTTGTTAACAAAACAGAAGTCCAAG0.012800.001700.491400.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846CAGACGAAUGAAUGUAAUA96.463135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221864CAGACGAATGAATGTAATATATTACATTCATTCGTCTG0.094100.041900.741400.750001.000001.00000


Target Position: 576, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576CAAUUCUAACUAUUGGAAU84.1239293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
574-596TACAATTCTAACTATTGGAATTCAUUCCAAUAGUUAGAAUUGUACAAUUCUAACUAUUGGAAUUCU20.16.922


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868AACUAUGGAGUUACCAAUA86.8226208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521886AACTATGGAGTTACCAATATATTGGTAACTCCATAGTT0.076200.003200.603400.500000.913000.87500


Target Position: 1993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1993AGAUGAAACUGGAUAUAAU99.212912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2882011AGATGAAACTGGATATAATATTATATCCAGTTTCATCT0.113100.013300.715500.750001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143GUUUUGUUAUUUGCAGUUU73.7018800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602161GTTTTGTTATTTGCAGTTTAAACTGCAAATAACAAAAC0.073000.040700.646600.750001.000001.00000


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GAGGGAAACACACUUCACA92.726874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351968GAGGGAAACACACTTCACATGTGAAGTGTGTTTCCCTC0.154000.016000.603400.500001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137GUCACCCCCUUCACCCCCA69.71881027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991155GTCACCCCCTTCACCCCCATGGGGGTGAAGGGGGTGAC0.445700.107800.474100.500001.000001.00000


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184CCUAUAGCCAAUCAGAUCA84.8745260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741202CCTATAGCCAATCAGATCATGATCTGATTGGCTATAGG0.377500.248100.620700.750001.000001.00000


Target Position: 2131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2131GACUUCUGUUUUGUUUUGU71.7644908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672149GACTTCTGTTTTGTTTTGTACAAAACAAAACAGAAGTC0.174100.002700.612100.500001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602CGAGAUCUAGGGCUCCUUA92.870570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450620CGAGATCTAGGGCTCCTTATAAGGAGCCCTAGATCTCG0.046800.003300.758601.000000.940200.62500


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160AGCAGCCCAAGGAUUCUUC58.08931617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701178AGCAGCCCAAGGATTCTTCGAAGAATCCTTGGGCTGCT0.029000.009700.681000.500001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072UGUGACUGCUUUCAACAUA83.2606335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162090TGTGACTGCTTTCAACATATATGTTGAAAGCAGTCACA0.110500.001000.663800.750001.000001.00000


Target Position: 549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549CCAGGAGCAGCCACCAUAU83.5564315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377567CCAGGAGCAGCCACCATATATATGGTGGCTGCTCCTGG0.241300.006700.801701.000000.934800.87500


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GAUUUAGAACAAAGUGGAA96.573633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131678GATTTAGAACAAAGTGGAATTCCACTTTGTTCTAAATC0.145600.032800.508600.750001.000001.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36AAACGUAUACUCCCUCUUA90.862103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50854AAACGTATACTCCCTCTTATAAGAGGGAGTATACGTTT0.105800.041900.465500.500001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GGAAUGACCCUGCCCCAUU78.1953562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419940GGAATGACCCTGCCCCATTAATGGGGCAGGGTCATTCC0.139300.004800.862101.000000.978300.62500


Target Position: 660, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GAGUUUGAAUUCUUAUACA99.405511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434678GAGTTTGAATTCTTATACATGTATAAGAATTCAAACTC0.231300.035600.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
658-680CAGAGTTTGAATTCTTATACAAAUGUAUAAGAAUUCAAACUCUGGAGUUUGAAUUCUUAUACAAAU6.319.232


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CAUAUCCUAGCUACAAUUC69.21671057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487581CATATCCTAGCTACAATTCGAATTGTAGCTAGGATATG0.079200.051000.482800.500001.000001.00000


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37AACGUAUACUCCCUCUUAA91.291598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44855AACGTATACTCCCTCTTAATTAAGAGGGAGTATACGTT0.061000.025300.612100.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CCAGCAGCCCAAGGAUUCU70.8118962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941176CCAGCAGCCCAAGGATTCTAGAATCCTTGGGCTGCTGG0.020200.008500.620700.750001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381UCCACCCUUAUAUCCUCUU59.77151535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171399TCCACCCTTATATCCTCTTAAGAGGATATAAGGGTGGA0.634200.169200.732800.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GCCUUCAUCAGCGCCCUCA72.9518841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341071GCCTTCATCAGCGCCCTCATGAGGGCGCTGATGAAGGC0.041600.008900.775900.750000.929300.62500


Target Position: 1273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273GAUUCAGAUCUUUUGGAUU89.2501145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1271-1293ATGATTCAGATCTTTTGGATTCCAAUCCAAAAGAUCUGAAUCAUGAUUCAGAUCUUUUGGAUUCCU20.120.412


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816CAGCCCAACUCCAGUCUCU80.0717480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504834CAGCCCAACTCCAGTCTCTAGAGACTGGAGTTGGGCTG0.154000.007800.560300.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210AACCGGCACAACUUUCCUU71.8373900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211228AACCGGCACAACTTTCCTTAAGGAAAGTTGTGCCGGTT0.455900.047600.508600.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075GACUGCUUUCAACAUAUAC76.6558637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262093GACTGCTTTCAACATATACGTATATGTTGAAAGCAGTC0.106500.070200.637900.500001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132CCCCAGUCACCCCCUUCAC58.44091600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221150CCCCAGTCACCCCCTTCACGTGAAGGGGGTGACTGGGG0.662300.134300.698300.750001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043GUUAUCCCUGGCCUUCAUC59.55381546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061061GTTATCCCTGGCCTTCATCGATGAAGGCCAGGGATAAC0.017000.002400.465500.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853CAGGACUGUCAGACUGAAG76.3632649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383871CAGGACTGTCAGACTGAAGCTTCAGTCTGACAGTCCTG0.232700.013700.646600.500001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GCUUCUCCUGGUGCUUAUG66.88941187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981030GCTTCTCCTGGTGCTTATGCATAAGCACCAGGAGAAGC0.018100.001600.698300.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655GGCCAGAGUUUGAAUUCUU88.7115159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308673GGCCAGAGTTTGAATTCTTAAGAATTCAAACTCTGGCC0.098700.015000.862101.000000.994600.62500


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001CUGGAUAUAAUCUGAGACA87.7377181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982019CTGGATATAATCTGAGACATGTCTCAGATTATATCCAG0.052400.010500.577600.500001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153CCAGUCCAGCAGCCCAAGG52.81991828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101171CCAGTCCAGCAGCCCAAGGCCTTGGGCTGCTGGACTGG0.013900.008100.500000.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211ACCGGCACAACUUUCCUUG54.95261754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041229ACCGGCACAACTTTCCTTGCAAGGAAAGTTGTGCCGGT0.453000.052200.706900.500001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621GCCAUACUGGAAAAAUUAG73.2643823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1191639GCCATACTGGAAAAATTAGCTAATTTTTCCAGTATGGC0.675600.062800.827600.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CAGAAAAGAGGCUGUUUGU80.6425448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613GCCAGAAAAGAGGCTGTTTGTAAACAAACAGCCUCUUUUCUGGCCAGAAAAGAGGCUGUUUGUAAU16.710.322


Target Position: 652, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652CAAGGCCAGAGUUUGAAUU76.2114664

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_665219CAAGGCCAGAGTTTGAATT1/1/0/091.46BAG4NM_004874.21NANANA8:38050305,38065030..38050313,38065039(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430670CAAGGCCAGAGTTTGAATTAATTCAAACTCTGGCCTTG0.068400.004300.637900.750001.000001.00000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924AUCUACAAGCUGCUUCUUA80.4275463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571942ATCTACAAGCTGCTTCTTATAAGAAGCAGCTTGTAGAT0.053900.003100.646600.500001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352ACAAUCAAGAUCAAAGUAG65.8081241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661370ACAATCAAGATCAAAGTAGCTACTTTGATCTTGATTGT0.557700.239700.534500.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723CCCUCUUUUUGAAAUGCCU74.2717772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421741CCCTCTTTTTGAAATGCCTAGGCATTTCAAAAAGAGGG0.148100.127100.646600.750001.000001.00000


