siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 280   292   956   961   969   1185   2249   2382   2406   2560   2639   2663   2727   2728   2858  
Biltr, Ernai, Rnaxs, Sidirect 2592   2834  
Biltr, Rnaxs, Sidirect 211   289   366   779   810   819   824   833   886   890   900   971   2181   2247   2257   2259   2352   2365   2366   2373  
2374   2376   2407   2426   2435   2436   2438   2563   2564   2577   2598   2615   2660   2672   2674   2679   2699   2700   2704   2714  
2723   2734   2736   2755   2835   2837   2842   2844   2845   2874   2882   3115   3120   3144   3147   3148  
Biltr, Ernai, Sidirect 356   2641  
Biltr, Rnaxs 81   82   83   87   158   159   160   190   191   192   199   200   204   205   206   209   210   212   215   217  
218   219   224   225   226   232   233   290   291   305   328   330   331   332   357   361   362   363   365   386  
387   396   418   419   420   438   448   451   452   486   487   488   489   491   499   500   501   502   503   505  
506   512   539   540   541   544   545   556   598   609   610   611   613   614   617   618   619   620   625   626  
675   676   684   685   686   687   688   690   695   752   753   755   756   757   761   762   763   764   767   768  
769   773   774   775   778   782   803   804   805   806   807   808   809   812   813   814   815   818   820   821  
822   823   825   826   827   832   834   866   867   869   879   880   881   882   884   885   887   888   889   894  
895   898   899   901   906   907   908   917   918   937   939   940   941   942   946   949   950   952   955   957  
958   962   977   981   982   983   994   997   1003   1004   1005   1006   1007   1008   1018   1029   1030   1031   1036   1037  
1084   1085   1136   1140   1141   1142   1143   1144   1145   1147   1148   1173   1174   1175   1177   1178   1179   1180   1181   1183  
1184   1189   1190   1191   1192   1200   1201   1202   1204   1208   1209   1210   1211   1213   1214   1215   1216   1217   1218   1219  
1220   1227   1228   1229   1237   1238   1239   1240   1241   1261   1262   1263   1264   1265   1266   1267   1268   1269   1270   1271  
1272   1273   1274   1276   1277   1280   1281   1282   1286   1308   1332   1333   1334   1336   1337   1379   1405   1406   1407   1408  
1409   1414   1415   1421   1423   1424   1425   1426   1427   1428   1429   1430   1431   1432   1433   1434   1435   1436   1469   1470  
1471   1472   1480   1481   1482   1517   1518   1519   1520   1521   1522   1523   1524   1525   1526   1528   1529   1530   1531   1532  
1620   1623   1624   1625   1626   1627   1654   1655   1670   1671   1672   1673   1740   1741   1742   1744   1745   1764   1765   1768  
1769   1771   1775   1776   1777   1831   1832   1833   1834   1835   1836   1837   1838   1840   1845   1846   1847   1852   1853   1854  
1855   1858   1859   1860   1861   1862   1866   1867   1868   1877   1891   1892   1894   1895   1896   1897   1898   1899   1900   1901  
1922   1923   1942   2027   2028   2029   2030   2031   2032   2033   2034   2036   2037   2040   2041   2042   2043   2044   2045   2067  
2068   2070   2071   2072   2073   2074   2075   2079   2080   2081   2082   2083   2084   2085   2086   2091   2094   2095   2099   2145  
2148   2149   2150   2155   2156   2157   2158   2180   2182   2183   2190   2207   2232   2233   2234   2235   2236   2237   2246   2248  
2254   2255   2256   2258   2298   2299   2300   2301   2302   2305   2306   2307   2309   2319   2332   2333   2334   2336   2339   2341  
2342   2343   2344   2350   2351   2354   2358   2359   2364   2367   2368   2369   2370   2371   2372   2375   2380   2381   2404   2405  
2412   2424   2425   2428   2429   2430   2431   2432   2433   2434   2437   2450   2474   2475   2483   2484   2489   2490   2545   2546  
2548   2549   2550   2551   2552   2553   2554   2555   2556   2557   2558   2559   2561   2562   2565   2566   2567   2568   2569   2570  
2571   2572   2573   2578   2579   2585   2586   2587   2590   2591   2596   2597   2599   2600   2603   2604   2605   2606   2611   2612  
2613   2614   2616   2617   2618   2625   2626   2627   2628   2629   2630   2634   2635   2636   2637   2638   2640   2649   2650   2651  
2652   2653   2658   2659   2662   2664   2665   2668   2669   2671   2673   2675   2676   2677   2678   2685   2687   2688   2689   2690  
2697   2698   2702   2703   2707   2708   2709   2712   2713   2721   2722   2724   2725   2729   2730   2731   2733   2735   2740   2741  
2742   2743   2749   2750   2751   2761   2762   2763   2764   2765   2769   2770   2823   2824   2825   2826   2827   2829   2830   2831  
2832   2833   2836   2841   2843   2846   2871   2872   2873   2875   2876   2877   2878   2880   2881   2884   2885   2886   2897   2899  
2900   2901   2907   2908   2912   2913   2914   2925   2935   2936   2937   2941   2943   2944   2945   2946   2947   2948   2949   2950  
2951   2952   2954   2955   2956   3033   3035   3036   3037   3038   3039   3040   3044   3045   3049   3050   3051   3056   3057   3058  
3059   3060   3065   3098   3099   3109   3110   3111   3112   3114   3116   3119   3139   3140   3141   3142   3143   3145   3146   3149  
3150   3151   3152   3153   3154  
Biltr, Ernai, Rnaxs 754   1182   2427  
Biltr, Ernai 278   2346   2403  


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585UUUUUUUGCUUAACAGUUU65.55521847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972603TTTTTTTGCTTAACAGTTTAAACTGTTAAGCAAAAAAA0.270200.223400.500000.500001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286GACAAAGAAGGCAGAGAGA88.27193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851304GACAAAGAAGGCAGAGAGATCTCTCTGCCTTCTTTGTC0.232600.175900.594800.500001.000001.00000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672AGGAGAGCUUGCAGGAUGA85.5167328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891690AGGAGAGCTTGCAGGATGATCATCCTGCAAGCTCTCCT0.119000.005600.620700.500001.000001.00000


Target Position: 2637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637AUCAGCUAUAUACUAUUUA80.818577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182655ATCAGCTATATACTATTTATAAATAGTATATAGCTGAT0.216900.130200.646600.500000.989100.75000


Target Position: 2342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2342CUGUGCCAUACUUGUUCUG64.17721959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312360CTGTGCCATACTTGTTCTGCAGAACAAGTATGGCACAG0.059000.001700.500000.500001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755UGGGAUGCUCAAAGAUAAU75.9966934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438773TGGGATGCTCAAAGATAATATTATCTTTGAGCATCCCA0.272500.016100.836200.750001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396CUGGAUAAGAAGGUGUCUG64.82431904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742414CTGGATAAGAAGGTGTCTGCAGACACCTTCTTATCCAG0.012600.001000.500000.500001.000001.00000


Target Position: 2755, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2755GAAAAACCCUCUAAACCAU88.9065180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732773GAAAAACCCTCTAAACCATATGGTTTAGAGGGTTTTTC0.202800.086300.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2753-2775ATGAAAAACCCTCTAAACCATGGAUGGUUUAGAGGGUUUUUCAUGAAAAACCCUCUAAACCAUGGU20.012.621


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859CCACAAUGACAUCAUCCAC77.5102834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121877CCACAATGACATCATCCACGTGGATGATGTCATTGTGG0.087100.049700.551700.750000.962000.87500


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209ACCGAAAAUGCCGAAACCA71.19521357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582227ACCGAAAATGCCGAAACCATGGTTTCGGCATTTTCGGT0.594600.208900.508600.500001.000001.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233UGUCCGAGUUACCACCAUG71.16351359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695251TGTCCGAGTTACCACCATGCATGGTGGTAACTCGGACA0.024400.010700.551700.500000.989100.87500


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831CCCAGGCCCGAGAUGAGAA82.7753470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101849CCCAGGCCCGAGATGAGAATTCTCATCTCGGGCCTGGG0.282100.036600.819001.000001.000001.00000


Target Position: 2665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665GAUAAUACAGAUUUGUAAC80.0288634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6332683GATAATACAGATTTGTAACGTTACAAATCTGTATTATC0.051900.027600.534500.500000.956500.75000


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136CCAGGCCCGGGAGGAGAAG48.83672928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171154CCAGGCCCGGGAGGAGAAGCTTCTCCTCCCGGGCCTGG0.343800.001500.706900.750000.956501.00000


Target Position: 900, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GAGAAAGAUGAUAAGUUAA99.90946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489918GAGAAAGATGATAAGTTAATTAACTTATCATCTTTCTC0.095800.025700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
898-920ATGAGAAAGATGATAAGTTAACCUUAACUUAUCAUCUUUCUCAUGAGAAAGAUGAUAAGUUAACCU6.619.122


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099GUUACCCAACAGAAACAUU80.3347616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5262117GTTACCCAACAGAAACATTAATGTTTCTGTTGGGTAAC0.082500.022300.637900.750001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008CCUGACUUUGUGUUUUAUG68.48721589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6491026CCTGACTTTGTGTTTTATGCATAAAACACAAAGTCAGG0.039900.008000.689700.750001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913CCACUAUGAGCUUUCAGAC76.3807914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042931CCACTATGAGCTTTCAGACGTCTGAAAGCTCATAGTGG0.022900.004000.525900.750001.000001.00000


Target Position: 2713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2713UGUAUAUUUUGUUACCUUU80.4514609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622731TGTATATTTTGTTACCTTTAAAGGTAACAAAATATACA0.531600.014300.706900.750001.000001.00000


Target Position: 961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961CUUUCAAUGACAAAAAGUU80.8642574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
959-981CTCTTTCAATGACAAAAAGTTTGAACUUUUUGUCAUUGAAAGAGCUUUCAAUGACAAAAAGUUUGU3.27.412


Target Position: 2698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2698GGGAAAGUUUUGUUCUGUA98.518217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802716GGGAAAGTTTTGTTCTGTATACAGAACAAAACTTTCCC0.028100.015400.810301.000001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451AGUUCCGGGCCAAGUUCUA77.06872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
696469AGTTCCGGGCCAAGTTCTATAGAACTTGGCCCGGAACT0.297700.001800.534500.750001.000001.00000


Target Position: 3050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050CCUUCUCGUGCACUGCUUU78.3144766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043068CCTTCTCGTGCACTGCTTTAAAGCAGTGCACGAGAAGG0.208800.119100.844801.000001.000001.00000


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095AGCAGUUACCCAACAGAAA86.248284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022113AGCAGTTACCCAACAGAAATTTCTGTTGGGTAACTGCT0.058400.057400.853400.750001.000001.00000


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037CCGCCCACUCAUUCCUUCU70.27511435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3203055CCGCCCACTCATTCCTTCTAGAAGGAATGAGTGGGCGG0.702800.103000.689700.750001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469UGCGGAGCUUGCAGAAUAC68.11061623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431487TGCGGAGCTTGCAGAATACGTATTCTGCAAGCTCCGCA0.012000.003800.672400.500000.967400.62500


Target Position: 2636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GAUCAGCUAUAUACUAUUU95.123140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2972654GATCAGCTATATACTATTTAAATAGTATATAGCTGATC0.214300.128200.681000.750000.989100.75000


Target Position: 2257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257CUGUAAAGUCUGAGUAAGA91.5791103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722275CTGTAAAGTCTGAGTAAGATCTTACTCAGACTTTACAG0.143500.014000.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2255-2277GCCTGTAAAGTCTGAGTAAGAAAUCUUACUCAGACUUUACAGGCCUGUAAAGUCUGAGUAAGAAAU18.911.831


Target Position: 2742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2742AAGAAUUACAUAUGAAAAA85.6935316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5032760AAGAATTACATATGAAAAATTTTTCATATGTAATTCTT0.843200.717000.637900.500001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688UGGACCAGCACAAACUUAC60.26272287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727706TGGACCAGCACAAACTTACGTAAGTTTGTGCTGGTCCA0.147500.001400.663800.500000.972800.87500


Target Position: 2668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2668AAUACAGAUUUGUAACAUU88.9344178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072686AATACAGATTTGTAACATTAATGTTACAAATCTGTATT0.076100.033400.500000.500000.956500.75000


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523GCGCAAGGAGGAUGAAGUU81.8719518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161541GCGCAAGGAGGATGAAGTTAACTTCATCCTCCTTGCGC0.503400.035900.775901.000001.000001.00000


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884CACUUUUAAUUUUGUCAGA86.0438290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7252902CACTTTTAATTTTGTCAGATCTGACAAAATTAAAAGTG0.429900.197600.569000.500001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085GUAUAUGCGCCGCAGGAAG67.73721653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6761103GTATATGCGCCGCAGGAAGCTTCCTGCGGCGCATATAC0.029400.007500.543100.500000.978301.00000


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CCCACAAUGACAUCAUCCA85.5711325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131876CCCACAATGACATCATCCATGGATGATGTCATTGTGGG0.086200.049700.646600.750000.962000.75000


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212GAAAAUGCCGAAACCAAUC67.74971652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695230GAAAATGCCGAAACCAATCGATTGGTTTCGGCATTTTC0.573200.197800.491400.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368AAUGAGCUCAAAUUGAUUU75.9207944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142386AATGAGCTCAAATTGATTTAAATCAATTTGAGCTCATT0.072500.016200.508600.500001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426AGAGACAGGCGGUGGAUCA82.1511504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5991444AGAGACAGGCGGTGGATCATGATCCACCGCCTGTCTCT0.197400.017300.500000.500001.000001.00000


Target Position: 2484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484UGAUUCCCUCCUCCCGUCA66.47551761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232502TGATTCCCTCCTCCCGTCATGACGGGAGGAGGGAATCA0.168800.063000.500000.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546GGUGGAGGAGGACACUUGG69.76891466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192564GGTGGAGGAGGACACTTGGCCAAGTGTCCTCCTCCACC0.026100.002700.508600.500000.956500.62500


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895UUUAUGAGAAAGAUGAUAA82.3042491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744913TTTATGAGAAAGATGATAATTATCATCTTTCTCATAAA0.068900.029600.465500.500001.000001.00000


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GGAGGAGGACACUUGGAUU91.863397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362567GGAGGAGGACACTTGGATTAATCCAAGTGTCCTCCTCC0.102500.003800.862101.000001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897GCCGGGACAAGUACAAGAC68.86451546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771915GCCGGGACAAGTACAAGACGTCTTGTACTTGTCCCGGC0.157800.064200.681000.750001.000001.00000


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228AGCAGAUGAUGCGCGAGAA88.0681203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771246AGCAGATGATGCGCGAGAATTCTCGCGCATCATCTGCT0.028700.005000.681000.750000.918500.62500


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804GACCUGGAAAUGUAUGGAA91.4581107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574822GACCTGGAAATGTATGGAATTCCATACATTTCCAGGTC0.065100.045200.646600.750001.000001.00000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561UUGGAUUUUUUUUUUUGUU62.3882126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912579TTGGATTTTTTTTTTTGTTAACAAAAAAAAAAATCCAA0.122400.073300.500000.500001.000001.00000


Target Position: 2679, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679GUAACAUUAGUUUUAAAAA93.493461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2142697GTAACATTAGTTTTAAAAATTTTTAAAACTAATGTTAC0.322800.179700.681000.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2677-2699TTGTAACATTAGTTTTAAAAAGGUUUUUAAAACUAAUGUUACAAGUAACAUUAGUUUUAAAAAGGU-9.16.922


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GAUAAUGCUAUGUUGGAAU85.9699293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
359786GATAATGCTATGTTGGAATATTCCAACATAGCATTATC0.234500.102800.672400.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571UUUUUUGUUUUUUUUUUUU60.06722302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082589TTTTTTGTTTTTTTTTTTTAAAAAAAAAAAACAAAAAA0.245500.077500.500000.500001.000001.00000


Target Position: 2300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2300CAAGAGUCAGCAUCAUUAA96.730129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4032318CAAGAGTCAGCATCATTAATTAATGATGCTGACTCTTG0.266800.074000.612100.750001.000001.00000


Target Position: 2034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2034CACGCUUGUGUCUUUAGUG75.9439942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362052CACGCTTGTGTCTTTAGTGCACTAAAGACACAAGCGTG0.242500.006400.500000.500000.962000.62500


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UGGAUUUUUUUUUUUGUUU66.83331727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4252580TGGATTTTTTTTTTTGTTTAAACAAAAAAAAAAATCCA0.124600.074800.844800.750001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768UCACUGAGGCAGAGAAGAA86.349281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021786TCACTGAGGCAGAGAAGAATTCTTCTCTGCCTCAGTGA0.607900.053900.551700.750000.945700.62500


