siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 499   500   669   670   727   1535   1915   2200   2206   2374   2547   2769   2832   2882   3114   3388   3948   4170   4173   4426  
5207   5880   5884   5952   6180   6181   6649   6801   6989   6990   7106   7561   7568   8051  
Biltr, Rnaxs 356   471   498   659   660   667   668   671   819   968   969   973   1040   1073   1328   1529   1786   1914   2195   2196  
2205   2280   2283   2284   2285   2286   2368   2369   2394   2565   2721   2724   2725   2727   2729   2768   2922   2923   2925   3108  
3110   3111   3113   3218   3219   3276   3397   3438   3443   3663   3664   3774   3775   3816   3918   3956   4169   4172   4469   4593  
4717   4718   4788   4791   4794   5141   5142   5473   5480   5482   5877   5878   5879   5883   5947   5951   5988   5989   5990   6036  
6085   6086   6305   6925   6928   7017   7025   7026   7027   7472   7480   7483   7557   7560   7621   7691   7895   8260   8262   8280  
8301   8302   8306   8310   8311   8312   8313  
Biltr, Sidirect 174   177   179   186   189   200   201   335   337   363   416   428   449   477   478   479   490   507   514   551  
560   566   570   573   576   579   582   585   631   633   640   644   648   672   692   693   702   728   734   737  
749   756   757   762   784   785   789   798   823   824   831   911   912   1092   1095   1115   1118   1143   1148   1167  
1202   1203   1290   1294   1313   1358   1360   1363   1417   1428   1430   1445   1498   1500   1506   1507   1509   1531   1575   1578  
1579   1599   1602   1635   1659   1660   1692   1828   1852   1855   1857   1930   1956   2058   2063   2068   2102   2139   2141   2144  
2154   2164   2174   2175   2187   2208   2228   2229   2232   2237   2253   2287   2289   2405   2467   2468   2470   2475   2496   2497  
2542   2543   2549   2554   2602   2612   2628   2633   2705   2732   2764   2766   2790   2791   2824   2833   2841   2843   2845   2892  
2895   2896   2901   2903   2904   2927   2963   2964   2978   2980   2986   2988   2991   3007   3008   3047   3050   3051   3058   3060  
3071   3115   3246   3249   3337   3366   3398   3429   3442   3444   3448   3534   3543   3544   3602   3612   3614   3622   3937   4094  
4147   4171   4179   4185   4194   4195   4201   4221   4226   4402   4404   4406   4418   4429   4445   4470   4490   4492   4495   4498  
4597   4648   4649   4652   4662   4665   4677   4678   4752   4755   4762   4787   4789   4792   4815   4817   4851   4929   4997   5019  
5026   5042   5050   5051   5063   5070   5099   5101   5115   5144   5145   5146   5166   5169   5175   5176   5179   5183   5190   5196  
5205   5209   5251   5255   5263   5264   5307   5316   5331   5346   5354   5356   5359   5378   5387   5390   5393   5398   5400   5409  
5410   5437   5439   5440   5445   5447   5448   5454   5483   5484   5492   5496   5518   5529   5545   5571   5572   5575   5578   5581  
5583   5618   5669   5670   5682   5696   5719   5722   5762   5766   5814   5816   5855   5876   5892   5907   5912   5953   5957   5984  
5993   5994   6044   6048   6101   6143   6144   6153   6154   6158   6177   6256   6290   6300   6306   6309   6317   6328   6339   6345  
6443   6460   6463   6465   6469   6496   6560   6564   6569   6579   6593   6603   6606   6609   6652   6668   6705   6715   6726   6739  
6747   6748   6751   6756   6782   6803   6820   6843   6852   6853   6869   6872   6888   6900   6901   6909   6964   6991   7004   7018  
7028   7031   7038   7047   7048   7058   7059   7086   7096   7101   7107   7113   7116   7122   7135   7144   7146   7147   7204   7206  
7212   7227   7237   7242   7248   7252   7258   7264   7289   7291   7293   7298   7304   7310   7339   7350   7366   7378   7414   7421  
7441   7448   7451   7453   7460   7481   7486   7491   7495   7510   7562   7597   7599   7602   7606   7626   7648   7684   7685   7700  
7710   7719   7720   7721   7729   7730   7875   7876   7877   7896   7899   7956   7989   8003   8005   8011   8013   8034   8037   8053  
8065   8076   8077   8078   8085   8086   8120   8121   8137   8170   8179   8182   8185   8213   8214   8216   8223   8227   8238   8264  
8269   8273   8279   8281   8303  
Biltr, Ernai 275   1571   2135   5755   6152  
Biltr, Ernai, Sidirect 754   1034   1168   2494   4484  


Target Position: 6609, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6609GUAAUGAAAAUCUAUUUAA93.9836341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6607-6629TAGTAATGAAAATCTATTTAATCUUAAAUAGAUUUUCAUUACUAGUAAUGAAAAUCUAUUUAAUCU-2.38.922


Target Position: 4147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4147CACUAACGACUCUUCUUCA96.2543201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4145-4167AACACTAACGACTCTTCTTCAAGUGAAGAAGAGUCGUUAGUGUUCACUAACGACUCUUCUUCAAGU19.119.633


Target Position: 5141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5141GCUGGCAUAUAUUAAAUUA97.4312143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9035159GCTGGCATATATTAAATTATAATTTAATATATGCCAGC0.659200.072700.819001.000001.000001.00000


Target Position: 2922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922AGGAGGAAAGUAGCAGAAA82.51162069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052940AGGAGGAAAGTAGCAGAAATTTCTGCTACTTTCCTCCT0.439600.186700.844800.750001.000001.00000


Target Position: 5209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5209CAAAAACACUAAACAUAAA98.846991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5207-5229CACAAAAACACTAAACATAAAAGUUUAUGUUUAGUGUUUUUGUGCAAAAACACUAAACAUAAAAGU6.95.612


Target Position: 2824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2824CUUUCUUUGGAAUUUAUCU77.2553299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2822-2844GCCTTTCTTTGGAATTTATCTCAAGAUAAAUUCCAAAGAAAGGCCUUUCUUUGGAAUUUAUCUCAU1.85.522


Target Position: 7481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7481CAUCUCAUUACUAACUUUU81.40542307

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7479-7501AACATCTCATTACTAACTTTTAAAAAAGUUAGUAAUGAGAUGUUCAUCUCAUUACUAACUUUUAAU4.920.422


Target Position: 7122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7122CAUUGUUUGUCUUCUAAUA98.4159106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7120-7142TTCATTGTTTGTCTTCTAATATGUAUUAGAAGACAAACAAUGAACAUUGUUUGUCUUCUAAUAUGU6.95.323


Target Position: 2374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374CCUUACACCCAAUAGAAAU82.39552101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2622392CCTTACACCCAATAGAAATATTTCTATTGGGTGTAAGG0.606700.495300.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394CACCTTACACCCAATAGAAATTGAUUUCUAUUGGGUGUAAGGUGCCUUACACCCAAUAGAAAUUGU6.919.023


Target Position: 5356, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5356GAACUUUGUAAGUAAGUUU89.0374867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5354-5376CAGAACTTTGTAAGTAAGTTTTAAAACUUACUUACAAAGUUCUGGAACUUUGUAAGUAAGUUUUAU12.910.322


Target Position: 2790, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2790GCAAAACUCAGGUCUAUUA94.8268277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2788-2810TGGCAAAACTCAGGTCTATTAATUAAUAGACCUGAGUUUUGCCAGCAAAACUCAGGUCUAUUAAUU14.510.323


Target Position: 579, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579GUAGAAGAUAUUAAUAUAU92.4983473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
577-599ATGTAGAAGATATTAATATATTAAUAUAUUAAUAUCUUCUACAUGUAGAAGAUAUUAAUAUAUUAU-5.920.221


Target Position: 6144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6144CUCAUUGUCCCUAAGAUUU75.90133634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6142-6164GCCTCATTGTCCCTAAGATTTCTAAAUCUUAGGGACAAUGAGGCCUCAUUGUCCCUAAGAUUUCUU6.920.532


Target Position: 5876, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5876CAGUCUAUCCUAUUUUCUU90.5255680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5874-5896AGCAGTCTATCCTATTTTCTTATAAGAAAAUAGGAUAGACUGCUCAGUCUAUCCUAUUUUCUUAUU5.318.932


Target Position: 2154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154GAAAGAGAUGCAUAUCUUU93.2674400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2152-2174TTGAAAGAGATGCATATCTTTTGAAAGAUAUGCAUCUCUUUCAAGAAAGAGAUGCAUAUCUUUUGU6.619.122


Target Position: 6180, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6180GGAUUACUUCUCUUUUUAA103.21818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7256198GGATTACTTCTCTTTTTAATTAAAAAGAGAAGTAATCC0.332200.113900.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6178-6200ATGGATTACTTCTCTTTTTAATTUUAAAAAGAGAAGUAAUCCAUGGAUUACUUCUCUUUUUAAUUU-3.814.522


Target Position: 8311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8311GCCCACAAAAAAAAAAAAA79.3492786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908329GCCCACAAAAAAAAAAAAATTTTTTTTTTTTTGTGGGC0.998100.973901.000001.000001.000001.00000


Target Position: 4169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4169UGCAGUAUAAGACAAUGAA85.84891366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894187TGCAGTATAAGACAATGAATTCATTGTCTTATACTGCA0.388400.063900.681000.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GCAUAGUAGAUAUACAUGA93.8924349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
782-804TCGCATAGTAGATATACATGAACUCAUGUAUAUCUACUAUGCGAGCAUAGUAGAUAUACAUGAACU13.313.132


Target Position: 3444, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3444GUAUCAUCUAUAAGUUUAA96.9170

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3442-3464CTGTATCATCTATAAGTTTAACCUUAAACUUAUAGAUGAUACAGGUAUCAUCUAUAAGUUUAACCU4.917.422


Target Position: 4815, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4815GUCAACUAUUCUAUUUGCA83.86391779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4813-4835CTGTCAACTATTCTATTTGCATTUGCAAAUAGAAUAGUUGACAGGUCAACUAUUCUAUUUGCAUUU15.320.322


Target Position: 5207, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5207CACAAAAACACUAAACAUA93.9028347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5695225CACAAAAACACTAAACATATATGTTTAGTGTTTTTGTG0.397400.134400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5205-5227CACACAAAAACACTAAACATAAAUAUGUUUAGUGUUUUUGUGUGCACAAAAACACUAAACAUAAAU6.95.621


Target Position: 7451, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7451GACUUUAUUCAAUAUUUUU89.5768800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7449-7471ATGACTTTATTCAATATTTTTCTAAAAAUAUUGAAUAAAGUCAUGACUUUAUUCAAUAUUUUUCUU-10.34.611


Target Position: 5953, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5953CAUUCUUCUCUUUAUAAAA97.885125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5951-5973GCCATTCTTCTCTTTATAAAATAUUUUAUAAAGAGAAGAAUGGCCAUUCUUCUCUUUAUAAAAUAU-7.514.822


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667UGGCAGAAAUUCGACAAUA82.94751981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385685TGGCAGAAATTCGACAATATATTGTCGAATTTCTGCCA0.637400.336400.801700.750001.000001.00000


Target Position: 2164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164CAUAUCUUUUGCAACGAAU83.10521950

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2162-2184TGCATATCTTTTGCAACGAATGGAUUCGUUGCAAAAGAUAUGCACAUAUCUUUUGCAACGAAUGGU21.16.632


Target Position: 2628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628CAAGAGUUGAACAACUUUA93.5246379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2626-2648TTCAAGAGTTGAACAACTTTAATUAAAGUUGUUCAACUCUUGAACAAGAGUUGAACAACUUUAAUU10.317.723


Target Position: 8003, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8003GUCAAAGUGACAUGUAUAA90.4876685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8001-8023TTGTCAAAGTGACATGTATAATTUUAUACAUGUCACUUUGACAAGUCAAAGUGACAUGUAUAAUUU8.219.233


Target Position: 3246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3246CCUGAAAGUGAAACAGAAA93.4396388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3244-3266TCCCTGAAAGTGAAACAGAAAGTUUUCUGUUUCACUUUCAGGGACCUGAAAGUGAAACAGAAAGUU19.216.622


Target Position: 2253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2253CAAAGGAAAAAAAUUGCAA87.61021071

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2251-2273TCCAAAGGAAAAAAATTGCAAGAUUGCAAUUUUUUUCCUUUGGACAAAGGAAAAAAAUUGCAAGAU20.018.712


Target Position: 6593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6593CAAAUUUAUCCUUGUAGUA93.1566411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6591-6613GACAAATTTATCCTTGTAGTAATUACUACAAGGAUAAAUUUGUCCAAAUUUAUCCUUGUAGUAAUU19.0-9.722


Target Position: 6036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6036CCUAAGACCAUCCAUUCAA87.08851153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7406054CCTAAGACCATCCATTCAATTGAATGGATGGTCTTAGG0.447400.107000.698301.000001.000001.00000


Target Position: 189, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
189GAAUUAAUUUUGCAAUUAU94.8727274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
187-209AAGAATTAATTTTGCAATTATTAAUAAUUGCAAAAUUAAUUCUUGAAUUAAUUUUGCAAUUAUUAU15.3-10.321


Target Position: 2841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841CUCACUAAUAUCUUGAAAA90.9255626

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2839-2861ATCTCACTAATATCTTGAAAACAUUUUCAAGAUAUUAGUGAGAUCUCACUAAUAUCUUGAAAACAU12.220.322


Target Position: 551, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551GGUAUUGAUGGAUAUGUUU87.92181011

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
549-571AAGGTATTGATGGATATGTTTCAAAACAUAUCCAUCAAUACCUUGGUAUUGAUGGAUAUGUUUCAU6.716.122


Target Position: 6747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6747GGAACAUUUCUUUUAGAAA98.6448100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6745-6767GTGGAACATTTCTTTTAGAAATGUUUCUAAAAGAAAUGUUCCACGGAACAUUUCUUUUAGAAAUGU7.114.822


Target Position: 5814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5814CACGAUAGUACAGUAUGUA93.0261422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5812-5834ATCACGATAGTACAGTATGTAGTUACAUACUGUACUAUCGUGAUCACGAUAGUACAGUAUGUAGUU19.020.922


Target Position: 757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757CUAAUGAUGUAGAAAAUAU92.8423445

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
755-777AGCTAATGATGTAGAAAATATATAUAUUUUCUACAUCAUUAGCUCUAAUGAUGUAGAAAAUAUAUU2.18.722


Target Position: 7144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7144CAGCUUAAAUUCAGAUUUU87.06021157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7142-7164GACAGCTTAAATTCAGATTTTTAAAAAUCUGAAUUUAAGCUGUCCAGCUUAAAUUCAGAUUUUUAU12.018.312


Target Position: 5884, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5884CCUAUUUUCUUAUUUAUUU83.60241856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2755902CCTATTTTCTTATTTATTTAAATAAATAAGAAAATAGG0.596900.497300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5882-5904ATCCTATTTTCTTATTTATTTGTAAAUAAAUAAGAAAAUAGGAUCCUAUUUUCUUAUUUAUUUGUU-10.3-4.322


Target Position: 8086, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8086CUAAAAUAAUUGUCAAAAA94.6323292

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8084-8106TGCTAAAATAATTGTCAAAAAATUUUUUGACAAUUAUUUUAGCACUAAAAUAAUUGUCAAAAAAUU14.9-7.521


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195UGGAACAGUAAGAGGUAAA79.87922665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152213TGGAACAGTAAGAGGTAAATTTACCTCTTACTGTTCCA0.335100.236700.844800.750001.000001.00000


Target Position: 8262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8262GGCAUUACUAAGAUAAACU85.78661377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5578280GGCATTACTAAGATAAACTAGTTTATCTTAGTAATGCC0.404400.233100.793100.750001.000001.00000


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768AGAUCACUAUAAGAAAUAU93.1261413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502786AGATCACTATAAGAAATATATATTTCTTATAGTGATCT0.631600.184700.681000.750001.000001.00000


Target Position: 4593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4593GCCUGUUUACAGAUUAUUA98.647299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6254611GCCTGTTTACAGATTATTATAATAATCTGTAAACAGGC0.419500.121600.965501.000000.929300.62500


Target Position: 7720, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7720CCAAUUGCUGCAGAAUUAU76.46993485

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7718-7740AGCCAATTGCTGCAGAATTATAAAUAAUUCUGCAGCAAUUGGCUCCAAUUGCUGCAGAAUUAUAAU6.920.032


Target Position: 5719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5719CACCAUUAGAGACAUUUUU79.72322705

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5717-5739CACACCATTAGAGACATTTTTAGAAAAAUGUCUCUAAUGGUGUGCACCAUUAGAGACAUUUUUAGU5.320.023


Target Position: 7116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7116GUAUUUCAUUGUUUGUCUU84.99391538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7114-7136TTGTATTTCATTGTTTGTCTTCTAAGACAAACAAUGAAAUACAAGUAUUUCAUUGUUUGUCUUCUU19.28.921


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283CCAGGUCAUAAUAUUACAU87.40641105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202301CCAGGTCATAATATTACATATGTAATATTATGACCTGG0.637800.146200.689701.000001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CUGGGCCAUAUAGAAGAUA78.23023056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
724837CTGGGCCATATAGAAGATATATCTTCTATATGGCCCAG0.738400.330100.741400.750001.000001.00000


Target Position: 728, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CUUUGUCUCCAAUUCAAAA91.5858562

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
726-748CCCTTTGTCTCCAATTCAAAATTUUUUGAAUUGGAGACAAAGGGCUUUGUCUCCAAUUCAAAAUUU7.419.222


Target Position: 6153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6153CCUAAGAUUUCUCUUUUUA90.8887635

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6151-6173TCCCTAAGATTTCTCTTTTTATGUAAAAAGAGAAAUCUUAGGGACCUAAGAUUUCUCUUUUUAUGU5.511.622


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368UGCUCACCUUACACCCAAU80.78782453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3892386TGCTCACCTTACACCCAATATTGGGTGTAAGGTGAGCA0.662200.180300.844800.750001.000001.00000


Target Position: 1115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115GCAGUUAGAAGAAAAAAGU79.24672816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1113-1135AAGCAGTTAGAAGAAAAAAGTGAACUUUUUUCUUCUAACUGCUUGCAGUUAGAAGAAAAAAGUGAU-5.916.402


Target Position: 6603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6603CUUGUAGUAAUGAAAAUCU80.09482630

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6601-6623TCCTTGTAGTAATGAAAATCTATAGAUUUUCAUUACUACAAGGACUUGUAGUAAUGAAAAUCUAUU10.419.031


Target Position: 2058, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058GAACUGAAAAGAUUUAGAA97.8406128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2056-2078CAGAACTGAAAAGATTTAGAAAAUUCUAAAUCUUUUCAGUUCUGGAACUGAAAAGAUUUAGAAAAU6.919.221


Target Position: 8279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8279CUGAAAAAUAAUAAAGAAA89.6556791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8277-8299AACTGAAAAATAATAAAGAAAAAUUUCUUUAUUAUUUUUCAGUUCUGAAAAAUAAUAAAGAAAAAU7.17.721


Target Position: 7700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7700GAAAAUAGUGCAUUAAGUA100.09465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7698-7720ATGAAAATAGTGCATTAAGTAGCUACUUAAUGCACUAUUUUCAUGAAAAUAGUGCAUUAAGUAGCU4.6-4.322


Target Position: 5572, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5572CUUGUUGAAGAGAAAACAU82.46172084

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5570-5592ACCTTGTTGAAGAGAAAACATTTAUGUUUUCUCUUCAACAAGGUCUUGUUGAAGAGAAAACAUUUU14.920.522


Target Position: 6305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6305UCAACCUAUCUAGUCUAUA78.52872982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9126323TCAACCTATCTAGTCTATATATAGACTAGATAGGTTGA0.451200.224300.681000.750000.978300.75000


Target Position: 449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449CAUUUCUGCAGACAUUUUA87.18271140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
447-469TACATTTCTGCAGACATTTTAAAUAAAAUGUCUGCAGAAAUGUACAUUUCUGCAGACAUUUUAAAU5.312.022


Target Position: 5993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5993CCUAAAACAUUAAUUUCAA93.8708350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5991-6013GTCCTAAAACATTAATTTCAAATUUGAAAUUAAUGUUUUAGGACCCUAAAACAUUAAUUUCAAAUU7.44.921


Target Position: 6290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6290GGUGAUAACCCCUUUUCAA96.4314190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6288-6310AAGGTGATAACCCCTTTTCAACCUUGAAAAGGGGUUAUCACCUUGGUGAUAACCCCUUUUCAACCU12.216.133