Target Position: 1718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718AAUUACCCUCUUUUUGAAA79.9901481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041736AATTACCCTCTTTTTGAAATTTCAAAAAGAGGGTAATT0.338800.248400.508600.500001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626ACUGGAAAAAUUAGAAAAA83.8659305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041644ACTGGAAAAATTAGAAAAATTTTTCTAATTTTTCCAGT0.676300.141500.706900.750001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412CCCCAGCCUCCCAUUUCCU65.4371264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313430CCCCAGCCTCCCATTTCCTAGGAAATGGGAGGCTGGGG0.183500.010900.646600.750001.000001.00000


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647AGGAUUAUGAAAGGAUUUA80.3022469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1851665AGGATTATGAAAGGATTTATAAATCCTTTCATAATCCT0.190800.193300.810300.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224UCCUUGCAGUGUCCAUCAG60.68991479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021242TCCTTGCAGTGTCCATCAGCTGATGGACACTGCAAGGA0.016200.003200.586200.500001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155GCAGUUUACAAAUAUAGUA95.431949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632173GCAGTTTACAAATATAGTATACTATATTTGTAAACTGC0.070700.010800.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2153-2175TTGCAGTTTACAAATATAGTATTUACUAUAUUUGUAAACUGCAAGCAGUUUACAAAUAUAGUAUUU6.111.810


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645AAAGGAUUAUGAAAGGAUU83.5487317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691663AAAGGATTATGAAAGGATTAATCCTTTCATAATCCTTT0.291300.271500.491400.500001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469CUGGGAGAAGGCGGAGGAG59.55351547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500487CTGGGAGAAGGCGGAGGAGCTCCTCCGCCTTCTCCCAG0.025700.004500.474100.500001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639GAAAAAAAAGGAUUAUGAA98.659217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431657GAAAAAAAAGGATTATGAATTCATAATCCTTTTTTTTC0.684300.575800.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1637-1659TAGAAAAAAAAGGATTATGAAAGUUCAUAAUCCUUUUUUUUCUAGAAAAAAAAGGAUUAUGAAAGU8.7-11.311


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613GCUCCUUACCCAAGUACAU83.8572306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203631GCTCCTTACCCAAGTACATATGTACTTGGGTAAGGAGC0.405900.032500.698301.000001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141CCCCCUUCACCCCCAGUCC49.28331929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091159CCCCCTTCACCCCCAGTCCGGACTGGGGGTGAAGGGGG0.230900.185000.620700.500001.000001.00000


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140ACCCCCUUCACCCCCAGUC43.23442052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941158ACCCCCTTCACCCCCAGTCGACTGGGGGTGAAGGGGGT0.232300.193100.534500.500001.000001.00000


Target Position: 1701, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701GAACACUUGAUUUGGUUAA86.1386225

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9170119GAACACTTGATTTGGTTAA1/1/0/091.46BAG4NM_004874.21NANANA8:38068056..38068074(+)|8:70771436..70771454(-)00BAG4(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1699-1721AAGAACACTTGATTTGGTTAATTUUAACCAAAUCAAGUGUUCUUGAACACUUGAUUUGGUUAAUUU20.017.823


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828UGAGUUGUUUUCAGUUUUC63.99631328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141846TGAGTTGTTTTCAGTTTTCGAAAACTGAAAACAACTCA0.041700.001100.551700.500001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416GAGUAUUAAAAAAAUCAUA97.327826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1091434GAGTATTAAAAAAATCATATATGATTTTTTTAATACTC0.698600.070200.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1414-1436CCGAGTATTAAAAAAATCATACAUAUGAUUUUUUUAAUACUCGGGAGUAUUAAAAAAAUCAUACAU7.26.312


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130CUCCCCAGUCACCCCCUUC55.77261717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681148CTCCCCAGTCACCCCCTTCGAAGGGGGTGACTGGGGAG0.249600.107300.637900.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UGGUAAUCGUAGUGUUCCA85.3909247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515972TGGTAATCGTAGTGTTCCATGGAACACTACGATTACCA0.013400.007100.500000.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781ACAGAAGUUCCAAGUACUU78.1758564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320799ACAGAAGTTCCAAGTACTTAAGTACTTGGAACTTCTGT0.218800.067000.569000.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080CUUUCAACAUAUACUUCAU90.7109107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842098CTTTCAACATATACTTCATATGAAGTATATGTTGAAAG0.051400.019400.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2078-2100TGCTTTCAACATATACTTCATGTAUGAAGUAUAUGUUGAAAGCACUUUCAACAUAUACUUCAUGUU20.314.932


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056UCACAUUUUUGUACAUUGU70.4009989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3912074TCACATTTTTGTACATTGTACAATGTACAAAAATGTGA0.076400.013100.517200.500000.983700.62500


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690UGGUCCAACAUACCCCCCA65.00731280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469708TGGTCCAACATACCCCCCATGGGGGGTATGTTGGACCA0.030000.002700.500000.500000.923900.62500


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185CUAUAGCCAAUCAGAUCAA90.4441112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821203CTATAGCCAATCAGATCAATTGATCTGATTGGCTATAG0.373900.236800.525900.750001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CCUCCCCAGCCUCCCAUUU62.54451393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221427CCTCCCCAGCCTCCCATTTAAATGGGAGGCTGGGGAGG0.277200.026900.844801.000001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348GCCUGGGGGUGGAGAUGUG70.6941969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415366GCCTGGGGGTGGAGATGTGCACATCTCCACCCCCAGGC0.046100.016000.706900.750001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GGUUAUACUCAGACCAGUU93.803863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279775GGTTATACTCAGACCAGTTAACTGGTCTGAGTATAACC0.114400.050700.706901.000000.951100.62500


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206CAUGAACCGGCACAACUUU79.5112495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471224CATGAACCGGCACAACTTTAAAGTTGTGCCGGTTCATG0.402400.031300.655200.750001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810GGAAGAAUAUUUUAGUCAU97.449324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841828GGAAGAATATTTTAGTCATATGACTAAAATATTCTTCC0.058700.044200.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1808-1830ATGGAAGAATATTTTAGTCATGAAUGACUAAAAUAUUCUUCCAUGGAAGAAUAUUUUAGUCAUGAU20.314.822


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CUGGCAAAGGAAUGGAAGA78.9948525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261815CTGGCAAAGGAATGGAAGATCTTCCATTCCTTTGCCAG0.096700.005400.560300.500001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182GACCCCCUUCGCUGCUCUC63.1381373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400200GACCCCCTTCGCTGCTCTCGAGAGCAGCGAAGGGGGTC0.138800.017100.508600.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625UACUGGAAAAAUUAGAAAA83.2978330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251643TACTGGAAAAATTAGAAAATTTTCTAATTTTTCCAGTA0.674000.111600.681000.500001.000001.00000


Target Position: 1477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477GAAUUUGUAGGAAAAAAGA89.3211141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1475-1497AAGAATTTGTAGGAAAAAAGACAUCUUUUUUCCUACAAAUUCUUGAAUUUGUAGGAAAAAAGACAU-5.95.322


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867AAACUAUGGAGUUACCAAU82.7277357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021885AAACTATGGAGTTACCAATATTGGTAACTCCATAGTTT0.057200.002400.491400.500000.913000.75000


Target Position: 2148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148GUUAUUUGCAGUUUACAAA88.8829155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2146-2168TTGTTATTTGCAGTTTACAAATAUUUGUAAACUGCAAAUAACAAGUUAUUUGCAGUUUACAAAUAU7.2-1.422


Target Position: 2079, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079GCUUUCAACAUAUACUUCA87.0121202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3762097GCTTTCAACATATACTTCATGAAGTATATGTTGAAAGC0.060400.026300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2077-2099CTGCTTTCAACATATACTTCATGUGAAGUAUAUGUUGAAAGCAGGCUUUCAACAUAUACUUCAUGU14.512.222