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006CACCUGACUUUGUGUUUUA93.729756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741024CACCTGACTTTGTGTTTTATAAAACACAAAGTCAGGTG0.029700.006300.758600.750000.962000.62500


Target Position: 2577, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577GUUUUUUUUUUUUUUGCUU71.82031290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812595GTTTTTTTTTTTTTTGCTTAAGCAAAAAAAAAAAAAAC0.570000.193800.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2575-2597TTGTTTTTTTTTTTTTTGCTTAAAAGCAAAAAAAAAAAAAACAAGUUUUUUUUUUUUUUGCUUAAU18.6-11.300


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812AAUGUAUGGAAUCAACUAU82.7337473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
743830AATGTATGGAATCAACTATATAGTTGATTCCATACATT0.117600.015400.465500.500001.000001.00000


Target Position: 2899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899CAGAUUCACACAUGCCACU78.0903788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4572917CAGATTCACACATGCCACTAGTGGCATGTGTGAATCTG0.314900.184700.577600.500001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981GUCAUUAAACCCAUCGACA85.3048338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484999GTCATTAAACCCATCGACATGTCGATGGGTTTAATGAC0.197100.011400.612100.500001.000001.00000


Target Position: 2640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640AGCUAUAUACUAUUUAUAU93.642759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042658AGCTATATACTATTTATATATATAAATAGTATATAGCT0.091800.052000.810300.750001.000001.00000


Target Position: 2639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2639CAGCUAUAUACUAUUUAUA100.4765

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2637-2659ATCAGCTATATACTATTTATATAUAUAAAUAGUAUAUAGCUGAUCAGCUAUAUACUAUUUAUAUAU-8.019.522


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431GAGGGGUGAAAAUUAUUUU84.3987384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6532449GAGGGGTGAAAATTATTTTAAAATAATTTTCACCCCTC0.367600.003200.810300.750001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770CCAUGGCACUUGAUGUGAU90.2239138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682788CCATGGCACTTGATGTGATATCACATCAAGTGCCATGG0.071100.002700.663801.000000.967400.75000


Target Position: 2246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246ACGGAAAAUGCCUGUAAAG66.7641736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422264ACGGAAAATGCCTGTAAAGCTTTACAGGCATTTTCCGT0.062900.011300.637900.500001.000001.00000


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741AAAGAAUUACAUAUGAAAA93.237967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452759AAAGAATTACATATGAAAATTTTCATATGTAATTCTTT0.835300.612600.500000.500001.000001.00000


Target Position: 3152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3152AAAAAAAAAAAAAAAAAAA83.5835426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123170AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.997300.500000.500001.000001.00000


Target Position: 1180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180AGCUGGAAACAGAGAAGAA93.960452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321198AGCTGGAAACAGAGAAGAATTCTTCTCTGTTTCCAGCT0.616000.016500.681000.750000.994600.75000


Target Position: 2941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2941GAAGAGACUCUGUUUGCUU89.6977155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862959GAAGAGACTCTGTTTGCTTAAGCAAACAGAGTCTCTTC0.155100.002300.534500.750001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901GGACAAGUACAAGACGCUG76.2502921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631919GGACAAGTACAAGACGCTGCAGCGTCTTGTACTTGTCC0.033600.025700.586200.750001.000001.00000


Target Position: 2382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2382GAUUUUUUAAUUUCUAUGA85.7623309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2380-2402TTGATTTTTTAATTTCTATGAAGUCAUAGAAAUUAAAAAAUCAAGAUUUUUUAAUUUCUAUGAAGU13.4-12.021


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GAAUAAGAGGACCCACAAU90.5934127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591865GAATAAGAGGACCCACAATATTGTGGGTCCTCTTATTC0.172700.142900.663800.750000.945700.62500


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888CUGAAUAUUUAUGAGAAAG72.65641210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615906CTGAATATTTATGAGAAAGCTTTCTCATAAATATTCAG0.155500.119600.646600.500001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900GGGACAAGUACAAGACGCU84.0789402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131918GGGACAAGTACAAGACGCTAGCGTCTTGTACTTGTCCC0.053800.031200.637900.750001.000001.00000


Target Position: 2749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2749ACAUAUGAAAAACCCUCUA81.8332522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352767ACATATGAAAAACCCTCTATAGAGGGTTTTTCATATGT0.256500.248100.534500.750001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044UCUUUAGUGCUCCAAGUCU69.84771460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382062TCTTTAGTGCTCCAAGTCTAGACTTGGAGCACTAAAGA0.044800.017500.500000.500001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618GGGGACUACAACAAAGAAG73.20951158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307636GGGGACTACAACAAAGAAGCTTCTTTGTTGTAGTCCCC0.252600.049200.853400.750001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517GCGGAGGCGCAAGGAGGAU67.10411702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891535GCGGAGGCGCAAGGAGGATATCCTCCTTGCGCCTCCGC0.267100.011000.741401.000000.951100.62500


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778UGUUGGAAUACCUGAAGAU80.3528614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716796TGTTGGAATACCTGAAGATATCTTCAGGTATTCCAACA0.019100.006000.525900.750000.956501.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151AAAAAAAAAAAAAAAAAAA83.5835425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373169AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.997200.500000.500001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566UUUUUUUUUUUGUUUUUUU62.33722132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962584TTTTTTTTTTTGTTTTTTTAAAAAAACAAAAAAAAAAA0.127300.076200.500000.500001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CUUGGACUGAAUAUUUAUG72.37061239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709900CTTGGACTGAATATTTATGCATAAATATTCAGTCCAAG0.212700.006300.482800.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885GGACUGAAUAUUUAUGAGA92.40681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353903GGACTGAATATTTATGAGATCTCATAAATATTCAGTCC0.174900.029700.646600.750001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336AGCUGGAGGAGGAGAGGAA85.3869336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181354AGCTGGAGGAGGAGAGGAATTCCTCTCCTCCTCCAGCT0.299000.066300.681000.750001.000001.00000


Target Position: 280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280CAAAUACAACUGGAAAACA88.4106190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
278-300GCCAAATACAACTGGAAAACAGCUGUUUUCCAGUUGUAUUUGGCCAAAUACAACUGGAAAACAGCU21.26.912


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079CCCAGUUCCUUUAGAAAGC59.01882397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6462097CCCAGTTCCTTTAGAAAGCGCTTTCTAAAGGAACTGGG0.371000.126500.637900.500001.000001.00000


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044CUCAUUCCUUCUCGUGCAC61.12552219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153062CTCATTCCTTCTCGTGCACGTGCACGAGAAGGAATGAG0.334000.245500.517200.500001.000001.00000


Target Position: 2659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659ACAAGUGAUAAUACAGAUU78.9375720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542677ACAAGTGATAATACAGATTAATCTGTATTATCACTTGT0.102600.007300.698300.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899UGAGAAAGAUGAUAAGUUA96.886228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462917TGAGAAAGATGATAAGTTATAACTTATCATCTTTCTCA0.112000.028200.689700.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899CGGGACAAGUACAAGACGC65.50271851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6971917CGGGACAAGTACAAGACGCGCGTCTTGTACTTGTCCCG0.146900.036300.491400.500001.000001.00000


Target Position: 356, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356CCACUAUGUGGAUAAUAAA99.61588

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_235619CCACTATGTGGATAATAAA1/1/0/097.75EZRNM_001111077.1+NM_003379.41+1NANANA6:159208173..159208191(-)00EZR(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
354-376CTCCACTATGTGGATAATAAAGGUUUAUUAUCCACAUAGUGGAGCCACUAUGUGGAUAAUAAAGGU-8.017.932


Target Position: 2157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157CCAGUUGUAAUAGUGCCAA82.1521503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522175CCAGTTGTAATAGTGCCAATTGGCACTATTACAACTGG0.175100.063600.698301.000001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687AUGGACCAGCACAAACUUA80.2643621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
663705ATGGACCAGCACAAACTTATAAGTTTGTGCTGGTCCAT0.175900.002800.620700.500000.972800.75000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544UCCUUAGCGAUGAGAUCUA78.2213777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354562TCCTTAGCGATGAGATCTATAGATCTCATCGCTAAGGA0.220300.030700.698300.750001.000001.00000


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579UUUUUUUUUUUUUGCUUAA69.54721481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422597TTTTTTTTTTTTTGCTTAATTAAGCAAAAAAAAAAAAA0.364100.104800.465500.500001.000001.00000


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004GGCACCUGACUUUGUGUUU77.7106819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201022GGCACCTGACTTTGTGTTTAAACACAAAGTCAGGTGCC0.018600.002501.000001.000000.929300.62500


Target Position: 2425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2425UGCUUAGAGGGGUGAAAAU74.74611044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322443TGCTTAGAGGGGTGAAAATATTTTCACCCCTCTAAGCA0.047100.001300.844800.750001.000001.00000


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805ACCUGGAAAUGUAUGGAAU80.6946588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465823ACCTGGAAATGTATGGAATATTCCATACATTTCCAGGT0.111200.046300.844800.750001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525GCAAGGAGGAUGAAGUUGA86.5027274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961543GCAAGGAGGATGAAGTTGATCAACTTCATCCTCCTTGC0.500600.147800.629300.750001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423UGGAGAGACAGGCGGUGGA70.53361414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161441TGGAGAGACAGGCGGTGGATCCACCGCCTGTCTCTCCA0.093100.003600.474100.500001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822AUCAACUAUUUCGAGAUAA77.9294800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641840ATCAACTATTTCGAGATAATTATCTCGAAATAGTTGAT0.109700.038100.646600.500001.000001.00000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860CACAAUGACAUCAUCCACA90.0948143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821878CACAATGACATCATCCACATGTGGATGATGTCATTGTG0.093800.050900.586200.500000.962000.87500


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617ACUUAUACACCUUAUUAAU85.231343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082635ACTTATACACCTTATTAATATTAATAAGGTGTATAAGT0.496900.202700.698300.750001.000001.00000


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954UUGCUUGUGUUUGUUUGUU60.52742266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482972TTGCTTGTGTTTGTTTGTTAACAAACAAACACAAGCAA0.327500.106500.500000.500001.000001.00000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091AGAAAGCAGUUACCCAACA81.1039560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932109AGAAAGCAGTTACCCAACATGTTGGGTAACTGCTTTCT0.098100.094600.517200.500001.000001.00000


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029CCACGUCUGAGAAUCAACA88.3976191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401047CCACGTCTGAGAATCAACATGTTGATTCTCAGACGTGG0.340000.042100.637900.750000.978300.62500


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269CAGGACUAUGAGGAGAAGA81.3403549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6401287CAGGACTATGAGGAGAAGATCTTCTCCTCATAGTCCTG0.817900.313300.560300.500001.000001.00000


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618CUUAUACACCUUAUUAAUG74.24691076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002636CTTATACACCTTATTAATGCATTAATAAGGTGTATAAG0.471100.208400.482800.500001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CACCCAGAAACUUUUCUUC69.77081465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710524CACCCAGAAACTTTTCTTCGAAGAAAAGTTTCTGGGTG0.031600.009100.620700.500000.951100.75000


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869UGGAGUUGAUGCCCUUGGA75.6347978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726887TGGAGTTGATGCCCTTGGATCCAAGGGCATCAACTCCA0.016600.003700.474100.500000.972800.62500


Target Position: 2190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2190CGCGAUUAUUCUCGAAUCA86.8036256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362208CGCGATTATTCTCGAATCATGATTCGAGAATAATCGCG0.013000.001600.698300.750000.940200.75000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997ACAAGAAGGCACCUGACUU79.64656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101015ACAAGAAGGCACCTGACTTAAGTCAGGTGCCTTCTTGT0.046700.001600.569000.750000.907600.62500


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290UGGAAAACAGCUUUUUGAU74.42931063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306308TGGAAAACAGCTTTTTGATATCAAAAAGCTGTTTTCCA0.208200.043500.663800.750001.000001.00000


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690UUUAAAAAGGGAAAGUUUU63.34512036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192708TTTAAAAAGGGAAAGTTTTAAAACTTTCCCTTTTTAAA0.062700.040200.500000.500001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155CCCCAGUUGUAAUAGUGCC64.28641948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862173CCCCAGTTGTAATAGTGCCGGCACTATTACAACTGGGG0.181400.049800.491400.500001.000001.00000


Target Position: 2949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2949UCUGUUUGCUUGUGUUUGU67.13481700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642967TCTGTTTGCTTGTGTTTGTACAAACACAAGCAAACAGA0.494200.053800.517200.500001.000001.00000


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073UCAGAUCCCAGUUCCUUUA75.8379959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3842091TCAGATCCCAGTTCCTTTATAAAGGAACTGGGATCTGA0.149700.081700.689700.750001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191CGAGGAUACUCACCAGAAA99.432211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514209CGAGGATACTCACCAGAAATTTCTGGTGAGTATCCTCG0.241000.009100.793101.000000.923900.62500


Target Position: 754, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754GUGGGAUGCUCAAAGAUAA97.39824

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_375419GTGGGATGCTCAAAGATAA1/1/0/097.21EZRNM_001111077.1+NM_003379.41+1NANANA6:159204693,159205676..159204698,159205688(-)00EZR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549772GTGGGATGCTCAAAGATAATTATCTTTGAGCATCCCAC0.225800.007600.758600.750001.000001.00000


Target Position: 2874, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2874GGACUAUGCACACUUUUAA97.665221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072892GGACTATGCACACTTTTAATTAAAAGTGTGCATAGTCC0.361500.037600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2872-2894ATGGACTATGCACACTTTTAATTUUAAAAGUGUGCAUAGUCCAUGGACUAUGCACACUUUUAAUUU4.920.333


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191GAGAAGAAAAGGAGAGAAA94.126550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601209GAGAAGAAAAGGAGAGAAATTTCTCTCCTTTTCTTCTC0.708300.659100.810300.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GCGCGAGAAGGAGGAGUUG65.49341854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011256GCGCGAGAAGGAGGAGTTGCAACTCCTCCTTCTCGCGC0.139100.026000.775900.750001.000001.00000


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900AGAUUCACACAUGCCACUA83.7382417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082918AGATTCACACATGCCACTATAGTGGCATGTGTGAATCT0.325400.180400.551700.750001.000001.00000


Target Position: 2235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2235CUGAUUGAAUUACGGAAAA82.89463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342253CTGATTGAATTACGGAAAATTTTCCGTAATTCAATCAG0.080000.082200.784500.750001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCAGGAACAUCUCUUUCAA87.0523248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
645967TCAGGAACATCTCTTTCAATTGAAAGAGATGTTCCTGA0.042500.008700.577600.750001.000001.00000


Target Position: 2552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552GGAGGACACUUGGAUUUUU87.8623208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922570GGAGGACACTTGGATTTTTAAAAATCCAAGTGTCCTCC0.208800.005500.870701.000001.000001.00000


Target Position: 1333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1333UGCAGCUGGAGGAGGAGAG55.85242614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471351TGCAGCTGGAGGAGGAGAGCTCTCCTCCTCCAGCTGCA0.311600.050800.543100.500001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671CAGGAGAGCUUGCAGGAUG75.07091020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481689CAGGAGAGCTTGCAGGATGCATCCTGCAAGCTCTCCTG0.059400.004600.629300.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977GUUUGUCAUUAAACCCAUC73.42831143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
737995GTTTGTCATTAAACCCATCGATGGGTTTAATGACAAAC0.613000.005200.465500.500000.989101.00000


Target Position: 292, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292GAAAACAGCUUUUUGAUCA89.6741157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
290-312TGGAAAACAGCTTTTTGATCAGGUGAUCAAAAAGCUGUUUUCCAGAAAACAGCUUUUUGAUCAGGU16.310.322


Target Position: 2826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826UGCAGUCACGUGUAAACAG69.18321511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892844TGCAGTCACGTGTAAACAGCTGTTTACACGTGACTGCA0.055300.015700.569000.500001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563GGAUUUUUUUUUUUGUUUU81.8974516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222581GGATTTTTTTTTTTGTTTTAAAACAAAAAAAAAAATCC0.125300.074800.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2561-2583TTGGATTTTTTTTTTTGTTTTTTAAAACAAAAAAAAAAAUCCAAGGAUUUUUUUUUUUGUUUUUUU5.60.410


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141CACGAAGCAAAAAAAAAAA85.9884292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753159CACGAAGCAAAAAAAAAAATTTTTTTTTTTGCTTCGTG0.997300.006000.793100.750001.000001.00000