Target Position: 2068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068GAUUUAGAAAAGAAUAUAU95.671227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2066-2088AAGATTTAGAAAAGAATATATACAUAUAUUCUUUUCUAAAUCUUGAUUUAGAAAAGAAUAUAUACU3.56.921


Target Position: 6085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6085CGCUACAACUAAUCAUGAU90.5392679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7926103CGCTACAACTAATCATGATATCATGATTAGTTGTAGCG0.307700.140700.741401.000001.000001.00000


Target Position: 5440, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5440GUUUUCUGCUUUAUCAAAA87.6671057

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5438-5460AGGTTTTCTGCTTTATCAAAACTUUUUGAUAAAGCAGAAAACCUGUUUUCUGCUUUAUCAAAACUU8.912.222


Target Position: 2732, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732GAAGAAAAUUUUAGAAGAA100.24758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2730-2752CAGAAGAAAATTTTAGAAGAAGCUUCUUCUAAAAUUUUCUUCUGGAAGAAAAUUUUAGAAGAAGCU20.25.511


Target Position: 8280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8280UGAAAAAUAAUAAAGAAAA83.86021780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9598298TGAAAAATAATAAAGAAAATTTTCTTTATTATTTTTCA0.645300.067200.724100.750001.000001.00000


Target Position: 1930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930CAUACAGAUCCUUUUGCAA95.3343252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1928-1950AACATACAGATCCTTTTGCAAACUUGCAAAAGGAUCUGUAUGUUCAUACAGAUCCUUUUGCAAACU20.020.322


Target Position: 6989, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6989GGCUAUAUUAUGAUUCUAA102.69729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7787007GGCTATATTATGATTCTAATTAGAATCATAATATAGCC0.345800.088800.965501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6987-7009GAGGCTATATTATGATTCTAAATUUAGAAUCAUAAUAUAGCCUCGGCUAUAUUAUGAUUCUAAAUU16.014.822


Target Position: 7135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7135CUAAUAUGACAGCUUAAAU88.7457906

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7133-7155TTCTAATATGACAGCTTAAATTCAUUUAAGCUGUCAUAUUAGAACUAAUAUGACAGCUUAAAUUCU13.70.032


Target Position: 5755, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5755GUGGGAACCUAGUACUUUA100.26756

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5575519GTGGGAACCTAGTACTTTA1/1/0/0100.00SOS1NM_005633.31NANANA2:39211235..39211253(-)00SOS1(0.002)


Target Position: 2833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833GAAUUUAUCUCACUAAUAU98.3712109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2831-2853TGGAATTTATCTCACTAATATCTAUAUUAGUGAGAUAAAUUCCAGAAUUUAUCUCACUAAUAUCUU6.3-10.322


Target Position: 573, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
573CAAGAUGUAGAAGAUAUUA95.1771258

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
571-593ATCAAGATGTAGAAGATATTAATUAAUAUCUUCUACAUCUUGAUCAAGAUGUAGAAGAUAUUAAUU6.619.222


Target Position: 4787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4787CAGAAGAACUUUUUAAAAA95.417243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4785-4807GACAGAAGAACTTTTTAAAAAAAUUUUUAAAAAGUUCUUCUGUCCAGAAGAACUUUUUAAAAAAAU-9.119.121


Target Position: 8273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8273GAUAAACUGAAAAAUAAUA96.0217214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8271-8293AAGATAAACTGAAAAATAATAAAUAUUAUUUUUCAGUUUAUCUUGAUAAACUGAAAAAUAAUAAAU-10.34.612


Target Position: 3007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007GGUUCUUUGAAAACUUGAA92.2091501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3005-3027AAGGTTCTTTGAAAACTTGAATCUUCAAGUUUUCAAAGAACCUUGGUUCUUUGAAAACUUGAAUCU19.213.322


Target Position: 2980, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2980GUUUACGAGUAGAAUCAGA88.4203948

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2978-3000CTGTTTACGAGTAGAATCAGATAUCUGAUUCUACUCGUAAACAGGUUUACGAGUAGAAUCAGAUAU20.416.533


Target Position: 5146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5146CAUAUAUUAAAUUAUUAUA100.09764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5144-5166GGCATATATTAAATTATTATATGUAUAAUAAUUUAAUAUAUGCCCAUAUAUUAAAUUAUUAUAUGU-8.0-8.612


Target Position: 7561, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7561GCAUGAAGUCUAUAUUAUA108.0473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3257579GCATGAAGTCTATATTATATATAATATAGACTTCATGC0.810300.418300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7559-7581AAGCATGAAGTCTATATTATAAAUAUAAUAUAGACUUCAUGCUUGCAUGAAGUCUAUAUUAUAAAU-8.618.132


Target Position: 1290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290CUAGCAAUCAAGAAGAUGA89.9675746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1288-1310AACTAGCAATCAAGAAGATGAACUCAUCUUCUUGAUUGCUAGUUCUAGCAAUCAAGAAGAUGAACU20.419.733


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394GCUCGACAACUCACUUUAC79.08792857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942412GCTCGACAACTCACTTTACGTAAAGTGAGTTGTCGAGC0.622500.133100.672400.750001.000001.00000


Target Position: 2205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205AGAGGUAAAGCAAUGAAAA90.8803636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5332223AGAGGTAAAGCAATGAAAATTTTCATTGCTTTACCTCT0.503200.214500.724100.750001.000001.00000


Target Position: 911, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911GGCAUUUGAUCCAUAUGAA99.888570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
909-931CTGGCATTTGATCCATATGAATCUUCAUAUGGAUCAAAUGCCAGGGCAUUUGAUCCAUAUGAAUCU14.920.022


Target Position: 5354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5354CAGAACUUUGUAAGUAAGU72.55414506

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5352-5374AGCAGAACTTTGTAAGTAAGTTTACUUACUUACAAAGUUCUGCUCAGAACUUUGUAAGUAAGUUUU9.817.722


Target Position: 1294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294CAAUCAAGAAGAUGAACGA90.4046691

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1292-1314AGCAATCAAGAAGATGAACGAGAUCGUUCAUCUUCUUGAUUGCUCAAUCAAGAAGAUGAACGAGAU21.112.023


Target Position: 200, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200GCAAUUAUUAAAUAUGCUA92.5866466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
198-220TTGCAATTATTAAATATGCTATGUAGCAUAUUUAAUAAUUGCAAGCAAUUAUUAAAUAUGCUAUGU19.7-1.832


Target Position: 4490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4490CUCUUCUACUUUAGAAUAU82.05652161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4488-4510TACTCTTCTACTTTAGAATATTTAUAUUCUAAAGUAGAAGAGUACUCUUCUACUUUAGAAUAUUUU8.420.221


Target Position: 5050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5050GCCUAAAUCAUAUGUAUAU90.4407689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5048-5070TTGCCTAAATCATATGTATATAGAUAUACAUAUGAUUUAGGCAAGCCUAAAUCAUAUGUAUAUAGU8.210.922


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498CGGCAUUAUGAAAUUACAA93.8359355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964516CGGCATTATGAAATTACAATTGTAATTTCATAATGCCG0.410900.066700.767201.000001.000001.00000


Target Position: 499, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499GGCAUUAUGAAAUUACAAA94.4348307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540517GGCATTATGAAATTACAAATTTGTAATTTCATAATGCC0.412200.216001.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
497-519ACGGCATTATGAAATTACAAAACUUUGUAAUUUCAUAAUGCCGUGGCAUUAUGAAAUUACAAAACU6.915.232


Target Position: 4492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4492CUUCUACUUUAGAAUAUUU89.7907770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4490-4512CTCTTCTACTTTAGAATATTTTCAAAUAUUCUAAAGUAGAAGAGCUUCUACUUUAGAAUAUUUUCU1.818.922


Target Position: 8053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8053GUAUUUGCCUUUGUUUAGU71.45064785

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8051-8073GTGTATTTGCCTTTGTTTAGTAGACUAAACAAAGGCAAAUACACGUAUUUGCCUUUGUUUAGUAGU11.815.322


Target Position: 4179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4179GACAAUGAAUUUUAACCUA95.432241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4177-4199AAGACAATGAATTTTAACCTAGAUAGGUUAAAAUUCAUUGUCUUGACAAUGAAUUUUAACCUAGAU18.620.522


Target Position: 754, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754CAGCUAAUGAUGUAGAAAA97.8135129

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_875419CAGCTAATGATGTAGAAAA1/1/0/097.75SOS1NM_005633.31NANANA2:39278418,39281755..39278428,39281762(-)00SOS1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
752-774TTCAGCTAATGATGTAGAAAATAUUUUCUACAUCAUUAGCUGAACAGCUAAUGAUGUAGAAAAUAU14.618.322


Target Position: 7721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7721CAAUUGCUGCAGAAUUAUA97.4601142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7719-7741GCCAATTGCTGCAGAATTATAAAUAUAAUUCUGCAGCAAUUGGCCAAUUGCUGCAGAAUUAUAAAU1.818.532


Target Position: 3442, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3442CUGUAUCAUCUAUAAGUUU86.80971197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3440-3462TTCTGTATCATCTATAAGTTTAAAAACUUAUAGAUGAUACAGAACUGUAUCAUCUAUAAGUUUAAU4.621.523


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GGCAGAAAUUCGACAAUAU95.4961236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
231686GGCAGAAATTCGACAATATATATTGTCGAATTTCTGCC0.629600.434600.956901.000001.000001.00000


Target Position: 3276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276GCACCAAAUUCUCCAAGAA96.2385203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9213294GCACCAAATTCTCCAAGAATTCTTGGAGAATTTGGTGC0.407200.172500.681001.000001.000001.00000


Target Position: 7018, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7018GUUUUUUUCCCUCCAUAAA83.50521874

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7016-7038AGGTTTTTTTCCCTCCATAAATCUUUAUGGAGGGAAAAAAACCUGUUUUUUUCCCUCCAUAAAUCU21.2-11.322


Target Position: 8306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8306ACAUAGCCCACAAAAAAAA81.73512242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6358324ACATAGCCCACAAAAAAAATTTTTTTTGTGGGCTATGT0.994700.601300.706900.750001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196GGAACAGUAAGAGGUAAAG74.71793933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782214GGAACAGTAAGAGGTAAAGCTTTACCTCTTACTGTTCC0.363600.248900.732800.750001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529GCGAAAGGUACAAAUUAAU82.81992007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131547GCGAAAGGTACAAATTAATATTAATTTGTACCTTTCGC0.465800.102800.913801.000001.000001.00000


Target Position: 8260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8260CUGGCAUUACUAAGAUAAA92.7025459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6708278CTGGCATTACTAAGATAAATTTATCTTAGTAATGCCAG0.610600.402800.784500.750001.000001.00000


Target Position: 3108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3108CCUCUCCCAAGAUUUCCAA79.97912650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7123126CCTCTCCCAAGATTTCCAATTGGAAATCTTGGGAGAGG0.361000.292700.698301.000000.989100.62500


Target Position: 6928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6928GCAUGCCACACUAAUACUA91.4756570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8956946GCATGCCACACTAATACTATAGTATTAGTGTGGCATGC0.606100.180100.681001.000001.000001.00000


Target Position: 1148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148CAAGGAAUGUUUAAAACAA99.019787

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1146-1168GACAAGGAATGTTTAAAACAAGCUUGUUUUAAACAUUCCUUGUCCAAGGAAUGUUUAAAACAAGCU7.218.722


Target Position: 4652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4652CUUUUUUGUUGUUGUUGUU77.92583148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4650-4672TACTTTTTTGTTGTTGTTGTTGTAACAACAACAACAAAAAAGUACUUUUUUGUUGUUGUUGUUGUU19.3-2.900


Target Position: 6256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6256GUAUGUCUUCGGCUAAUGU82.33952109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6254-6276CAGTATGTCTTCGGCTAATGTGTACAUUAGCCGAAGACAUACUGGUAUGUCUUCGGCUAAUGUGUU19.720.333


Target Position: 785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785CAUAGUAGAUAUACAUGAA107.7044

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
783-805CGCATAGTAGATATACATGAACTUUCAUGUAUAUCUACUAUGCGCAUAGUAGAUAUACAUGAACUU21.511.222


Target Position: 756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GCUAAUGAUGUAGAAAAUA89.8586758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
754-776CAGCTAATGATGTAGAAAATATAUAUUUUCUACAUCAUUAGCUGGCUAAUGAUGUAGAAAAUAUAU5.313.413


Target Position: 2289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289CAUAAUAUUACAUUUCAGA90.8306642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2287-2309GTCATAATATTACATTTCAGAGTUCUGAAAUGUAAUAUUAUGACCAUAAUAUUACAUUUCAGAGUU12.0-8.612


Target Position: 500, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500GCAUUAUGAAAUUACAAAA96.8648171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556518GCATTATGAAATTACAAAATTTTGTAATTTCATAATGC0.405300.217400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
498-520CGGCATTATGAAATTACAAAACAUUUUGUAAUUUCAUAAUGCCGGCAUUAUGAAAUUACAAAACAU7.25.632


Target Position: 2139, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139CACUUCUAUGAUUUUGAAA89.4502820

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2137-2159ACCACTTCTATGATTTTGAAAGAUUUCAAAAUCAUAGAAGUGGUCACUUCUAUGAUUUUGAAAGAU7.718.932


Target Position: 5144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5144GGCAUAUAUUAAAUUAUUA102.92426

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5142-5164CTGGCATATATTAAATTATTATAUAAUAAUUUAAUAUAUGCCAGGGCAUAUAUUAAAUUAUUAUAU-10.316.511


Target Position: 4172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4172AGUAUAAGACAAUGAAUUU87.42141101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6504190AGTATAAGACAATGAATTTAAATTCATTGTCTTATACT0.523800.230200.706900.750001.000001.00000


Target Position: 4718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4718CCCCACACACCCAAACAAA84.23541713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9144736CCCCACACACCCAAACAAATTTGTTTGGGTGTGTGGGG0.313200.071600.991401.000001.000001.00000


Target Position: 4406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4406GUUUUUGUAAUUCAAAUUA84.24521710

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4404-4426CAGTTTTTGTAATTCAAATTATGUAAUUUGAAUUACAAAAACUGGUUUUUGUAAUUCAAAUUAUGU7.45.631


Target Position: 5877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5877AGUCUAUCCUAUUUUCUUA97.1843157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9835895AGTCTATCCTATTTTCTTATAAGAAAATAGGATAGACT0.643600.368400.672400.750001.000001.00000


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969CGUUUCCUUAGUCAGUUAU78.97512879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708987CGTTTCCTTAGTCAGTTATATAACTGACTAAGGAAACG0.338900.193800.732801.000001.000001.00000


Target Position: 5393, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5393GUAUACAGUUUGUUAAGGU80.76992460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5391-5413AAGTATACAGTTTGTTAAGGTTTACCUUAACAAACUGUAUACUUGUAUACAGUUUGUUAAGGUUUU18.613.113


Target Position: 5722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5722CAUUAGAGACAUUUUUAGA94.9772266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5720-5742ACCATTAGAGACATTTTTAGAAGUCUAAAAAUGUCUCUAAUGGUCAUUAGAGACAUUUUUAGAAGU-3.811.632


Target Position: 5409, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5409GGUUUAUAUUGAACAUUCU91.7291551

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5407-5429AAGGTTTATATTGAACATTCTACAGAAUGUUCAAUAUAAACCUUGGUUUAUAUUGAACAUUCUACU14.81.412


Target Position: 2923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2923GGAGGAAAGUAGCAGAAAU96.2205207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622941GGAGGAAAGTAGCAGAAATATTTCTGCTACTTTCCTCC0.452200.204600.862101.000001.000001.00000


Target Position: 4597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4597GUUUACAGAUUAUUACGGU76.91913384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4595-4617CTGTTTACAGATTATTACGGTGAACCGUAAUAAUCUGUAAACAGGUUUACAGAUUAUUACGGUGAU20.611.823


Target Position: 6177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6177CAUGGAUUACUUCUCUUUU86.40051268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6175-6197CTCATGGATTACTTCTCTTTTTAAAAAGAGAAGUAAUCCAUGAGCAUGGAUUACUUCUCUUUUUAU19.120.112


Target Position: 7310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7310CUUUUAACAUAUAUUGUGU82.29942116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7308-7330TTCTTTTAACATATATTGTGTGAACACAAUAUAUGUUAAAAGAACUUUUAACAUAUAUUGUGUGAU13.50.022


Target Position: 4173, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4173GUAUAAGACAAUGAAUUUU82.10092149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8734191GTATAAGACAATGAATTTTAAAATTCATTGTCTTATAC0.521800.233600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4171-4193CAGTATAAGACAATGAATTTTAAAAAAUUCAUUGUCUUAUACUGGUAUAAGACAAUGAAUUUUAAU7.48.422


Target Position: 1034, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034CAAAGAAGCUGUUCAAUAU96.5996182

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1103419CAAAGAAGCTGTTCAATAT1/1/0/0100.00SOS1NM_005633.31NANANA2:39262416..39262434(-)00SOS1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1032-1054TTCAAAGAAGCTGTTCAATATGTAUAUUGAACAGCUUCUUUGAACAAAGAAGCUGUUCAAUAUGUU8.910.322


Target Position: 7626, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7626CCUUAUUUUCCAUUUUUGA82.81982008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7624-7646TGCCTTATTTTCCATTTTTGACAUCAAAAAUGGAAAAUAAGGCACCUUAUUUUCCAUUUUUGACAU-3.3-4.322


Target Position: 2764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764GUGAAGAUCACUAUAAGAA94.3186318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2762-2784GAGTGAAGATCACTATAAGAAATUUCUUAUAGUGAUCUUCACUCGUGAAGAUCACUAUAAGAAAUU8.420.422


Target Position: 2542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542GGUUUGAGAAAUGUAUUGU79.13192846

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2540-2562GTGGTTTGAGAAATGTATTGTAGACAAUACAUUUCUCAAACCACGGUUUGAGAAAUGUAUUGUAGU13.519.213


Target Position: 7989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7989CAGAGAAUUUGUUUGUCAA100.35355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7987-8009ACCAGAGAATTTGTTTGTCAAAGUUGACAAACAAAUUCUCUGGUCAGAGAAUUUGUUUGUCAAAGU20.519.122


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CUGGUUGGGAAUUAUGUAA84.76351589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906489CTGGTTGGGAATTATGTAATTACATAATTCCCAACCAG0.271200.077200.750000.750001.000001.00000


Target Position: 6652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6652GAUAAAUGCAUCAUUACAA99.310982

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6650-6672GAGATAAATGCATCATTACAAAAUUGUAAUGAUGCAUUUAUCUCGAUAAAUGCAUCAUUACAAAAU13.5-1.822


Target Position: 6569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6569CAAUAUGAAACAUUAACUA97.0056164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6567-6589CTCAATATGAAACATTAACTAGTUAGUUAAUGUUUCAUAUUGAGCAAUAUGAAACAUUAACUAGUU4.68.722


Target Position: 7602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7602GUAACUUGUUUAGUAAAUU82.6452037

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7600-7622TTGTAACTTGTTTAGTAAATTCCAAUUUACUAAACAAGUUACAAGUAACUUGUUUAGUAAAUUCCU4.611.812


Target Position: 2549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GAAAUGUAUUGUAGAAACU87.31651119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2547-2569GAGAAATGTATTGTAGAAACTGAAGUUUCUACAAUACAUUUCUCGAAAUGUAUUGUAGAAACUGAU14.66.922


Target Position: 5578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5578GAAGAGAAAACAUUUUAUU86.82211196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5576-5598TTGAAGAGAAAACATTTTATTAAAAUAAAAUGUUUUCUCUUCAAGAAGAGAAAACAUUUUAUUAAU-10.319.121


Target Position: 1092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CUCCAUUACUUUGAACUUU75.77093661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1090-1112GTCTCCATTACTTTGAACTTTTGAAAGUUCAAAGUAAUGGAGACCUCCAUUACUUUGAACUUUUGU19.221.222


Target Position: 3249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3249GAAAGUGAAACAGAAAGUA90.9057630

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3247-3269CTGAAAGTGAAACAGAAAGTACAUACUUUCUGUUUCACUUUCAGGAAAGUGAAACAGAAAGUACAU17.719.222


Target Position: 7597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7597CACUUGUAACUUGUUUAGU73.99834143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7595-7617AGCACTTGTAACTTGTTTAGTAAACUAAACAAGUUACAAGUGCUCACUUGUAACUUGUUUAGUAAU11.819.022