Target Position: 1874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874GGAGUUACCAAUAUUGCCA88.6009164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771892GGAGTTACCAATATTGCCATGGCAATATTGGTAACTCC0.266800.034200.525900.750001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776UUUGAUUUUAUACUUGAAA71.9824894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451794TTTGATTTTATACTTGAAATTTCAAGTATAAAATCAAA0.332500.037700.500000.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778UCCACAGAAGUUCCAAGUA76.3139653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191796TCCACAGAAGTTCCAAGTATACTTGGAACTTCTGTGGA0.184100.078100.689700.750001.000001.00000


Target Position: 186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186CCCUUCGCUGCUCUCCAUU66.94411183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83204CCCTTCGCTGCTCTCCATTAATGGAGAGCAGCGAAGGG0.447000.090500.982801.000001.000001.00000


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CAGAAUUGCAAGGCCAGAG66.64561199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498662CAGAATTGCAAGGCCAGAGCTCTGGCCTTGCAATTCTG0.037100.001600.474100.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789UCCAAGUACUUACCGUUCA71.3415932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287807TCCAAGTACTTACCGTTCATGAACGGTAAGTACTTGGA0.429700.119800.646600.500001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894UCCAGGAUAUCCGCCUUCA70.16631000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474912TCCAGGATATCCGCCTTCATGAAGGCGGATATCCTGGA0.364200.002500.646600.500000.962000.75000


Target Position: 1850, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850CGAAUGAAUGUAAUAGGAA95.89843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911868CGAATGAATGTAATAGGAATTCCTATTACATTCATTCG0.022500.005900.620701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1848-1870GACGAATGAATGTAATAGGAAACUUCCUAUUACAUUCAUUCGUCCGAAUGAAUGUAAUAGGAAACU19.916.322


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128CUCUCCCCAGUCACCCCCU60.33231505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071146CTCTCCCCAGTCACCCCCTAGGGGGTGACTGGGGAGAG0.184500.076700.465500.500001.000001.00000


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088AUAUACUUCAUGUGUAAUU74.5807752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822106ATATACTTCATGTGTAATTAATTACACATGAAGTATAT0.029900.008000.534500.500001.000001.00000


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144CCUUCACCCCCAGUCCAGC54.79311761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861162CCTTCACCCCCAGTCCAGCGCTGGACTGGGGGTGAAGG0.193400.168700.491400.500000.978300.62500


Target Position: 2004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2004GAUAUAAUCUGAGACAAAC81.956405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982022GATATAATCTGAGACAAACGTTTGTCTCAGATTATATC0.032200.004300.534500.500001.000001.00000


Target Position: 2160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160UUACAAAUAUAGUAUUAUU85.4528245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3802178TTACAAATATAGTATTATTAATAATACTATATTTGTAA0.309800.029300.525900.500001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548ACCAGGAGCAGCCACCAUA80.6112452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335566ACCAGGAGCAGCCACCATATATGGTGGCTGCTCCTGGT0.447900.009100.810300.750000.934800.87500


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CUCCACCCUUAUAUCCUCU73.0154837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299398CTCCACCCTTATATCCTCTAGAGGATATAAGGGTGGAG0.698400.169700.586200.500001.000001.00000


Target Position: 2130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130GGACUUCUGUUUUGUUUUG74.8648734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862148GGACTTCTGTTTTGTTTTGCAAAACAAAACAGAAGTCC0.086100.001900.724100.750001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767CAGCUUUCCUUUGAUUUUA85.6273242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271785CAGCTTTCCTTTGATTTTATAAAATCAAAGGAAAGCTG0.156200.090400.750000.750001.000001.00000


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134UUCUGUUUUGUUUUGUUAU67.70621136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4412152TTCTGTTTTGTTTTGTTATATAACAAAACAAAACAGAA0.179500.003500.629300.500001.000001.00000


Target Position: 851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851AGCAGGACUGUCAGACUGA84.7522265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316869AGCAGGACTGTCAGACTGATCAGTCTGACAGTCCTGCT0.270900.010700.629300.500001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374ACCCACCUCCACCCUUAUA73.4724810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255392ACCCACCTCCACCCTTATATATAAGGGTGGAGGTGGGT0.313000.126800.810300.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687CUAACUUGACCAAAGAACA86.5627216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131705CTAACTTGACCAAAGAACATGTTCTTTGGTCAAGTTAG0.045800.005400.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1685-1707TACTAACTTGACCAAAGAACACTUGUUCUUUGGUCAAGUUAGUACUAACUUGACCAAAGAACACUU13.311.823


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411CCUCCGAGUAUUAAAAAAA89.455139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141429CCTCCGAGTATTAAAAAAATTTTTTTAATACTCGGAGG0.452200.028800.844801.000001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942UCCUUAUGGAGAUGGUAAU71.2315938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476960TCCTTATGGAGATGGTAATATTACCATCTCCATAAGGA0.027300.005400.862100.750000.934800.62500


Target Position: 1474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474GAAGAAUUUGUAGGAAAAA90.124121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641492GAAGAATTTGTAGGAAAAATTTTTCCTACAAATTCTTC0.363500.054100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1472-1494TAGAAGAATTTGTAGGAAAAAAGUUUUUCCUACAAAUUCUUCUAGAAGAAUUUGUAGGAAAAAAGU18.75.311


Target Position: 1629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629GGAAAAAUUAGAAAAAAAA95.32451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91647GGAAAAATTAGAAAAAAAATTTTTTTTCTAATTTTTCC0.739200.618900.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1627-1649CTGGAAAAATTAGAAAAAAAAGGUUUUUUUUCUAAUUUUUCCAGGGAAAAAUUAGAAAAAAAAGGU-11.30.422


Target Position: 57, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
57GAACACGGUGUCUUCCUUC72.4356872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44075GAACACGGTGTCTTCCTTCGAAGGAAGACACCGTGTTC0.105500.007000.500000.500000.956500.62500


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097CUGAAAGUACUUCACCAUG70.6695970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171115CTGAAAGTACTTCACCATGCATGGTGAAGTACTTTCAG0.043200.009800.629300.500000.972800.62500


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512GCUUCUGGAAGAAAUGCUA90.3475115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321530GCTTCTGGAAGAAATGCTATAGCATTTCTTCCAGAAGC0.299400.004300.681001.000000.989100.62500


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925UCUACAAGCUGCUUCUUAC72.8147849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851943TCTACAAGCTGCTTCTTACGTAAGAAGCAGCTTGTAGA0.298500.002600.543100.500001.000001.00000


Target Position: 1836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1836UUUCAGUUUUCAGACGAAU65.5891257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711854TTTCAGTTTTCAGACGAATATTCGTCTGAAAACTGAAA0.109500.003200.491400.500001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CUAACUAUUGGAAUUCUAC75.6566696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512599CTAACTATTGGAATTCTACGTAGAATTCCAATAGTTAG0.020200.001500.491400.500001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078CCCGGCAAUCUCUACAUGA82.2022390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3171096CCCGGCAATCTCTACATGATCATGTAGAGATTGCCGGG0.098400.010700.767200.750001.000001.00000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GGACAGUGAACAAUGAUGA92.388577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651274GGACAGTGAACAATGATGATCATCATTGTTCACTGTCC0.209600.017100.646600.750001.000001.00000


Target Position: 40, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
40GUAUACUCCCUCUUAAGGA83.51321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
38-60ACGTATACTCCCTCTTAAGGAACUCCUUAAGAGGGAGUAUACGUGUAUACUCCCUCUUAAGGAACU15.815.830


Target Position: 1628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628UGGAAAAAUUAGAAAAAAA89.2469146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1291646TGGAAAAATTAGAAAAAAATTTTTTTCTAATTTTTCCA0.720300.332800.844800.750001.000001.00000


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375CCCACCUCCACCCUUAUAU70.3813990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82393CCCACCTCCACCCTTATATATATAAGGGTGGAGGTGGG0.386900.144800.948301.000001.000001.00000