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597ACAGUUUUAGAAUACAUUG69.9711453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582615ACAGTTTTAGAATACATTGCAATGTATTCTAAAACTGT0.097300.046200.560300.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264GGCUGCAGGACUAUGAGGA83.4159444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381282GGCTGCAGGACTATGAGGATCCTCATAGTCCTGCAGCC0.436700.008000.629300.750001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830GUCACGUGUAAACAGGAUU75.9302943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252848GTCACGTGTAAACAGGATTAATCCTGTTTACACGTGAC0.124300.008600.810300.750001.000001.00000


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354UGUUCUGUAUUCGAAAUGA80.7128587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7012372TGTTCTGTATTCGAAATGATCATTTCGAATACAGAACA0.109600.016300.482800.500001.000001.00000


Target Position: 2403, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403GAUCCAUCUUUGUAUAUUU96.95126

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4240319GATCCATCTTTGTATATTT1/1/0/096.22EZRNM_001111077.1+NM_003379.41+1NANANA6:159187501..159187519(-)00EZR(0.002)


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CCAAGUUUGGGGACUACAA88.1035199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734628CCAAGTTTGGGGACTACAATTGTAGTCCCCAAACTTGG0.128400.001200.698301.000000.967400.62500


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305UGAUCAGGUGGUAAAGACU78.7631732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715323TGATCAGGTGGTAAAGACTAGTCTTTACCACCTGATCA0.076500.001500.517200.500001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957AUCUCUUUCAAUGACAAAA77.789813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719975ATCTCTTTCAATGACAAAATTTTGTCATTGAAAGAGAT0.018800.005700.681000.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573UUUUGUUUUUUUUUUUUUU62.51952115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982591TTTTGTTTTTTTTTTTTTTAAAAAAAAAAAAAACAAAA0.310800.082700.500000.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500GGACAUCACCCAGAAACUU83.4901436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308518GGACATCACCCAGAAACTTAAGTTTCTGGGTGATGTCC0.205300.114600.732801.000001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031ACGUCUGAGAAUCAACAAG68.09361629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561049ACGTCTGAGAATCAACAAGCTTGTTGATTCTCAGACGT0.165500.016100.637900.500000.978300.62500


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282AGAAGACAAAGAAGGCAGA81.3766545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771300AGAAGACAAAGAAGGCAGATCTGCCTTCTTTGTCTTCT0.230000.168100.500000.500001.000001.00000


Target Position: 2028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028CCCCGCCACGCUUGUGUCU62.18622151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692046CCCCGCCACGCTTGTGTCTAGACACAAGCGTGGCGGGG0.067600.007100.767200.750000.902200.87500


Target Position: 2750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2750CAUAUGAAAAACCCUCUAA91.6245102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3882768CATATGAAAAACCCTCTAATTAGAGGGTTTTTCATATG0.244400.238000.620700.750001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271GGACUAUGAGGAGAAGACA93.797855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691289GGACTATGAGGAGAAGACATGTCTTCTCCTCATAGTCC0.650500.364800.663800.750001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887ACUGAAUAUUUAUGAGAAA91.5452106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339905ACTGAATATTTATGAGAAATTTCTCATAAATATTCAGT0.183300.077000.706900.750001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GGAUGCUCAAAGAUAAUGC70.97331376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
612775GGATGCTCAAAGATAATGCGCATTATCTTTGAGCATCC0.193900.015300.517200.500000.929300.62500


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763UCAAAGAUAAUGCUAUGUU72.81131191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454781TCAAAGATAATGCTATGTTAACATAGCATTATCTTTGA0.160600.098200.577600.750001.000001.00000


Target Position: 2858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858GUUUUAUGCAUGUAAUGGA85.242342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2856-2878GTGTTTTATGCATGTAATGGACTUCCAUUACAUGCAUAAAACACGUUUUAUGCAUGUAAUGGACUU20.0-1.413


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877CAACGAGAACAUGAGGCAA91.80499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211895CAACGAGAACATGAGGCAATTGCCTCATGTTCTCGTTG0.092700.077200.500000.750001.000001.00000


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918ACCCCAAAGAUUGGCUUUC49.47452911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730936ACCCCAAAGATTGGCTTTCGAAAGCCAATCTTTGGGGT0.015700.002400.681000.500000.902200.87500


Target Position: 819, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GGAAUCAACUAUUUCGAGA89.9148149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566837GGAATCAACTATTTCGAGATCTCGAAATAGTTGATTCC0.068800.020400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
817-839ATGGAATCAACTATTTCGAGATAUCUCGAAAUAGUUGAUUCCAUGGAAUCAACUAUUUCGAGAUAU21.016.333


Target Position: 226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
226CAAUCAAUGUCCGAGUUAC79.568665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729244CAATCAATGTCCGAGTTACGTAACTCGGACATTGATTG0.084600.056900.465500.500001.000001.00000


Target Position: 620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
620GGACUACAACAAAGAAGUG81.932513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
598638GGACTACAACAAAGAAGTGCACTTCTTTGTTGTAGTCC0.059200.015100.577600.750001.000001.00000


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753CGUGGGAUGCUCAAAGAUA96.221932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488771CGTGGGATGCTCAAAGATATATCTTTGAGCATCCCACG0.323300.011100.732801.000001.000001.00000


Target Position: 2041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2041GUGUCUUUAGUGCUCCAAG74.1161091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432059GTGTCTTTAGTGCTCCAAGCTTGGAGCACTAAAGACAC0.192200.094800.655200.500001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942AGUGAAAUCAGGAACAUCU82.5753480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707960AGTGAAATCAGGAACATCTAGATGTTCCTGATTTCACT0.113600.023100.482800.500001.000001.00000


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881GCACACUUUUAAUUUUGUC71.23491354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282899GCACACTTTTAATTTTGTCGACAAAATTAAAAGTGTGC0.463700.164900.534500.750001.000001.00000


Target Position: 278, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
278GCCAAAUACAACUGGAAAA88.2181196

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_127819GCCAAATACAACTGGAAAA1/1/0/097.75EZRNM_001111077.1+NM_003379.41+1NANANA6:159210335..159210353(-)00EZR(0.002)


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922GCAGAUCCGGCAGGGCAAC56.44492571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251940GCAGATCCGGCAGGGCAACGTTGCCCTGCCGGATCTGC0.029600.001400.706900.750000.967401.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232AUGUCCGAGUUACCACCAU70.26041436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
603250ATGTCCGAGTTACCACCATATGGTGGTAACTCGGACAT0.128200.023100.500000.500000.989100.75000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490CCUCCUCCCGUCACUCCAC64.90381897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6642508CCTCCTCCCGTCACTCCACGTGGAGTGACGGGAGGAGG0.033300.011700.551700.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625ACAACAAAGAAGUGCACAA88.0172205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688643ACAACAAAGAAGTGCACAATTGTGCACTTCTTTGTTGT0.026000.007600.560300.750001.000001.00000


Target Position: 2156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156CCCAGUUGUAAUAGUGCCA79.8411647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3482174CCCAGTTGTAATAGTGCCATGGCACTATTACAACTGGG0.177100.056200.646600.750001.000001.00000


Target Position: 1200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1200AGGAGAGAAACCGUGGAGA74.5151056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801218AGGAGAGAAACCGTGGAGATCTCCACGGTTTCTCTCCT0.322100.304400.620700.500000.983700.75000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CCGGGAGGAGAAGCAUCAG65.78041823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311160CCGGGAGGAGAAGCATCAGCTGATGCTTCTCCTCCCGG0.123300.029600.629300.750001.000001.00000


Target Position: 1421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421GCUGGAGAGACAGGCGGUG61.73792182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181439GCTGGAGAGACAGGCGGTGCACCGCCTGTCTCTCCAGC0.043400.001500.560300.750000.972800.62500


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867CUUGGAGUUGAUGCCCUUG62.72362104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735885CTTGGAGTTGATGCCCTTGCAAGGGCATCAACTCCAAG0.048600.001200.491400.500000.972800.75000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675CCUCAAAGAGUGAUGGACC69.00621526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
697693CCTCAAAGAGTGATGGACCGGTCCATCACTCTTTGAGG0.025500.001700.491400.500000.962000.62500


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CUAUUUCGAGAUAAAAAAC71.99081276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730845CTATTTCGAGATAAAAAACGTTTTTTATCTCGAAATAG0.475400.021800.525900.500001.000001.00000


Target Position: 2723, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723GUUACCUUUUACAGAAUAA92.043992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6742741GTTACCTTTTACAGAATAATTATTCTGTAAAAGGTAAC0.071800.002500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2721-2743TTGTTACCTTTTACAGAATAAAAUUAUUCUGUAAAAGGUAACAAGUUACCUUUUACAGAAUAAAAU13.418.622


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605AGAAUACAUUGUACUUAUA97.49622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292623AGAATACATTGTACTTATATATAAGTACAATGTATTCT0.264600.064100.681000.750000.983700.75000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CUUGGAGUGAAAUCAGGAA87.6942217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
739955CTTGGAGTGAAATCAGGAATTCCTGATTTCACTCCAAG0.098800.001700.465500.750001.000001.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419GGAGGUCAGGAAGGAGAAU80.7323584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643437GGAGGTCAGGAAGGAGAATATTCTCCTTCCTGACCTCC0.042700.005800.862101.000001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626CAACAAAGAAGUGCACAAG74.70451046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740644CAACAAAGAAGTGCACAAGCTTGTGCACTTCTTTGTTG0.012200.007800.508600.500001.000001.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148UUGUUUUCCCCAGUUGUAA68.91291539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4212166TTGTTTTCCCCAGTTGTAATTACAACTGGGGAAAACAA0.190700.100900.612100.500001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366GAAAUGAGCUCAAAUUGAU92.823175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982384GAAATGAGCTCAAATTGATATCAATTTGAGCTCATTTC0.079200.011000.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2364-2386TCGAAATGAGCTCAAATTGATTTAUCAAUUUGAGCUCAUUUCGAGAAAUGAGCUCAAAUUGAUUUU7.412.032


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337GCUGGAGGAGGAGAGGAAG68.54511583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771355GCTGGAGGAGGAGAGGAAGCTTCCTCTCCTCCTCCAGC0.189700.025300.715500.750001.000001.00000


Target Position: 487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487AGGAGCUCAUCCAGGACAU77.3357850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608505AGGAGCTCATCCAGGACATATGTCCTGGATGAGCTCCT0.112200.004900.689700.750000.918500.62500


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362UGUGGAUAAUAAAGGAUUU79.9913637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532380TGTGGATAATAAAGGATTTAAATCCTTTATTATCCACA0.095500.008200.706900.750001.000001.00000


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955UGCUUGUGUUUGUUUGUUU75.539988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2222973TGCTTGTGTTTGTTTGTTTAAACAAACAAACACAAGCA0.326200.132600.853400.750001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894AUUUAUGAGAAAGAUGAUA79.301692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745912ATTTATGAGAAAGATGATATATCATCTTTCTCATAAAT0.081800.043300.465500.500001.000001.00000


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568UUUUUUUUUGUUUUUUUUU56.93512543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6872586TTTTTTTTTGTTTTTTTTTAAAAAAAAACAAAAAAAAA0.129500.067600.500000.500001.000001.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412UUGUAUAUUUACAUGCUUA87.7339213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242430TTGTATATTTACATGCTTATAAGCATGTAAATATACAA0.025200.006100.612100.500000.967400.62500


Target Position: 2671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2671ACAGAUUUGUAACAUUAGU75.0291021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562689ACAGATTTGTAACATTAGTACTAATGTTACAAATCTGT0.296400.034300.500000.500001.000001.00000


Target Position: 2708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2708UGUUCUGUAUAUUUUGUUA90.46131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3652726TGTTCTGTATATTTTGTTATAACAAAATATACAGAACA0.677600.027300.672400.750001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154AAAAAAAAAAAAAAAAAAA83.5835428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273172AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.997400.500000.500001.000001.00000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GGAAAUGUAUGGAAUCAAC83.4733438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506827GGAAATGTATGGAATCAACGTTGATTCCATACATTTCC0.091400.028300.724100.750001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371GAGCUCAAAUUGAUUUUUU84.5421378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952389GAGCTCAAATTGATTTTTTAAAAAATCAATTTGAGCTC0.059700.027500.810300.750001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502ACAUCACCCAGAAACUUUU77.3731847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533520ACATCACCCAGAAACTTTTAAAAGTTTCTGGGTGATGT0.080100.043700.706900.750001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GGGACUACAACAAAGAAGU79.6317657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379637GGGACTACAACAAAGAAGTACTTCTTTGTTGTAGTCCC0.155800.036600.784500.750001.000001.00000


Target Position: 3039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3039GCCCACUCAUUCCUUCUCG62.77292100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343057GCCCACTCATTCCTTCTCGCGAGAAGGAATGAGTGGGC0.527300.229100.706900.500001.000001.00000


Target Position: 2551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2551AGGAGGACACUUGGAUUUU72.42891232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322569AGGAGGACACTTGGATTTTAAAATCCAAGTGTCCTCCT0.194800.004000.844800.750001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613UUGUACUUAUACACCUUAU75.261009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482631TTGTACTTATACACCTTATATAAGGTGTATAAGTACAA0.407800.247000.603400.500000.978300.62500


Target Position: 2699, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2699GGAAAGUUUUGUUCUGUAU89.9317146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602717GGAAAGTTTTGTTCTGTATATACAGAACAAAACTTTCC0.034500.015200.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2697-2719AGGGAAAGTTTTGTTCTGTATATAUACAGAACAAAACUUUCCCUGGAAAGUUUUGUUCUGUAUAUU20.313.322


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418AGGAGGUCAGGAAGGAGAA83.3193450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
609436AGGAGGTCAGGAAGGAGAATTCTCCTTCCTGACCTCCT0.056100.009000.672400.750001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177AACAGCUGGAAACAGAGAA78.5051754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211195AACAGCTGGAAACAGAGAATTCTCTGTTTCCAGCTGTT0.556800.004100.474100.500000.994601.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782GGAAUACCUGAAGAUUGCU80.0183635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574800GGAATACCTGAAGATTGCTAGCAATCTTCAGGTATTCC0.077100.009200.517200.750001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GGGAUGCUCAAAGAUAAUG69.73941468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411774GGGATGCTCAAAGATAATGCATTATCTTTGAGCATCCC0.219100.019100.836200.750001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771CUGAGGCAGAGAAGAACGA77.5545831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281789CTGAGGCAGAGAAGAACGATCGTTCTTCTCTGCCTCAG0.261900.046200.491400.500001.000001.00000


Target Position: 2032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032GCCACGCUUGUGUCUUUAG71.14761362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5312050GCCACGCTTGTGTCTTTAGCTAAAGACACAAGCGTGGC0.139900.008200.827600.750000.902200.75000


Target Position: 2885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885ACUUUUAAUUUUGUCAGAU76.2844918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422903ACTTTTAATTTTGTCAGATATCTGACAAAATTAAAAGT0.370400.185200.525900.750001.000001.00000


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703AGUUUUGUUCUGUAUAUUU84.609376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232721AGTTTTGTTCTGTATATTTAAATATACAGAACAAAACT0.083800.015900.706900.750001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CAACUAUUUCGAGAUAAAA94.438547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310842CAACTATTTCGAGATAAAATTTTATCTCGAAATAGTTG0.262900.050300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
822-844ATCAACTATTTCGAGATAAAAAAUUUUAUCUCGAAAUAGUUGAUCAACUAUUUCGAGAUAAAAAAU6.94.622


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149AAAAAAAAAAAAAAAAAAA83.5835423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933167AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.996200.500000.500001.000001.00000


Target Position: 3040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3040CCCACUCAUUCCUUCUCGU75.27741008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713058CCCACTCATTCCTTCTCGTACGAGAAGGAATGAGTGGG0.449300.180300.715500.750001.000001.00000


Target Position: 2234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2234ACUGAUUGAAUUACGGAAA78.8946725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962252ACTGATTGAATTACGGAAATTTCCGTAATTCAATCAGT0.093900.098000.706900.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777CAGAGAAGAACGAGCGUGU80.0331633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981795CAGAGAAGAACGAGCGTGTACACGCTCGTTCTTCTCTG0.023600.022300.577600.500001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868CAUCAUCCACAACGAGAAC72.37421238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921886CATCATCCACAACGAGAACGTTCTCGTTGTGGATGATG0.530700.069500.508600.500000.951100.75000