Target Position: 5042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5042CUUGCAUUGCCUAAAUCAU81.85912203

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5040-5062ATCTTGCATTGCCTAAATCATATAUGAUUUAGGCAAUGCAAGAUCUUGCAUUGCCUAAAUCAUAUU8.920.022


Target Position: 5398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5398CAGUUUGUUAAGGUUUAUA88.7645900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5396-5418TACAGTTTGTTAAGGTTTATATTUAUAAACCUUAACAAACUGUACAGUUUGUUAAGGUUUAUAUUU13.917.822


Target Position: 8078, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8078GUUAUUUGCUAAAAUAAUU84.04881756

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8076-8098CGGTTATTTGCTAAAATAATTGTAAUUAUUUUAGCAAAUAACCGGUUAUUUGCUAAAAUAAUUGUU-10.3-1.422


Target Position: 3115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115CAAGAUUUCCAAAAAAAUA93.3916392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3113-3135CCCAAGATTTCCAAAAAAATATAUAUUUUUUUGGAAAUCUUGGGCAAGAUUUCCAAAAAAAUAUAU-12.05.321


Target Position: 5682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5682GAAUAAUGAAGCAACAUUU92.3362491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5680-5702CTGAATAATGAAGCAACATTTCAAAAUGUUGCUUCAUUAUUCAGGAAUAAUGAAGCAACAUUUCAU12.1-1.832


Target Position: 2494, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494CUCCUAAUCUUCUGAAAAU86.91761178

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3249419CTCCTAATCTTCTGAAAAT1/1/0/0100.00SOS1NM_005633.31NANANA2:39237764..39237782(-)00SOS1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2492-2514CTCTCCTAATCTTCTGAAAATGAAUUUUCAGAAGAUUAGGAGAGCUCCUAAUCUUCUGAAAAUGAU12.219.922


Target Position: 5529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5529GUUCUUCUGAGUCUAACAA88.0604992

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5527-5549CTGTTCTTCTGAGTCTAACAAATUUGUUAGACUCAGAAGAACAGGUUCUUCUGAGUCUAACAAAUU20.319.121


Target Position: 6705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6705GUAAAUGCAGCAUGACUUU80.19872601

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6703-6725GGGTAAATGCAGCATGACTTTTTAAAGUCAUGCUGCAUUUACCCGUAAAUGCAGCAUGACUUUUUU19.215.322


Target Position: 6154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6154CUAAGAUUUCUCUUUUUAU89.0461865

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6152-6174CCCTAAGATTTCTCTTTTTATGTAUAAAAAGAGAAAUCUUAGGGCUAAGAUUUCUCUUUUUAUGUU-3.86.922


Target Position: 6443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6443GAGGAUAUUUUUAUUCUGA94.3386313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6441-6463TGGAGGATATTTTTATTCTGAACUCAGAAUAAAAAUAUCCUCCAGAGGAUAUUUUUAUUCUGAACU13.419.922


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914CGGACAUUUCUUACAACAU87.91411013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851932CGGACATTTCTTACAACATATGTTGTAAGAAATGTCCG0.256400.064800.758601.000001.000001.00000


Target Position: 4789, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4789GAAGAACUUUUUAAAAAAA97.128162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4787-4809CAGAAGAACTTTTTAAAAAAAAAUUUUUUUAAAAAGUUCUUCUGGAAGAACUUUUUAAAAAAAAAU-9.117.711


Target Position: 7648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7648CGUAAAGUGCAUUUUCUGU81.0352408

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7646-7668ACCGTAAAGTGCATTTTCTGTCGACAGAAAAUGCACUUUACGGUCGUAAAGUGCAUUUUCUGUCGU12.212.922


Target Position: 8085, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8085GCUAAAAUAAUUGUCAAAA86.90251184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8083-8105TTGCTAAAATAATTGTCAAAAAAUUUUGACAAUUAUUUUAGCAAGCUAAAAUAAUUGUCAAAAAAU20.5-4.321


Target Position: 5019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5019GUAAUCAGCAUAUCUAGAA90.7211659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5017-5039GAGTAATCAGCATATCTAGAATTUUCUAGAUAUGCUGAUUACUCGUAAUCAGCAUAUCUAGAAUUU20.213.432


Target Position: 5437, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5437GAGGUUUUCUGCUUUAUCA95.3465249

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5435-5457TTGAGGTTTTCTGCTTTATCAAAUGAUAAAGCAGAAAACCUCAAGAGGUUUUCUGCUUUAUCAAAU6.917.322


Target Position: 6339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6339GAUUUGGAGUUCUAAUCCU84.54391642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6337-6359CAGATTTGGAGTTCTAATCCTATAGGAUUAGAACUCCAAAUCUGGAUUUGGAGUUCUAAUCCUAUU19.920.132


Target Position: 6901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6901CUUUAAUGGAUCUGAAUUU81.3082336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6899-6921TGCTTTAATGGATCTGAATTTGAAAAUUCAGAUCCAUUAAAGCACUUUAAUGGAUCUGAAUUUGAU12.0-1.432


Target Position: 4649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4649GUACUUUUUUGUUGUUGUU80.8042452

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4647-4669AGGTACTTTTTTGTTGTTGTTGTAACAACAACAAAAAAGUACCUGUACUUUUUUGUUGUUGUUGUU19.34.911


Target Position: 1118, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118GUUAGAAGAAAAAAGUGAA92.9306439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1116-1138CAGTTAGAAGAAAAAAGTGAAGAUUCACUUUUUUCUUCUAACUGGUUAGAAGAAAAAAGUGAAGAU19.211.712


Target Position: 3448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448CAUCUAUAAGUUUAACCAA97.6177136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3446-3468ATCATCTATAAGTTTAACCAAAGUUGGUUAAACUUAUAGAUGAUCAUCUAUAAGUUUAACCAAAGU20.08.232


Target Position: 1500, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500GAAUAUCGUCUUAAAGAAA99.513277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1498-1520CAGAATATCGTCTTAAAGAAAAGUUUCUUUAAGACGAUAUUCUGGAAUAUCGUCUUAAAGAAAAGU7.18.822


Target Position: 640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CUUACUAUGAUUUGGUAAA85.93711353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
638-660AACTTACTATGATTTGGTAAAAGUUUACCAAAUCAUAGUAAGUUCUUACUAUGAUUUGGUAAAAGU20.06.332


Target Position: 6044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6044CAUCCAUUCAACAGUAUUU87.64741064

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6042-6064ACCATCCATTCAACAGTATTTATAAAUACUGUUGAAUGGAUGGUCAUCCAUUCAACAGUAUUUAUU11.620.121


Target Position: 478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478GGAAUUAUGUAAGAAAUAU92.6097462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
476-498TGGGAATTATGTAAGAAATATACAUAUUUCUUACAUAAUUCCCAGGAAUUAUGUAAGAAAUAUACU6.91.822


Target Position: 7252, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7252GAAACAGUUUAACCAUUUA97.8761126

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7250-7272AAGAAACAGTTTAACCATTTATTUAAAUGGUUAAACUGUUUCUUGAAACAGUUUAACCAUUUAUUU18.817.812


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356CCCAGUAGAAAAAAUUCAU81.38762311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718374CCCAGTAGAAAAAATTCATATGAATTTTTTCTACTGGG0.334400.109400.836201.000000.994600.75000


Target Position: 514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514CAAAACAAGAUAUUAAAGU75.31093777

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
512-534TACAAAACAAGATATTAAAGTGGACUUUAAUAUCUUGUUUUGUACAAAACAAGAUAUUAAAGUGGU-4.35.622


Target Position: 8137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8137CAAAGUGUGGUCUAUACAU90.7581649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8135-8157AACAAAGTGTGGTCTATACATCTAUGUAUAGACCACACUUUGUUCAAAGUGUGGUCUAUACAUCUU13.117.823


Target Position: 7264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7264CCAUUUAUUUCUUGGUAUU83.68911832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7262-7284AACCATTTATTTCTTGGTATTCTAAUACCAAGAAAUAAAUGGUUCCAUUUAUUUCUUGGUAUUCUU20.0-1.822


Target Position: 6560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6560CCUUCUUCUCAAUAUGAAA95.3576248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6558-6580TGCCTTCTTCTCAATATGAAACAUUUCAUAUUGAGAAGAAGGCACCUUCUUCUCAAUAUGAAACAU8.719.133


Target Position: 4185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4185GAAUUUUAACCUAGAUGUA97.3984147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4183-4205ATGAATTTTAACCTAGATGTAATUACAUCUAGGUUAAAAUUCAUGAAUUUUAACCUAGAUGUAAUU20.3-9.732


Target Position: 7206, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7206GUUGUACAUAUUGAAGAAA86.241301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7204-7226GTGTTGTACATATTGAAGAAAACUUUCUUCAAUAUGUACAACACGUUGUACAUAUUGAAGAAAACU20.420.412


Target Position: 6751, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6751CAUUUCUUUUAGAAAUGAA95.5026233

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6749-6771AACATTTCTTTTAGAAATGAAAAUUCAUUUCUAAAAGAAAUGUUCAUUUCUUUUAGAAAUGAAAAU16.35.321


Target Position: 6888, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6888CAACUCAAGGAUGCUUUAA84.10381745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6886-6908AACAACTCAAGGATGCTTTAATGUUAAAGCAUCCUUGAGUUGUUCAACUCAAGGAUGCUUUAAUGU19.719.222


Target Position: 4426, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4426GCACUUUUAAAAAAAAAAA86.27791292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1784444GCACTTTTAAAAAAAAAAATTTTTTTTTTTAAAAGTGC0.662400.529900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4424-4446ATGCACTTTTAAAAAAAAAAACTUUUUUUUUUUUAAAAGUGCAUGCACUUUUAAAAAAAAAAACUU-11.310.311


Target Position: 8185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8185CAUAGGUAAUCUUUGUACU87.35381112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8183-8205TTCATAGGTAATCTTTGTACTCTAGUACAAAGAUUACCUAUGAACAUAGGUAAUCUUUGUACUCUU14.719.823


Target Position: 6463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6463CUGUUACAUUUAGGUAAAA87.7411045

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6461-6483AACTGTTACATTTAGGTAAAAATUUUUACCUAAAUGUAACAGUUCUGUUACAUUUAGGUAAAAAUU18.620.421


Target Position: 4752, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4752CUUCAAAAAAGAGAAGUUU74.44534017

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4750-4772GCCTTCAAAAAAGAGAAGTTTTGAAACUUCUCUUUUUUGAAGGCCUUCAAAAAAGAGAAGUUUUGU17.77.721


Target Position: 5952, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5952CCAUUCUUCUCUUUAUAAA93.4688386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2115970CCATTCTTCTCTTTATAAATTTATAAAGAGAAGAATGG0.846900.548300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5950-5972AGCCATTCTTCTCTTTATAAAATUUUAUAAAGAGAAGAAUGGCUCCAUUCUUCUCUUUAUAAAAUU-7.512.032


Target Position: 4791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4791AGAACUUUUUAAAAAAAAA89.5899797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254809AGAACTTTTTAAAAAAAAATTTTTTTTTAAAAAGTTCT0.731700.163200.724100.750001.000001.00000


Target Position: 2229, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229GUUGAAUCCAUCACUAAAA90.9398625

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2227-2249GGGTTGAATCCATCACTAAAATAUUUUAGUGAUGGAUUCAACCCGUUGAAUCCAUCACUAAAAUAU11.816.333


Target Position: 4404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4404CAGUUUUUGUAAUUCAAAU88.4353945

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4402-4424GACAGTTTTTGTAATTCAAATTAAUUUGAAUUACAAAAACUGUCCAGUUUUUGUAAUUCAAAUUAU7.43.221


Target Position: 7038, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7038CAAAAAUUACCUUAUGUAA96.817173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7036-7058ATCAAAAATTACCTTATGTAAACUUACAUAAGGUAAUUUUUGAUCAAAAAUUACCUUAUGUAAACU8.5-12.032


Target Position: 831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831GAAGAUACAGUAGAAAUGA90.7496654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
829-851TAGAAGATACAGTAGAAATGACAUCAUUUCUACUGUAUCUUCUAGAAGAUACAGUAGAAAUGACAU12.014.521


Target Position: 7086, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7086GAUCUUAAUUCUCAAGUUU89.1728849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7084-7106ATGATCTTAATTCTCAAGTTTAGAAACUUGAGAAUUAAGAUCAUGAUCUUAAUUCUCAAGUUUAGU19.26.922


Target Position: 179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
179GUAUGUUGAAGAAUUAAUU86.74741211

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
177-199CAGTATGTTGAAGAATTAATTTTAAUUAAUUCUUCAACAUACUGGUAUGUUGAAGAAUUAAUUUUU-10.313.511


Target Position: 7058, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7058CCAAAAAUUAGUUGGUAUU79.25632812

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7056-7078AACCAAAAATTAGTTGGTATTTAAAUACCAACUAAUUUUUGGUUCCAAAAAUUAGUUGGUAUUUAU20.0-3.312


Target Position: 7113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7113CUUGUAUUUCAUUGUUUGU74.79873915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7111-7133ATCTTGTATTTCATTGTTTGTCTACAAACAAUGAAAUACAAGAUCUUGUAUUUCAUUGUUUGUCUU12.26.922


Target Position: 6465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6465GUUACAUUUAGGUAAAAAU87.11321148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6463-6485CTGTTACATTTAGGTAAAAATATAUUUUUACCUAAAUGUAACAGGUUACAUUUAGGUAAAAAUAUU0.06.922


Target Position: 4226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4226CCAGUUUAGAAUAUGGAAA87.2981120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4224-4246TTCCAGTTTAGAATATGGAAAGAUUUCCAUAUUCUAAACUGGAACCAGUUUAGAAUAUGGAAAGAU21.211.822


Target Position: 6158, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6158GAUUUCUCUUUUUAUGUCU81.60642264

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6156-6178AAGATTTCTCTTTTTATGTCTCAAGACAUAAAAAGAGAAAUCUUGAUUUCUCUUUUUAUGUCUCAU16.114.822


Target Position: 201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
201CAAUUAUUAAAUAUGCUAU91.4695571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
199-221TGCAATTATTAAATATGCTATGCAUAGCAUAUUUAAUAAUUGCACAAUUAUUAAAUAUGCUAUGCU20.9-10.322


Target Position: 2565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565ACUGAAAAUUUAGAAGAAA86.01811341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412583ACTGAAAATTTAGAAGAAATTTCTTCTAAATTTTCAGT0.377500.288200.706900.750001.000001.00000


Target Position: 2174, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174GCAACGAAUGGAAGAAUUU82.01242172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2172-2194TTGCAACGAATGGAAGAATTTATAAAUUCUUCCAUUCGUUGCAAGCAACGAAUGGAAGAAUUUAUU5.321.122


Target Position: 1143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143GAAGACAAGGAAUGUUUAA92.3847487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1141-1163AAGAAGACAAGGAATGTTTAAAAUUAAACAUUCCUUGUCUUCUUGAAGACAAGGAAUGUUUAAAAU6.919.222


Target Position: 5439, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5439GGUUUUCUGCUUUAUCAAA94.6875284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5437-5459GAGGTTTTCTGCTTTATCAAAACUUUGAUAAAGCAGAAAACCUCGGUUUUCUGCUUUAUCAAAACU8.913.312


Target Position: 8037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8037GUUUGUGUAUAUAUGUGUA99.429479

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8035-8057GTGTTTGTGTATATATGTGTATTUACACAUAUAUACACAAACACGUUUGUGUAUAUAUGUGUAUUU20.419.311


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973UCCUUAGUCAGUUAUCAAA83.17981931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579991TCCTTAGTCAGTTATCAAATTTGATAACTGACTAAGGA0.538300.250500.870700.750001.000001.00000


Target Position: 1168, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CAAUAACAGCUUUGCUUAA94.8128278

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9116819CAATAACAGCTTTGCTTAA1/1/0/097.75SOS1NM_005633.31NANANA2:39251208..39251226(-)00SOS1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1166-1188AGCAATAACAGCTTTGCTTAATGUUAAGCAAAGCUGUUAUUGCUCAAUAACAGCUUUGCUUAAUGU19.76.922


Target Position: 2602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2602GAAUUAUUGAGAUUCUACA97.1587160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2600-2622TCGAATTATTGAGATTCTACAAGUGUAGAAUCUCAAUAAUUCGAGAAUUAUUGAGAUUCUACAAGU14.5-10.332


Target Position: 6306, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6306CAACCUAUCUAGUCUAUAA108.6951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6304-6326TTCAACCTATCTAGTCTATAAAGUUAUAGACUAGAUAGGUUGAACAACCUAUCUAGUCUAUAAAGU15.818.523


Target Position: 7495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7495CUUUUAAGAUUAUUUCAUA97.991121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7493-7515AACTTTTAAGATTATTTCATAATUAUGAAAUAAUCUUAAAAGUUCUUUUAAGAUUAUUUCAUAAUU7.2-3.822


Target Position: 4498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4498CUUUAGAAUAUUUUCUUAA90.7293658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4496-4518TACTTTAGAATATTTTCTTAAAAUUAAGAAAAUAUUCUAAAGUACUUUAGAAUAUUUUCUUAAAAU7.17.112


Target Position: 4469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4469CCUUUGUUUUCCUUUGCUU78.15363078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7024487CCTTTGTTTTCCTTTGCTTAAGCAAAGGAAAACAAAGG0.803500.209000.706901.000001.000001.00000


Target Position: 5447, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5447GCUUUAUCAAAACUAUUCA89.0263870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5445-5467CTGCTTTATCAAAACTATTCATAUGAAUAGUUUUGAUAAAGCAGGCUUUAUCAAAACUAUUCAUAU14.56.922


Target Position: 7304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7304CUUAUUCUUUUAACAUAUA91.0492614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7302-7324TACTTATTCTTTTAACATATATTUAUAUGUUAAAAGAAUAAGUACUUAUUCUUUUAACAUAUAUUU6.76.922


Target Position: 5448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5448CUUUAUCAAAACUAUUCAU84.17711730

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5446-5468TGCTTTATCAAAACTATTCATAAAUGAAUAGUUUUGAUAAAGCACUUUAUCAAAACUAUUCAUAAU13.48.922


Target Position: 8310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8310AGCCCACAAAAAAAAAAAA81.77792228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8128328AGCCCACAAAAAAAAAAAATTTTTTTTTTTTGTGGGCT0.998000.964100.853400.750001.000001.00000


Target Position: 1507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507GUCUUAAAGAAAAGUUUUU77.18663320

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1505-1527TCGTCTTAAAGAAAAGTTTTTTAAAAAACUUUUCUUUAAGACGAGUCUUAAAGAAAAGUUUUUUAU3.27.121


Target Position: 7289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7289CUGUGAAUAGGUUUACUUA98.0062119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7287-7309TGCTGTGAATAGGTTTACTTATTUAAGUAAACCUAUUCACAGCACUGUGAAUAGGUUUACUUAUUU4.920.532


Target Position: 1506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506CGUCUUAAAGAAAAGUUUU82.86552000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1504-1526ATCGTCTTAAAGAAAAGTTTTTTAAAACUUUUCUUUAAGACGAUCGUCUUAAAGAAAAGUUUUUUU3.214.611


Target Position: 727, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727CCUUUGUCUCCAAUUCAAA89.7953768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816745CCTTTGTCTCCAATTCAAATTTGAATTGGAGACAAAGG0.298600.145000.844801.000000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
725-747GCCCTTTGTCTCCAATTCAAAATUUUGAAUUGGAGACAAAGGGCCCUUUGUCUCCAAUUCAAAAUU7.419.222


Target Position: 7877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7877CAAAUGUGCCUUUAAUUAA93.7428360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7875-7897GCCAAATGTGCCTTTAATTAAGAUUAAUUAAAGGCACAUUUGGCCAAAUGUGCCUUUAAUUAAGAU-7.512.122


Target Position: 3050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050GGAAUUUACAGAUUAUCUU88.4958936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3048-3070AAGGAATTTACAGATTATCTTTTAAGAUAAUCUGUAAAUUCCUUGGAAUUUACAGAUUAUCUUUUU6.62.122


Target Position: 2470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470CAAAAGAAGACAAAGAAAU82.921990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2468-2490GACAAAAGAAGACAAAGAAATTAAUUUCUUUGUCUUCUUUUGUCCAAAAGAAGACAAAGAAAUUAU5.55.511


Target Position: 1167, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GCAAUAACAGCUUUGCUUA92.256496

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1165-1187AAGCAATAACAGCTTTGCTTAATUAAGCAAAGCUGUUAUUGCUUGCAAUAACAGCUUUGCUUAAUU18.66.922