Target Position: 1820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820UUUAGUCAUGAGUUGUUUU71.1913942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991838TTTAGTCATGAGTTGTTTTAAAACAACTCATGACTAAA0.035200.001600.500000.500001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054CCUUCAUCAGCGCCCUCAG68.58771090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991072CCTTCATCAGCGCCCTCAGCTGAGGGCGCTGATGAAGG0.051700.005700.560300.750001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919UGGAUAUCUACAAGCUGCU69.24841055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761937TGGATATCTACAAGCTGCTAGCAGCTTGTAGATATCCA0.117800.003000.491400.500001.000001.00000


Target Position: 1947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947CAGGAGGGAAACACACUUC71.2208939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811965CAGGAGGGAAACACACTTCGAAGTGTGTTTCCCTCCTG0.105800.002200.612100.500001.000001.00000


Target Position: 1741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1741UGUUGAUGACAAGAAGCAA87.5668183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431759TGTTGATGACAAGAAGCAATTGCTTCTTGTCATCAACA0.037500.006300.560300.750001.000001.00000


Target Position: 1851, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851GAAUGAAUGUAAUAGGAAA106.8531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081869GAATGAATGTAATAGGAAATTTCCTATTACATTCATTC0.014400.004200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1849-1871ACGAATGAATGTAATAGGAAACTUUUCCUAUUACAUUCAUUCGUGAAUGAAUGUAAUAGGAAACUU19.97.222


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869ACUAUGGAGUUACCAAUAU78.6653545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011887ACTATGGAGTTACCAATATATATTGGTAACTCCATAGT0.099400.005400.663800.750000.913001.00000


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GUGGGGAGCGGGGCGGGAA68.53711095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268260GTGGGGAGCGGGGCGGGAATTCCCGCCCCGCTCCCCAC0.251600.027600.620700.750001.000001.00000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765UCCAGCUUUCCUUUGAUUU62.16561413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2261783TCCAGCTTTCCTTTGATTTAAATCAAAGGAAAGCTGGA0.166100.078500.870700.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414CCGAGUAUUAAAAAAAUCA86.9261206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981432CCGAGTATTAAAAAAATCATGATTTTTTTAATACTCGG0.709300.044700.689700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1412-1434CTCCGAGTATTAAAAAAATCATAUGAUUUUUUUAAUACUCGGAGCCGAGUAUUAAAAAAAUCAUAU0.420.922


Target Position: 2027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027UGUGUUUUUUUAAACAUCU71.8127902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5112045TGTGTTTTTTTAAACATCTAGATGTTTAAAAAAACACA0.135100.024900.482800.500000.940200.62500


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257GACAGUGAACAAUGAUGAU92.03581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541275GACAGTGAACAATGATGATATCATCATTGTTCACTGTC0.140700.018800.637900.750001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CUCCCCAGCCUCCCAUUUC55.15051739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439428CTCCCCAGCCTCCCATTTCGAAATGGGAGGCTGGGGAG0.259500.022100.637900.500001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905CCUUAAAAAAUUUAUGGAU82.1898391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191923CCTTAAAAAATTTATGGATATCCATAAATTTTTTAAGG0.094500.043300.663801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1903-1925CTCCTTAAAAAATTTATGGATATAUCCAUAAAUUUUUUAAGGAGCCUUAAAAAAUUUAUGGAUAUU21.2-3.822


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961ACUUCACACAACAGGCUUA86.6291213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571979ACTTCACACAACAGGCTTATAAGCCTGTTGTGTGAAGT0.378500.060200.672400.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780CACAGAAGUUCCAAGUACU90.0171124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446798CACAGAAGTTCCAAGTACTAGTACTTGGAACTTCTGTG0.204700.070200.586200.500001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267AAUGAUGAUUCAGAUCUUU79.6913490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901285AATGATGATTCAGATCTTTAAAGATCTGAATCATCATT0.075500.017900.508600.500001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102AGUACUUCACCAUGGCCUA85.0699256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291120AGTACTTCACCATGGCCTATAGGCCATGGTGAAGTACT0.042700.018300.534500.750001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643CCAGAAUUGCAAGGCCAGA76.2672659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515661CCAGAATTGCAAGGCCAGATCTGGCCTTGCAATTCTGG0.023500.001000.620700.750001.000001.00000


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473AGAAGAAUUUGUAGGAAAA94.350657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1551491AGAAGAATTTGTAGGAAAATTTTCCTACAAATTCTTCT0.244800.047400.724100.750001.000001.00000


Target Position: 731, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CAUACUCAGGGGCUUAUUA91.902683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
729-751CTCATACTCAGGGGCTTATTATGUAAUAAGCCCCUGAGUAUGAGCAUACUCAGGGGCUUAUUAUGU13.620.332


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107GACCUCCGUCCCUCAGCUU75.4951705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494125GACCTCCGTCCCTCAGCTTAAGCTGAGGGACGGAGGTC0.056100.001700.681000.750000.923900.62500


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945AGCAGGAGGGAAACACACU74.5289758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141963AGCAGGAGGGAAACACACTAGTGTGTTTCCCTCCTGCT0.092300.001700.646600.500001.000001.00000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898ACUCACUCCUUAAAAAAUU73.7782798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651916ACTCACTCCTTAAAAAATTAATTTTTTAAGGAGTGAGT0.214100.002900.698300.750001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594AGAAAAGAGGCUGUUUGUA82.1616393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121612AGAAAAGAGGCTGTTTGTATACAAACAGCCTCTTTTCT0.013400.003300.543100.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779CCACAGAAGUUCCAAGUAC75.8128685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200797CCACAGAAGTTCCAAGTACGTACTTGGAACTTCTGTGG0.178500.073600.663800.750001.000001.00000


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394CCUCUUCGCCCUGAACCUC59.29481556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363412CCTCTTCGCCCTGAACCTCGAGGTTCAGGGCGAAGAGG0.125900.116600.534500.750001.000001.00000


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095UCAUGUGUAAUUAUAGCUU74.4921759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3332113TCATGTGTAATTATAGCTTAAGCTATAATTACACATGA0.150200.009100.586200.750001.000001.00000


Target Position: 1087, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087CUCUACAUGACUGAAAGUA81.8201409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1085-1107ATCTCTACATGACTGAAAGTACTUACUUUCAGUCAUGUAGAGAUCUCUACAUGACUGAAAGUACUU19.220.332


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092ACUUCAUGUGUAAUUAUAG77.2848606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142110ACTTCATGTGTAATTATAGCTATAATTACACATGAAGT0.117400.007500.534500.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921GAUAUCUACAAGCUGCUUC70.00481011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281939GATATCTACAAGCTGCTTCGAAGCAGCTTGTAGATATC0.089000.006200.508600.500001.000001.00000


Target Position: 1504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504GCAUACUGGCUUCUGGAAG68.04841113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121522GCATACTGGCTTCTGGAAGCTTCCAGAAGCCAGTATGC0.034700.001100.715500.750001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967CACAACAGGCUUAUCAGAA89.8171129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841985CACAACAGGCTTATCAGAATTCTGATAAGCCTGTTGTG0.110900.072000.620700.750001.000001.00000


Target Position: 2123, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123CCUUCUUGGACUUCUGUUU77.0382613

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2121-2143AGCCTTCTTGGACTTCTGTTTTGAAACAGAAGUCCAAGAAGGCUCCUUCUUGGACUUCUGUUUUGU19.216.621


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CCACCUCCACCCUUAUAUC72.8228848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206394CCACCTCCACCCTTATATCGATATAAGGGTGGAGGTGG0.436100.159500.663800.750001.000001.00000


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930CCUGCCCCAUUAUCCUUAU75.8404683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486948CCTGCCCCATTATCCTTATATAAGGATAATGGGGCAGG0.023300.023800.801701.000001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651GCAAGGCCAGAGUUUGAAU83.8532307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436669GCAAGGCCAGAGTTTGAATATTCAAACTCTGGCCTTGC0.058900.004200.844801.000001.000001.00000


Target Position: 1855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GAAUGUAAUAGGAAACUAU98.944615

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1853-1875ATGAATGTAATAGGAAACTATGGAUAGUUUCCUAUUACAUUCAUGAAUGUAAUAGGAAACUAUGGU14.66.932