Target Position: 1741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1741GGGAUGACCGCAAUGAGGA82.908462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171759GGGATGACCGCAATGAGGATCCTCATTGCGGTCATCCC0.420900.009000.620700.750000.978300.75000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765GCAUCACUGAGGCAGAGAA96.162533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671783GCATCACTGAGGCAGAGAATTCTCTGCCTCAGTGATGC0.316300.013600.681001.000000.913000.62500


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894AAGGCCGGGACAAGUACAA73.45841142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851912AAGGCCGGGACAAGTACAATTGTACTTGTCCCGGCCTT0.499300.006000.491400.500001.000001.00000


Target Position: 2871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2871AAUGGACUAUGCACACUUU87.4883226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202889AATGGACTATGCACACTTTAAAGTGTGCATAGTCCATT0.171800.022800.508600.500001.000001.00000


Target Position: 82, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
82GGCGCGGCAGGAGGACGAG60.48052268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
705100GGCGCGGCAGGAGGACGAGCTCGTCCTCCTGCCGCGCC0.219800.001700.689700.750001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150AAAAAAAAAAAAAAAAAAA83.5835424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783168AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.996500.500000.500001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208AACCGUGGAGAGAGAGAAA87.1814243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161226AACCGTGGAGAGAGAGAAATTTCTCTCTCTCCACGGTT0.803700.297600.646600.500001.000001.00000


Target Position: 81, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
81GGGCGCGGCAGGAGGACGA71.58091317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70499GGGCGCGGCAGGAGGACGATCGTCCTCCTGCCGCGCCC0.262700.001700.698300.750001.000001.00000


Target Position: 2897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2897GUCAGAUUCACACAUGCCA84.2197392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192915GTCAGATTCACACATGCCATGGCATGTGTGAATCTGAC0.298500.195000.474100.500001.000001.00000


Target Position: 2376, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376CAAAUUGAUUUUUUAAUUU83.3976445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842394CAAATTGATTTTTTAATTTAAATTAAAAAATCAATTTG0.062300.017100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2374-2396CTCAAATTGATTTTTTAATTTCTAAAUUAAAAAAUCAAUUUGAGCAAAUUGAUUUUUUAAUUUCUU-9.77.412


Target Position: 3057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057GUGCACUGCUUUCUCCUUC65.41371861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973075GTGCACTGCTTTCTCCTTCGAAGGAGAAAGCAGTGCAC0.285800.067400.620700.500001.000001.00000


Target Position: 1334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334GCAGCUGGAGGAGGAGAGG57.97572483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751352GCAGCTGGAGGAGGAGAGGCCTCTCCTCCTCCAGCTGC0.367400.052200.508600.500001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CCCCUCCAGUUCAAGUUCC56.26812583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
673456CCCCTCCAGTTCAAGTTCCGGAACTTGAACTGGAGGGG0.030300.003400.620700.500000.962000.87500


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769AUAAUGCUAUGUUGGAAUA84.4894379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721787ATAATGCTATGTTGGAATATATTCCAACATAGCATTAT0.287900.110800.500000.500001.000001.00000


Target Position: 2912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2912GCCACUAUGAGCUUUCAGA86.8176255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292930GCCACTATGAGCTTTCAGATCTGAAAGCTCATAGTGGC0.078300.004100.775900.750000.983700.62500


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202GAGAGAAACCGUGGAGAGA86.4453276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721220GAGAGAAACCGTGGAGAGATCTCTCCACGGTTTCTCTC0.548200.299700.586200.500001.000001.00000


Target Position: 2836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836UGUAAACAGGAUUAUUAUU78.2547773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422854TGTAAACAGGATTATTATTAATAATAATCCTGTTTACA0.119100.021000.698300.750001.000001.00000


Target Position: 3148, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148CAAAAAAAAAAAAAAAAAA86.7759258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2853166CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.999800.993800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3146-3168AGCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGCUCAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330CUCCGGGAAGUGUGGUACU70.53241416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726348CTCCGGGAAGTGTGGTACTAGTACCACACTTCCCGGAG0.028100.005400.603400.500001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GCCCUUGGACUGAAUAUUU81.8628520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588897GCCCTTGGACTGAATATTTAAATATTCAGTCCAAGGGC0.140600.005601.000001.000000.951100.62500


Target Position: 225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
225CCAAUCAAUGUCCGAGUUA82.6468477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503243CCAATCAATGTCCGAGTTATAACTCGGACATTGATTGG0.092500.069300.810301.000001.000001.00000


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832CACGUGUAAACAGGAUUAU76.5661903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102850CACGTGTAAACAGGATTATATAATCCTGTTTACACGTG0.143500.019200.750000.750001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962UUUCAAUGACAAAAAGUUU70.67471405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717980TTTCAATGACAAAAAGTTTAAACTTTTTGTCATTGAAA0.018900.003100.500000.500001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676CUCAAAGAGUGAUGGACCA84.4038383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
733694CTCAAAGAGTGATGGACCATGGTCCATCACTCTTTGAG0.045000.001700.465500.500001.000001.00000


Target Position: 2627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627CUUAUUAAUGAUCAGCUAU83.4198443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172645CTTATTAATGATCAGCTATATAGCTGATCATTAATAAG0.222200.134100.594800.750001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810GAAAUGUAUGGAAUCAACU84.7727366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741828GAAATGTATGGAATCAACTAGTTGATTCCATACATTTC0.073000.024100.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
808-830TGGAAATGTATGGAATCAACTATAGUUGAUUCCAUACAUUUCCAGAAAUGUAUGGAAUCAACUAUU14.86.922


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045UCAUUCCUUCUCGUGCACU60.98692231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373063TCATTCCTTCTCGTGCACTAGTGCACGAGAAGGAATGA0.328700.240200.517200.500001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UUCCAUCUGUGCCAUACUU68.88331543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942354TTCCATCTGTGCCATACTTAAGTATGGCACAGATGGAA0.059900.034700.534500.500001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216AGAGAGAGAAAGAGCAGAU85.9696294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211234AGAGAGAGAAAGAGCAGATATCTGCTCTTTCTCTCTCT0.245300.269000.543100.750001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625ACCUUAUUAAUGAUCAGCU74.75941043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632643ACCTTATTAATGATCAGCTAGCTGATCATTAATAAGGT0.195800.158400.500000.500001.000001.00000


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367AAAUGAGCUCAAAUUGAUU83.8981409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892385AAATGAGCTCAAATTGATTAATCAATTTGAGCTCATTT0.078200.010100.491400.500001.000001.00000


Target Position: 2734, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734CAGAAUAAAAGAAUUACAU87.1923242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582752CAGAATAAAAGAATTACATATGTAATTCTTTTATTCTG0.765200.122000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2732-2754TACAGAATAAAAGAATTACATATAUGUAAUUCUUUUAUUCUGUACAGAAUAAAAGAAUUACAUAUU6.96.922


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217GAGAGAGAAAGAGCAGAUG74.28991072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861235GAGAGAGAAAGAGCAGATGCATCTGCTCTTTCTCTCTC0.233200.257400.655200.500001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042UGUCUUUAGUGCUCCAAGU72.69711205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182060TGTCTTTAGTGCTCCAAGTACTTGGAGCACTAAAGACA0.067500.027400.500000.500001.000001.00000


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604UAGAAUACAUUGUACUUAU86.1304288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352622TAGAATACATTGTACTTATATAAGTACAATGTATTCTA0.140200.053600.629300.500000.983700.75000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361AUGUGGAUAAUAAAGGAUU74.37971067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560379ATGTGGATAATAAAGGATTAATCCTTTATTATCCACAT0.131300.006900.646600.500001.000001.00000


Target Position: 939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939UGGAGUGAAAUCAGGAACA76.882886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561957TGGAGTGAAATCAGGAACATGTTCCTGATTTCACTCCA0.085600.006800.637900.500001.000001.00000


Target Position: 2249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249GAAAAUGCCUGUAAAGUCU84.7795365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2247-2269CGGAAAATGCCTGTAAAGTCTGAAGACUUUACAGGCAUUUUCCGGAAAAUGCCUGUAAAGUCUGAU14.614.022


Target Position: 2033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033CCACGCUUGUGUCUUUAGU73.62991127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472051CCACGCTTGTGTCTTTAGTACTAAAGACACAAGCGTGG0.260800.007600.637900.750000.902200.62500


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GCCAAGUUUGGGGACUACA78.3677762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
737627GCCAAGTTTGGGGACTACATGTAGTCCCCAAACTTGGC0.062400.001100.793100.750000.945700.62500


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261UGCGGCUGCAGGACUAUGA70.86911382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6241279TGCGGCTGCAGGACTATGATCATAGTCCTGCAGCCGCA0.354600.004200.629300.500000.945700.62500


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432AGGGGUGAAAAUUAUUUUG65.80131820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312450AGGGGTGAAAATTATTTTGCAAAATAATTTTCACCCCT0.263500.008800.698300.500001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CGAGAUAAAAAACAAGAAA92.450978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255851CGAGATAAAAAACAAGAAATTTCTTGTTTTTTATCTCG0.241700.072200.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
831-853TTCGAGATAAAAAACAAGAAAGGUUUCUUGUUUUUUAUCUCGAACGAGAUAAAAAACAAGAAAGGU19.216.022


Target Position: 2236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236UGAUUGAAUUACGGAAAAU77.2824855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572254TGATTGAATTACGGAAAATATTTTCCGTAATTCAATCA0.072200.069500.715500.750001.000001.00000


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834AGGCCCGAGAUGAGAAUAA80.6902589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281852AGGCCCGAGATGAGAATAATTATTCTCATCTCGGGCCT0.288500.034300.810300.750001.000001.00000


Target Position: 2674, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674GAUUUGUAACAUUAGUUUU88.4396189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092692GATTTGTAACATTAGTTTTAAAACTAATGTTACAAATC0.296100.039600.681000.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694CAGATTTGTAACATTAGTTTTAAAAAACUAAUGUUACAAAUCUGGAUUUGUAACAUUAGUUUUAAU4.96.921


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270AGGACUAUGAGGAGAAGAC71.52571323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691288AGGACTATGAGGAGAAGACGTCTTCTCCTCATAGTCCT0.627600.312400.525900.500001.000001.00000


Target Position: 2598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598CAGUUUUAGAAUACAUUGU78.32765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422616CAGTTTTAGAATACATTGTACAATGTATTCTAAAACTG0.121700.048200.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2596-2618AACAGTTTTAGAATACATTGTACACAAUGUAUUCUAAAACUGUUCAGUUUUAGAAUACAUUGUACU13.54.932


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545CCUUAGCGAUGAGAUCUAC74.76031042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305563CCTTAGCGATGAGATCTACGTAGATCTCATCGCTAAGG0.253400.038600.663800.750001.000001.00000


Target Position: 1832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832CCAGGCCCGAGAUGAGAAU71.32651348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191850CCAGGCCCGAGATGAGAATATTCTCATCTCGGGCCTGG0.280300.035600.836201.000001.000001.00000


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262GCGGCUGCAGGACUAUGAG71.32411349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221280GCGGCTGCAGGACTATGAGCTCATAGTCCTGCAGCCGC0.344200.004300.612100.750001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211CGUGGAGAGAGAGAAAGAG75.31811004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401229CGTGGAGAGAGAGAAAGAGCTCTTTCTCTCTCTCCACG0.378900.133500.465500.750001.000001.00000


Target Position: 3119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119UGAAAUAAAAGCUUUGCAA81.6949530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183137TGAAATAAAAGCTTTGCAATTGCAAAGCTTTTATTTCA0.018800.014900.577600.750001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072CUCAGAUCCCAGUUCCUUU82.3545490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4002090CTCAGATCCCAGTTCCTTTAAAGGAACTGGGATCTGAG0.139100.074000.810300.750001.000001.00000


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481AGAAUACACUGCCAAGAUU85.4431331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501499AGAATACACTGCCAAGATTAATCTTGGCAGTGTATTCT0.073800.025100.715500.750001.000001.00000


Target Position: 3099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3099UGGAUUCCAUGCCGCAGAC59.01012398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7353117TGGATTCCATGCCGCAGACGTCTGCGGCATGGAATCCA0.014100.002400.525900.500000.983700.62500


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GGAAACAGAGAAGAAAAGG64.46081934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481202GGAAACAGAGAAGAAAAGGCCTTTTCTTCTCTGTTTCC0.708000.375200.525900.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884UGGACUGAAUAUUUAUGAG74.24371077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654902TGGACTGAATATTTATGAGCTCATAAATATTCAGTCCA0.181400.030200.534500.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075AGAUCCCAGUUCCUUUAGA80.9148572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132093AGATCCCAGTTCCTTTAGATCTAAAGGAACTGGGATCT0.183600.099300.500000.500001.000001.00000


Target Position: 956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956CAUCUCUUUCAAUGACAAA92.199186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
954-976AACATCTCTTTCAATGACAAAAAUUUGUCAUUGAAAGAGAUGUUCAUCUCUUUCAAUGACAAAAAU20.519.112


Target Position: 3143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143CGAAGCAAAAAAAAAAAAA84.6611373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563161CGAAGCAAAAAAAAAAAAATTTTTTTTTTTTTGCTTCG0.998700.007200.793101.000001.000001.00000


Target Position: 366, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366GAUAAUAAAGGAUUUCCUA97.490423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592384GATAATAAAGGATTTCCTATAGGAAATCCTTTATTATC0.152300.020000.508600.750000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
364-386TGGATAATAAAGGATTTCCTACCUAGGAAAUCCUUUAUUAUCCAGAUAAUAAAGGAUUUCCUACCU18.7-8.032


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522GGCGCAAGGAGGAUGAAGU78.6865737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091540GGCGCAAGGAGGATGAAGTACTTCATCCTCCTTGCGCC0.216600.025100.793100.750001.000001.00000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841ACAGGAUUAUUAUUAGUGU81.415543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512859ACAGGATTATTATTAGTGTACACTAATAATAATCCTGT0.052000.003200.500000.500001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201GGAGAGAAACCGUGGAGAG79.1417708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841219GGAGAGAAACCGTGGAGAGCTCTCCACGGTTTCTCTCC0.545100.301800.560300.750001.000001.00000


Target Position: 3051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051CUUCUCGUGCACUGCUUUC62.38392128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7383069CTTCTCGTGCACTGCTTTCGAAAGCAGTGCACGAGAAG0.174900.093800.465500.500001.000001.00000


Target Position: 752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
752CCGUGGGAUGCUCAAAGAU79.7831649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694770CCGTGGGATGCTCAAAGATATCTTTGAGCATCCCACGG0.243400.001900.732801.000001.000001.00000


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944GAGACUCUGUUUGCUUGUG71.71741302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042962GAGACTCTGTTTGCTTGTGCACAAGCAAACAGAGTCTC0.171400.008100.517200.500001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424AUGCUUAGAGGGGUGAAAA77.6659822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362442ATGCTTAGAGGGGTGAAAATTTTCACCCCTCTAAGCAT0.015900.001200.655200.500001.000001.00000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205AGAAACCGAAAAUGCCGAA75.9779937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506223AGAAACCGAAAATGCCGAATTCGGCATTTTCGGTTTCT0.395400.257800.551700.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846AGAAUAAGAGGACCCACAA89.0377175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511864AGAATAAGAGGACCCACAATTGTGGGTCCTCTTATTCT0.185000.148700.577600.750000.945700.62500


Target Position: 2709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2709GUUCUGUAUAUUUUGUUAC69.88021457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242727GTTCTGTATATTTTGTTACGTAACAAAATATACAGAAC0.641000.015800.465500.500001.000001.00000


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268GCAGGACUAUGAGGAGAAG76.9518879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431286GCAGGACTATGAGGAGAAGCTTCTCCTCATAGTCCTGC0.816100.239100.715500.750001.000001.00000


Target Position: 2626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626CCUUAUUAAUGAUCAGCUA96.03736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932644CCTTATTAATGATCAGCTATAGCTGATCATTAATAAGG0.216300.142000.672401.000001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520GAGGCGCAAGGAGGAUGAA84.6192375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471538GAGGCGCAAGGAGGATGAATTCATCCTCCTTGCGCCTC0.369700.030400.637900.750001.000001.00000


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611CAAGUUUGGGGACUACAAC71.38511341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726629CAAGTTTGGGGACTACAACGTTGTAGTCCCCAAACTTG0.154900.001400.500000.500001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955ACAUCUCUUUCAAUGACAA92.090488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703973ACATCTCTTTCAATGACAATTGTCATTGAAAGAGATGT0.023000.008400.560300.750000.962000.62500


Target Position: 3116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3116ACAUGAAAUAAAAGCUUUG69.26831508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653134ACATGAAATAAAAGCTTTGCAAAGCTTTTATTTCATGT0.049100.004900.560300.500001.000001.00000