Target Position: 5378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5378GUUCCUAAGCAACAAGUAU85.04841527

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5376-5398AAGTTCCTAAGCAACAAGTATACAUACUUGUUGCUUAGGAACUUGUUCCUAAGCAACAAGUAUACU19.019.922


Target Position: 2633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633GUUGAACAACUUUAAUGGU74.73093932

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2631-2653GAGTTGAACAACTTTAATGGTGTACCAUUAAAGUUGUUCAACUCGUUGAACAACUUUAAUGGUGUU12.820.523


Target Position: 174, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174CUUCAGUAUGUUGAAGAAU77.23393308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
172-194CTCTTCAGTATGTTGAAGAATTAAUUCUUCAACAUACUGAAGAGCUUCAGUAUGUUGAAGAAUUAU20.420.322


Target Position: 2892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892CAUGGAAAAGAGCUUAUAA100.0667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2890-2912GACATGGAAAAGAGCTTATAAACUUAUAAGCUCUUUUCCAUGUCCAUGGAAAAGAGCUUAUAAACU14.920.122


Target Position: 5251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5251GUUUCUAGUUCUGGAUAUA93.9588342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5249-5271TGGTTTCTAGTTCTGGATATATGUAUAUCCAGAACUAGAAACCAGUUUCUAGUUCUGGAUAUAUGU21.211.732


Target Position: 648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648GAUUUGGUAAAAGCAUUUA85.89511362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
646-668ATGATTTGGTAAAAGCATTTATGUAAAUGCUUUUACCAAAUCAUGAUUUGGUAAAAGCAUUUAUGU18.518.822


Target Position: 4221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4221GUAUUCCAGUUUAGAAUAU83.791804

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4219-4241TGGTATTCCAGTTTAGAATATGGAUAUUCUAAACUGGAAUACCAGUAUUCCAGUUUAGAAUAUGGU8.421.232


Target Position: 1313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313GAUUCAGAAGAAUAUUGAU96.6286181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1311-1333GAGATTCAGAAGAATATTGATGGAUCAAUAUUCUUCUGAAUCUCGAUUCAGAAGAAUAUUGAUGGU8.720.413


Target Position: 2895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895GGAAAAGAGCUUAUAAACU86.44491260

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2893-2915ATGGAAAAGAGCTTATAAACTTTAGUUUAUAAGCUCUUUUCCAUGGAAAAGAGCUUAUAAACUUUU1.414.822


Target Position: 7258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7258GUUUAACCAUUUAUUUCUU83.17271934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7256-7278CAGTTTAACCATTTATTTCTTGGAAGAAAUAAAUGGUUAAACUGGUUUAACCAUUUAUUUCUUGGU6.914.012


Target Position: 3398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3398CGUCUUUAUCCAAGUUACU81.11642387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3396-3418ACCGTCTTTATCCAAGTTACTCTAGUAACUUGGAUAAAGACGGUCGUCUUUAUCCAAGUUACUCUU12.914.633


Target Position: 5879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5879UCUAUCCUAUUUUCUUAUU69.22975291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5835897TCTATCCTATTTTCTTATTAATAAGAAAATAGGATAGA0.638500.383900.715500.750001.000001.00000


Target Position: 6715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6715CAUGACUUUUUGUUAACCA85.93361355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6713-6735AGCATGACTTTTTGTTAACCACAUGGUUAACAAAAAGUCAUGCUCAUGACUUUUUGUUAACCACAU21.119.232


Target Position: 5316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5316GAAGAUACUUGGUUAGAAU97.8553127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5314-5336AGGAAGATACTTGGTTAGAATAGAUUCUAACCAAGUAUCUUCCUGAAGAUACUUGGUUAGAAUAGU14.614.522


Target Position: 6748, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6748GAACAUUUCUUUUAGAAAU90.3771698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6746-6768TGGAACATTTCTTTTAGAAATGAAUUUCUAAAAGAAAUGUUCCAGAACAUUUCUUUUAGAAAUGAU7.15.321


Target Position: 6460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6460GAACUGUUACAUUUAGGUA98.6044102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6458-6480CTGAACTGTTACATTTAGGTAAAUACCUAAAUGUAACAGUUCAGGAACUGUUACAUUUAGGUAAAU18.617.822


Target Position: 631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631GAGAACAAACUUACUAUGA87.7481043

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
629-651AGGAGAACAAACTTACTATGATTUCAUAGUAAGUUUGUUCUCCUGAGAACAAACUUACUAUGAUUU13.119.222


Target Position: 5951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5951GCCAUUCUUCUCUUUAUAA93.3739393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1455969GCCATTCTTCTCTTTATAATTATAAAGAGAAGAATGGC0.834000.522200.965501.000001.000001.00000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073GGCCCCUGUUUACCACUGU72.1044609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6891091GGCCCCTGTTTACCACTGTACAGTGGTAAACAGGGGCC0.490100.116300.793100.750000.951100.62500


Target Position: 7685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7685CCUUUUGCCUUUAAUGAAA86.4631257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7683-7705TCCCTTTTGCCTTTAATGAAAATUUUCAUUAAAGGCAAAAGGGACCUUUUGCCUUUAAUGAAAAUU8.918.612


Target Position: 5176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5176GUUGAUUCUUAUUUCUUUU83.46631882

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5174-5196TGGTTGATTCTTATTTCTTTTAGAAAAGAAAUAAGAAUCAACCAGUUGAUUCUUAUUUCUUUUAGU5.516.321


Target Position: 5264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5264GAUAUAUGUAUUAAUCUUA101.87933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5262-5284TGGATATATGTATTAATCTTAAAUAAGAUUAAUACAUAUAUCCAGAUAUAUGUAUUAAUCUUAAAU6.9-0.322


Target Position: 4094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4094CAAUGGAUGCACUGAAUGU87.34011113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4092-4114GGCAATGGATGCACTGAATGTGCACAUUCAGUGCAUCCAUUGCCCAAUGGAUGCACUGAAUGUGCU18.120.113


Target Position: 5387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5387CAACAAGUAUACAGUUUGU87.65111062

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5385-5407AGCAACAAGTATACAGTTTGTTAACAAACUGUAUACUUGUUGCUCAACAAGUAUACAGUUUGUUAU16.717.832


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727CGCCAGAAGAAAAUUUUAG71.23074840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642745CGCCAGAAGAAAATTTTAGCTAAAATTTTCTTCTGGCG0.457700.130600.750000.750001.000001.00000


Target Position: 5984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5984GAAAAGCGUCCUAAAACAU86.24221300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5982-6004TTGAAAAGCGTCCTAAAACATTAAUGUUUUAGGACGCUUUUCAAGAAAAGCGUCCUAAAACAUUAU7.219.132


Target Position: 2228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228GGUUGAAUCCAUCACUAAA103.23617

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2226-2248TGGGTTGAATCCATCACTAAAATUUUAGUGAUGGAUUCAACCCAGGUUGAAUCCAUCACUAAAAUU20.314.843


Target Position: 3622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622CACGAUAUUCAAUAUCAGA93.8399353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3620-3642ACCACGATATTCAATATCAGACCUCUGAUAUUGAAUAUCGUGGUCACGAUAUUCAAUAUCAGACCU13.316.432


Target Position: 7298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7298GGUUUACUUAUUCUUUUAA94.0438334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7296-7318TAGGTTTACTTATTCTTTTAACAUUAAAAGAAUAAGUAAACCUAGGUUUACUUAUUCUUUUAACAU7.112.922


Target Position: 416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416GGUUUCUGUUUACAUAGUA95.7835224

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
414-436CAGGTTTCTGTTTACATAGTAGCUACUAUGUAAACAGAAACCUGGGUUUCUGUUUACAUAGUAGCU19.019.222


Target Position: 7896, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7896GAACAUCUCUAAUUUUUUU90.9756621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7894-7916AAGAACATCTCTAATTTTTTTCTAAAAAAAUUAGAGAUGUUCUUGAACAUCUCUAAUUUUUUUCUU-12.019.222


Target Position: 6181, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6181GAUUACUUCUCUUUUUAAU89.0342868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9356199GATTACTTCTCTTTTTAATATTAAAAAGAGAAGTAATC0.351600.259100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6179-6201TGGATTACTTCTCTTTTTAATTGAUUAAAAAGAGAAGUAAUCCAGAUUACUUCUCUUUUUAAUUGU-9.14.621


Target Position: 4794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4794ACUUUUUAAAAAAAAAUAA81.28592339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9934812ACTTTTTAAAAAAAAATAATTATTTTTTTTTAAAAAGT0.568000.100200.672400.750001.000001.00000


Target Position: 7719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7719GCCAAUUGCUGCAGAAUUA92.054520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7717-7739TAGCCAATTGCTGCAGAATTATAUAAUUCUGCAGCAAUUGGCUAGCCAAUUGCUGCAGAAUUAUAU12.017.722


Target Position: 8121, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8121GUCUUUGAUGUAAGAACAA88.7542902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8119-8141CGGTCTTTGATGTAAGAACAAAGUUGUUCUUACAUCAAAGACCGGUCUUUGAUGUAAGAACAAAGU19.220.412


Target Position: 3534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534GAAUCUUCACCAUCUAAGA94.3525312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3532-3554CAGAATCTTCACCATCTAAGATTUCUUAGAUGGUGAAGAUUCUGGAAUCUUCACCAUCUAAGAUUU11.614.822


Target Position: 1095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095CAUUACUUUGAACUUUUGA81.72082243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1093-1115TCCATTACTTTGAACTTTTGAAGUCAAAAGUUCAAAGUAAUGGACAUUACUUUGAACUUUUGAAGU10.34.632


Target Position: 7691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7691GCCUUUAAUGAAAAUAGUG74.09264117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9477709GCCTTTAATGAAAATAGTGCACTATTTTCATTAAAGGC0.621000.068400.706900.750001.000001.00000


Target Position: 6086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6086GCUACAACUAAUCAUGAUA95.6249230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8466104GCTACAACTAATCATGATATATCATGATTAGTTGTAGC0.290400.217000.810301.000001.000001.00000


Target Position: 5912, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5912GAAUCCUUUCUCAAUAUCU86.82281195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5910-5932TTGAATCCTTTCTCAATATCTGTAGAUAUUGAGAAAGGAUUCAAGAAUCCUUUCUCAAUAUCUGUU8.718.732


Target Position: 8076, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8076CGGUUAUUUGCUAAAAUAA95.3315253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8074-8096CACGGTTATTTGCTAAAATAATTUUAUUUUAGCAAAUAACCGUGCGGUUAUUUGCUAAAAUAAUUU-7.513.922


Target Position: 7480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7480ACAUCUCAUUACUAACUUU89.7692776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6437498ACATCTCATTACTAACTTTAAAGTTAGTAATGAGATGT0.856900.410300.706900.750001.000001.00000


Target Position: 7242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7242GAUUUAGAAAGAAACAGUU87.76141038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7240-7262CAGATTTAGAAAGAAACAGTTTAAACUGUUUCUUUCUAAAUCUGGAUUUAGAAAGAAACAGUUUAU17.86.922


Target Position: 7350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7350GUUGUAUUGCAUUAAUCUU84.74121597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7348-7370CTGTTGTATTGCATTAATCTTTAAAGAUUAAUGCAAUACAACAGGUUGUAUUGCAUUAAUCUUUAU6.96.922


Target Position: 582, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582GAAGAUAUUAAUAUAUUAU98.2095113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
580-602TAGAAGATATTAATATATTATCTAUAAUAUAUUAAUAUCUUCUAGAAGAUAUUAAUAUAUUAUCUU-5.96.612


Target Position: 2766, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2766GAAGAUCACUAUAAGAAAU95.9399220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2764-2786GTGAAGATCACTATAAGAAATATAUUUCUUAUAGUGAUCUUCACGAAGAUCACUAUAAGAAAUAUU7.120.423


Target Position: 7414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7414GAAUUAUGCAGUAAAGUUA99.492778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7412-7434AAGAATTATGCAGTAAAGTTATTUAACUUUACUGCAUAAUUCUUGAAUUAUGCAGUAAAGUUAUUU4.9-1.823


Target Position: 2187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187GAAUUUAUUGGAACAGUAA98.2101112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2185-2207AAGAATTTATTGGAACAGTAAGAUUACUGUUCCAAUAAAUUCUUGAAUUUAUUGGAACAGUAAGAU19.0-10.323


Target Position: 5947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5947GGUAGCCAUUCUUCUCUUU84.41851668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6095965GGTAGCCATTCTTCTCTTTAAAGAGAAGAATGGCTACC0.846900.122800.853401.000001.000001.00000


Target Position: 8269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8269CUAAGAUAAACUGAAAAAU80.04962636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8267-8289TACTAAGATAAACTGAAAAATAAAUUUUUCAGUUUAUCUUAGUACUAAGAUAAACUGAAAAAUAAU7.78.422


Target Position: 1956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956GAACUACUGAGUCUUAUAA99.349381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1954-1976AAGAACTACTGAGTCTTATAATAUUAUAAGACUCAGUAGUUCUUGAACUACUGAGUCUUAUAAUAU8.417.623


Target Position: 6964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6964GAGAACAAUUACUAUGUCA97.1903156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6962-6984CAGAGAACAATTACTATGTCAGCUGACAUAGUAAUUGUUCUCUGGAGAACAAUUACUAUGUCAGCU20.319.233


Target Position: 8005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8005CAAAGUGACAUGUAUAAUU89.4946815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8003-8025GTCAAAGTGACATGTATAATTTTAAUUAUACAUGUCACUUUGACCAAAGUGACAUGUAUAAUUUUU1.119.222


Target Position: 2978, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2978CUGUUUACGAGUAGAAUCA84.76461588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2976-2998TACTGTTTACGAGTAGAATCAGAUGAUUCUACUCGUAAACAGUACUGUUUACGAGUAGAAUCAGAU16.014.733


Target Position: 2496, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496CCUAAUCUUCUGAAAAUGA87.26071124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2494-2516CTCCTAATCTTCTGAAAATGATTUCAUUUUCAGAAGAUUAGGAGCCUAAUCUUCUGAAAAUGAUUU7.411.622


Target Position: 7027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7027CCUCCAUAAAUCAAAAAUU82.93231984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7017045CCTCCATAAATCAAAAATTAATTTTTGATTTATGGAGG0.342700.236100.836201.000001.000001.00000


Target Position: 5115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5115GAAUAAAGAUACAAAUACU100.26257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5113-5135TTGAATAAAGATACAAATACTTTAGUAUUUGUAUCUUUAUUCAAGAAUAAAGAUACAAAUACUUUU6.9-4.322


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671AGAAAUUCGACAAUAUAUA89.1764848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872689AGAAATTCGACAATATATATATATATTGTCGAATTTCT0.661400.485600.681000.750001.000001.00000


Target Position: 7227, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7227CUUUUUGUUCCUUCAGAUU76.33273524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7225-7247ACCTTTTTGTTCCTTCAGATTTAAAUCUGAAGGAACAAAAAGGUCUUUUUGUUCCUUCAGAUUUAU20.45.622


Target Position: 8077, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8077GGUUAUUUGCUAAAAUAAU89.9455750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8075-8097ACGGTTATTTGCTAAAATAATTGAUUAUUUUAGCAAAUAACCGUGGUUAUUUGCUAAAAUAAUUGU-9.7-0.322


Target Position: 6843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6843GGUUGUUGGGCAUCAAAUU84.90631558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6841-6863AAGGTTGTTGGGCATCAAATTATAAUUUGAUGCCCAACAACCUUGGUUGUUGGGCAUCAAAUUAUU7.219.332


Target Position: 4418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4418CAAAUUAUGCACUUUUAAA96.1937208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4416-4438TTCAAATTATGCACTTTTAAAAAUUUAAAAGUGCAUAAUUUGAACAAAUUAUGCACUUUUAAAAAU-3.8-10.322


Target Position: 7048, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7048CUUAUGUAAACCAAAAAUU76.67033439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7046-7068ACCTTATGTAAACCAAAAATTAGAAUUUUUGGUUUACAUAAGGUCUUAUGUAAACCAAAAAUUAGU-3.38.512


Target Position: 6782, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6782CUGAUGUAUUUUAAGACUA90.7455655

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6780-6802GGCTGATGTATTTTAAGACTACAUAGUCUUAAAAUACAUCAGCCCUGAUGUAUUUUAAGACUACAU18.921.523


Target Position: 3543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3543CCAUCUAAGAUUAUGUCUA94.5029303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3541-3563CACCATCTAAGATTATGTCTAAGUAGACAUAAUCUUAGAUGGUGCCAUCUAAGAUUAUGUCUAAGU20.313.432


Target Position: 570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570CAUCAAGAUGUAGAAGAUA94.6184295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
568-590TTCATCAAGATGTAGAAGATATTUAUCUUCUACAUCUUGAUGAACAUCAAGAUGUAGAAGAUAUUU19.120.423


Target Position: 6649, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6649GGAGAUAAAUGCAUCAUUA106.4736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9366667GGAGATAAATGCATCATTATAATGATGCATTTATCTCC0.321100.069800.836201.000000.983700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6647-6669GAGGAGATAAATGCATCATTACAUAAUGAUGCAUUUAUCUCCUCGGAGAUAAAUGCAUCAUUACAU13.616.033


Target Position: 2237, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237CAUCACUAAAAUAAUCCAA89.9915739

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2235-2257TCCATCACTAAAATAATCCAAAGUUGGAUUAUUUUAGUGAUGGACAUCACUAAAAUAAUCCAAAGU21.220.322


Target Position: 8182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8182GUUCAUAGGUAAUCUUUGU82.05442164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8180-8202ATGTTCATAGGTAATCTTTGTACACAAAGAUUACCUAUGAACAUGUUCAUAGGUAAUCUUUGUACU12.013.432


Target Position: 5205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5205CACACAAAAACACUAAACA88.8332889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5203-5225AACACACAAAAACACTAAACATAUGUUUAGUGUUUUUGUGUGUUCACACAAAAACACUAAACAUAU12.919.322


Target Position: 566, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GUUUCAUCAAGAUGUAGAA94.6244293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
564-586ATGTTTCATCAAGATGTAGAAGAUUCUACAUCUUGAUGAAACAUGUUUCAUCAAGAUGUAGAAGAU20.316.333


Target Position: 5331, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5331GAAUAGGAUGGGUAUCUUU92.2622494

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5329-5351TAGAATAGGATGGGTATCTTTTAAAAGAUACCCAUCCUAUUCUAGAAUAGGAUGGGUAUCUUUUAU14.519.922


Target Position: 2200, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200CAGUAAGAGGUAAAGCAAU87.66681058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202218CAGTAAGAGGTAAAGCAATATTGCTTTACCTCTTACTG0.451000.121800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2198-2220AACAGTAAGAGGTAAAGCAATGAAUUGCUUUACCUCUUACUGUUCAGUAAGAGGUAAAGCAAUGAU18.618.933


Target Position: 4788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4788AGAAGAACUUUUUAAAAAA94.5954297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9364806AGAAGAACTTTTTAAAAAATTTTTTAAAAAGTTCTTCT0.265200.103600.724100.750001.000001.00000


Target Position: 7562, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7562CAUGAAGUCUAUAUUAUAA106.515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7560-7582AGCATGAAGTCTATATTATAAATUUAUAAUAUAGACUUCAUGCUCAUGAAGUCUAUAUUAUAAAUU-5.919.231


Target Position: 5359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5359CUUUGUAAGUAAGUUUUAA91.413579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5357-5379AACTTTGTAAGTAAGTTTTAAGTUUAAAACUUACUUACAAAGUUCUUUGUAAGUAAGUUUUAAGUU4.97.222


Target Position: 2903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GCUUAUAAACUUUAGCAAA95.3213254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2901-2923GAGCTTATAAACTTTAGCAAAAGUUUGCUAAAGUUUAUAAGCUCGCUUAUAAACUUUAGCAAAAGU19.7-2.332


Target Position: 4201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4201GUAAUUAUACAAUGGAAAU85.92881357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4199-4221ATGTAATTATACAATGGAAATGGAUUUCCAUUGUAUAAUUACAUGUAAUUAUACAAUGGAAAUGGU20.1-8.021


Target Position: 762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762GAUGUAGAAAAUAUAUUUA100.21761

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
760-782ATGATGTAGAAAATATATTTAGTUAAAUAUAUUUUCUACAUCAUGAUGUAGAAAAUAUAUUUAGUU-8.020.302