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766CAGACCAGUUACUCCACAG79.7109489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428784CAGACCAGTTACTCCACAGCTGTGGAGTAACTGGTCTG0.426700.061800.500000.500000.978300.62500


Target Position: 2065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065UGUACAUUGUGACUGCUUU79.2747508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202083TGTACATTGTGACTGCTTTAAAGCAGTCACAATGTACA0.044800.010200.706900.750000.983700.75000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617UCAGGCCAUACUGGAAAAA67.1971165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311635TCAGGCCATACTGGAAAAATTTTTCCAGTATGGCCTGA0.104200.004300.724100.750000.929300.62500


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965CACACAACAGGCUUAUCAG81.5646419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051983CACACAACAGGCTTATCAGCTGATAAGCCTGTTGTGTG0.131600.098000.508600.500001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GGCAAAGGAAUGGAAGAAU78.8702530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701817GGCAAAGGAATGGAAGAATATTCTTCCATTCCTTTGCC0.163400.007000.991401.000001.000001.00000


Target Position: 1747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747UGACAAGAAGCAAUACAUU80.7934442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481765TGACAAGAAGCAATACATTAATGTATTGCTTCTTGTCA0.507400.020700.715500.750001.000001.00000


Target Position: 1236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236CCAUCAGUACGAAUCCUCG75.1861720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751254CCATCAGTACGAATCCTCGCGAGGATTCGTACTGATGG0.027300.021000.551700.500000.983700.62500


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806GAAUGGAAGAAUAUUUUAG82.3374385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321824GAATGGAAGAATATTTTAGCTAAAATATTCTTCCATTC0.090500.058300.500000.500001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630GAAAAAUUAGAAAAAAAAG77.5758593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621648GAAAAATTAGAAAAAAAAGCTTTTTTTTCTAATTTTTC0.720200.583200.534500.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681CUGUUACUAACUUGACCAA88.8942154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551699CTGTTACTAACTTGACCAATTGGTCAAGTTAGTAACAG0.034100.004500.637900.750001.000001.00000


Target Position: 7, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7GAGGAAACUCCAUUGGAUA96.313538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46625GAGGAAACTCCATTGGATATATCCAATGGAGTTTCCTC0.096100.002900.767200.750000.945700.75000


Target Position: 1263, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263GAACAAUGAUGAUUCAGAU100.0077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771281GAACAATGATGATTCAGATATCTGAATCATCATTGTTC0.050500.038600.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1261-1283GTGAACAATGATGATTCAGATCTAUCUGAAUCAUCAUUGUUCACGAACAAUGAUGAUUCAGAUCUU20.412.123


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612GGCUCCUUACCCAAGUACA87.3102191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270630GGCTCCTTACCCAAGTACATGTACTTGGGTAAGGAGCC0.145000.027700.793100.750000.967400.62500


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CGGGGACAGUGAACAAUGA91.611989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271271CGGGGACAGTGAACAATGATCATTGTTCACTGTCCCCG0.233500.004500.689700.750001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614CUCCUUACCCAAGUACAUA85.6474241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184632CTCCTTACCCAAGTACATATATGTACTTGGGTAAGGAG0.413700.038200.767200.750001.000001.00000


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454AGUAUCUUGAACAAGAAGU69.67631031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061472AGTATCTTGAACAAGAAGTACTTCTTGTTCAAGATACT0.159100.003200.500000.500000.978300.87500


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103GUACUUCACCAUGGCCUAG67.73021131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491121GTACTTCACCATGGCCTAGCTAGGCCATGGTGAAGTAC0.036600.016700.508600.500001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743UUGAUGACAAGAAGCAAUA74.6474750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191761TTGATGACAAGAAGCAATATATTGCTTCTTGTCATCAA0.045100.013000.603400.500001.000001.00000


Target Position: 2046, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2046GGAUAUCUUGUCACAUUUU91.298797

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2044-2066CTGGATATCTTGTCACATTTTTGAAAAUGUGACAAGAUAUCCAGGGAUAUCUUGUCACAUUUUUGU12.115.922


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486GGAAAAAAGACAGACAAAG73.8393796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041504GGAAAAAAGACAGACAAAGCTTTGTCTGTCTTTTTTCC0.016000.010600.732800.750001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774CCUUUGAUUUUAUACUUGA89.3269140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651792CCTTTGATTTTATACTTGATCAAGTATAAAATCAAAGG0.431900.047500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1772-1794TTCCTTTGATTTTATACTTGAAAUCAAGUAUAAAAUCAAAGGAACCUUUGAUUUUAUACUUGAAAU11.612.022


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098UGUGUAAUUAUAGCUUAGA75.7631687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822116TGTGTAATTATAGCTTAGATCTAAGCTATAATTACACA0.058900.008800.482800.500001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985ACUGUACGACCACAAGAAG69.53991042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321003ACTGTACGACCACAAGAAGCTTCTTGTGGTCGTACAGT0.192700.009200.569000.500000.907600.62500


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184CCCCCUUCGCUGCUCUCCA73.6273802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250202CCCCCTTCGCTGCTCTCCATGGAGAGCAGCGAAGGGGG0.142700.055800.646600.750001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076CACCCGGCAAUCUCUACAU79.7553487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491094CACCCGGCAATCTCTACATATGTAGAGATTGCCGGGTG0.161600.020500.637900.750001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336ACCAGUGACCAUCCCAACA76.3108654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641354ACCAGTGACCATCCCAACATGTTGGGATGGTCACTGGT0.578000.103200.646600.500001.000001.00000


Target Position: 1726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1726UCUUUUUGAAAUGCCUGUU60.10641516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151744TCTTTTTGAAATGCCTGTTAACAGGCATTTCAAAAAGA0.127600.089800.577600.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CAUACUGGAAAAAUUAGAA94.076958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881641CATACTGGAAAAATTAGAATTCTAATTTTTCCAGTATG0.676100.085800.482800.750001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690ACUUGACCAAAGAACACUU79.4194499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461708ACTTGACCAAAGAACACTTAAGTGTTCTTTGGTCAAGT0.582800.003300.569000.750001.000001.00000


Target Position: 1748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1748GACAAGAAGCAAUACAUUC77.6381592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051766GACAAGAAGCAATACATTCGAATGTATTGCTTCTTGTC0.647100.023100.646600.500001.000001.00000


Target Position: 2028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028GUGUUUUUUUAAACAUCUG72.3016878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4032046GTGTTTTTTTAAACATCTGCAGATGTTTAAAAAAACAC0.099900.028000.508600.500000.940200.62500


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205GCAUGAACCGGCACAACUU87.3713189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041223GCATGAACCGGCACAACTTAAGTTGTGCCGGTTCATGC0.101800.026300.715501.000001.000001.00000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372ACACCCACCUCCACCCUUA80.5158460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160390ACACCCACCTCCACCCTTATAAGGGTGGAGGTGGGTGT0.247800.094200.672400.750001.000001.00000


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058ACAUUUUUGUACAUUGUGA84.409281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832076ACATTTTTGTACATTGTGATCACAATGTACAAAAATGT0.092300.028100.482800.500001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076ACUGCUUUCAACAUAUACU77.2956605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672094ACTGCTTTCAACATATACTAGTATATGTTGAAAGCAGT0.093600.055900.500000.500001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615UCCUUACCCAAGUACAUAU76.1638667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246633TCCTTACCCAAGTACATATATATGTACTTGGGTAAGGA0.413300.051900.827600.750001.000001.00000


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804AGGAAUGGAAGAAUAUUUU78.0533572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481822AGGAATGGAAGAATATTTTAAAATATTCTTCCATTCCT0.159300.026700.844800.750001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133CUUCUGUUUUGUUUUGUUA87.5011185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642151CTTCTGTTTTGTTTTGTTATAACAAAACAAAACAGAAG0.153800.002900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2131-2153GACTTCTGTTTTGTTTTGTTATTUAACAAAACAAAACAGAAGUCCUUCUGUUUUGUUUUGUUAUUU5.619.210