Target Position: 2936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2936GCUGUGAAGAGACUCUGUU82.2558497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482954GCTGTGAAGAGACTCTGTTAACAGAGTCTCTTCACAGC0.041900.003400.706901.000001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139GGCACGAAGCAAAAAAAAA90.9824115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6383157GGCACGAAGCAAAAAAAAATTTTTTTTTGCTTCGTGCC0.994500.003801.000001.000000.967400.75000


Target Position: 2554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554AGGACACUUGGAUUUUUUU78.6022745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4262572AGGACACTTGGATTTTTTTAAAAAAATCCAAGTGTCCT0.226500.017000.844800.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373GCUCAAAUUGAUUUUUUAA94.677842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482391GCTCAAATTGATTTTTTAATTAAAAAATCAATTTGAGC0.074700.024300.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2371-2393GAGCTCAAATTGATTTTTTAATTUUAAAAAAUCAAUUUGAGCUCGCUCAAAUUGAUUUUUUAAUUU-9.112.022


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281GAGAAGACAAAGAAGGCAG75.13161016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5991299GAGAAGACAAAGAAGGCAGCTGCCTTCTTTGTCTTCTC0.220200.169900.525900.500001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898AUGAGAAAGAUGAUAAGUU80.3122618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578916ATGAGAAAGATGATAAGTTAACTTATCATCTTTCTCAT0.102000.026100.508600.500001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745UGACCGCAAUGAGGAGAAG62.77592099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211763TGACCGCAATGAGGAGAAGCTTCTCCTCATTGCGGTCA0.049400.005000.586200.500001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675AUUUGUAACAUUAGUUUUA82.0607508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172693ATTTGTAACATTAGTTTTATAAAACTAATGTTACAAAT0.301500.046000.474100.500000.994600.87500


Target Position: 3112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3112GCAGACAUGAAAUAAAAGC63.69542000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263130GCAGACATGAAATAAAAGCGCTTTTATTTCATGTCTGC0.165600.016500.500000.500001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018UGUUUUAUGCCCCACGUCU67.78651649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101036TGTTTTATGCCCCACGTCTAGACGTGGGGCATAAAACA0.056700.005000.482800.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730UUUACAGAAUAAAAGAAUU74.03051096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052748TTTACAGAATAAAAGAATTAATTCTTTTATTCTGTAAA0.252900.062300.491400.500001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764UCUAAACCAUGGCACUUGA76.5721902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002782TCTAAACCATGGCACTTGATCAAGTGCCATGGTTTAGA0.023200.015100.500000.500001.000001.00000


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298UACAAGAGUCAGCAUCAUU79.213700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052316TACAAGAGTCAGCATCATTAATGATGCTGACTCTTGTA0.174900.054900.672400.500001.000001.00000


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591UGCUUAACAGUUUUAGAAU77.6965820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1662609TGCTTAACAGTTTTAGAATATTCTAAAACTGTTAAGCA0.336800.127600.844800.750001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87GGCAGGAGGACGAGGCAGG60.28762285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730105GGCAGGAGGACGAGGCAGGCCTGCCTCGTCCTCCTGCC0.049400.001300.655200.500001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435GGUGAAAAUUAUUUUGGAA99.59149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2512453GGTGAAAATTATTTTGGAATTCCAAAATAATTTTCACC0.244700.157300.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2433-2455GGGGTGAAAATTATTTTGGAAATUUCCAAAAUAAUUUUCACCCCGGUGAAAAUUAUUUUGGAAAUU20.114.922


Target Position: 2429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2429UAGAGGGGUGAAAAUUAUU73.95971102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992447TAGAGGGGTGAAAATTATTAATAATTTTCACCCCTCTA0.400000.001700.663800.500001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233GACUGAUUGAAUUACGGAA96.117835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682251GACTGATTGAATTACGGAATTCCGTAATTCAATCAGTC0.109200.108700.646600.750001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GGAGGCGCAAGGAGGAUGA78.3816761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001537GGAGGCGCAAGGAGGATGATCATCCTCCTTGCGCCTCC0.337300.021600.646600.750001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GCUGCAGGACUAUGAGGAG77.4627838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201283GCTGCAGGACTATGAGGAGCTCCTCATAGTCCTGCAGC0.595300.026000.543100.750001.000001.00000


Target Position: 1862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862CAAUGACAUCAUCCACAAC82.2183501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281880CAATGACATCATCCACAACGTTGTGGATGATGTCATTG0.204000.046400.500000.500000.962000.62500


Target Position: 2907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2907CACAUGCCACUAUGAGCUU79.4052681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702925CACATGCCACTATGAGCTTAAGCTCATAGTGGCATGTG0.030800.018900.655200.750000.913000.75000


Target Position: 2707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2707UUGUUCUGUAUAUUUUGUU64.35561941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6332725TTGTTCTGTATATTTTGTTAACAAAATATACAGAACAA0.580600.014100.500000.500001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854AGGACCCACAAUGACAUCA74.55611053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481872AGGACCCACAATGACATCATGATGTCATTGTGGGTCCT0.117900.017000.620700.500001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521AGGCGCAAGGAGGAUGAAG59.94212311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291539AGGCGCAAGGAGGATGAAGCTTCATCCTCCTTGCGCCT0.214600.017700.706900.500001.000001.00000


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334ACUUCCAUCUGUGCCAUAC63.2372047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122352ACTTCCATCTGTGCCATACGTATGGCACAGATGGAAGT0.049400.031100.525900.500001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GCGGAGCUUGCAGAAUACA81.1517558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591488GCGGAGCTTGCAGAATACATGTATTCTGCAAGCTCCGC0.056200.003000.715500.750001.000001.00000


Target Position: 3056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056CGUGCACUGCUUUCUCCUU82.874466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3463074CGTGCACTGCTTTCTCCTTAAGGAGAAAGCAGTGCACG0.317700.065900.637901.000001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219CCGAAACCAAUCAAUGUCC61.29372208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575237CCGAAACCAATCAATGTCCGGACATTGATTGGTTTCGG0.126100.124300.543100.500000.994600.62500


Target Position: 2700, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700GAAAGUUUUGUUCUGUAUA93.031769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392718GAAAGTTTTGTTCTGTATATATACAGAACAAAACTTTC0.077700.016000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2698-2720GGGAAAGTTTTGTTCTGTATATTUAUACAGAACAAAACUUUCCCGAAAGUUUUGUUCUGUAUAUUU20.33.222


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180GCCUGAUUCUCGCGAUUAU87.624219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7292198GCCTGATTCTCGCGATTATATAATCGCGAGAATCAGGC0.061600.001400.956901.000001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CCCCCGCCCCCACCACCCC35.81723135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301641CCCCCGCCCCCACCACCCCGGGGTGGTGGGGGCGGGGG0.125200.015200.500000.500001.000001.00000


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431CAGGCGGUGGAUCAGAUAA88.7192183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621449CAGGCGGTGGATCAGATAATTATCTGATCCACCGCCTG0.496500.096000.750000.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GGAGAGACAGGCGGUGGAU79.9468639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411442GGAGAGACAGGCGGTGGATATCCACCGCCTGTCTCTCC0.102500.003600.689701.000001.000001.00000


Target Position: 2259, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2259GUAAAGUCUGAGUAAGAAA95.486137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692277GTAAAGTCTGAGTAAGAAATTTCTTACTCAGACTTTAC0.165600.028600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2257-2279CTGTAAAGTCTGAGTAAGAAACTUUUCUUACUCAGACUUUACAGGUAAAGUCUGAGUAAGAAACUU14.614.632


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GGAGAGCUUGCAGGAUGAG71.41511340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821691GGAGAGCTTGCAGGATGAGCTCATCCTGCAAGCTCTCC0.076300.005900.560300.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080CCAGUUCCUUUAGAAAGCA81.4411541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732098CCAGTTCCTTTAGAAAGCATGCTTTCTAAAGGAACTGG0.380800.134500.491400.750001.000001.00000


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943AGAGACUCUGUUUGCUUGU68.65781574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522961AGAGACTCTGTTTGCTTGTACAAGCAAACAGAGTCTCT0.174600.003200.517200.500001.000001.00000


Target Position: 2430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2430AGAGGGGUGAAAAUUAUUU77.0072875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672448AGAGGGGTGAAAATTATTTAAATAATTTTCACCCCTCT0.378100.002700.724100.750001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526CAAGGAGGAUGAAGUUGAA99.74037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221544CAAGGAGGATGAAGTTGAATTCAACTTCATCCTCCTTG0.498800.177100.474100.750001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578UUUUUUUUUUUUUUGCUUA69.52461483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312596TTTTTTTTTTTTTTGCTTATAAGCAAAAAAAAAAAAAA0.491500.122500.465500.500001.000001.00000


Target Position: 1530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530GAGGAUGAAGUUGAAGAGU75.24811011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881548GAGGATGAAGTTGAAGAGTACTCTTCAACTTCATCCTC0.147000.051800.603400.500001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729UUUUACAGAAUAAAAGAAU67.00591714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772747TTTTACAGAATAAAAGAATATTCTTTTATTCTGTAAAA0.181200.048800.491400.500001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901AGAAAGAUGAUAAGUUAAC68.82481553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518919AGAAAGATGATAAGTTAACGTTAACTTATCATCTTTCT0.113700.028600.577600.500001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539AGGAAUCCUUAGCGAUGAG70.18041440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580557AGGAATCCTTAGCGATGAGCTCATCGCTAAGGATTCCT0.067900.005900.534500.500000.967400.87500


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GCACGAAGCAAAAAAAAAA92.934471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813158GCACGAAGCAAAAAAAAAATTTTTTTTTTGCTTCGTGC0.994800.005900.853401.000001.000001.00000


Target Position: 2404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404AUCCAUCUUUGUAUAUUUA87.6143220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712422ATCCATCTTTGTATATTTATAAATATACAAAGATGGAT0.030700.007700.646600.500001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690GACCAGCACAAACUUACCA85.1747345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
723708GACCAGCACAAACTTACCATGGTAAGTTTGTGCTGGTC0.114900.001600.474100.500000.956500.62500


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586UUUUUUGCUUAACAGUUUU64.24541951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512604TTTTTTGCTTAACAGTTTTAAAACTGTTAAGCAAAAAA0.252300.207900.500000.500001.000001.00000


Target Position: 3059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3059GCACUGCUUUCUCCUUCAC70.72971400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4963077GCACTGCTTTCTCCTTCACGTGAAGGAGAAAGCAGTGC0.247200.055300.560300.750001.000001.00000


Target Position: 2649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649CUAUUUAUAUACAAGUGAU94.589844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242667CTATTTATATACAAGTGATATCACTTGTATATAAATAG0.017600.004300.491400.750001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405UCCAUCUUUGUAUAUUUAC56.61042559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892423TCCATCTTTGTATATTTACGTAAATATACAAAGATGGA0.025600.004400.689700.500001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889UGAAUAUUUAUGAGAAAGA80.4083611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
611907TGAATATTTATGAGAAAGATCTTTCTCATAAATATTCA0.192400.107600.500000.500001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GAUGGACCAGCACAAACUU85.6001323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513704GATGGACCAGCACAAACTTAAGTTTGTGCTGGTCCATC0.229200.010100.543100.750000.972800.62500


Target Position: 2845, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845GAUUAUUAUUAGUGUUUUA103.2724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7012863GATTATTATTAGTGTTTTATAAAACACTAATAATAATC0.023100.009400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2843-2865AGGATTATTATTAGTGTTTTATGUAAAACACUAAUAAUAAUCCUGAUUAUUAUUAGUGUUUUAUGU13.3-8.021


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070CCCUCAGAUCCCAGUUCCU75.8553956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4302088CCCTCAGATCCCAGTTCCTAGGAACTGGGATCTGAGGG0.124100.056300.646600.750001.000001.00000


Target Position: 2043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2043GUCUUUAGUGCUCCAAGUC67.87321643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442061GTCTTTAGTGCTCCAAGTCGACTTGGAGCACTAAAGAC0.042600.016900.500000.500001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853GAGGACCCACAAUGACAUC71.3531344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041871GAGGACCCACAATGACATCGATGTCATTGTGGGTCCTC0.127300.011300.629300.500001.000001.00000


Target Position: 2728, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728CUUUUACAGAAUAAAAGAA89.8825150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2726-2748ACCTTTTACAGAATAAAAGAATTUUCUUUUAUUCUGUAAAAGGUCUUUUACAGAAUAAAAGAAUUU7.17.222


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227GAGCAGAUGAUGCGCGAGA82.8827464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861245GAGCAGATGATGCGCGAGATCTCGCGCATCATCTGCTC0.026100.003300.586200.500000.918500.75000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725UACCUUUUACAGAAUAAAA85.426333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452743TACCTTTTACAGAATAAAATTTTATTCTGTAAAAGGTA0.099800.003400.681000.500001.000001.00000


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110CCGCAGACAUGAAAUAAAA94.324748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5203128CCGCAGACATGAAATAAAATTTTATTTCATGTCTGCGG0.719000.008900.913801.000001.000001.00000


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183UGAUUCUCGCGAUUAUUCU70.7361398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342201TGATTCTCGCGATTATTCTAGAATAATCGCGAGAATCA0.088300.008000.500000.500001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199CUCACCAGAAACCGAAAAU71.44811336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350217CTCACCAGAAACCGAAAATATTTTCGGTTTCTGGTGAG0.306700.112500.801700.750000.983700.62500


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673AGAUUUGUAACAUUAGUUU80.9074573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3182691AGATTTGTAACATTAGTTTAAACTAATGTTACAAATCT0.295700.035700.724100.750000.994600.62500


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917AACCCCAAAGAUUGGCUUU65.23531873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707935AACCCCAAAGATTGGCTTTAAAGCCAATCTTTGGGGTT0.022300.003100.646600.500000.902201.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834GAGAUAAAAAACAAGAAAG79.6085660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441852GAGATAAAAAACAAGAAAGCTTTCTTGTTTTTTATCTC0.214500.205700.672400.500001.000001.00000


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555GGACACUUGGAUUUUUUUU79.5943662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3672573GGACACTTGGATTTTTTTTAAAAAAAATCCAAGTGTCC0.240000.026300.870701.000001.000001.00000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724UUACCUUUUACAGAAUAAA74.37191068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602742TTACCTTTTACAGAATAAATTTATTCTGTAAAAGGTAA0.084400.003000.534500.500001.000001.00000


Target Position: 2712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2712CUGUAUAUUUUGUUACCUU88.4836187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182730CTGTATATTTTGTTACCTTAAGGTAACAAAATATACAG0.539800.004400.646600.750001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627CGCCCCCACCACCCCCCGU51.89422821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461645CGCCCCCACCACCCCCCGTACGGGGGGTGGTGGGGGCG0.075700.035400.646600.750001.000001.00000


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309GCAUCAUUAAAGGAAACGU76.6878896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442327GCATCATTAAAGGAAACGTACGTTTCCTTTAATGATGC0.132000.040000.577600.750000.983700.62500


Target Position: 2438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GAAAAUUAUUUUGGAAAUU78.6637740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372456GAAAATTATTTTGGAAATTAATTTCCAAAATAATTTTC0.326700.184000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2436-2458GTGAAAATTATTTTGGAAATTGAAAUUUCCAAAAUAAUUUUCACGAAAAUUAUUUUGGAAAUUGAU20.1-9.720


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GCUAUGUUGGAAUACCUGA85.9412296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
690792GCTATGTTGGAATACCTGATCAGGTATTCCAACATAGC0.028600.002100.629300.750000.956500.87500


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GACAUCAUCCACAACGAGA87.8115210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261884GACATCATCCACAACGAGATCTCGTTGTGGATGATGTC0.543900.066200.594800.500000.951100.75000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826ACUAUUUCGAGAUAAAAAA82.8012468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215844ACTATTTCGAGATAAAAAATTTTTTATCTCGAAATAGT0.890500.067100.706900.750001.000001.00000


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215AAUGCCGAAACCAAUCAAU71.70051305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642233AATGCCGAAACCAATCAATATTGATTGGTTTCGGCATT0.502400.303000.500000.500000.989100.62500


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204CAGAAACCGAAAAUGCCGA77.0756869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687222CAGAAACCGAAAATGCCGATCGGCATTTTCGGTTTCTG0.374400.248900.491400.500001.000001.00000


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935AGCUGUGAAGAGACUCUGU79.4752674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522953AGCTGTGAAGAGACTCTGTACAGAGTCTCTTCACAGCT0.037600.003400.646600.500001.000001.00000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045CUUUAGUGCUCCAAGUCUA93.304265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452063CTTTAGTGCTCCAAGTCTATAGACTTGGAGCACTAAAG0.011800.004400.465500.750001.000001.00000