Target Position: 5483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5483GCAUCAUUACUAUCAUAAU96.6589177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5481-5503CTGCATCATTACTATCATAATATAUUAUGAUAGUAAUGAUGCAGGCAUCAUUACUAUCAUAAUAUU8.713.632


Target Position: 5989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5989GCGUCCUAAAACAUUAAUU79.75432695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6526007GCGTCCTAAAACATTAATTAATTAATGTTTTAGGACGC0.567500.114900.913801.000001.000001.00000


Target Position: 3438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3438GCUUCUGUAUCAUCUAUAA102.9922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373456GCTTCTGTATCATCTATAATTATAGATGATACAGAAGC0.409000.097600.819001.000001.000001.00000


Target Position: 585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585GAUAUUAAUAUAUUAUCUU92.8067448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
583-605AAGATATTAATATATTATCTTTAAAGAUAAUAUAUUAAUAUCUUGAUAUUAAUAUAUUAUCUUUAU6.6-8.022


Target Position: 1579, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1579CUUUUGAAAUAAUUUUAAA92.1524507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1577-1599TGCTTTTGAAATAATTTTAAAAGUUUAAAAUUAUUUCAAAAGCACUUUUGAAAUAAUUUUAAAAGU-9.77.720


Target Position: 7047, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7047CCUUAUGUAAACCAAAAAU81.75112235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7045-7067TACCTTATGTAAACCAAAAATTAAUUUUUGGUUUACAUAAGGUACCUUAUGUAAACCAAAAAUUAU11.511.623


Target Position: 798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798CAUGAACUUAGUGUAAAGU77.3213281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
796-818TACATGAACTTAGTGTAAAGTTAACUUUACACUAAGUUCAUGUACAUGAACUUAGUGUAAAGUUAU11.819.222


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GCAUUUAUGGCAGAAAUUC68.05445569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861678GCATTTATGGCAGAAATTCGAATTTCTGCCATAAATGC0.639800.164000.681000.750001.000001.00000


Target Position: 7441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7441GGAACAUGAUGACUUUAUU95.0623262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7439-7461AGGGAACATGATGACTTTATTCAAAUAAAGUCAUCAUGUUCCCUGGAACAUGAUGACUUUAUUCAU4.620.522


Target Position: 8051, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8051GUGUAUUUGCCUUUGUUUA88.0289996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9318069GTGTATTTGCCTTTGTTTATAAACAAAGGCAAATACAC0.299900.070000.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8049-8071ATGTGTATTTGCCTTTGTTTAGTUAAACAAAGGCAAAUACACAUGUGUAUUUGCCUUUGUUUAGUU5.66.922


Target Position: 672, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672GAAAUUCGACAAUAUAUAA101.67835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
670-692CAGAAATTCGACAATATATAAGGUUAUAUAUUGUCGAAUUUCUGGAAAUUCGACAAUAUAUAAGGU-6.47.423


Target Position: 8281, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8281GAAAAAUAAUAAAGAAAAA98.929389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8279-8301CTGAAAAATAATAAAGAAAAATGUUUUUCUUUAUUAUUUUUCAGGAAAAAUAAUAAAGAAAAAUGU5.5-9.711


Target Position: 5670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5670CAUGUAUCCUCUGAAUAAU89.5826799

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5668-5690TGCATGTATCCTCTGAATAATGAAUUAUUCAGAGGAUACAUGCACAUGUAUCCUCUGAAUAAUGAU8.916.023


Target Position: 6496, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6496GGUAACUGAUUAGAAAAAU84.34531692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6494-6516GTGGTAACTGATTAGAAAAATGCAUUUUUCUAAUCAGUUACCACGGUAACUGAUUAGAAAAAUGCU5.519.023


Target Position: 2547, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547GAGAAAUGUAUUGUAGAAA92.7143457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222565GAGAAATGTATTGTAGAAATTTCTACAATACATTTCTC0.448400.182800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2545-2567TTGAGAAATGTATTGTAGAAACTUUUCUACAAUACAUUUCUCAAGAGAAAUGUAUUGUAGAAACUU20.312.021


Target Position: 1855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855CUGUUAUUAAACUUAUAGA90.2428709

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1853-1875AACTGTTATTAAACTTATAGAGAUCUAUAAGUUUAAUAACAGUUCUGUUAUUAAACUUAUAGAGAU2.86.933


Target Position: 7004, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7004CUAAAUUCUUAAAGGUUUU77.53873228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7002-7024TTCTAAATTCTTAAAGGTTTTTTAAAACCUUUAAGAAUUUAGAACUAAAUUCUUAAAGGUUUUUUU17.32.122


Target Position: 8301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8301GCCUUACAUAGCCCACAAA89.2629840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1988319GCCTTACATAGCCCACAAATTTGTGGGCTATGTAAGGC0.711700.387101.000001.000000.967400.62500


Target Position: 1571, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571CAAGCAUGCUUUUGAAAUA96.9896166

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2157119CAAGCATGCTTTTGAAATA1/1/0/0100.00SOS1NM_005633.31NANANA2:39250021..39250039(-)00SOS1(0.002)


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925AGGAAAGUAGCAGAAAUAA86.76851208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522943AGGAAAGTAGCAGAAATAATTATTTCTGCTACTTTCCT0.935600.260000.810300.750001.000001.00000


Target Position: 2554, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554GUAUUGUAGAAACUGAAAA89.2848835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2552-2574ATGTATTGTAGAAACTGAAAATTUUUUCAGUUUCUACAAUACAUGUAUUGUAGAAACUGAAAAUUU19.28.522


Target Position: 8213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8213GCAGUAUUUGGUUUGCAUU83.25551918

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8211-8233CAGCAGTATTTGGTTTGCATTTAAAUGCAAACCAAAUACUGCUGGCAGUAUUUGGUUUGCAUUUAU20.011.621


Target Position: 363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363GAAAAAAUUCAUCCUUUAU88.3123959

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
361-383TAGAAAAAATTCATCCTTTATTAAUAAAGGAUGAAUUUUUUCUAGAAAAAAUUCAUCCUUUAUUAU19.9-12.022


Target Position: 7730, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7730CAGAAUUAUAAAGCAAAUU77.03643352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7728-7750TGCAGAATTATAAAGCAAATTAGAAUUUGCUUUAUAAUUCUGCACAGAAUUAUAAAGCAAAUUAGU18.56.922


Target Position: 5101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5101GUUUUAAUUUAAUUGAAUA96.7358175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5099-5121CTGTTTTAATTTAATTGAATAAAUAUUCAAUUAAAUUAAAACAGGUUUUAAUUUAAUUGAAUAAAU7.2-9.722


Target Position: 7212, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7212CAUAUUGAAGAAAACCUUU82.41672095

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7210-7232TACATATTGAAGAAAACCTTTTTAAAGGUUUUCUUCAAUAUGUACAUAUUGAAGAAAACCUUUUUU17.38.722


Target Position: 5026, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5026GCAUAUCUAGAAUUAUCUU91.8199543

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5024-5046CAGCATATCTAGAATTATCTTGCAAGAUAAUUCUAGAUAUGCUGGCAUAUCUAGAAUUAUCUUGCU6.613.312


Target Position: 4792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4792GAACUUUUUAAAAAAAAAU82.49532074

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4790-4812AAGAACTTTTTAAAAAAAAATAAAUUUUUUUUUAAAAAGUUCUUGAACUUUUUAAAAAAAAAUAAU-11.33.211


Target Position: 7510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7510CAUAAUCCCUUAUACAUGA92.2068502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7508-7530TTCATAATCCCTTATACATGAGCUCAUGUAUAAGGGAUUAUGAACAUAAUCCCUUAUACAUGAGCU13.315.423


Target Position: 5883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5883UCCUAUUUUCUUAUUUAUU71.93614656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5925901TCCTATTTTCTTATTTATTAATAAATAAGAAAATAGGA0.618000.441600.862100.750001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725GUCGCCAGAAGAAAAUUUU73.34884303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272743GTCGCCAGAAGAAAATTTTAAAATTTTCTTCTGGCGAC0.635700.154500.819000.750001.000001.00000


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286GGUCAUAAUAUUACAUUUC77.71673197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572304GGTCATAATATTACATTTCGAAATGTAATATTATGACC0.562200.221800.681000.750001.000001.00000


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816CCUCCUCCUCAAACACCUU78.36643024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8443834CCTCCTCCTCAAACACCTTAAGGTGTTTGAGGAGGAGG0.290600.305100.706901.000001.000001.00000


Target Position: 186, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186GAAGAAUUAAUUUUGCAAU85.80111374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
184-206TTGAAGAATTAATTTTGCAATTAAUUGCAAAAUUAAUUCUUCAAGAAGAAUUAAUUUUGCAAUUAU20.05.322


Target Position: 4678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4678GAAUAAUUGUACCAAUUUU93.6988363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4676-4698AGGAATAATTGTACCAATTTTAAAAAAUUGGUACAAUUAUUCCUGAAUAAUUGUACCAAUUUUAAU11.3-10.322


Target Position: 6739, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6739CAAAAUGUGGAACAUUUCU77.53423231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6737-6759TCCAAAATGTGGAACATTTCTTTAGAAAUGUUCCACAUUUUGGACAAAAUGUGGAACAUUUCUUUU14.85.321


Target Position: 7895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7895AGAACAUCUCUAAUUUUUU83.66151840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5287913AGAACATCTCTAATTTTTTAAAAAATTAGAGATGTTCT0.553200.143900.724100.750001.000001.00000


Target Position: 8302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8302CCUUACAUAGCCCACAAAA86.55121236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1348320CCTTACATAGCCCACAAAATTTTGTGGGCTATGTAAGG0.965900.410600.844801.000001.000001.00000


Target Position: 3937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3937CUCAACAUAUCCCUAAACU75.96443618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3935-3957TTCTCAACATATCCCTAAACTCCAGUUUAGGGAUAUGUUGAGAACUCAACAUAUCCCUAAACUCCU18.620.523


Target Position: 3918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3918CCUCCACGACAAAGCACUU81.46972290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473936CCTCCACGACAAAGCACTTAAGTGCTTTGTCGTGGAGG0.483300.222800.706901.000001.000001.00000


Target Position: 8034, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8034CGUGUUUGUGUAUAUAUGU83.66171839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8032-8054GACGTGTTTGTGTATATATGTGTACAUAUAUACACAAACACGUCCGUGUUUGUGUAUAUAUGUGUU-0.319.311


Target Position: 5307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5307GGCAUAUAGGAAGAUACUU83.72021824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5305-5327TTGGCATATAGGAAGATACTTGGAAGUAUCUUCCUAUAUGCCAAGGCAUAUAGGAAGAUACUUGGU18.916.522


Target Position: 5571, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5571CCUUGUUGAAGAGAAAACA83.81581792

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5569-5591CACCTTGTTGAAGAGAAAACATTUGUUUUCUCUUCAACAAGGUGCCUUGUUGAAGAGAAAACAUUU13.316.712


Target Position: 1535, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535GGUACAAAUUAAUGAUAAA105.5569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611553GGTACAAATTAATGATAAATTTATCATTAATTTGTACC0.606900.288800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1533-1555AAGGTACAAATTAATGATAAAGAUUUAUCAUUAAUUUGUACCUUGGUACAAAUUAAUGAUAAAGAU8.714.732


Target Position: 6852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6852GCAUCAAAUUAUGUUUAGU84.51281649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6850-6872GGGCATCAAATTATGTTTAGTAGACUAAACAUAAUUUGAUGCCCGCAUCAAAUUAUGUUUAGUAGU11.813.832


Target Position: 2845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845CUAAUAUCUUGAAAACAGA90.6221667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2843-2865CACTAATATCTTGAAAACAGAAGUCUGUUUUCAAGAUAUUAGUGCUAAUAUCUUGAAAACAGAAGU10.33.522


Target Position: 6869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6869GUAGGUUACUAUUCUCUAA101.31241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6867-6889TAGTAGGTTACTATTCTCTAACAUUAGAGAAUAGUAACCUACUAGUAGGUUACUAUUCUCUAACAU20.219.833


Target Position: 4929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4929CUAACCAUACCAUGGAAAU78.01223116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4927-4949CTCTAACCATACCATGGAAATGCAUUUCCAUGGUAUGGUUAGAGCUAACCAUACCAUGGAAAUGCU20.120.032


Target Position: 6820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6820CAUUGAGAGUUCGCUUAAU87.45971096

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6818-6840TACATTGAGAGTTCGCTTAATTAAUUAAGCGAACUCUCAAUGUACAUUGAGAGUUCGCUUAAUUAU20.420.423


Target Position: 2208, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208GGUAAAGCAAUGAAAAAAU86.46831256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2206-2228GAGGTAAAGCAATGAAAAAATGGAUUUUUUCAUUGCUUUACCUCGGUAAAGCAAUGAAAAAAUGGU0.720.912


Target Position: 7599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7599CUUGUAACUUGUUUAGUAA96.3347197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7597-7619CACTTGTAACTTGTTTAGTAAATUUACUAAACAAGUUACAAGUGCUUGUAACUUGUUUAGUAAAUU6.614.732


Target Position: 7486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7486CAUUACUAACUUUUAAGAU87.15611144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7484-7506CTCATTACTAACTTTTAAGATTAAUCUUAAAAGUUAGUAAUGAGCAUUACUAACUUUUAAGAUUAU7.16.322


Target Position: 1852, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852GAACUGUUAUUAAACUUAU93.2962397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1850-1872AGGAACTGTTATTAAACTTATAGAUAAGUUUAAUAACAGUUCCUGAACUGUUAUUAAACUUAUAGU4.917.822


Target Position: 7293, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7293GAAUAGGUUUACUUAUUCU94.3526311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7291-7313GTGAATAGGTTTACTTATTCTTTAGAAUAAGUAAACCUAUUCACGAAUAGGUUUACUUAUUCUUUU6.918.532


Target Position: 8011, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8011GACAUGUAUAAUUUUAGUU85.46161433

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8009-8031GTGACATGTATAATTTTAGTTGAAACUAAAAUUAUACAUGUCACGACAUGUAUAAUUUUAGUUGAU4.920.422


Target Position: 2405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405CACUUUACUUGAAUCAGAU92.0806515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2403-2425CTCACTTTACTTGAATCAGATCTAUCUGAUUCAAGUAAAGUGAGCACUUUACUUGAAUCAGAUCUU20.412.923


Target Position: 7025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7025UCCCUCCAUAAAUCAAAAA70.34565044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8607043TCCCTCCATAAATCAAAAATTTTTGATTTATGGAGGGA0.354500.193400.870700.750001.000001.00000


Target Position: 3113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3113CCCAAGAUUUCCAAAAAAA88.7794898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2403131CCCAAGATTTCCAAAAAAATTTTTTTGGAAATCTTGGG0.861200.296600.991401.000001.000001.00000


Target Position: 7028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7028CUCCAUAAAUCAAAAAUUA91.9718524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7026-7048CCCTCCATAAATCAAAAATTACCUAAUUUUUGAUUUAUGGAGGGCUCCAUAAAUCAAAAAUUACCU-12.021.222


Target Position: 644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CUAUGAUUUGGUAAAAGCA87.95761008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
642-664TACTATGATTTGGTAAAAGCATTUGCUUUUACCAAAUCAUAGUACUAUGAUUUGGUAAAAGCAUUU13.78.722


Target Position: 8223, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8223GUUUGCAUUUAAAGUGAAA88.7879894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8221-8243TGGTTTGCATTTAAAGTGAAAATUUUCACUUUAAAUGCAAACCAGUUUGCAUUUAAAGUGAAAAUU19.220.032


Target Position: 6048, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6048CAUUCAACAGUAUUUAUGU86.87131188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6046-6068TCCATTCAACAGTATTTATGTGAACAUAAAUACUGUUGAAUGGACAUUCAACAGUAUUUAUGUGAU-1.814.822


Target Position: 6803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6803CAUUAUCAGGAAACAUACA92.3708489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6801-6823CACATTATCAGGAAACATACATTUGUAUGUUUCCUGAUAAUGUGCAUUAUCAGGAAACAUACAUUU14.68.722


Target Position: 2232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232GAAUCCAUCACUAAAAUAA97.2723155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2230-2252TTGAATCCATCACTAAAATAATCUUAUUUUAGUGAUGGAUUCAAGAAUCCAUCACUAAAAUAAUCU-7.520.112


Target Position: 1430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430CUUUGAUGGCUUAAUGAUU82.39772100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1428-1450CTCTTTGATGGCTTAATGATTTGAAUCAUUAAGCCAUCAAAGAGCUUUGAUGGCUUAAUGAUUUGU8.713.812


Target Position: 7421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7421GCAGUAAAGUUAUUUAUAA102.18731

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7419-7441ATGCAGTAAAGTTATTTATAAGGUUAUAAAUAACUUUACUGCAUGCAGUAAAGUUAUUUAUAAGGU-8.011.823


Target Position: 2175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175CAACGAAUGGAAGAAUUUA92.7915449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2173-2195TGCAACGAATGGAAGAATTTATTUAAAUUCUUCCAUUCGUUGCACAACGAAUGGAAGAAUUUAUUU5.315.222


Target Position: 5518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5518GCGUAUGUACUGUUCUUCU86.26551296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5516-5538AAGCGTATGTACTGTTCTTCTGAAGAAGAACAGUACAUACGCUUGCGUAUGUACUGUUCUUCUGAU21.521.033


Target Position: 6872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6872GGUUACUAUUCUCUAACAA98.067115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6870-6892TAGGTTACTATTCTCTAACAACTUUGUUAGAGAAUAGUAACCUAGGUUACUAUUCUCUAACAACUU20.314.333


Target Position: 1575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575CAUGCUUUUGAAAUAAUUU84.1161744

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1573-1595AGCATGCTTTTGAAATAATTTTAAAAUUAUUUCAAAAGCAUGCUCAUGCUUUUGAAAUAAUUUUAU-10.318.522


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724AGUCGCCAGAAGAAAAUUU74.1244107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752742AGTCGCCAGAAGAAAATTTAAATTTTCTTCTGGCGACT0.547800.114600.706900.750001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369GCUCACCUUACACCCAAUA81.39942309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3332387GCTCACCTTACACCCAATATATTGGGTGTAAGGTGAGC0.630000.228100.810301.000001.000001.00000


Target Position: 734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CUCCAAUUCAAAAUUGUUU74.65043954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
732-754GTCTCCAATTCAAAATTGTTTTCAAACAAUUUUGAAUUGGAGACCUCCAAUUCAAAAUUGUUUUCU5.320.122


Target Position: 5878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5878GUCUAUCCUAUUUUCUUAU83.15791938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8115896GTCTATCCTATTTTCTTATATAAGAAAATAGGATAGAC0.641800.374000.775900.750001.000001.00000


Target Position: 7621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7621CCAUGCCUUAUUUUCCAUU74.54733980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7327639CCATGCCTTATTTTCCATTAATGGAAAATAAGGCATGG0.331200.257000.836201.000001.000001.00000


Target Position: 3051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051GAAUUUACAGAUUAUCUUU92.4398480

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3049-3071AGGAATTTACAGATTATCTTTTCAAAGAUAAUCUGUAAAUUCCUGAAUUUACAGAUUAUCUUUUCU6.9-0.332


Target Position: 7026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7026CCCUCCAUAAAUCAAAAAU75.66053687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6997044CCCTCCATAAATCAAAAATATTTTTGATTTATGGAGGG0.344400.200600.982801.000001.000001.00000


Target Position: 7291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7291GUGAAUAGGUUUACUUAUU84.44651661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7289-7311CTGTGAATAGGTTTACTTATTCTAAUAAGUAAACCUAUUCACAGGUGAAUAGGUUUACUUAUUCUU6.313.433


Target Position: 5454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5454CAAAACUAUUCAUAAUAGA91.1942598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5452-5474ATCAAAACTATTCATAATAGAACUCUAUUAUGAAUAGUUUUGAUCAAAACUAUUCAUAAUAGAACU-2.74.922


Target Position: 337, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337GAAGAAACCCUUUAUCUCU87.7521041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
335-357GCGAAGAAACCCTTTATCTCTCCAGAGAUAAAGGGUUUCUUCGCGAAGAAACCCUUUAUCUCUCCU16.013.322


Target Position: 669, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669GCAGAAAUUCGACAAUAUA98.4381105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310687GCAGAAATTCGACAATATATATATTGTCGAATTTCTGC0.626500.432400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
667-689TGGCAGAAATTCGACAATATATAUAUAUUGUCGAAUUUCUGCCAGCAGAAAUUCGACAAUAUAUAU6.712.033