Target Position: 2025, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025GAUGUGUUUUUUUAAACAU88.0808173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2023-2045AGGATGTGTTTTTTTAAACATCTAUGUUUAAAAAAACACAUCCUGAUGUGUUUUUUUAAACAUCUU7.219.312


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969UCCACAAUCAGGACCGACU66.14321222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479987TCCACAATCAGGACCGACTAGTCGGTCCTGATTGTGGA0.026000.003100.663800.500000.918500.62500


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239GCCGUGGGGAGCGGGGCGG33.32982138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469257GCCGTGGGGAGCGGGGCGGCCGCCCCGCTCCCCACGGC0.066100.005900.586200.500000.918500.62500


Target Position: 1455, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1455GUAUCUUGAACAAGAAGUA93.299566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331473GTATCTTGAACAAGAAGTATACTTCTTGTTCAAGATAC0.150900.007000.500000.750000.978300.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1453-1475CAGTATCTTGAACAAGAAGTAGAUACUUCUUGUUCAAGAUACUGGUAUCUUGAACAAGAAGUAGAU17.713.423


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GCACAACUUUCCUUGCAGU83.1019339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781233GCACAACTTTCCTTGCAGTACTGCAAGGAAAGTTGTGC0.026700.028800.646600.750000.918500.62500


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560CACCAUAUCCUAGCUACAA90.4682111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318578CACCATATCCTAGCTACAATTGTAGCTAGGATATGGTG0.094800.011700.646600.750000.940200.62500


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378ACCUCCACCCUUAUAUCCU67.72181133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463396ACCTCCACCCTTATATCCTAGGATATAAGGGTGGAGGT0.471900.200400.508600.500001.000001.00000


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929CCCUGCCCCAUUAUCCUUA76.3072655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442947CCCTGCCCCATTATCCTTATAAGGATAATGGGGCAGGG0.037600.038000.956901.000001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663UUUGAAUUCUUAUACAAAU76.2166663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466681TTTGAATTCTTATACAAATATTTGTATAAGAATTCAAA0.266800.053500.491400.500001.000001.00000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347UCCCAACAAUCAAGAUCAA81.9317406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191365TCCCAACAATCAAGATCAATTGATCTTGATTGTTGGGA0.453000.384800.724100.750001.000001.00000


Target Position: 1409, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409CUCCUCCGAGUAUUAAAAA82.2261388

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8140919CTCCTCCGAGTATTAAAAA1/1/0/091.46BAG4NM_004874.21NANANA8:38067764..38067782(+)00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891427CTCCTCCGAGTATTAAAAATTTTTAATACTCGGAGGAG0.107800.016300.810300.750000.902200.62500


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410UCCUCCGAGUAUUAAAAAA78.7773536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391428TCCTCCGAGTATTAAAAAATTTTTTAATACTCGGAGGA0.151800.022600.870700.750001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465CAAGAAGUAGAAGAAUUUG75.019730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251483CAAGAAGTAGAAGAATTTGCAAATTCTTCTACTTCTTG0.060700.031700.500000.500001.000001.00000


Target Position: 1214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GGCACAACUUUCCUUGCAG76.8557624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141232GGCACAACTTTCCTTGCAGCTGCAAGGAAAGTTGTGCC0.046100.048200.715500.750000.918500.62500


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742GCUUAUUAUGCACCUGGUU78.1818563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497760GCTTATTATGCACCTGGTTAACCAGGTGCATAATAAGC0.019200.008200.706901.000001.000001.00000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129UCUCCCCAGUCACCCCCUU55.91281709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081147TCTCCCCAGTCACCCCCTTAAGGGGGTGACTGGGGAGA0.223500.093700.586200.750001.000001.00000


Target Position: 1359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359AGAUCAAAGUAGCAGUCUU90.1861119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021377AGATCAAAGTAGCAGTCTTAAGACTGCTACTTTGATCT0.103900.090300.586200.750001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163AGCCCAAGGAUUCUUCAUA84.3076283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831181AGCCCAAGGATTCTTCATATATGAAGAATCCTTGGGCT0.482600.014200.810300.750001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077ACCCGGCAAUCUCUACAUG65.10871274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081095ACCCGGCAATCTCTACATGCATGTAGAGATTGCCGGGT0.139900.014100.698300.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718GCAAAUACUGCCUCAUACU84.0273299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
716-738GGGCAAATACTGCCTCATACTCAAGUAUGAGGCAGUAUUUGCCCGCAAAUACUGCCUCAUACUCAU20.36.933


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646AAGGAUUAUGAAAGGAUUU75.0485728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491664AAGGATTATGAAAGGATTTAAATCCTTTCATAATCCTT0.206400.206500.637900.500001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162CAGCCCAAGGAUUCUUCAU78.4639552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041180CAGCCCAAGGATTCTTCATATGAAGAATCCTTGGGCTG0.290300.011800.629300.750001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966ACACAACAGGCUUAUCAGA82.6566363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861984ACACAACAGGCTTATCAGATCTGATAAGCCTGTTGTGT0.119200.084800.482800.500001.000001.00000


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251CUCGGGGACAGUGAACAAU72.457869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111269CTCGGGGACAGTGAACAATATTGTTCACTGTCCCCGAG0.073700.005000.801700.750001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177UCAUACCCCUAUAGCCAAU71.0103953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1241195TCATACCCCTATAGCCAATATTGGCTATAGGGGTATGA0.340400.295800.715500.750000.994601.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100UGUAAUUAUAGCUUAGACU76.4344647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812118TGTAATTATAGCTTAGACTAGTCTAAGCTATAATTACA0.052800.034900.500000.500001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342GACCAUCCCAACAAUCAAG75.2672717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001360GACCATCCCAACAATCAAGCTTGATTGTTGGGATGGTC0.486400.316900.681000.500001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CAGUGAACAAUGAUGAUUC80.4211465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031277CAGTGAACAATGATGATTCGAATCATCATTGTTCACTG0.050500.007700.612100.500000.940200.62500


Target Position: 1778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1778UGAUUUUAUACUUGAAAAA83.2972332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721796TGATTTTATACTTGAAAAATTTTTCAAGTATAAAATCA0.309400.197500.724100.750001.000001.00000


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509CUGGCUUCUGGAAGAAAUG66.05641228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911527CTGGCTTCTGGAAGAAATGCATTTCTTCCAGAAGCCAG0.319100.001700.629300.500000.989100.75000


Target Position: 1790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790UGAAAAACUGGCAAAGGAA84.2917284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631808TGAAAAACTGGCAAAGGAATTCCTTTGCCAGTTTTTCA0.031200.011300.551700.750001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902ACUCCUUAAAAAAUUUAUG64.79381292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211920ACTCCTTAAAAAATTTATGCATAAATTTTTTAAGGAGT0.097800.004700.551700.500001.000001.00000


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756GCAAUACAUUCCAGCUUUC74.744742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171774GCAATACATTCCAGCTTTCGAAAGCTGGAATGTATTGC0.162300.132100.681000.750001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464ACAAGAAGUAGAAGAAUUU81.5359421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731482ACAAGAAGTAGAAGAATTTAAATTCTTCTACTTCTTGT0.061400.035300.706900.750001.000001.00000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672AGUGGAAGCCUGUUACUAA99.141813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511690AGTGGAAGCCTGTTACTAATTAGTAACAGGCTTCCACT0.141900.029800.672400.750001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616UUCAGGCCAUACUGGAAAA76.1249670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771634TTCAGGCCATACTGGAAAATTTTCCAGTATGGCCTGAA0.091400.002400.672400.500000.929300.75000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135UCUGUUUUGUUUUGUUAUU67.77111129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232153TCTGTTTTGTTTTGTTATTAATAACAAAACAAAACAGA0.195900.004600.715500.750001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CCACCCGGCAAUCUCUACA76.9494618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271093CCACCCGGCAATCTCTACATGTAGAGATTGCCGGGTGG0.262900.041000.637900.750001.000001.00000