Target Position: 2697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697AGGGAAAGUUUUGUUCUGU72.5871217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682715AGGGAAAGTTTTGTTCTGTACAGAACAAAACTTTCCCT0.031100.015200.637900.500001.000001.00000


Target Position: 2702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702AAGUUUUGUUCUGUAUAUU79.3534689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602720AAGTTTTGTTCTGTATATTAATATACAGAACAAAACTT0.085500.017200.629300.500001.000001.00000


Target Position: 3153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153AAAAAAAAAAAAAAAAAAA83.5835427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6883171AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.997500.500000.500001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CUGGAAAUGUAUGGAAUCA85.2214344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643825CTGGAAATGTATGGAATCATGATTCCATACATTTCCAG0.144000.036400.560300.500001.000001.00000


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956GCUUGUGUUUGUUUGUUUG76.373915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572974GCTTGTGTTTGTTTGTTTGCAAACAAACAAACACAAGC0.034800.006200.706900.750001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148GGAGAAGCAUCAGAAGCAG78.5615749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6251166GGAGAAGCATCAGAAGCAGCTGCTTCTGATGCTTCTCC0.049000.008300.586200.750000.962000.75000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CUCCCUCAGAUCCCAGUUC58.87352405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082086CTCCCTCAGATCCCAGTTCGAACTGGGATCTGAGGGAG0.125100.045100.637900.500001.000001.00000


Target Position: 211, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211CGAAAAUGCCGAAACCAAU85.0197353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82229CGAAAATGCCGAAACCAATATTGGTTTCGGCATTTTCG0.608500.205700.784501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
209-231ACCGAAAATGCCGAAACCAATCAAUUGGUUUCGGCAUUUUCGGUCGAAAAUGCCGAAACCAAUCAU18.87.422


Target Position: 224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
224ACCAAUCAAUGUCCGAGUU70.67471404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511242ACCAATCAATGTCCGAGTTAACTCGGACATTGATTGGT0.087100.071800.706900.750001.000001.00000


Target Position: 3033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033GGUUCCGCCCACUCAUUCC65.02811891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053051GGTTCCGCCCACTCATTCCGGAATGAGTGGGCGGAACC0.395200.046000.482800.500000.978300.75000


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189CAGAGAAGAAAAGGAGAGA84.1942396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781207CAGAGAAGAAAAGGAGAGATCTCTCCTTTTCTTCTCTG0.685400.618900.560300.500001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406GCGGGCUAAGGAGGAGCUG54.73052683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7331424GCGGGCTAAGGAGGAGCTGCAGCTCCTCCTTAGCCCGC0.018200.001300.637900.750000.972800.75000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGAGAAUCAACAAGCGGAU72.55161221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221054TGAGAATCAACAAGCGGATATCCGCTTGTTGATTCTCA0.102600.026200.543100.750001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145GGUUUGUUUUCCCCAGUUG71.8621288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3992163GGTTTGTTTTCCCCAGTTGCAACTGGGGAAAACAAACC0.197300.049800.706900.750001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415GGAGGAGCUGGAGAGACAG75.8588955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201433GGAGGAGCTGGAGAGACAGCTGTCTCTCCAGCTCCTCC0.119000.001500.586200.750000.989100.62500


Target Position: 3035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035UUCCGCCCACUCAUUCCUU58.06832474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5303053TTCCGCCCACTCATTCCTTAAGGAATGAGTGGGCGGAA0.696600.067800.534500.500001.000001.00000


Target Position: 2946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2946GACUCUGUUUGCUUGUGUU91.3191109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262964GACTCTGTTTGCTTGTGTTAACACAAGCAAACAGAGTC0.192800.108400.672400.750001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150GUUUUCCCCAGUUGUAAUA79.6199658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082168GTTTTCCCCAGTTGTAATATATTACAACTGGGGAAAAC0.261800.061900.603400.750001.000001.00000


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590UUGCUUAACAGUUUUAGAA77.1338865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152608TTGCTTAACAGTTTTAGAATTCTAAAACTGTTAAGCAA0.200400.127400.474100.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UGAUGGACCAGCACAAACU76.0307932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717703TGATGGACCAGCACAAACTAGTTTGTGCTGGTCCATCA0.117700.024700.517200.500000.994600.62500


Target Position: 1531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531AGGAUGAAGUUGAAGAGUG73.59381133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011549AGGATGAAGTTGAAGAGTGCACTCTTCAACTTCATCCT0.071900.065900.551700.500001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352CUUGUUCUGUAUUCGAAAU80.5803602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4732370CTTGTTCTGTATTCGAAATATTTCGAATACAGAACAAG0.328600.012500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2350-2372TACTTGTTCTGTATTCGAAATGAAUUUCGAAUACAGAACAAGUACUUGUUCUGUAUUCGAAAUGAU16.819.222


Target Position: 386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386CUGGCUGAAGCUGGAUAAG62.51582116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
737404CTGGCTGAAGCTGGATAAGCTTATCCAGCTTCAGCCAG0.013000.001600.646600.500001.000001.00000


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664UGAUAAUACAGAUUUGUAA92.062689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142682TGATAATACAGATTTGTAATTACAAATCTGTATTATCA0.053100.008400.689700.750000.956500.62500


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946AAAUCAGGAACAUCUCUUU82.2187500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649964AAATCAGGAACATCTCTTTAAAGAGATGTTCCTGATTT0.237400.029100.500000.500001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596AACAGUUUUAGAAUACAUU78.9996716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272614AACAGTTTTAGAATACATTAATGTATTCTAAAACTGTT0.113400.062900.637900.500001.000001.00000


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149UGUUUUCCCCAGUUGUAAU75.9927935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3872167TGTTTTCCCCAGTTGTAATATTACAACTGGGGAAAACA0.180400.093800.698300.750001.000001.00000


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951UGUUUGCUUGUGUUUGUUU72.41391233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2272969TGTTTGCTTGTGTTTGTTTAAACAAACACAAGCAAACA0.495900.086800.706900.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923CAGAUCCGGCAGGGCAACA72.78051195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981941CAGATCCGGCAGGGCAACATGTTGCCCTGCCGGATCTG0.024100.001700.577600.500000.967401.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UCAUUAAACCCAUCGACAA83.4627439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421000TCATTAAACCCATCGACAATTGTCGATGGGTTTAATGA0.188900.017400.577600.750001.000001.00000


Target Position: 2663, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663GUGAUAAUACAGAUUUGUA99.565310

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2661-2683AAGTGATAATACAGATTTGTAACUACAAAUCUGUAUUAUCACUUGUGAUAAUACAGAUUUGUAACU14.88.722


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948CUCUGUUUGCUUGUGUUUG62.99772084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942966CTCTGTTTGCTTGTGTTTGCAAACACAAGCAAACAGAG0.362000.044900.663800.500001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832UCGAGAUAAAAAACAAGAA80.8605575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387850TCGAGATAAAAAACAAGAATTCTTGTTTTTTATCTCGA0.270600.063100.620700.750001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598ACGCUGUGCAGGCCAAGUU68.66171572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744616ACGCTGTGCAGGCCAAGTTAACTTGGCCTGCACAGCGT0.011900.001700.629300.750001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GGAGCUUGCAGAAUACACU87.2998237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281490GGAGCTTGCAGAATACACTAGTGTATTCTGCAAGCTCC0.063300.001400.663800.750001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007ACCUGACUUUGUGUUUUAU78.7716731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581025ACCTGACTTTGTGTTTTATATAAAACACAAAGTCAGGT0.034700.006900.810300.750001.000001.00000


Target Position: 2662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662AGUGAUAAUACAGAUUUGU73.10221168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402680AGTGATAATACAGATTTGTACAAATCTGTATTATCACT0.083200.007000.500000.500001.000001.00000


Target Position: 1742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1742GGAUGACCGCAAUGAGGAG80.4112610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521760GGATGACCGCAATGAGGAGCTCCTCATTGCGGTCATCC0.434600.007500.560300.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GUUGGAAUACCUGAAGAUU81.5434538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
666797GTTGGAATACCTGAAGATTAATCTTCAGGTATTCCAAC0.032600.005800.637900.750000.956500.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
777-799ATGTTGGAATACCTGAAGATTGCAAUCUUCAGGUAUUCCAACAUGUUGGAAUACCUGAAGAUUGCU20.420.113


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CCGUGGAGAGAGAGAAAGA89.3215165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461228CCGTGGAGAGAGAGAAAGATCTTTCTCTCTCTCCACGG0.714700.390700.689700.750001.000001.00000


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CACGUCUGAGAAUCAACAA90.1375141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921048CACGTCTGAGAATCAACAATTGTTGATTCTCAGACGTG0.328300.048400.646600.750000.978300.62500


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190AGAGAAGAAAAGGAGAGAA87.513225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111208AGAGAAGAAAAGGAGAGAATTCTCTCCTTTTCTTCTCT0.682200.644400.551700.750001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685UUAGUUUUAAAAAGGGAAA68.01251636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352703TTAGTTTTAAAAAGGGAAATTTCCCTTTTTAAAACTAA0.477800.233900.534500.500001.000001.00000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248GGAAAAUGCCUGUAAAGUC80.3205617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6032266GGAAAATGCCTGTAAAGTCGACTTTACAGGCATTTTCC0.058000.015700.551700.750001.000001.00000


Target Position: 2550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2550GAGGAGGACACUUGGAUUU79.5677666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432568GAGGAGGACACTTGGATTTAAATCCAAGTGTCCTCCTC0.176900.003600.810300.750001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908UGAUAAGUUAACCCCAAAG66.04631797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736926TGATAAGTTAACCCCAAAGCTTTGGGGTTAACTTATCA0.109000.008800.586200.500000.962000.75000


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435CGGUGGAUCAGAUAAAGAG81.6752532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811453CGGTGGATCAGATAAAGAGCTCTTTATCTGATCCACCG0.062800.010300.603400.750001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218GCCGAAACCAAUCAAUGUC67.05961705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363236GCCGAAACCAATCAATGTCGACATTGATTGGTTTCGGC0.170700.137600.681000.750000.989100.62500


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620GCACCCCCGCCCCCACCAC50.79862864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981638GCACCCCCGCCCCCACCACGTGGTGGGGGCGGGGGTGC0.173500.005200.560300.750000.962000.62500


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881CCUUGGACUGAAUAUUUAU89.3756163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579899CCTTGGACTGAATATTTATATAAATATTCAGTCCAAGG0.222400.005900.801701.000001.000001.00000


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213UGGAGAGAGAGAAAGAGCA80.8245576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781231TGGAGAGAGAGAAAGAGCATGCTCTTTCTCTCTCTCCA0.318100.161400.491400.500001.000001.00000


Target Position: 3120, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120GAAAUAAAAGCUUUGCAAA93.681457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343138GAAATAAAAGCTTTGCAAATTTGCAAAGCTTTTATTTC0.014700.012300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3118-3140ATGAAATAAAAGCTTTGCAAAGGUUUGCAAAGCUUUUAUUUCAUGAAAUAAAAGCUUUGCAAAGGU20.0-9.722


Target Position: 886, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886GACUGAAUAUUUAUGAGAA105.8823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342904GACTGAATATTTATGAGAATTCTCATAAATATTCAGTC0.183700.031200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
884-906TGGACTGAATATTTATGAGAAAGUUCUCAUAAAUAUUCAGUCCAGACUGAAUAUUUAUGAGAAAGU21.419.222


Target Position: 1185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185GAAACAGAGAAGAAAAGGA88.9123179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1183-1205TGGAAACAGAGAAGAAAAGGAGAUCCUUUUCUUCUCUGUUUCCAGAAACAGAGAAGAAAAGGAGAU18.719.202


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178ACAGCUGGAAACAGAGAAG68.11051624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301196ACAGCTGGAAACAGAGAAGCTTCTCTGTTTCCAGCTGT0.557400.004400.569000.500000.994601.00000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434GGGUGAAAAUUAUUUUGGA94.489446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3772452GGGTGAAAATTATTTTGGATCCAAAATAATTTTCACCC0.270900.035800.620700.750001.000001.00000


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273ACUAUGAGGAGAAGACAAA85.7362313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741291ACTATGAGGAGAAGACAAATTTGTCTTCTCCTCATAGT0.652400.505900.706900.750001.000001.00000


Target Position: 2436, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436GUGAAAAUUAUUUUGGAAA85.74312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3672454GTGAAAATTATTTTGGAAATTTCCAAAATAATTTTCAC0.239500.206300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2434-2456GGGTGAAAATTATTTTGGAAATTUUUCCAAAAUAAUUUUCACCCGUGAAAAUUAUUUUGGAAAUUU20.17.422


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239CGCGAGAAGGAGGAGUUGA79.5723664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971257CGCGAGAAGGAGGAGTTGATCAACTCCTCCTTCTCGCG0.140400.046000.698300.750001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407CGGGCUAAGGAGGAGCUGG58.32732449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141425CGGGCTAAGGAGGAGCTGGCCAGCTCCTCCTTAGCCCG0.019400.002400.569000.500000.972800.75000


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350UACUUGUUCUGUAUUCGAA87.0649247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802368TACTTGTTCTGTATTCGAATTCGAATACAGAACAAGTA0.355200.031100.508600.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891GGCAAGGCCGGGACAAGUA84.6344374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871909GGCAAGGCCGGGACAAGTATACTTGTCCCGGCCTTGCC0.428400.005700.819001.000000.913000.62500


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192AGAAGAAAAGGAGAGAAAC69.33461501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401210AGAAGAAAAGGAGAGAAACGTTTCTCTCCTTTTCTTCT0.629900.590400.577600.500001.000001.00000


Target Position: 2616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616UACUUAUACACCUUAUUAA90.4115133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132634TACTTATACACCTTATTAATTAATAAGGTGTATAAGTA0.494400.198500.646600.500001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CGGUGAGCUACCAUGUCCA90.7907120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821672CGGTGAGCTACCATGTCCATGGACATGGTAGCTCACCG0.038000.002400.569000.750000.913000.62500


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815GUAUGGAAUCAACUAUUUC78.2124780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637833GTATGGAATCAACTATTTCGAAATAGTTGATTCCATAC0.045000.005700.508600.500001.000001.00000


Target Position: 2358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2358CUGUAUUCGAAAUGAGCUC64.54461926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202376CTGTATTCGAAATGAGCTCGAGCTCATTTCGAATACAG0.108500.050400.474100.500001.000001.00000


Target Position: 3111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111CGCAGACAUGAAAUAAAAG79.2093701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343129CGCAGACATGAAATAAAAGCTTTTATTTCATGTCTGCG0.176900.016300.784500.750001.000001.00000


Target Position: 2556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556GACACUUGGAUUUUUUUUU78.0084794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912574GACACTTGGATTTTTTTTTAAAAAAAAATCCAAGTGTC0.228200.044900.819000.750001.000001.00000


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332CUGCAGCUGGAGGAGGAGA72.37061240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641350CTGCAGCTGGAGGAGGAGATCTCCTCCTCCAGCTGCAG0.523600.009400.560300.500001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237UGCGCGAGAAGGAGGAGUU68.36861603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761255TGCGCGAGAAGGAGGAGTTAACTCCTCCTTCTCGCGCA0.158900.027800.706900.750001.000001.00000


Target Position: 2600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2600GUUUUAGAAUACAUUGUAC80.7291585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352618GTTTTAGAATACATTGTACGTACAATGTATTCTAAAAC0.118500.054000.465500.500001.000001.00000


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332CCGGGAAGUGUGGUACUUU79.5846663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
739350CCGGGAAGTGTGGTACTTTAAAGTACCACACTTCCCGG0.012600.005600.913801.000001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614GUUUGGGGACUACAACAAA90.9265118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601632GTTTGGGGACTACAACAAATTTGTTGTAGTCCCCAAAC0.287500.005100.646600.750001.000001.00000


Target Position: 2843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843AGGAUUAUUAUUAGUGUUU76.2084924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562861AGGATTATTATTAGTGTTTAAACACTAATAATAATCCT0.035000.005400.844800.750001.000001.00000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CCCCGCCCCCACCACCCCC35.54643138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6001642CCCCGCCCCCACCACCCCCGGGGGTGGTGGGGGCGGGG0.095600.031200.500000.500001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GAAUAUUUAUGAGAAAGAU93.491262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
680908GAATATTTATGAGAAAGATATCTTTCTCATAAATATTC0.187800.098900.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
888-910CTGAATATTTATGAGAAAGATGAAUCUUUCUCAUAAAUAUUCAGGAAUAUUUAUGAGAAAGAUGAU19.1-10.322