Target Position: 2467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467GGACAAAAGAAGACAAAGA93.5094383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2465-2487GTGGACAAAAGAAGACAAAGAAAUCUUUGUCUUCUUUUGUCCACGGACAAAAGAAGACAAAGAAAU19.214.922


Target Position: 2135, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135GCACCACUUCUAUGAUUUU87.68451051

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10213519GCACCACTTCTATGATTTT1/1/0/097.75SOS1NM_005633.31NANANA2:39240656..39240674(-)00SOS1(0.002)


Target Position: 3956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3956CCCUCCAAAAACUUACAAA86.77751204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4563974CCCTCCAAAAACTTACAAATTTGTAAGTTTTTGGAGGG0.939000.156400.991401.000001.000001.00000


Target Position: 576, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576GAUGUAGAAGAUAUUAAUA103.17920

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
574-596AAGATGTAGAAGATATTAATATAUAUUAAUAUCUUCUACAUCUUGAUGUAGAAGAUAUUAAUAUAU-8.020.312


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285AGGUCAUAAUAUUACAUUU92.09514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102303AGGTCATAATATTACATTTAAATGTAATATTATGACCT0.575900.175200.844800.750001.000001.00000


Target Position: 1635, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635GAAGAGAAAAACAAUUGGA86.94111173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1633-1655CTGAAGAGAAAAACAATTGGATGUCCAAUUGUUUUUCUCUUCAGGAAGAGAAAAACAAUUGGAUGU17.719.122


Target Position: 5166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5166GAAGAAAAUGGUUGAUUCU86.27071295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5164-5186ATGAAGAAAATGGTTGATTCTTAAGAAUCAACCAUUUUCUUCAUGAAGAAAAUGGUUGAUUCUUAU16.35.522


Target Position: 4997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4997CUCAUGUUUUACACAUAGU78.51132988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4995-5017CGCTCATGTTTTACACATAGTTGACUAUGUGUAAAACAUGAGCGCUCAUGUUUUACACAUAGUUGU17.920.522


Target Position: 5051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5051CCUAAAUCAUAUGUAUAUA97.7227132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5049-5071TGCCTAAATCATATGTATATAGTUAUAUACAUAUGAUUUAGGCACCUAAAUCAUAUGUAUAUAGUU8.26.922


Target Position: 3060, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060GAUUAUCUUUUCAACAAAU93.1887406

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3058-3080CAGATTATCTTTTCAACAAATCCAUUUGUUGAAAAGAUAAUCUGGAUUAUCUUUUCAACAAAUCCU12.26.622


Target Position: 560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GGAUAUGUUUCAUCAAGAU96.9541167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
558-580ATGGATATGTTTCATCAAGATGTAUCUUGAUGAAACAUAUCCAUGGAUAUGUUUCAUCAAGAUGUU20.416.033


Target Position: 7684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7684CCCUUUUGCCUUUAAUGAA85.9541348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7682-7704TTCCCTTTTGCCTTTAATGAAAAUUCAUUAAAGGCAAAAGGGAACCCUUUUGCCUUUAAUGAAAAU8.916.122


Target Position: 6991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6991CUAUAUUAUGAUUCUAAAU89.6926788

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6989-7011GGCTATATTATGATTCTAAATTCAUUUAGAAUCAUAAUAUAGCCCUAUAUUAUGAUUCUAAAUUCU7.1-5.922


Target Position: 3775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3775GCAAUGCCUUCUUCCCAAA87.18071141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233793GCAATGCCTTCTTCCCAAATTTGGGAAGAAGGCATTGC0.519100.138600.853401.000001.000001.00000


Target Position: 3047, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047GAAGGAAUUUACAGAUUAU100.23759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3045-3067GAGAAGGAATTTACAGATTATCTAUAAUCUGUAAAUUCCUUCUCGAAGGAAUUUACAGAUUAUCUU13.418.723


Target Position: 428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428CAUAGUAGCAGUCUUAGAA98.0223117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
426-448TACATAGTAGCAGTCTTAGAATAUUCUAAGACUGCUACUAUGUACAUAGUAGCAGUCUUAGAAUAU20.211.222


Target Position: 3366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366CAUUCGAGCCCUUUUCACU82.45792085

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3364-3386ATCATTCGAGCCCTTTTCACTCAAGUGAAAAGGGCUCGAAUGAUCAUUCGAGCCCUUUUCACUCAU14.921.023


Target Position: 1915, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915GGACAUUUCUUACAACAUA100.76649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411933GGACATTTCTTACAACATATATGTTGTAAGAAATGTCC0.291100.091100.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1913-1935TCGGACATTTCTTACAACATACAUAUGUUGUAAGAAAUGUCCGAGGACAUUUCUUACAACAUACAU19.314.822


Target Position: 8312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8312CCCACAAAAAAAAAAAAAA83.85851781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
698330CCCACAAAAAAAAAAAAAATTTTTTTTTTTTTTGTGGG0.998300.980000.991401.000001.000001.00000


Target Position: 4484, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484GCUUUACUCUUCUACUUUA100.87446

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4448419GCTTTACTCTTCTACTTTA1/1/0/0100.00SOS1NM_005633.31NANANA2:39212506..39212524(-)00SOS1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4482-4504TTGCTTTACTCTTCTACTTTAGAUAAAGUAGAAGAGUAAAGCAAGCUUUACUCUUCUACUUUAGAU9.89.822


Target Position: 2102, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102GCGAGUAUUAAAUGUAUGU80.09312632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2100-2122CTGCGAGTATTAAATGTATGTCGACAUACAUUUAAUACUCGCAGGCGAGUAUUAAAUGUAUGUCGU13.320.922


Target Position: 1417, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417GACACAUAUUUCUCUUUGA95.4756238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1415-1437GAGACACATATTTCTCTTTGATGUCAAAGAGAAAUAUGUGUCUCGACACAUAUUUCUCUUUGAUGU16.620.422


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786CUGAAGAGAAUAUUAUAUU85.27311486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801804CTGAAGAGAATATTATATTAATATAATATTCTCTTCAG0.341800.150500.775900.750001.000001.00000


Target Position: 5545, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5545CAAAUACUGUGACUGAAAU89.8512759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5543-5565AACAAATACTGTGACTGAAATGCAUUUCAGUCACAGUAUUUGUUCAAAUACUGUGACUGAAAUGCU19.24.622


Target Position: 2705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2705CACAUUUGAGCAAAUACCA86.07921329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2703-2725CACACATTTGAGCAAATACCAAGUGGUAUUUGCUCAAAUGUGUGCACAUUUGAGCAAAUACCAAGU13.912.122


Target Position: 7710, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7710CAUUAAGUAGCCAAUUGCU81.54422275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7708-7730TGCATTAAGTAGCCAATTGCTGCAGCAAUUGGCUACUUAAUGCACAUUAAGUAGCCAAUUGCUGCU20.04.632


Target Position: 8303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8303CUUACAUAGCCCACAAAAA90.5481676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8301-8323GCCTTACATAGCCCACAAAAAAAUUUUUGUGGGCUAUGUAAGGCCUUACAUAGCCCACAAAAAAAU12.28.531


Target Position: 5410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5410GUUUAUAUUGAACAUUCUA93.2369404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5408-5430AGGTTTATATTGAACATTCTACCUAGAAUGUUCAAUAUAAACCUGUUUAUAUUGAACAUUCUACCU19.2-8.022


Target Position: 6309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6309CCUAUCUAGUCUAUAAAGA87.57571076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6307-6329AACCTATCTAGTCTATAAAGAGGUCUUUAUAGACUAGAUAGGUUCCUAUCUAGUCUAUAAAGAGGU-2.313.023


Target Position: 5145, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5145GCAUAUAUUAAAUUAUUAU94.7756280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5143-5165TGGCATATATTAAATTATTATATAUAAUAAUUUAAUAUAUGCCAGCAUAUAUUAAAUUAUUAUAUU-8.0-0.312


Target Position: 3602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602CACAUCAAAAGCCUAUUCA82.95571978

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3600-3622CCCACATCAAAAGCCTATTCACCUGAAUAGGCUUUUGAUGUGGGCACAUCAAAAGCCUAUUCACCU19.920.523


Target Position: 2468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468GACAAAAGAAGACAAAGAA95.4547239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2466-2488TGGACAAAAGAAGACAAAGAAATUUCUUUGUCUUCUUUUGUCCAGACAAAAGAAGACAAAGAAAUU19.210.322


Target Position: 5255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5255CUAGUUCUGGAUAUAUGUA93.5411377

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5253-5275TTCTAGTTCTGGATATATGTATTUACAUAUAUCCAGAACUAGAACUAGUUCUGGAUAUAUGUAUUU8.218.922


Target Position: 2882, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882CCUAAAAAGACAUGGAAAA86.52561249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922900CCTAAAAAGACATGGAAAATTTTCCATGTCTTTTTAGG0.439100.269800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2880-2902GTCCTAAAAAGACATGGAAAAGAUUUUCCAUGUCUUUUUAGGACCCUAAAAAGACAUGGAAAAGAU20.1-3.822


Target Position: 7031, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7031CAUAAAUCAAAAAUUACCU77.27893292

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7029-7051TCCATAAATCAAAAATTACCTTAAGGUAAUUUUUGAUUUAUGGACAUAAAUCAAAAAUUACCUUAU13.91.822


Target Position: 5063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5063GUAUAUAGUGAAUGUUAUA100.93444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5061-5083ATGTATATAGTGAATGTTATATAUAUAACAUUCACUAUAUACAUGUAUAUAGUGAAUGUUAUAUAU6.7-0.822


Target Position: 4762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4762GAGAAGUUUUGUGUCAUUA93.5169380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4760-4782AAGAGAAGTTTTGTGTCATTAACUAAUGACACAAAACUUCUCUUGAGAAGUUUUGUGUCAUUAACU20.517.723


Target Position: 8065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8065GUUUAGUAGCACGGUUAUU77.48683248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8063-8085TTGTTTAGTAGCACGGTTATTTGAAUAACCGUGCUACUAAACAAGUUUAGUAGCACGGUUAUUUGU20.66.632


Target Position: 7568, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7568GUCUAUAUUAUAAAUCUAA97.7085134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8967586GTCTATATTATAAATCTAATTAGATTTATAATATAGAC0.274500.238700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7566-7588AAGTCTATATTATAAATCTAAACUUAGAUUUAUAAUAUAGACUUGUCUAUAUUAUAAAUCUAAACU6.98.232


Target Position: 8264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8264CAUUACUAAGAUAAACUGA89.7124784

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8262-8284GGCATTACTAAGATAAACTGAAAUCAGUUUAUCUUAGUAAUGCCCAUUACUAAGAUAAACUGAAAU11.86.333


Target Position: 8013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8013CAUGUAUAAUUUUAGUUGA93.0272421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8011-8033GACATGTATAATTTTAGTTGAGAUCAACUAAAAUUAUACAUGUCCAUGUAUAAUUUUAGUUGAGAU11.88.213


Target Position: 2927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927GAAAGUAGCAGAAAUAACA95.9826216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2925-2947AGGAAAGTAGCAGAAATAACAGGUGUUAUUUCUGCUACUUUCCUGAAAGUAGCAGAAAUAACAGGU-0.39.821


Target Position: 7204, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7204GUGUUGUACAUAUUGAAGA85.1491508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7202-7224TAGTGTTGTACATATTGAAGAAAUCUUCAAUAUGUACAACACUAGUGUUGUACAUAUUGAAGAAAU12.020.422


Target Position: 7106, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7106GCUUAAUCUUGUAUUUCAU92.1191510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7857124GCTTAATCTTGTATTTCATATGAAATACAAGATTAAGC0.535700.139100.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7104-7126TAGCTTAATCTTGTATTTCATTGAUGAAAUACAAGAUUAAGCUAGCUUAAUCUUGUAUUUCAUUGU8.96.922


Target Position: 4402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4402GACAGUUUUUGUAAUUCAA97.1795158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4400-4422ATGACAGTTTTTGTAATTCAAATUUGAAUUACAAAAACUGUCAUGACAGUUUUUGUAAUUCAAAUU8.917.831


Target Position: 912, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912GCAUUUGAUCCAUAUGAAU89.1606851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
910-932TGGCATTTGATCCATATGAATCGAUUCAUAUGGAUCAAAUGCCAGCAUUUGAUCCAUAUGAAUCGU8.713.822


Target Position: 4495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4495CUACUUUAGAAUAUUUUCU77.60563218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4493-4515TTCTACTTTAGAATATTTTCTTAAGAAAAUAUUCUAAAGUAGAACUACUUUAGAAUAUUUUCUUAU2.16.621


Target Position: 7147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7147CUUAAAUUCAGAUUUUUAA88.7459905

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7145-7167AGCTTAAATTCAGATTTTTAAGTUUAAAAAUCUGAAUUUAAGCUCUUAAAUUCAGAUUUUUAAGUU-9.7-9.712


Target Position: 6579, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6579CAUUAACUAGUUGACAAAU85.14861509

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6577-6599AACATTAACTAGTTGACAAATTTAUUUGUCAACUAGUUAAUGUUCAUUAACUAGUUGACAAAUUUU20.54.632


Target Position: 4755, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4755CAAAAAAGAGAAGUUUUGU76.04093598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4753-4775TTCAAAAAAGAGAAGTTTTGTGTACAAAACUUCUCUUUUUUGAACAAAAAAGAGAAGUUUUGUGUU10.3-5.922


Target Position: 4470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4470CUUUGUUUUCCUUUGCUUU76.18523554

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4468-4490TCCTTTGTTTTCCTTTGCTTTACAAAGCAAAGGAAAACAAAGGACUUUGUUUUCCUUUGCUUUACU18.65.612


Target Position: 4817, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4817CAACUAUUCUAUUUGCAUU91.6267557

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4815-4837GTCAACTATTCTATTTGCATTTAAAUGCAAAUAGAAUAGUUGACCAACUAUUCUAUUUGCAUUUAU20.04.632


Target Position: 2991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991GAAUCAGAUAUCAAAAGGU85.07491521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2989-3011TAGAATCAGATATCAAAAGGTTCACCUUUUGAUAUCUGAUUCUAGAAUCAGAUAUCAAAAGGUUCU16.120.422


Target Position: 8227, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8227GCAUUUAAAGUGAAAAUAA97.3207153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8225-8247TTGCATTTAAAGTGAAAATAACGUUAUUUUCACUUUAAAUGCAAGCAUUUAAAGUGAAAAUAACGU2.1-1.422


Target Position: 7557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7557AGAAGCAUGAAGUCUAUAU84.43511666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8787575AGAAGCATGAAGTCTATATATATAGACTTCATGCTTCT0.527000.336000.681000.750001.000001.00000


Target Position: 8120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8120GGUCUUUGAUGUAAGAACA96.636180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8118-8140TCGGTCTTTGATGTAAGAACAAAUGUUCUUACAUCAAAGACCGAGGUCUUUGAUGUAAGAACAAAU14.619.222


Target Position: 7560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7560AGCAUGAAGUCUAUAUUAU88.0543994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3167578AGCATGAAGTCTATATTATATAATATAGACTTCATGCT0.754000.414700.810300.750001.000001.00000


Target Position: 4170, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4170GCAGUAUAAGACAAUGAAU92.4136483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9774188GCAGTATAAGACAATGAATATTCATTGTCTTATACTGC0.396200.065200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4168-4190ATGCAGTATAAGACAATGAATTTAUUCAUUGUCUUAUACUGCAUGCAGUAUAAGACAAUGAAUUUU13.813.122


Target Position: 5669, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5669GCAUGUAUCCUCUGAAUAA103.63915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5667-5689CTGCATGTATCCTCTGAATAATGUUAUUCAGAGGAUACAUGCAGGCAUGUAUCCUCUGAAUAAUGU13.413.323


Target Position: 490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490GAAAUAUACGGCAUUAUGA94.1429327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
488-510AAGAAATATACGGCATTATGAAAUCAUAAUGCCGUAUAUUUCUUGAAAUAUACGGCAUUAUGAAAU5.6-8.022


Target Position: 6328, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6328GGAAAAAUUCAGAUUUGGA93.692365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6326-6348GAGGAAAAATTCAGATTTGGAGTUCCAAAUCUGAAUUUUUCCUCGGAAAAAUUCAGAUUUGGAGUU20.10.422


Target Position: 5762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5762CCUAGUACUUUAAUAAUUU89.7423779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5760-5782AACCTAGTACTTTAATAATTTCCAAAUUAUUAAAGUACUAGGUUCCUAGUACUUUAAUAAUUUCCU-10.318.822


Target Position: 5263, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5263GGAUAUAUGUAUUAAUCUU100.70451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5261-5283CTGGATATATGTATTAATCTTAAAAGAUUAAUACAUAUAUCCAGGGAUAUAUGUAUUAAUCUUAAU6.93.222


Target Position: 5070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5070GUGAAUGUUAUAUAAUAUA94.6633288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5068-5090TAGTGAATGTTATATAATATACCUAUAUUAUAUAACAUUCACUAGUGAAUGUUAUAUAAUAUACCU-8.620.521


Target Position: 7472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7472UCUUUGAAACAUCUCAUUA83.20311929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9827490TCTTTGAAACATCTCATTATAATGAGATGTTTCAAAGA0.538800.076200.689700.750000.983700.87500


Target Position: 5957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5957CUUCUCUUUAUAAAAUAUU75.60533703

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5955-5977TTCTTCTCTTTATAAAATATTTCAAUAUUUUAUAAAGAGAAGAACUUCUCUUUAUAAAAUAUUUCU-10.319.122


Target Position: 3008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008GUUCUUUGAAAACUUGAAU76.96723370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3006-3028AGGTTCTTTGAAAACTTGAATCCAUUCAAGUUUUCAAAGAACCUGUUCUUUGAAAACUUGAAUCCU19.212.223


Target Position: 4648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4648GGUACUUUUUUGUUGUUGU82.85752003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4646-4668GAGGTACTTTTTTGTTGTTGTTGACAACAACAAAAAAGUACCUCGGUACUUUUUUGUUGUUGUUGU19.312.921


Target Position: 6909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6909GAUCUGAAUUUGACAAAGA94.952269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6907-6929TGGATCTGAATTTGACAAAGAGCUCUUUGUCAAAUUCAGAUCCAGAUCUGAAUUUGACAAAGAGCU19.220.432


Target Position: 3948, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3948CCUAAACUCCCUCCAAAAA84.90041561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663966CCTAAACTCCCTCCAAAAATTTTTGGAGGGAGTTTAGG0.257300.193400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3946-3968TCCCTAAACTCCCTCCAAAAACTUUUUUGGAGGGAGUUUAGGGACCUAAACUCCCUCCAAAAACUU20.19.823


Target Position: 3614, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3614CUAUUCACCACGAUAUUCA85.64971395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3612-3634GCCTATTCACCACGATATTCAATUGAAUAUCGUGGUGAAUAGGCCUAUUCACCACGAUAUUCAAUU11.616.133


Target Position: 2843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843CACUAAUAUCUUGAAAACA90.1467721

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2841-2863CTCACTAATATCTTGAAAACAGAUGUUUUCAAGAUAUUAGUGAGCACUAAUAUCUUGAAAACAGAU14.96.323


Target Position: 5880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5880CUAUCCUAUUUUCUUAUUU81.05632404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9475898CTATCCTATTTTCTTATTTAAATAAGAAAATAGGATAG0.630500.410500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5878-5900GTCTATCCTATTTTCTTATTTATAAAUAAGAAAAUAGGAUAGACCUAUCCUAUUUUCUUAUUUAUU6.921.012


Target Position: 2206, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206GAGGUAAAGCAAUGAAAAA96.9304168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4252224GAGGTAAAGCAATGAAAAATTTTTCATTGCTTTACCTC0.513200.397400.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2204-2226AAGAGGTAAAGCAATGAAAAAATUUUUUCAUUGCUUUACCUCUUGAGGUAAAGCAAUGAAAAAAUU7.418.622


Target Position: 4677, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4677GGAAUAAUUGUACCAAUUU86.7821203

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4675-4697TAGGAATAATTGTACCAATTTTAAAAUUGGUACAAUUAUUCCUAGGAAUAAUUGUACCAAUUUUAU18.81.833


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721CCAAGUCGCCAGAAGAAAA91.8791536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432739CCAAGTCGCCAGAAGAAAATTTTCTTCTGGCGACTTGG0.263200.086200.844801.000001.000001.00000


Target Position: 7876, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7876CCAAAUGUGCCUUUAAUUA88.4817937

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7874-7896TGCCAAATGTGCCTTTAATTAAGUAAUUAAAGGCACAUUUGGCACCAAAUGUGCCUUUAAUUAAGU-9.712.122