Target Position: 2156, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156CAGUUUACAAAUAUAGUAU90.8175105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2762174CAGTTTACAAATATAGTATATACTATATTTGTAAACTG0.117700.021100.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2154-2176TGCAGTTTACAAATATAGTATTAAUACUAUAUUUGUAAACUGCACAGUUUACAAAUAUAGUAUUAU7.912.921


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712UUGGUUAAUUACCCUCUUU68.73041081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961730TTGGTTAATTACCCTCTTTAAAGAGGGTAATTAACCAA0.432600.013200.646600.500000.902200.75000


Target Position: 1906, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CUUAAAAAAUUUAUGGAUA90.0981123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061924CTTAAAAAATTTATGGATATATCCATAAATTTTTTAAG0.099600.048700.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1904-1926TCCTTAAAAAATTTATGGATATCUAUCCAUAAAUUUUUUAAGGACUUAAAAAAUUUAUGGAUAUCU21.2-9.122


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161GCAGCCCAAGGAUUCUUCA82.1486395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231179GCAGCCCAAGGATTCTTCATGAAGAATCCTTGGGCTGC0.261300.010000.629300.750001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826CAUGAGUUGUUUUCAGUUU83.6914312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591844CATGAGTTGTTTTCAGTTTAAACTGAAAACAACTCATG0.043900.003100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1824-1846GTCATGAGTTGTTTTCAGTTTTCAAACUGAAAACAACUCAUGACCAUGAGUUGUUUUCAGUUUUCU19.219.221


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624AUACUGGAAAAAUUAGAAA82.5263372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901642ATACTGGAAAAATTAGAAATTTCTAATTTTTCCAGTAT0.675400.097500.543100.500001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764CUCAGACCAGUUACUCCAC68.10961111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390782CTCAGACCAGTTACTCCACGTGGAGTAACTGGTCTGAG0.477900.062600.517200.500000.978300.62500


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668ACAAAGUGGAAGCCUGUUA78.5069549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161686ACAAAGTGGAAGCCTGTTATAACAGGCTTCCACTTTGT0.095600.014500.672400.750001.000001.00000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840AGUUUUCAGACGAAUGAAU79.2586510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271858AGTTTTCAGACGAATGAATATTCATTCGTCTGAAAACT0.313800.009500.698300.750000.967400.62500


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765UCAGACCAGUUACUCCACA74.4748761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389783TCAGACCAGTTACTCCACATGTGGAGTAACTGGTCTGA0.484700.066200.517200.500000.978300.62500


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079CCGGCAAUCUCUACAUGAC76.9528617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921097CCGGCAATCTCTACATGACGTCATGTAGAGATTGCCGG0.078300.005900.594800.750001.000001.00000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099GUGUAAUUAUAGCUUAGAC82.3241387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102117GTGTAATTATAGCTTAGACGTCTAAGCTATAATTACAC0.055200.012500.474100.500001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517UGGAAGAAAUGCUAACCAA89.1832148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361535TGGAAGAAATGCTAACCAATTGGTTAGCATTTCTTCCA0.040700.026300.698300.750001.000001.00000


Target Position: 179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
179UCCGACCCCCUUCGCUGCU45.0662021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461197TCCGACCCCCTTCGCTGCTAGCAGCGAAGGGGGTCGGA0.321700.057000.517200.500000.940200.75000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640AAAAAAAAGGAUUAUGAAA87.1862197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011658AAAAAAAAGGATTATGAAATTTCATAATCCTTTTTTTT0.561100.526200.500000.500001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880ACCAAUAUUGCCAAGUAGA77.6775591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181898ACCAATATTGCCAAGTAGATCTACTTGGCAATATTGGT0.098100.004800.629300.500001.000001.00000


Target Position: 547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
547CACCAGGAGCAGCCACCAU79.4594498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361565CACCAGGAGCAGCCACCATATGGTGGCTGCTCCTGGTG0.421200.007700.637900.750000.934800.75000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953GGAAACACACUUCACACAA92.797473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771971GGAAACACACTTCACACAATTGTGTGAAGTGTGTTTCC0.196300.076500.724101.000001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GAAUAUUUUAGUCAUGAGU81.758410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111832GAATATTTTAGTCATGAGTACTCATGACTAAAATATTC0.041700.023700.465500.500001.000001.00000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379CCUCCACCCUUAUAUCCUC72.7059857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376397CCTCCACCCTTATATCCTCGAGGATATAAGGGTGGAGG0.541700.209400.534500.750001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382CCACCCUUAUAUCCUCUUC67.42121149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195400CCACCCTTATATCCTCTTCGAAGAGGATATAAGGGTGG0.572700.175400.672400.750001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659GGAUUUAGAACAAAGUGGA89.6413135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461677GGATTTAGAACAAAGTGGATCCACTTTGTTCTAAATCC0.080700.038600.500000.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258ACAGUGAACAAUGAUGAUU73.4399814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571276ACAGTGAACAATGATGATTAATCATCATTGTTCACTGT0.074500.018600.698300.750001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136CUGUUUUGUUUUGUUAUUU74.9558732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3432154CTGTTTTGTTTTGTTATTTAAATAACAAAACAAAACAG0.172700.008600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2134-2156TTCTGTTTTGTTTTGTTATTTGCAAAUAACAAAACAAAACAGAACUGUUUUGUUUUGUUAUUUGCU6.912.210


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653AUGAAAGGAUUUAGAACAA85.1274254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021671ATGAAAGGATTTAGAACAATTGTTCTAAATCCTTTCAT0.113200.096100.508600.500001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458UCUUGAACAAGAAGUAGAA85.1973251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461476TCTTGAACAAGAAGTAGAATTCTACTTCTTGTTCAAGA0.169500.035400.551700.750001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069CAUUGUGACUGCUUUCAAC83.545318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4012087CATTGTGACTGCTTTCAACGTTGAAAGCAGTCACAATG0.191300.007300.508600.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408ACCUCCCCAGCCUCCCAUU60.44841497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187426ACCTCCCCAGCCTCCCATTAATGGGAGGCTGGGGAGGT0.189000.039300.844800.750001.000001.00000


Target Position: 35, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
35GAAACGUAUACUCCCUCUU80.5792457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36953GAAACGTATACTCCCTCTTAAGAGGGAGTATACGTTTC0.237600.089500.534500.750001.000001.00000


Target Position: 1727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1727CUUUUUGAAAUGCCUGUUG60.33191506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641745CTTTTTGAAATGCCTGTTGCAACAGGCATTTCAAAAAG0.380000.074500.491400.500001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796ACUGGCAAAGGAAUGGAAG60.22661510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201814ACTGGCAAAGGAATGGAAGCTTCCATTCCTTTGCCAGT0.046200.004700.569000.500001.000001.00000


Target Position: 1994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1994GAUGAAACUGGAUAUAAUC82.8176354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4262012GATGAAACTGGATATAATCGATTATATCCAGTTTCATC0.192100.017700.500000.500001.000001.00000


Target Position: 2016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016GACAAACAGGAUGUGUUUU78.8017533

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2014-2036GAGACAAACAGGATGTGTTTTTTAAAACACAUCCUGUUUGUCUCGACAAACAGGAUGUGUUUUUUU19.319.323


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229GCAGUGUCCAUCAGUACGA84.5667276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801247GCAGTGTCCATCAGTACGATCGTACTGATGGACACTGC0.056400.002300.560300.750001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671AAGUGGAAGCCUGUUACUA84.7431266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101689AAGTGGAAGCCTGTTACTATAGTAACAGGCTTCCACTT0.110700.024100.465500.500001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UGGCAAAGGAAUGGAAGAA75.7051692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811816TGGCAAAGGAATGGAAGAATTCTTCCATTCCTTTGCCA0.162000.006500.672400.750001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178CAUACCCCUAUAGCCAAUC58.22871610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931196CATACCCCTATAGCCAATCGATTGGCTATAGGGGTATG0.331500.294400.474100.500000.994600.87500


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091ACAUGACUGAAAGUACUUC67.49971145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821109ACATGACTGAAAGTACTTCGAAGTACTTTCAGTCATGT0.131400.011300.534500.500001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090UACAUGACUGAAAGUACUU73.2254825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071108TACATGACTGAAAGTACTTAAGTACTTTCAGTCATGTA0.135400.011000.543100.500001.000001.00000