Target Position: 969, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969GACAAAAAGUUUGUCAUUA92.052390

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
967-989ATGACAAAAAGTTTGTCATTAAAUAAUGACAAACUUUUUGUCAUGACAAAAAGUUUGUCAUUAAAU20.55.622


Target Position: 2660, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660CAAGUGAUAAUACAGAUUU84.7334367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632678CAAGTGATAATACAGATTTAAATCTGTATTATCACTTG0.106700.006600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2658-2680TACAAGTGATAATACAGATTTGTAAAUCUGUAUUAUCACUUGUACAAGUGAUAAUACAGAUUUGUU19.219.223


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769ACCAUGGCACUUGAUGUGA69.30651505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892787ACCATGGCACTTGATGTGATCACATCAAGTGCCATGGT0.057400.002100.629300.500000.967400.62500


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688GUUUUAAAAAGGGAAAGUU75.8532957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412706GTTTTAAAAAGGGAAAGTTAACTTTCCCTTTTTAAAAC0.116500.092300.500000.750001.000001.00000


Target Position: 2727, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727CCUUUUACAGAAUAAAAGA87.3495236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2725-2747TACCTTTTACAGAATAAAAGAATUCUUUUAUUCUGUAAAAGGUACCUUUUACAGAAUAAAAGAAUU-4.34.931


Target Position: 2612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612AUUGUACUUAUACACCUUA82.7808469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142630ATTGTACTTATACACCTTATAAGGTGTATAAGTACAAT0.397500.119800.474100.500000.978300.75000


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173CGGCAACAGCUGGAAACAG71.46581333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311191CGGCAACAGCTGGAAACAGCTGTTTCCAGCTGTTGCCG0.049800.001300.629300.750000.951100.75000


Target Position: 1836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1836GCCCGAGAUGAGAAUAAGA90.0964142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371854GCCCGAGATGAGAATAAGATCTTATTCTCATCTCGGGC0.485500.033100.775900.750001.000001.00000


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901GAUUCACACAUGCCACUAU91.942195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3412919GATTCACACATGCCACTATATAGTGGCATGTGTGAATC0.247800.167300.637900.750001.000001.00000


Target Position: 3038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038CGCCCACUCAUUCCUUCUC63.77771993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3973056CGCCCACTCATTCCTTCTCGAGAAGGAATGAGTGGGCG0.716000.215800.612100.750001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277UGAGGAGAAGACAAAGAAG73.85511108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771295TGAGGAGAAGACAAAGAAGCTTCTTTGTCTTCTCCTCA0.562800.476400.586200.500001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677UUGUAACAUUAGUUUUAAA87.2937238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002695TTGTAACATTAGTTTTAAATTTAAAACTAATGTTACAA0.296800.065400.646600.500000.994601.00000


Target Position: 2908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2908ACAUGCCACUAUGAGCUUU73.92731104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832926ACATGCCACTATGAGCTTTAAAGCTCATAGTGGCATGT0.027800.016500.706900.750000.913000.87500


Target Position: 3036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3036UCCGCCCACUCAUUCCUUC51.8782822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453054TCCGCCCACTCATTCCTTCGAAGGAATGAGTGGGCGGA0.702700.084800.698300.500001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501GACAUCACCCAGAAACUUU84.1699399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498519GACATCACCCAGAAACTTTAAAGTTTCTGGGTGATGTC0.093700.059300.819000.750001.000001.00000


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559ACUUGGAUUUUUUUUUUUG66.01521801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202577ACTTGGATTTTTTTTTTTGCAAAAAAAAAAATCCAAGT0.119700.066700.560300.500001.000001.00000


Target Position: 2380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380UUGAUUUUUUAAUUUCUAU72.34941242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922398TTGATTTTTTAATTTCTATATAGAAATTAAAAAATCAA0.116700.018800.603400.500001.000001.00000


Target Position: 2247, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2247CGGAAAAUGCCUGUAAAGU73.78781114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6112265CGGAAAATGCCTGTAAAGTACTTTACAGGCATTTTCCG0.055600.012400.706900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2245-2267TACGGAAAATGCCTGTAAAGTCTACUUUACAGGCAUUUUCCGUACGGAAAAUGCCUGUAAAGUCUU11.814.222


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634AUGAUCAGCUAUAUACUAU84.8975358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5242652ATGATCAGCTATATACTATATAGTATATAGCTGATCAT0.214100.126800.612100.500000.989100.62500


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144GGGAGGAGAAGCAUCAGAA98.135820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041162GGGAGGAGAAGCATCAGAATTCTGATGCTTCTCCTCCC0.136900.056700.819001.000001.000001.00000


Target Position: 2672, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672CAGAUUUGUAACAUUAGUU86.163286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3502690CAGATTTGTAACATTAGTTAACTAATGTTACAAATCTG0.291400.034300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2670-2692TACAGATTTGTAACATTAGTTTTAACUAAUGUUACAAAUCUGUACAGAUUUGUAACAUUAGUUUUU11.612.022


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895AGGCCGGGACAAGUACAAG65.31861867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621913AGGCCGGGACAAGTACAAGCTTGTACTTGTCCCGGCCT0.346600.006600.706900.500001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695GCACAAACUUACCAGGGAC76.5214906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661713GCACAAACTTACCAGGGACGTCCCTGGTAAGTTTGTGC0.033800.024700.534500.750001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429GACAGGCGGUGGAUCAGAU89.7704153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281447GACAGGCGGTGGATCAGATATCTGATCCACCGCCTGTC0.486700.044900.637900.750001.000001.00000


Target Position: 2629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629UAUUAAUGAUCAGCUAUAU83.348448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702647TATTAATGATCAGCTATATATATAGCTGATCATTAATA0.232700.128800.500000.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615GUACUUAUACACCUUAUUA98.675616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2922633GTACTTATACACCTTATTATAATAAGGTGTATAAGTAC0.564800.215600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2613-2635TTGTACTTATACACCTTATTAATUAAUAAGGUGUAUAAGUACAAGUACUUAUACACCUUAUUAAUU10.96.323


Target Position: 3114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114AGACAUGAAAUAAAAGCUU77.54833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923132AGACATGAAATAAAAGCTTAAGCTTTTATTTCATGTCT0.095400.012100.586200.750001.000001.00000


Target Position: 2638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638UCAGCUAUAUACUAUUUAU89.7544154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982656TCAGCTATATACTATTTATATAAATAGTATATAGCTGA0.214100.126300.681000.750000.989100.62500


Target Position: 1532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1532GGAUGAAGUUGAAGAGUGG81.6347533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461550GGATGAAGTTGAAGAGTGGCCACTCTTCAACTTCATCC0.394100.049300.525900.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299ACAAGAGUCAGCAUCAUUA92.002894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142317ACAAGAGTCAGCATCATTATAATGATGCTGACTCTTGT0.201600.065400.672400.750001.000001.00000


Target Position: 1942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942CCAAGCAGCGCAUCGACGA76.4184911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111960CCAAGCAGCGCATCGACGATCGTCGATGCGCTGCTTGG0.180600.009200.551700.750000.972800.62500


Target Position: 1480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480CAGAAUACACUGCCAAGAU87.3513235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711498CAGAATACACTGCCAAGATATCTTGGCAGTGTATTCTG0.067200.021700.603400.750000.967400.62500


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GAGAAACCGUGGAGAGAGA90.449132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7031222GAGAAACCGTGGAGAGAGATCTCTCTCCACGGTTTCTC0.663300.294800.586200.500001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CCUGGAAAUGUAUGGAAUC71.4791330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
386824CCTGGAAATGTATGGAATCGATTCCATACATTTCCAGG0.147900.041400.663800.750001.000001.00000


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085UCCUUUAGAAAGCAGUUAC59.83582322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932103TCCTTTAGAAAGCAGTTACGTAACTGCTTTCTAAAGGA0.345600.079400.689700.500001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405UGCGGGCUAAGGAGGAGCU59.66552341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401423TGCGGGCTAAGGAGGAGCTAGCTCCTCCTTAGCCCGCA0.015600.001100.500000.500000.972800.62500


Target Position: 2343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2343UGUGCCAUACUUGUUCUGU64.05431976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142361TGTGCCATACTTGTTCTGTACAGAACAAGTATGGCACA0.059300.001900.500000.500001.000001.00000


Target Position: 2084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084UUCCUUUAGAAAGCAGUUA65.07041887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542102TTCCTTTAGAAAGCAGTTATAACTGCTTTCTAAAGGAA0.598000.182800.637900.500001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776GCAGAGAAGAACGAGCGUG69.04561522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6551794GCAGAGAAGAACGAGCGTGCACGCTCGTTCTTCTCTGC0.036000.033300.560300.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GAAUCAACUAUUUCGAGAU91.3044110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688838GAATCAACTATTTCGAGATATCTCGAAATAGTTGATTC0.082400.026000.491400.750001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773UGCUAUGUUGGAAUACCUG65.94381807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688791TGCTATGTTGGAATACCTGCAGGTATTCCAACATAGCA0.027700.002100.569000.500000.956500.75000


Target Position: 541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541GAAUCCUUAGCGAUGAGAU87.8109211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695559GAATCCTTAGCGATGAGATATCTCATCGCTAAGGATTC0.137200.024900.491400.750000.967400.75000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762CCUCUAAACCAUGGCACUU75.9564939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792780CCTCTAAACCATGGCACTTAAGTGCCATGGTTTAGAGG0.028300.025900.706901.000001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852AGAGGACCCACAAUGACAU81.7279529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701870AGAGGACCCACAATGACATATGTCATTGTGGGTCCTCT0.145500.014800.569000.750001.000001.00000


Target Position: 2834, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834CGUGUAAACAGGAUUAUUA98.765815

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10283419CGTGTAAACAGGATTATTA1/1/0/094.96EZRNM_001111077.1+NM_003379.41+1NANANA6:159187070..159187088(-)00EZR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532852CGTGTAAACAGGATTATTATAATAATCCTGTTTACACG0.073000.013900.741401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2832-2854CACGTGTAAACAGGATTATTATTUAAUAAUCCUGUUUACACGUGCGUGUAAACAGGAUUAUUAUUU1.814.732


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528AGGAGGAUGAAGUUGAAGA83.615422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511546AGGAGGATGAAGTTGAAGATCTTCAACTTCATCCTCCT0.501500.205400.620700.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503CAUCACCCAGAAACUUUUC65.02891890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706521CATCACCCAGAAACTTTTCGAAAAGTTTCTGGGTGATG0.065700.019900.482800.500001.000001.00000


Target Position: 2945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945AGACUCUGUUUGCUUGUGU73.5331137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622963AGACTCTGTTTGCTTGTGTACACAAGCAAACAGAGTCT0.180400.015700.517200.500001.000001.00000


Target Position: 328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328GCCUCCGGGAAGUGUGGUA78.7879729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
648346GCCTCCGGGAAGTGTGGTATACCACACTTCCCGGAGGC0.040200.005500.819001.000000.956500.62500


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872AUGGACUAUGCACACUUUU67.62741667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6532890ATGGACTATGCACACTTTTAAAAGTGTGCATAGTCCAT0.232400.024400.655200.500001.000001.00000


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083GUUCCUUUAGAAAGCAGUU78.2293775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432101GTTCCTTTAGAAAGCAGTTAACTGCTTTCTAAAGGAAC0.576400.160500.500000.750001.000001.00000


Target Position: 2450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450GGAAAUUGAGUCUGAAGCA92.993270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282468GGAAATTGAGTCTGAAGCATGCTTCAGACTCAATTTCC0.048000.004100.517200.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952GGAACAUCUCUUUCAAUGA94.235949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710970GGAACATCTCTTTCAATGATCATTGAAAGAGATGTTCC0.021200.011600.646600.750000.962000.62500


Target Position: 2374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374CUCAAAUUGAUUUUUUAAU75.4321997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5552392CTCAAATTGATTTTTTAATATTAAAAAATCAATTTGAG0.072500.020300.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394AGCTCAAATTGATTTTTTAATTTAUUAAAAAAUCAAUUUGAGCUCUCAAAUUGAUUUUUUAAUUUU-9.17.422


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241CGAGAAGGAGGAGUUGAUG72.94981181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281259CGAGAAGGAGGAGTTGATGCATCAACTCCTCCTTCTCG0.082200.044900.637900.750001.000001.00000


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029CCCGCCACGCUUGUGUCUU62.69692107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5662047CCCGCCACGCTTGTGTCTTAAGACACAAGCGTGGCGGG0.166000.006400.853401.000000.902201.00000


Target Position: 2837, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2837GUAAACAGGAUUAUUAUUA87.8993207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342855GTAAACAGGATTATTATTATAATAATAATCCTGTTTAC0.084000.008100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2835-2857GTGTAAACAGGATTATTATTAGTUAAUAAUAAUCCUGUUUACACGUAAACAGGAUUAUUAUUAGUU-8.011.832


Target Position: 2658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658UACAAGUGAUAAUACAGAU84.0011407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792676TACAAGTGATAATACAGATATCTGTATTATCACTTGTA0.122600.007500.500000.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430ACAGGCGGUGGAUCAGAUA80.9571567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511448ACAGGCGGTGGATCAGATATATCTGATCCACCGCCTGT0.498400.056200.663800.750001.000001.00000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263CGGCUGCAGGACUAUGAGG66.04741796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6251281CGGCTGCAGGACTATGAGGCCTCATAGTCCTGCAGCCG0.397100.004200.569000.500001.000001.00000


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218AGAGAGAAAGAGCAGAUGA87.4752227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171236AGAGAGAAAGAGCAGATGATCATCTGCTCTTTCTCTCT0.221800.245100.500000.500001.000001.00000


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653UUAUAUACAAGUGAUAAUA81.1665557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052671TTATATACAAGTGATAATATATTATCACTTGTATATAA0.022700.002400.491400.500001.000001.00000


Target Position: 2565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565AUUUUUUUUUUUGUUUUUU60.87452239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242583ATTTTTTTTTTTGTTTTTTAAAAAACAAAAAAAAAAAT0.124400.075200.508600.500001.000001.00000


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274CUAUGAGGAGAAGACAAAG75.7911964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811292CTATGAGGAGAAGACAAAGCTTTGTCTTCTCCTCATAG0.577200.469500.534500.500001.000001.00000


Target Position: 2339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339CAUCUGUGCCAUACUUGUU85.7656308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332357CATCTGTGCCATACTTGTTAACAAGTATGGCACAGATG0.014900.001600.508600.750001.000001.00000


Target Position: 2381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381UGAUUUUUUAAUUUCUAUG65.38811864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222399TGATTTTTTAATTTCTATGCATAGAAATTAAAAAATCA0.089400.027000.569000.500001.000001.00000


Target Position: 2678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2678UGUAACAUUAGUUUUAAAA80.1691624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1862696TGTAACATTAGTTTTAAAATTTTAAAACTAATGTTACA0.314000.090400.706900.750000.994600.87500


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436GGUGGAUCAGAUAAAGAGC73.36731149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081454GGTGGATCAGATAAAGAGCGCTCTTTATCTGATCCACC0.021400.008000.500000.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003AGGCACCUGACUUUGUGUU69.30551506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391021AGGCACCTGACTTTGTGTTAACACAAAGTCAGGTGCCT0.016600.001100.698300.750000.929300.62500


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761CCCUCUAAACCAUGGCACU75.40631000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592779CCCTCTAAACCATGGCACTAGTGCCATGGTTTAGAGGG0.034500.032700.784500.750001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159CGCUGCUGCUGGAUAGUCG72.90561183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744177CGCTGCTGCTGGATAGTCGCGACTATCCAGCAGCAGCG0.060900.002500.629300.500000.962000.75000


Target Position: 2875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2875GACUAUGCACACUUUUAAU92.831674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2112893GACTATGCACACTTTTAATATTAAAAGTGTGCATAGTC0.436500.129800.810300.750001.000001.00000


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837CCCGAGAUGAGAAUAAGAG72.04761270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971855CCCGAGATGAGAATAAGAGCTCTTATTCTCATCTCGGG0.254800.010400.681000.750001.000001.00000


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379CCUAGAGGCUGACCGUAUG73.32781151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651397CCTAGAGGCTGACCGTATGCATACGGTCAGCCTCTAGG0.050600.002800.689700.750000.989101.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158UCGCUGCUGCUGGAUAGUC54.13442711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718176TCGCTGCTGCTGGATAGTCGACTATCCAGCAGCAGCGA0.048300.001700.474100.500000.962000.75000


Target Position: 2427, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427CUUAGAGGGGUGAAAAUUA90.2497137