Target Position: 5994, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5994CUAAAACAUUAAUUUCAAA94.7371281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5992-6014TCCTAAAACATTAATTTCAAATCUUUGAAAUUAAUGUUUUAGGACUAAAACAUUAAUUUCAAAUCU7.47.211


Target Position: 5990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5990CGUCCUAAAACAUUAAUUU85.71711389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6646008CGTCCTAAAACATTAATTTAAATTAATGTTTTAGGACG0.571000.113200.775901.000001.000001.00000


Target Position: 4665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4665GUUGUUGUUUUAGGAAUAA85.14331512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4663-4685TTGTTGTTGTTTTAGGAATAATTUUAUUCCUAAAACAACAACAAGUUGUUGUUUUAGGAAUAAUUU19.919.322


Target Position: 4662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662GUUGUUGUUGUUUUAGGAA85.9791346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4660-4682TTGTTGTTGTTGTTTTAGGAATAUUCCUAAAACAACAACAACAAGUUGUUGUUGUUUUAGGAAUAU19.919.312


Target Position: 335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335GCGAAGAAACCCUUUAUCU80.65142492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
333-355AAGCGAAGAAACCCTTTATCTCTAGAUAAAGGGUUUCUUCGCUUGCGAAGAAACCCUUUAUCUCUU6.921.013


Target Position: 633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633GAACAAACUUACUAUGAUU98.3197111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
631-653GAGAACAAACTTACTATGATTTGAAUCAUAGUAAGUUUGUUCUCGAACAAACUUACUAUGAUUUGU13.313.312


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659AGCAUUUAUGGCAGAAAUU75.52643725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554677AGCATTTATGGCAGAAATTAATTTCTGCCATAAATGCT0.406100.160400.844800.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477GGGAAUUAUGUAAGAAAUA94.5115302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
475-497TTGGGAATTATGTAAGAAATATAUAUUUCUUACAUAAUUCCCAAGGGAAUUAUGUAAGAAAUAUAU5.315.522


Target Position: 2284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2284CAGGUCAUAAUAUUACAUU84.14721737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072302CAGGTCATAATATTACATTAATGTAATATTATGACCTG0.628400.141600.775900.750001.000001.00000


Target Position: 2141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141CUUCUAUGAUUUUGAAAGA86.78621202

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2139-2161CACTTCTATGATTTTGAAAGAGAUCUUUCAAAAUCAUAGAAGUGCUUCUAUGAUUUUGAAAGAGAU12.213.431


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219CCAAGGAAAAUUAGUUAUA88.4759940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4933237CCAAGGAAAATTAGTTATATATAACTAATTTTCCTTGG0.438900.240900.801701.000001.000001.00000


Target Position: 2832, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832GGAAUUUAUCUCACUAAUA100.2260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992850GGAATTTATCTCACTAATATATTAGTGAGATAAATTCC0.435700.211500.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2830-2852TTGGAATTTATCTCACTAATATCUAUUAGUGAGAUAAAUUCCAAGGAAUUUAUCUCACUAAUAUCU11.62.113


Target Position: 789, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789GUAGAUAUACAUGAACUUA96.6638176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
787-809TAGTAGATATACATGAACTTAGTUAAGUUCAUGUAUAUCUACUAGUAGAUAUACAUGAACUUAGUU19.28.222


Target Position: 6925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6925AGAGCAUGCCACACUAAUA97.4033146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8666943AGAGCATGCCACACTAATATATTAGTGTGGCATGCTCT0.651500.136500.681000.750001.000001.00000


Target Position: 6606, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6606GUAGUAAUGAAAAUCUAUU86.85281190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6604-6626TTGTAGTAATGAAAATCTATTTAAAUAGAUUUUCAUUACUACAAGUAGUAAUGAAAAUCUAUUUAU6.66.321


Target Position: 7875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7875GCCAAAUGUGCCUUUAAUU81.22332359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7873-7895CTGCCAAATGTGCCTTTAATTAAAAUUAAAGGCACAUUUGGCAGGCCAAAUGUGCCUUUAAUUAAU-4.317.722


Target Position: 5581, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5581GAGAAAACAUUUUAUUAAU93.0894418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5579-5601AAGAGAAAACATTTTATTAATCTAUUAAUAAAAUGUUUUCUCUUGAGAAAACAUUUUAUUAAUCUU-7.513.311


Target Position: 2612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612GAUUCUACAAGUCUUUCAA96.3683196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2610-2632GAGATTCTACAAGTCTTTCAAGAUUGAAAGACUUGUAGAAUCUCGAUUCUACAAGUCUUUCAAGAU20.414.522


Target Position: 1660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660CAUUGAUAUCUUUACAGUA103.38716

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1658-1680AGCATTGATATCTTTACAGTACCUACUGUAAAGAUAUCAAUGCUCAUUGAUAUCUUUACAGUACCU19.08.733


Target Position: 1828, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828CUGGAAUUCCAAUUAUCAA92.6067463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1826-1848GGCTGGAATTCCAATTATCAAAGUUGAUAAUUGGAAUUCCAGCCCUGGAAUUCCAAUUAUCAAAGU8.720.132


Target Position: 5445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5445CUGCUUUAUCAAAACUAUU81.16272375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5443-5465TTCTGCTTTATCAAAACTATTCAAAUAGUUUUGAUAAAGCAGAACUGCUUUAUCAAAACUAUUCAU4.619.712


Target Position: 5575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5575GUUGAAGAGAAAACAUUUU78.99742877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5573-5595TTGTTGAAGAGAAAACATTTTATAAAAUGUUUUCUCUUCAACAAGUUGAAGAGAAAACAUUUUAUU5.320.422


Target Position: 6900, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6900GCUUUAAUGGAUCUGAAUU83.81871791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6898-6920ATGCTTTAATGGATCTGAATTTGAAUUCAGAUCCAUUAAAGCAUGCUUUAAUGGAUCUGAAUUUGU20.4-4.322


Target Position: 8214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8214CAGUAUUUGGUUUGCAUUU79.51792745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8212-8234AGCAGTATTTGGTTTGCATTTAAAAAUGCAAACCAAAUACUGCUCAGUAUUUGGUUUGCAUUUAAU20.04.621


Target Position: 7729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7729GCAGAAUUAUAAAGCAAAU89.7048786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7727-7749CTGCAGAATTATAAAGCAAATTAAUUUGCUUUAUAAUUCUGCAGGCAGAAUUAUAAAGCAAAUUAU18.612.022


Target Position: 4195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4195CUAGAUGUAAUUAUACAAU86.3741273

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4193-4215ACCTAGATGTAATTATACAATGGAUUGUAUAAUUACAUCUAGGUCUAGAUGUAAUUAUACAAUGGU8.520.332


Target Position: 5907, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5907GAAUUGAAUCCUUUCUCAA98.670897

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5905-5927TAGAATTGAATCCTTTCTCAATAUUGAGAAAGGAUUCAAUUCUAGAAUUGAAUCCUUUCUCAAUAU20.47.422


Target Position: 1360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360GUUGUAAUGAAUUUAUAAU86.97421167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1358-1380GTGTTGTAATGAATTTATAATGGAUUAUAAAUUCAUUACAACACGUUGUAAUGAAUUUAUAAUGGU-7.56.922


Target Position: 2280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280GGACCAGGUCAUAAUAUUA105.07113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492298GGACCAGGTCATAATATTATAATATTATGACCTGGTCC0.628300.133400.836201.000001.000001.00000


Target Position: 507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
507GAAAUUACAAAACAAGAUA92.5393469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
505-527ATGAAATTACAAAACAAGATATTUAUCUUGUUUUGUAAUUUCAUGAAAUUACAAAACAAGAUAUUU19.2-0.311


Target Position: 5816, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5816CGAUAGUACAGUAUGUAGU85.92511358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5814-5836CACGATAGTACAGTATGTAGTCCACUACAUACUGUACUAUCGUGCGAUAGUACAGUAUGUAGUCCU13.115.833


Target Position: 3612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3612GCCUAUUCACCACGAUAUU80.25512585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3610-3632AAGCCTATTCACCACGATATTCAAAUAUCGUGGUGAAUAGGCUUGCCUAUUCACCACGAUAUUCAU16.419.933


Target Position: 823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GCCAUAUAGAAGAUACAGU82.66582030

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
821-843GGGCCATATAGAAGATACAGTAGACUGUAUCUUCUAUAUGGCCCGCCAUAUAGAAGAUACAGUAGU20.314.023


Target Position: 3071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071CAACAAAUCCCUAGAAAUA97.1246163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3069-3091TTCAACAAATCCCTAGAAATAGAUAUUUCUAGGGAUUUGUUGAACAACAAAUCCCUAGAAAUAGAU6.95.322


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729CCAGAAGAAAAUUUUAGAA91.5985558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882747CCAGAAGAAAATTTTAGAATTCTAAAATTTTCTTCTGG0.443000.151400.672401.000001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040AGCUGUUCAAUAUGUUUUA85.851365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351058AGCTGTTCAATATGTTTTATAAAACATATTGAACAGCT0.594900.069800.819000.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CAAUUCAAAAUUGUUUUCA77.50123243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
735-757TCCAATTCAAAATTGTTTTCAGCUGAAAACAAUUUUGAAUUGGACAAUUCAAAAUUGUUUUCAGCU14.97.421


Target Position: 4445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4445CUUAAACAGGGAUCUUAAU80.6722488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4443-4465AACTTAAACAGGGATCTTAATATAUUAAGAUCCCUGUUUAAGUUCUUAAACAGGGAUCUUAAUAUU6.97.232


Target Position: 7101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7101GUUUAGCUUAAUCUUGUAU81.10752392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7099-7121AAGTTTAGCTTAATCTTGTATTTAUACAAGAUUAAGCUAAACUUGUUUAGCUUAAUCUUGUAUUUU20.318.332


Target Position: 177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177CAGUAUGUUGAAGAAUUAA94.0598333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
175-197TTCAGTATGTTGAAGAATTAATTUUAAUUCUUCAACAUACUGAACAGUAUGUUGAAGAAUUAAUUU6.919.021


Target Position: 1363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363GUAAUGAAUUUAUAAUGGA88.1446981

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1361-1383TTGTAATGAATTTATAATGGAAGUCCAUUAUAAAUUCAUUACAAGUAAUGAAUUUAUAAUGGAAGU12.68.922


Target Position: 3114, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114CCAAGAUUUCCAAAAAAAU83.98091765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2023132CCAAGATTTCCAAAAAAATATTTTTTTGGAAATCTTGG0.861200.292100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3112-3134TCCCAAGATTTCCAAAAAAATATAUUUUUUUGGAAAUCUUGGGACCAAGAUUUCCAAAAAAAUAUU-11.312.022


Target Position: 1599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599GAUGAAAAUAGUGUUAUAU90.1529720

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1597-1619AAGATGAAAATAGTGTTATATTTAUAUAACACUAUUUUCAUCUUGAUGAAAAUAGUGUUAUAUUUU8.57.421


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664CUGAAAGCCCUCCCUUAUU72.73894466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5653682CTGAAAGCCCTCCCTTATTAATAAGGGAGGGCTTTCAG0.399300.162200.775900.750000.994600.75000


Target Position: 1602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602GAAAAUAGUGUUAUAUUUU90.3505700

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1600-1622ATGAAAATAGTGTTATATTTTCTAAAAUAUAACACUAUUUUCAUGAAAAUAGUGUUAUAUUUUCUU-8.0-4.311


Target Position: 4171, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4171CAGUAUAAGACAAUGAAUU87.31831118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4169-4191TGCAGTATAAGACAATGAATTTTAAUUCAUUGUCUUAUACUGCACAGUAUAAGACAAUGAAUUUUU7.26.332


Target Position: 7096, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7096CUCAAGUUUAGCUUAAUCU76.90533385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7094-7116TTCTCAAGTTTAGCTTAATCTTGAGAUUAAGCUAAACUUGAGAACUCAAGUUUAGCUUAAUCUUGU6.919.232


Target Position: 2543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543GUUUGAGAAAUGUAUUGUA95.8888221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2541-2563TGGTTTGAGAAATGTATTGTAGAUACAAUACAUUUCUCAAACCAGUUUGAGAAAUGUAUUGUAGAU14.620.412


Target Position: 6564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6564CUUCUCAAUAUGAAACAUU78.82682917

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6562-6584TTCTTCTCAATATGAAACATTAAAAUGUUUCAUAUUGAGAAGAACUUCUCAAUAUGAAACAUUAAU14.820.421


Target Position: 5473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5473ACAUCUACCUGCAUCAUUA97.4717141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9925491ACATCTACCTGCATCATTATAATGATGCAGGTAGATGT0.487200.286200.672400.750000.994600.62500


Target Position: 5892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5892CUUAUUUAUUUGUUAGAAU85.56251416

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5890-5912TTCTTATTTATTTGTTAGAATTGAUUCUAACAAAUAAAUAAGAACUUAUUUAUUUGUUAGAAUUGU14.6-7.522


Target Position: 7460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7460CAAUAUUUUUCUUCUUUGA89.689789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7458-7480TTCAATATTTTTCTTCTTTGAAAUCAAAGAAGAAAAAUAUUGAACAAUAUUUUUCUUCUUUGAAAU12.2-10.321


Target Position: 2988, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2988GUAGAAUCAGAUAUCAAAA97.9329124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2986-3008GAGTAGAATCAGATATCAAAAGGUUUUGAUAUCUGAUUCUACUCGUAGAAUCAGAUAUCAAAAGGU8.916.033


Target Position: 1202, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202GGAAAAAAUAUGUUCUAAA99.853372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1200-1222ATGGAAAAAATATGTTCTAAAAGUUUAGAACAUAUUUUUUCCAUGGAAAAAAUAUGUUCUAAAAGU14.60.722


Target Position: 2901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901GAGCUUAUAAACUUUAGCA93.796358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2899-2921AAGAGCTTATAAACTTTAGCAAAUGCUAAAGUUUAUAAGCUCUUGAGCUUAUAAACUUUAGCAAAU18.318.322


Target Position: 8170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8170GUACCUAACCAUGUUCAUA92.9758431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8168-8190TTGTACCTAACCATGTTCATAGGUAUGAACAUGGUUAGGUACAAGUACCUAACCAUGUUCAUAGGU20.519.822


Target Position: 7366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7366CUUUACCAGUAACUAAACA84.25571708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7364-7386ATCTTTACCAGTAACTAAACATCUGUUUAGUUACUGGUAAAGAUCUUUACCAGUAACUAAACAUCU12.920.032


Target Position: 8313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8313CCACAAAAAAAAAAAAAAA87.16691142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2108331CCACAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGTGG0.998600.985800.844801.000001.000001.00000


Target Position: 1328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328UGAUGGUUGGGAGGGAAAA73.35814301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521346TGATGGTTGGGAGGGAAAATTTTCCCTCCCAACCATCA0.417100.118700.724100.750001.000001.00000


Target Position: 5496, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5496CAUAAUAUGGAUUAUUCAU90.686663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5494-5516ATCATAATATGGATTATTCATAAAUGAAUAAUCCAUAUUAUGAUCAUAAUAUGGAUUAUUCAUAAU8.9-8.622


Target Position: 6726, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6726GUUAACCACAUUCCAAAAU70.16545093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6724-6746TTGTTAACCACATTCCAAAATGTAUUUUGGAAUGUGGUUAACAAGUUAACCACAUUCCAAAAUGUU20.120.022


Target Position: 1445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GAUUUGCUGUAAAUCAAAU90.6177669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1443-1465ATGATTTGCTGTAAATCAAATCAAUUUGAUUUACAGCAAAUCAUGAUUUGCUGUAAAUCAAAUCAU7.418.532


Target Position: 2769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769GAUCACUAUAAGAAAUAUU89.3928825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492787GATCACTATAAGAAATATTAATATTTCTTATAGTGATC0.671000.194800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789AAGATCACTATAAGAAATATTTGAAUAUUUCUUAUAGUGAUCUUGAUCACUAUAAGAAAUAUUUGU1.820.322


Target Position: 702, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702CUAAUUAUAAAAGUUUUUA83.36741898

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
700-722ATCTAATTATAAAAGTTTTTAGAUAAAAACUUUUAUAAUUAGAUCUAAUUAUAAAAGUUUUUAGAU3.2-8.022


Target Position: 6101, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6101GAUAGACAGUCCAGAAUCU92.5994464

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6099-6121ATGATAGACAGTCCAGAATCTCCAGAUUCUGGACUGUCUAUCAUGAUAGACAGUCCAGAAUCUCCU20.420.333


Target Position: 7146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7146GCUUAAAUUCAGAUUUUUA99.176884

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7144-7166CAGCTTAAATTCAGATTTTTAAGUAAAAAUCUGAAUUUAAGCUGGCUUAAAUUCAGAUUUUUAAGU0.4-4.311


Target Position: 1498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498CAGAAUAUCGUCUUAAAGA91.817544

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1496-1518TGCAGAATATCGTCTTAAAGAAAUCUUUAAGACGAUAUUCUGCACAGAAUAUCGUCUUAAAGAAAU1.36.622


Target Position: 5142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5142CUGGCAUAUAUUAAAUUAU85.45041436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9795160CTGGCATATATTAAATTATATAATTTAATATATGCCAG0.636500.065100.741400.750001.000001.00000


Target Position: 3058, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058CAGAUUAUCUUUUCAACAA96.2784199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3056-3078TACAGATTATCTTTTCAACAAATUUGUUGAAAAGAUAAUCUGUACAGAUUAUCUUUUCAACAAAUU20.56.622


Target Position: 7059, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7059CAAAAAUUAGUUGGUAUUU76.92243382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7057-7079ACCAAAAATTAGTTGGTATTTATAAAUACCAACUAAUUUUUGGUCAAAAAUUAGUUGGUAUUUAUU20.0-12.022


Target Position: 1509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509CUUAAAGAAAAGUUUUUUA86.71611215

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1507-1529GTCTTAAAGAAAAGTTTTTTATGUAAAAAACUUUUCUUUAAGACCUUAAAGAAAAGUUUUUUAUGU-1.87.121


Target Position: 7483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7483UCUCAUUACUAACUUUUAA85.51021424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9617501TCTCATTACTAACTTTTAATTAAAAGTTAGTAATGAGA0.647800.451100.689700.750001.000001.00000


Target Position: 1531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531GAAAGGUACAAAUUAAUGA91.5481568

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1529-1551GCGAAAGGTACAAATTAATGATAUCAUUAAUUUGUACCUUUCGCGAAAGGUACAAAUUAAUGAUAU-1.818.623


Target Position: 8216, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8216GUAUUUGGUUUGCAUUUAA92.9669432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8214-8236CAGTATTTGGTTTGCATTTAAAGUUAAAUGCAAACCAAAUACUGGUAUUUGGUUUGCAUUUAAAGU15.312.832


Target Position: 8238, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8238GAAAAUAACGGCUGUUAUU85.83941367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8236-8258GTGAAAATAACGGCTGTTATTTTAAUAACAGCCGUUAUUUUCACGAAAAUAACGGCUGUUAUUUUU11.6-9.732


Target Position: 6469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6469CAUUUAGGUAAAAAUAUUU86.88291186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6467-6489TACATTTAGGTAAAAATATTTTCAAAUAUUUUUACCUAAAUGUACAUUUAGGUAAAAAUAUUUUCU-10.310.922


Target Position: 1857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857GUUAUUAAACUUAUAGAGA87.98441000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1855-1877CTGTTATTAAACTTATAGAGAGGUCUCUAUAAGUUUAAUAACAGGUUAUUAAACUUAUAGAGAGGU13.0-7.532


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218GCCAAGGAAAAUUAGUUAU78.81262920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4963236GCCAAGGAAAATTAGTTATATAACTAATTTTCCTTGGC0.437000.238900.956901.000001.000001.00000


Target Position: 5855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5855GUUAACUGCACCAUCAUUA86.56041235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5853-5875ATGTTAACTGCACCATCATTAAGUAAUGAUGGUGCAGUUAACAUGUUAACUGCACCAUCAUUAAGU13.611.831


Target Position: 5400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5400GUUUGUUAAGGUUUAUAUU85.17311502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5398-5420CAGTTTGTTAAGGTTTATATTGAAAUAUAAACCUUAACAAACUGGUUUGUUAAGGUUUAUAUUGAU-8.07.212


Target Position: 5179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5179GAUUCUUAUUUCUUUUAGU88.2293967

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5177-5199TTGATTCTTATTTCTTTTAGTTGACUAAAAGAAAUAAGAAUCAAGAUUCUUAUUUCUUUUAGUUGU1.36.921