Target Position: 647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647AAUUGCAAGGCCAGAGUUU71.5818918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511665AATTGCAAGGCCAGAGTTTAAACTCTGGCCTTGCAATT0.070100.001100.508600.500001.000001.00000


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078UGCUUUCAACAUAUACUUC66.93961185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692096TGCTTTCAACATATACTTCGAAGTATATGTTGAAAGCA0.068000.033100.681000.500001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GUACGACCACAAGAAGAUG73.9174786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291006GTACGACCACAAGAAGATGCATCTTCTTGTGGTCGTAC0.222000.009300.525900.500001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800GCAAAGGAAUGGAAGAAUA94.771554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881818GCAAAGGAATGGAAGAATATATTCTTCCATTCCTTTGC0.186900.006100.810301.000001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527GCUAACCAAGGAACUUUUG63.96141330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401545GCTAACCAAGGAACTTTTGCAAAAGTTCCTTGGTTAGC0.039100.006000.706900.750001.000001.00000


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183CCCUAUAGCCAAUCAGAUC73.4318815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651201CCCTATAGCCAATCAGATCGATCTGATTGGCTATAGGG0.383600.225600.810300.750001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485AGGAAAAAAGACAGACAAA91.623587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961503AGGAAAAAAGACAGACAAATTTGTCTGTCTTTTTTCCT0.019900.012900.844800.750001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064UUGUACAUUGUGACUGCUU66.36791210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4742082TTGTACATTGTGACTGCTTAAGCAGTCACAATGTACAA0.030200.007600.508600.500000.983700.75000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CUUCUGGAAGAAAUGCUAA87.4141187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051531CTTCTGGAAGAAATGCTAATTAGCATTTCTTCCAGAAG0.307000.011800.603400.750001.000001.00000


Target Position: 1412, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412CUCCGAGUAUUAAAAAAAU84.6544270

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4141219CTCCGAGTATTAAAAAAAT1/1/0/093.44BAG4NM_004874.21NANANANA00BAG4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071430CTCCGAGTATTAAAAAAATATTTTTTTAATACTCGGAG0.765500.030900.801700.750001.000001.00000


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356UCAAGAUCAAAGUAGCAGU71.728910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921374TCAAGATCAAAGTAGCAGTACTGCTACTTTGATCTTGA0.182300.126000.517200.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589UGGAAUUCUACUGCGAGAU65.72371248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354607TGGAATTCTACTGCGAGATATCTCGCAGTAGAATTCCA0.087300.008000.663800.750001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243UGGGGAGCGGGGCGGGAAG44.22352037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508261TGGGGAGCGGGGCGGGAAGCTTCCCGCCCCGCTCCCCA0.034000.001300.706900.500001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GUUCCAAGUACUUACCGUU83.4036324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435805GTTCCAAGTACTTACCGTTAACGGTAAGTACTTGGAAC0.252100.110100.500000.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360GAUCAAAGUAGCAGUCUUC80.6336450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051378GATCAAAGTAGCAGTCTTCGAAGACTGCTACTTTGATC0.105200.094000.508600.500001.000001.00000


Target Position: 896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
896CAGGAUAUCCGCCUUCACA89.7165133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420914CAGGATATCCGCCTTCACATGTGAAGGCGGATATCCTG0.365700.030200.577600.500000.967400.75000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635AUUAGAAAAAAAAGGAUUA80.6016455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971653ATTAGAAAAAAAAGGATTATAATCCTTTTTTTTCTAAT0.778000.562400.474100.500001.000001.00000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190GCCAAUCAGAUCAAAGCAU79.3399502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431208GCCAATCAGATCAAAGCATATGCTTTGATCTGATTGGC0.147700.113500.844801.000001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265ACAAUGAUGAUUCAGAUCU71.9036898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851283ACAATGATGATTCAGATCTAGATCTGAATCATCATTGT0.044800.036000.482800.500001.000001.00000


Target Position: 1334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334CCACCAGUGACCAUCCCAA89.5254136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1341352CCACCAGTGACCATCCCAATTGGGATGGTCACTGGTGG0.477200.067600.698301.000001.000001.00000


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603GAGAUCUAGGGCUCCUUAC70.7136968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470621GAGATCTAGGGCTCCTTACGTAAGGAGCCCTAGATCTC0.031100.002700.629300.500000.972800.87500


Target Position: 1415, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415CGAGUAUUAAAAAAAUCAU88.0752174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401433CGAGTATTAAAAAAATCATATGATTTTTTTAATACTCG0.695700.052000.637901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1413-1435TCCGAGTATTAAAAAAATCATACAUGAUUUUUUUAAUACUCGGACGAGUAUUAAAAAAAUCAUACU7.414.522


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927GACCCUGCCCCAUUAUCCU75.9439677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494945GACCCTGCCCCATTATCCTAGGATAATGGGGCAGGGTC0.061900.038200.474100.500001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829GAGUUGUUUUCAGUUUUCA88.3137167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091847GAGTTGTTTTCAGTTTTCATGAAAACTGAAAACAACTC0.064600.001200.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1827-1849ATGAGTTGTTTTCAGTTTTCAGAUGAAAACUGAAAACAACUCAUGAGUUGUUUUCAGUUUUCAGAU13.317.822


Target Position: 1775, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775CUUUGAUUUUAUACUUGAA96.057942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091793CTTTGATTTTATACTTGAATTCAAGTATAAAATCAAAG0.349400.040600.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1773-1795TCCTTTGATTTTATACTTGAAAAUUCAAGUAUAAAAUCAAAGGACUUUGAUUUUAUACUUGAAAAU20.37.422


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249UCCUCGGGGACAGUGAACA64.88611287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051267TCCTCGGGGACAGTGAACATGTTCACTGTCCCCGAGGA0.090300.001300.663800.500000.956500.62500


Target Position: 10, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10GAAACUCCAUUGGAUAAAU87.0655201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44428GAAACTCCATTGGATAAATATTTATCCAATGGAGTTTC0.164600.003400.663800.750000.967401.00000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811GAAGAAUAUUUUAGUCAUG83.0723342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061829GAAGAATATTTTAGTCATGCATGACTAAAATATTCTTC0.050200.038600.517200.500001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159CAGCAGCCCAAGGAUUCUU73.097833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891177CAGCAGCCCAAGGATTCTTAAGAATCCTTGGGCTGCTG0.022900.008800.646600.750001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CCCCUUCACCCCCAGUCCA70.788965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081160CCCCTTCACCCCCAGTCCATGGACTGGGGGTGAAGGGG0.219500.186900.646600.750001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805GGAAUGGAAGAAUAUUUUA96.156541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281823GGAATGGAAGAATATTTTATAAAATATTCTTCCATTCC0.155700.055700.836201.000001.000001.00000


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741GGCUUAUUAUGCACCUGGU83.5874314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503759GGCTTATTATGCACCTGGTACCAGGTGCATAATAAGCC0.016100.004900.646600.750000.972800.62500


Target Position: 187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CCUUCGCUGCUCUCCAUUC68.30591103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
233205CCTTCGCTGCTCTCCATTCGAATGGAGAGCAGCGAAGG0.421300.067100.672400.750001.000001.00000


Target Position: 1649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649GAUUAUGAAAGGAUUUAGA92.2179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1647-1669AGGATTATGAAAGGATTTAGAACUCUAAAUCCUUUCAUAAUCCUGAUUAUGAAAGGAUUUAGAACU6.98.732


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659AGAGUUUGAAUUCUUAUAC69.06331063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437677AGAGTTTGAATTCTTATACGTATAAGAATTCAAACTCT0.179500.028000.543100.500001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744UGAUGACAAGAAGCAAUAC68.73611080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531762TGATGACAAGAAGCAATACGTATTGCTTCTTGTCATCA0.042300.015500.543100.500001.000001.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288GAUUCCCAAGUCCAGUAUA90.8412104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711306GATTCCCAAGTCCAGTATATATACTGGACTTGGGAATC0.028200.007700.637900.750001.000001.00000