Target Position: 275, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275CCCUCAUCCAAUUGAUAAA89.9681745

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_727519CCCTCATCCAATTGATAAA1/1/0/097.75SOS1NM_005633.31NANANA2:39285907..39285925(-)00SOS1(0.002)


Target Position: 7248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7248GAAAGAAACAGUUUAACCA91.7457550

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7246-7268TAGAAAGAAACAGTTTAACCATTUGGUUAAACUGUUUCUUUCUAGAAAGAAACAGUUUAACCAUUU14.05.532


Target Position: 1692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692GAAAGGAUGCUUGAUGUAA92.8919442

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1690-1712TGGAAAGGATGCTTGATGTAACAUUACAUCAAGCAUCCUUUCCAGAAAGGAUGCUUGAUGUAACAU21.518.723


Target Position: 5618, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5618GAAAUGUGCAGUAUUCCAU87.16421143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5616-5638GTGAAATGTGCAGTATTCCATCCAUGGAAUACUGCACAUUUCACGAAAUGUGCAGUAUUCCAUCCU21.212.123


Target Position: 3429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3429CCAAGAUCUGCUUCUGUAU85.97921345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3427-3449GCCCAAGATCTGCTTCTGTATCAAUACAGAAGCAGAUCUUGGGCCCAAGAUCUGCUUCUGUAUCAU20.320.422


Target Position: 5190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5190CUUUUAGUUGAAAAACACA86.59931228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5188-5210TTCTTTTAGTTGAAAAACACACAUGUGUUUUUCAACUAAAAGAACUUUUAGUUGAAAAACACACAU13.34.922


Target Position: 7491, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7491CUAACUUUUAAGAUUAUUU82.44742087

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7489-7511TACTAACTTTTAAGATTATTTCAAAAUAAUCUUAAAAGUUAGUACUAACUUUUAAGAUUAUUUCAU1.84.922


Target Position: 1428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428CUCUUUGAUGGCUUAAUGA84.15351735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1426-1448TTCTCTTTGATGGCTTAATGATTUCAUUAAGCCAUCAAAGAGAACUCUUUGAUGGCUUAAUGAUUU3.520.412


Target Position: 2791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791CAAAACUCAGGUCUAUUAA89.6315794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2789-2811GGCAAAACTCAGGTCTATTAATCUUAAUAGACCUGAGUUUUGCCCAAAACUCAGGUCUAUUAAUCU8.413.323


Target Position: 2287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287GUCAUAAUAUUACAUUUCA91.7042552

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2285-2307AGGTCATAATATTACATTTCAGAUGAAAUGUAAUAUUAUGACCUGUCAUAAUAUUACAUUUCAGAU14.88.722


Target Position: 6990, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6990GCUAUAUUAUGAUUCUAAA102.94625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6557008GCTATATTATGATTCTAAATTTAGAATCATAATATAGC0.356100.255500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6988-7010AGGCTATATTATGATTCTAAATTUUUAGAAUCAUAAUAUAGCCUGCUAUAUUAUGAUUCUAAAUUU6.9-2.723


Target Position: 3337, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3337CAGAUGUUUGCAGUGUAUU78.1533079

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3335-3357CACAGATGTTTGCAGTGTATTTGAAUACACUGCAAACAUCUGUGCAGAUGUUUGCAGUGUAUUUGU19.019.222


Target Position: 693, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693GAACUAAAUCUAAUUAUAA105.8757

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
691-713GGGAACTAAATCTAATTATAAAAUUAUAAUUAGAUUUAGUUCCCGAACUAAAUCUAAUUAUAAAAU-8.04.921


Target Position: 1203, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203GAAAAAAUAUGUUCUAAAA101.67436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1201-1223TGGAAAAAATATGTTCTAAAAGTUUUUAGAACAUAUUUUUUCCAGAAAAAAUAUGUUCUAAAAGUU7.1-12.022


Target Position: 4429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4429CUUUUAAAAAAAAAAACUU75.64633690

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4427-4449CACTTTTAAAAAAAAAAACTTAAAAGUUUUUUUUUUUAAAAGUGCUUUUAAAAAAAAAAACUUAAU3.2-9.111


Target Position: 2904, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2904CUUAUAAACUUUAGCAAAA90.499683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2902-2924AGCTTATAAACTTTAGCAAAAGGUUUUGCUAAAGUUUAUAAGCUCUUAUAAACUUUAGCAAAAGGU19.7-7.532


Target Position: 3544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3544CAUCUAAGAUUAUGUCUAA105.311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3542-3564ACCATCTAAGATTATGTCTAAGCUUAGACAUAAUCUUAGAUGGUCAUCUAAGAUUAUGUCUAAGCU20.311.622


Target Position: 5169, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5169GAAAAUGGUUGAUUCUUAU92.9362436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5167-5189AAGAAAATGGTTGATTCTTATTTAUAAGAAUCAACCAUUUUCUUGAAAAUGGUUGAUUCUUAUUUU6.911.322


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110UCUCCCAAGAUUUCCAAAA70.49865001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5293128TCTCCCAAGATTTCCAAAATTTTGGAAATCTTGGGAGA0.499700.305000.724100.750001.000001.00000


Target Position: 5099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5099CUGUUUUAAUUUAAUUGAA89.7936769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5097-5119GTCTGTTTTAATTTAATTGAATAUUCAAUUAAAUUAAAACAGACCUGUUUUAAUUUAAUUGAAUAU8.97.222


Target Position: 7107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7107CUUAAUCUUGUAUUUCAUU79.85992668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7105-7127AGCTTAATCTTGTATTTCATTGTAAUGAAAUACAAGAUUAAGCUCUUAAUCUUGUAUUUCAUUGUU7.26.932


Target Position: 5696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5696CAUUUCAGCAAUUCUGUUA88.3072960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5694-5716AACATTTCAGCAATTCTGTTAACUAACAGAAUUGCUGAAAUGUUCAUUUCAGCAAUUCUGUUAACU19.212.022


Target Position: 7378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7378CUAAACAUCACAAGGUUAA82.4492086

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7376-7398AACTAAACATCACAAGGTTAATAUUAACCUUGUGAUGUUUAGUUCUAAACAUCACAAGGUUAAUAU18.66.923


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663CCUGAAAGCCCUCCCUUAU77.82363173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753681CCTGAAAGCCCTCCCTTATATAAGGGAGGGCTTTCAGG0.385900.111000.801701.000000.994600.75000


Target Position: 692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692GGAACUAAAUCUAAUUAUA105.21712

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
690-712AGGGAACTAAATCTAATTATAAAUAUAAUUAGAUUUAGUUCCCUGGAACUAAAUCUAAUUAUAAAU-8.014.622


Target Position: 2144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144CUAUGAUUUUGAAAGAGAU92.0616519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2142-2164TTCTATGATTTTGAAAGAGATGCAUCUCUUUCAAAAUCAUAGAACUAUGAUUUUGAAAGAGAUGCU19.18.722


Target Position: 6668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6668CAAAAUUCUGCUUUUGAAU81.00492412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6666-6688TACAAAATTCTGCTTTTGAATCCAUUCAAAAGCAGAAUUUUGUACAAAAUUCUGCUUUUGAAUCCU7.70.422


Target Position: 7956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7956GAACUUUGGGGUGCAAAUA85.18431500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7954-7976GGGAACTTTGGGGTGCAAATATCUAUUUGCACCCCAAAGUUCCCGAACUUUGGGGUGCAAAUAUCU20.010.323


Target Position: 5484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5484CAUCAUUACUAUCAUAAUA102.43230

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5482-5504TGCATCATTACTATCATAATATGUAUUAUGAUAGUAAUGAUGCACAUCAUUACUAUCAUAAUAUGU8.78.732


Target Position: 3111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111CUCCCAAGAUUUCCAAAAA87.25131127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843129CTCCCAAGATTTCCAAAAATTTTTGGAAATCTTGGGAG0.554200.305600.810300.750001.000001.00000


Target Position: 6345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345GAGUUCUAAUCCUAUUUCU87.47831090

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6343-6365TGGAGTTCTAATCCTATTTCTCCAGAAAUAGGAUUAGAACUCCAGAGUUCUAAUCCUAUUUCUCCU6.918.932


Target Position: 2986, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2986GAGUAGAAUCAGAUAUCAA108.3942

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2984-3006ACGAGTAGAATCAGATATCAAAAUUGAUAUCUGAUUCUACUCGUGAGUAGAAUCAGAUAUCAAAAU17.418.933


Target Position: 6801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6801CACAUUAUCAGGAAACAUA95.7722226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6046819CACATTATCAGGAAACATATATGTTTCCTGATAATGTG0.499100.123800.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6799-6821TACACATTATCAGGAAACATACAUAUGUUUCCUGAUAAUGUGUACACAUUAUCAGGAAACAUACAU14.86.732


Target Position: 5196, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5196GUUGAAAAACACACAAAAA94.6798287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5194-5216TAGTTGAAAAACACACAAAAACAUUUUUGUGUGUUUUUCAACUAGUUGAAAAACACACAAAAACAU12.27.711


Target Position: 5390, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5390CAAGUAUACAGUUUGUUAA97.1785159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5388-5410AACAAGTATACAGTTTGTTAAGGUUAACAAACUGUAUACUUGUUCAAGUAUACAGUUUGUUAAGGU7.26.322


Target Position: 7606, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7606CUUGUUUAGUAAAUUCCAU82.64242038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7604-7626AACTTGTTTAGTAAATTCCATGCAUGGAAUUUACUAAACAAGUUCUUGUUUAGUAAAUUCCAUGCU20.17.212


Target Position: 7448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7448GAUGACUUUAUUCAAUAUU81.05672403

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7446-7468ATGATGACTTTATTCAATATTTTAAUAUUGAAUAAAGUCAUCAUGAUGACUUUAUUCAAUAUUUUU8.719.221


Target Position: 3388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3388GCAAUGAUACCGUCUUUAU88.4811938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273406GCAATGATACCGTCTTTATATAAAGACGGTATCATTGC0.366800.133700.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3386-3408AAGCAATGATACCGTCTTTATCCAUAAAGACGGUAUCAUUGCUUGCAAUGAUACCGUCUUUAUCCU14.613.633


Target Position: 749, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GUUUUCAGCUAAUGAUGUA92.8434444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
747-769TTGTTTTCAGCTAATGATGTAGAUACAUCAUUAGCUGAAAACAAGUUUUCAGCUAAUGAUGUAGAU20.512.232


Target Position: 5492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5492CUAUCAUAAUAUGGAUUAU91.0263618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5490-5512TACTATCATAATATGGATTATTCAUAAUCCAUAUUAUGAUAGUACUAUCAUAAUAUGGAUUAUUCU21.210.233


Target Position: 5482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5482UGCAUCAUUACUAUCAUAA81.99992174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9935500TGCATCATTACTATCATAATTATGATAGTAATGATGCA0.484000.327800.819000.750001.000001.00000


Target Position: 2497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497CUAAUCUUCUGAAAAUGAU82.85992001

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2495-2517TCCTAATCTTCTGAAAATGATTCAUCAUUUUCAGAAGAUUAGGACUAAUCUUCUGAAAAUGAUUCU7.46.932


Target Position: 5988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5988AGCGUCCUAAAACAUUAAU69.77095168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5806006AGCGTCCTAAAACATTAATATTAATGTTTTAGGACGCT0.587400.127100.844800.750001.000001.00000


Target Position: 5583, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5583GAAAACAUUUUAUUAAUCU84.95871544

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5581-5603GAGAAAACATTTTATTAATCTCCAGAUUAAUAAAAUGUUUUCUCGAAAACAUUUUAUUAAUCUCCU1.85.322


Target Position: 6143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6143CCUCAUUGUCCCUAAGAUU84.76261590

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6141-6163AGCCTCATTGTCCCTAAGATTTCAAUCUUAGGGACAAUGAGGCUCCUCAUUGUCCCUAAGAUUUCU11.618.132


Target Position: 5183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5183CUUAUUUCUUUUAGUUGAA86.01711342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5181-5203TTCTTATTTCTTTTAGTTGAAAAUUCAACUAAAAGAAAUAAGAACUUAUUUCUUUUAGUUGAAAAU20.32.122


Target Position: 4851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4851CUAUGCUAGAUUGUCAUUU73.91684164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4849-4871ATCTATGCTAGATTGTCATTTTCAAAUGACAAUCUAGCAUAGAUCUAUGCUAGAUUGUCAUUUUCU20.520.922


Target Position: 2896, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896GAAAAGAGCUUAUAAACUU92.2039503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2894-2916TGGAAAAGAGCTTATAAACTTTAAAGUUUAUAAGCUCUUUUCCAGAAAAGAGCUUAUAAACUUUAU4.610.322


Target Position: 824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CCAUAUAGAAGAUACAGUA100.95943

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
822-844GGCCATATAGAAGATACAGTAGAUACUGUAUCUUCUAUAUGGCCCCAUAUAGAAGAUACAGUAGAU19.04.933


Target Position: 7017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7017GGUUUUUUUCCCUCCAUAA93.1826407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8387035GGTTTTTTTCCCTCCATAATTATGGAGGGAAAAAAACC0.775500.079100.819001.000000.972800.75000


Target Position: 7899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7899CAUCUCUAAUUUUUUUCUU80.78422456

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7897-7919AACATCTCTAATTTTTTTCTTCAAAGAAAAAAAUUAGAGAUGUUCAUCUCUAAUUUUUUUCUUCAU5.520.221


Target Position: 3774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3774GGCAAUGCCUUCUUCCCAA90.2055714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5873792GGCAATGCCTTCTTCCCAATTGGGAAGAAGGCATTGCC0.521400.125500.853401.000000.918500.62500


Target Position: 479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479GAAUUAUGUAAGAAAUAUA105.8078

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
477-499GGGAATTATGTAAGAAATATACGUAUAUUUCUUACAUAAUUCCCGAAUUAUGUAAGAAAUAUACGU1.8-1.832


Target Position: 6152, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6152CCCUAAGAUUUCUCUUUUU84.24581709

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6615219CCCTAAGATTTCTCTTTTT1/1/0/0100.00SOS1NM_005633.31NANANA2:39210838..39210856(-)00SOS1(0.002)


Target Position: 5175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5175GGUUGAUUCUUAUUUCUUU94.6515289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5173-5195ATGGTTGATTCTTATTTCTTTTAAAAGAAAUAAGAAUCAACCAUGGUUGAUUCUUAUUUCUUUUAU5.314.822


Target Position: 5766, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5766GUACUUUAAUAAUUUCCUA96.3798194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5764-5786TAGTACTTTAATAATTTCCTATGUAGGAAAUUAUUAAAGUACUAGUACUUUAAUAAUUUCCUAUGU18.76.622


Target Position: 670, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670CAGAAAUUCGACAAUAUAU92.3486490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687688CAGAAATTCGACAATATATATATATTGTCGAATTTCTG0.628600.452500.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
668-690GGCAGAAATTCGACAATATATAAAUAUAUUGUCGAAUUUCUGCCCAGAAAUUCGACAAUAUAUAAU0.05.322


Target Position: 6300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6300CCUUUUCAACCUAUCUAGU77.09293339

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6298-6320CCCCTTTTCAACCTATCTAGTCTACUAGAUAGGUUGAAAAGGGGCCUUUUCAACCUAUCUAGUCUU13.012.233


Target Position: 6317, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6317GUCUAUAAAGAGGAAAAAU83.66761835

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6315-6337TAGTCTATAAAGAGGAAAAATTCAUUUUUCCUCUUUAUAGACUAGUCUAUAAAGAGGAAAAAUUCU14.38.422


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968UCGUUUCCUUAGUCAGUUA83.5071872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832986TCGTTTCCTTAGTCAGTTATAACTGACTAAGGAAACGA0.293400.125000.758600.750001.000001.00000


Target Position: 1659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659GCAUUGAUAUCUUUACAGU88.2046971

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1657-1679CAGCATTGATATCTTTACAGTACACUGUAAAGAUAUCAAUGCUGGCAUUGAUAUCUUUACAGUACU11.813.622


Target Position: 1358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GUGUUGUAAUGAAUUUAUA96.4214192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1356-1378CAGTGTTGTAATGAATTTATAATUAUAAAUUCAUUACAACACUGGUGUUGUAAUGAAUUUAUAAUU-10.320.412


Target Position: 3397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397CCGUCUUUAUCCAAGUUAC75.94723622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733415CCGTCTTTATCCAAGTTACGTAACTTGGATAAAGACGG0.254800.151300.732800.750001.000001.00000


Target Position: 6756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6756CUUUUAGAAAUGAAAAUAU84.45971659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6754-6776TTCTTTTAGAAATGAAAATATTTAUAUUUUCAUUUCUAAAAGAACUUUUAGAAAUGAAAAUAUUUU2.17.122


Target Position: 2063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063GAAAAGAUUUAGAAAAGAA102.77927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2061-2083CTGAAAAGATTTAGAAAAGAATAUUCUUUUCUAAAUCUUUUCAGGAAAAGAUUUAGAAAAGAAUAU14.85.322


Target Position: 7339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7339GUAUAGGUCCUGUUGUAUU87.76781035

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7337-7359AAGTATAGGTCCTGTTGTATTGCAAUACAACAGGACCUAUACUUGUAUAGGUCCUGUUGUAUUGCU14.619.832


Target Position: 5346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5346CUUUUAAGCAGAACUUUGU74.10324113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5344-5366ATCTTTTAAGCAGAACTTTGTAAACAAAGUUCUGCUUAAAAGAUCUUUUAAGCAGAACUUUGUAAU10.3-3.822


Target Position: 2475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475GAAGACAAAGAAAUUAACU82.52562066

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2473-2495AAGAAGACAAAGAAATTAACTCTAGUUAAUUUCUUUGUCUUCUUGAAGACAAAGAAAUUAACUCUU-0.319.212


Target Position: 8179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8179CAUGUUCAUAGGUAAUCUU87.46071095

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8177-8199ACCATGTTCATAGGTAATCTTTGAAGAUUACCUAUGAACAUGGUCAUGUUCAUAGGUAAUCUUUGU14.520.532


Target Position: 3443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3443UGUAUCAUCUAUAAGUUUA87.68291052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643461TGTATCATCTATAAGTTTATAAACTTATAGATGATACA0.680000.280000.672400.750001.000001.00000


Target Position: 2964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964CAAAAUCAGCCUUACUGUU83.08681956

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2962-2984ACCAAAATCAGCCTTACTGTTTAAACAGUAAGGCUGAUUUUGGUCAAAAUCAGCCUUACUGUUUAU19.07.422


Target Position: 1578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578GCUUUUGAAAUAAUUUUAA87.91991012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1576-1598ATGCTTTTGAAATAATTTTAAAAUUAAAAUUAUUUCAAAAGCAUGCUUUUGAAAUAAUUUUAAAAU-9.712.221


Target Position: 7453, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7453CUUUAUUCAAUAUUUUUCU75.02423851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7451-7473GACTTTATTCAATATTTTTCTTCAGAAAAAUAUUGAAUAAAGUCCUUUAUUCAAUAUUUUUCUUCU0.42.121


Target Position: 2963, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963CCAAAAUCAGCCUUACUGU78.84072912

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2961-2983TACCAAAATCAGCCTTACTGTTTACAGUAAGGCUGAUUUUGGUACCAAAAUCAGCCUUACUGUUUU16.47.422


Target Position: 5480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5480CCUGCAUCAUUACUAUCAU89.8942754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8405498CCTGCATCATTACTATCATATGATAGTAATGATGCAGG0.518600.339200.689701.000001.000001.00000


Target Position: 6853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6853CAUCAAAUUAUGUUUAGUA99.229383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6851-6873GGCATCAAATTATGTTTAGTAGGUACUAAACAUAAUUUGAUGCCCAUCAAAUUAUGUUUAGUAGGU12.97.222


Target Position: 7237, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7237CUUCAGAUUUAGAAAGAAA96.2305204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7235-7257TCCTTCAGATTTAGAAAGAAACAUUUCUUUCUAAAUCUGAAGGACUUCAGAUUUAGAAAGAAACAU14.820.412


Target Position: 4717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4717UCCCCACACACCCAAACAA74.82513906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8394735TCCCCACACACCCAAACAATTGTTTGGGTGTGTGGGGA0.297500.080500.724100.750001.000001.00000


Target Position: 4194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4194CCUAGAUGUAAUUAUACAA99.009988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4192-4214AACCTAGATGTAATTATACAATGUUGUAUAAUUACAUCUAGGUUCCUAGAUGUAAUUAUACAAUGU8.517.832