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9242719CTTAGAGGGGTGAAAATTA1/1/0/094.96EZRNM_001111077.1+NM_003379.41+1NANANA6:159187477..159187495(-)00EZR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222445CTTAGAGGGGTGAAAATTATAATTTTCACCCCTCTAAG0.377100.001400.603400.750001.000001.00000


Target Position: 2027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027GCCCCGCCACGCUUGUGUC63.56892014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412045GCCCCGCCACGCTTGTGTCGACACAAGCGTGGCGGGGC0.044000.001100.681000.750000.902200.75000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845GAGAAUAAGAGGACCCACA90.2815136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131863GAGAATAAGAGGACCCACATGTGGGTCCTCTTATTCTC0.192900.149400.603400.500000.945700.62500


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572UUUUUGUUUUUUUUUUUUU60.17952294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382590TTTTTGTTTTTTTTTTTTTAAAAAAAAAAAAACAAAAA0.268200.080600.500000.500001.000001.00000


Target Position: 2359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359UGUAUUCGAAAUGAGCUCA73.19751161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032377TGTATTCGAAATGAGCTCATGAGCTCATTTCGAATACA0.074700.043900.482800.500001.000001.00000


Target Position: 2426, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426GCUUAGAGGGGUGAAAAUU78.2381774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242444GCTTAGAGGGGTGAAAATTAATTTTCACCCCTCTAAGC0.077300.001400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2424-2446ATGCTTAGAGGGGTGAAAATTATAAUUUUCACCCCUCUAAGCAUGCUUAGAGGGGUGAAAAUUAUU7.416.332


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331UCCGGGAAGUGUGGUACUU63.19492055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
722349TCCGGGAAGTGTGGTACTTAAGTACCACACTTCCCGGA0.018100.005500.732800.750001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GGACCUGGAAAUGUAUGGA84.8014361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632821GGACCTGGAAATGTATGGATCCATACATTTCCAGGTCC0.063300.050200.500000.750001.000001.00000


Target Position: 2560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560CUUGGAUUUUUUUUUUUGU72.55221220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2558-2580CACTTGGATTTTTTTTTTTGTTTACAAAAAAAAAAAUCCAAGUGCUUGGAUUUUUUUUUUUGUUUU-2.920.111


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873UGGACUAUGCACACUUUUA87.2188240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452891TGGACTATGCACACTTTTATAAAAGTGTGCATAGTCCA0.351100.030800.810300.750001.000001.00000


Target Position: 190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
190UCGAGGAUACUCACCAGAA84.4109382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595208TCGAGGATACTCACCAGAATTCTGGTGAGTATCCTCGA0.104100.005500.620700.750000.913000.62500


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344GUGCCAUACUUGUUCUGUA98.879613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832362GTGCCATACTTGTTCTGTATACAGAACAAGTATGGCAC0.068200.002300.612100.750001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570UUUUUUUGUUUUUUUUUUU61.22052212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6352588TTTTTTTGTTTTTTTTTTTAAAAAAAAAAACAAAAAAA0.226300.072900.500000.500001.000001.00000


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372AGCUCAAAUUGAUUUUUUA94.504245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862390AGCTCAAATTGATTTTTTATAAAAAATCAATTTGAGCT0.061900.036200.819000.750001.000001.00000


Target Position: 2704, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704GUUUUGUUCUGUAUAUUUU85.7497310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492722GTTTTGTTCTGTATATTTTAAAATATACAGAACAAAAC0.074200.014700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2702-2724AAGTTTTGTTCTGTATATTTTGTAAAAUAUACAGAACAAAACUUGUUUUGUUCUGUAUAUUUUGUU-8.05.622


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626CCGCCCCCACCACCCCCCG35.2633139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071644CCGCCCCCACCACCCCCCGCGGGGGGTGGTGGGGGCGG0.077900.046500.500000.500001.000001.00000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751AUAUGAAAAACCCUCUAAA87.5344224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5152769ATATGAAAAACCCTCTAAATTTAGAGGGTTTTTCATAT0.232000.224200.543100.500001.000001.00000


Target Position: 1147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147AGGAGAAGCAUCAGAAGCA87.545222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131165AGGAGAAGCATCAGAAGCATGCTTCTGATGCTTCTCCT0.019600.009400.491400.500000.962000.75000


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474GCACACACAGUGAUUCCCU79.4108680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932492GCACACACAGTGATTCCCTAGGGAATCACTGTGTGTGC0.024500.004200.508600.750000.934800.62500


Target Position: 2743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2743AGAAUUACAUAUGAAAAAC71.71191304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4402761AGAATTACATATGAAAAACGTTTTTCATATGTAATTCT0.459300.402000.577600.500001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670CCAGGAGAGCUUGCAGGAU76.4543909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721688CCAGGAGAGCTTGCAGGATATCCTGCAAGCTCTCCTGG0.030400.003600.663801.000001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220AGAGAAAGAGCAGAUGAUG72.24191249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671238AGAGAAAGAGCAGATGATGCATCATCTGCTCTTTCTCT0.094200.071800.569000.500001.000001.00000


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950CUGUUUGCUUGUGUUUGUU74.85321035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262968CTGTTTGCTTGTGTTTGTTAACAAACACAAGCAAACAG0.503300.063800.637900.750001.000001.00000


Target Position: 2346, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346GCCAUACUUGUUCUGUAUU79.5575668

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8234619GCCATACTTGTTCTGTATT1/1/0/094.96EZRNM_001111077.1+NM_003379.41+1NANANA6:159187558..159187576(-)00EZR(0.002)


Target Position: 1408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1408GGGCUAAGGAGGAGCUGGA83.5039434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091426GGGCTAAGGAGGAGCTGGATCCAGCTCCTCCTTAGCCC0.021300.003100.620700.750000.972800.75000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CCCGCCCCCACCACCCCCC30.98663147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411643CCCGCCCCCACCACCCCCCGGGGGGTGGTGGGGGCGGG0.344200.062400.500000.500001.000001.00000


Target Position: 3098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098GUGGAUUCCAUGCCGCAGA73.62491130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7433116GTGGATTCCATGCCGCAGATCTGCGGCATGGAATCCAC0.017800.001000.569000.500000.994600.62500


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529GGAGGAUGAAGUUGAAGAG82.3788488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001547GGAGGATGAAGTTGAAGAGCTCTTCAACTTCATCCTCC0.281200.110400.560300.750001.000001.00000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825CUGCAGUCACGUGUAAACA82.8456467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6542843CTGCAGTCACGTGTAAACATGTTTACACGTGACTGCAG0.059100.003200.577600.500001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491GCUCAUCCAGGACAUCACC66.6551746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684509GCTCATCCAGGACATCACCGGTGATGTCCTGGATGAGC0.329500.058700.500000.500000.962000.75000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433GGCGGUGGAUCAGAUAAAG74.98851025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631451GGCGGTGGATCAGATAAAGCTTTATCTGATCCACCGCC0.644500.159600.862100.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GCACCUGACUUUGUGUUUU79.9675638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021023GCACCTGACTTTGTGTTTTAAAACACAAAGTCAGGTGC0.023100.004900.853401.000000.929300.62500


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140GCCCGGGAGGAGAAGCAUC63.53052016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631158GCCCGGGAGGAGAAGCATCGATGCTTCTCCTCCCGGGC0.112000.024300.819000.750000.956500.62500


Target Position: 3115, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115GACAUGAAAUAAAAGCUUU87.1426244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5603133GACATGAAATAAAAGCTTTAAAGCTTTTATTTCATGTC0.071200.007800.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3113-3135CAGACATGAAATAAAAGCTTTGCAAAGCUUUUAUUUCAUGUCUGGACAUGAAAUAAAAGCUUUGCU17.020.522


Target Position: 2158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158CAGUUGUAAUAGUGCCAAG81.7373528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472176CAGTTGTAATAGTGCCAAGCTTGGCACTATTACAACTG0.040400.018400.646600.500001.000001.00000


Target Position: 2877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2877CUAUGCACACUUUUAAUUU81.7775525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632895CTATGCACACTTTTAATTTAAATTAAAAGTGTGCATAG0.545700.142200.672400.750001.000001.00000


Target Position: 2914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914CACUAUGAGCUUUCAGACU81.7815524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282932CACTATGAGCTTTCAGACTAGTCTGAAAGCTCATAGTG0.055900.004100.586200.500001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UGGAGGAGGACACUUGGAU70.80511387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312566TGGAGGAGGACACTTGGATATCCAAGTGTCCTCCTCCA0.063500.004100.663800.750001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866GCUUGGAGUUGAUGCCCUU85.2428341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738884GCTTGGAGTTGATGCCCTTAAGGGCATCAACTCCAAGC0.056300.001100.715501.000000.972800.75000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898CCGGGACAAGUACAAGACG65.1281883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091916CCGGGACAAGTACAAGACGCGTCTTGTACTTGTCCCGG0.088400.046100.637900.500001.000001.00000


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145AAGCAAAAAAAAAAAAAAA81.771526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6213163AAGCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGCTT0.999000.007800.637900.500001.000001.00000


Target Position: 2207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2207CACCUCCUGUGUUGUGCUG66.57441757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162225CACCTCCTGTGTTGTGCTGCAGCACAACACAGGAGGTG0.127500.001500.508600.500000.972800.62500


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614UGUACUUAUACACCUUAUU73.9221106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1862632TGTACTTATACACCTTATTAATAAGGTGTATAAGTACA0.374400.206700.698300.750001.000001.00000


Target Position: 2714, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2714GUAUAUUUUGUUACCUUUU80.6253597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682732GTATATTTTGTTACCTTTTAAAAGGTAACAAAATATAC0.205000.013500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2712-2734CTGTATATTTTGTTACCTTTTACAAAAGGUAACAAAAUAUACAGGUAUAUUUUGUUACCUUUUACU18.6-8.021


Target Position: 2341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341UCUGUGCCAUACUUGUUCU72.44271229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112359TCTGTGCCATACTTGTTCTAGAACAAGTATGGCACAGA0.062100.001600.500000.500001.000001.00000


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370UGAGCUCAAAUUGAUUUUU67.01271712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902388TGAGCTCAAATTGATTTTTAAAAATCAATTTGAGCTCA0.061000.016700.724100.750001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940GGAGUGAAAUCAGGAACAU87.3974231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544958GGAGTGAAATCAGGAACATATGTTCCTGATTTCACTCC0.113500.007800.715501.000001.000001.00000


Target Position: 2040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2040UGUGUCUUUAGUGCUCCAA71.61241315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812058TGTGTCTTTAGTGCTCCAATTGGAGCACTAAAGACACA0.219500.093400.560300.750001.000001.00000


Target Position: 2687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687AGUUUUAAAAAGGGAAAGU65.70981832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6502705AGTTTTAAAAAGGGAAAGTACTTTCCCTTTTTAAAACT0.222900.129700.500000.500001.000001.00000


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200UCACCAGAAACCGAAAAUG57.95692484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732218TCACCAGAAACCGAAAATGCATTTTCGGTTTCTGGTGA0.297000.115000.569000.500001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145GGAGGAGAAGCAUCAGAAG81.8136523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621163GGAGGAGAAGCATCAGAAGCTTCTGATGCTTCTCCTCC0.171100.059200.732800.750001.000001.00000


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229GCAGAUGAUGCGCGAGAAG71.66271309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731247GCAGATGATGCGCGAGAAGCTTCTCGCGCATCATCTGC0.121600.006100.715500.750000.978300.62500


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308CUCUCGGAGCAGAUUCAGA85.4956330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7111326CTCTCGGAGCAGATTCAGATCTGAATCTGCTCCGAGAG0.112300.002300.586200.500000.951100.62500


Target Position: 2587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587UUUUUGCUUAACAGUUUUA71.86841285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322605TTTTTGCTTAACAGTTTTATAAAACTGTTAAGCAAAAA0.232800.188100.465500.500001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307CAGCAUCAUUAAAGGAAAC74.38251066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622325CAGCATCATTAAAGGAAACGTTTCCTTTAATGATGCTG0.459100.106900.637900.500001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676UUUGUAACAUUAGUUUUAA77.872805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362694TTTGTAACATTAGTTTTAATTAAAACTAATGTTACAAA0.291300.055400.465500.500000.994601.00000


Target Position: 2428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428UUAGAGGGGUGAAAAUUAU73.96231101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7212446TTAGAGGGGTGAAAATTATATAATTTTCACCCCTCTAA0.457400.001500.491400.500001.000001.00000


Target Position: 2740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2740AAAAGAAUUACAUAUGAAA92.409980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7012758AAAAGAATTACATATGAAATTTCATATGTAATTCTTTT0.804800.387100.500000.500001.000001.00000


Target Position: 3049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3049UCCUUCUCGUGCACUGCUU64.50331930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2203067TCCTTCTCGTGCACTGCTTAAGCAGTGCACGAGAAGGA0.271100.168500.732800.750001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765CUAAACCAUGGCACUUGAU75.9883936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112783CTAAACCATGGCACTTGATATCAAGTGCCATGGTTTAG0.020700.009700.491400.750001.000001.00000


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764CGCAUCACUGAGGCAGAGA77.4749836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961782CGCATCACTGAGGCAGAGATCTCTGCCTCAGTGATGCG0.265600.010500.698300.750000.923900.62500


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179CAGCUGGAAACAGAGAAGA78.5039755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601197CAGCTGGAAACAGAGAAGATCTTCTCTGTTTCCAGCTG0.599000.004700.560300.500000.994600.87500


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332GGACUUCCAUCUGUGCCAU83.5268432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6012350GGACTTCCATCTGTGCCATATGGCACAGATGGAAGTCC0.058700.008500.715501.000000.994600.62500


Target Position: 3060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060CACUGCUUUCUCCUUCACA86.5394269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6763078CACTGCTTTCTCCTTCACATGTGAAGGAGAAAGCAGTG0.173300.049800.586200.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GAGAAUCAACAAGCGGAUC66.221777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871055GAGAATCAACAAGCGGATCGATCCGCTTGTTGATTCTC0.106700.029400.629300.500001.000001.00000


Target Position: 2407, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407CAUCUUUGUAUAUUUACAU88.1622197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6352425CATCTTTGTATATTTACATATGTAAATATACAAAGATG0.070300.003800.500000.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2405-2427TCCATCTTTGTATATTTACATGCAUGUAAAUAUACAAAGAUGGACAUCUUUGUAUAUUUACAUGCU6.912.022


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143CGGGAGGAGAAGCAUCAGA82.4111486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141161CGGGAGGAGAAGCATCAGATCTGATGCTTCTCCTCCCG0.129300.035100.689700.750001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084UGUAUAUGCGCCGCAGGAA75.8502958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241102TGTATATGCGCCGCAGGAATTCCTGCGGCGCATATACA0.085100.010000.534500.750000.978301.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617UGGGGACUACAACAAAGAA86.5522268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354635TGGGGACTACAACAAAGAATTCTTTGTTGTAGTCCCCA0.251200.029300.672400.750001.000001.00000


Target Position: 2736, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GAAUAAAAGAAUUACAUAU96.153634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692754GAATAAAAGAATTACATATATATGTAATTCTTTTATTC0.780500.161100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2734-2756CAGAATAAAAGAATTACATATGAAUAUGUAAUUCUUUUAUUCUGGAAUAAAAGAAUUACAUAUGAU8.5-9.722


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813AUGUAUGGAAUCAACUAUU77.7449818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
634831ATGTATGGAATCAACTATTAATAGTTGATTCCATACAT0.046100.011600.646600.500001.000001.00000


Target Position: 2630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2630AUUAAUGAUCAGCUAUAUA89.9199148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7262648ATTAATGATCAGCTATATATATATAGCTGATCATTAAT0.230000.140700.465500.500001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GCAAGGCCGGGACAAGUAC65.05721888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761910GCAAGGCCGGGACAAGTACGTACTTGTCCCGGCCTTGC0.436600.006000.672400.750001.000001.00000


Target Position: 2651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651AUUUAUAUACAAGUGAUAA87.718215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132669ATTTATATACAAGTGATAATTATCACTTGTATATAAAT0.024400.004300.474100.500001.000001.00000


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351ACUUGUUCUGUAUUCGAAA86.3576279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702369ACTTGTTCTGTATTCGAAATTTCGAATACAGAACAAGT0.339100.013000.706900.750001.000001.00000


Target Position: 3147, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147GCAAAAAAAAAAAAAAAAA85.9047297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453165GCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGC0.999200.993200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3145-3167AAGCAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUGCUUGCAAAAAAAAAAAAAAAAAAAU-11.3-2.900


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512GAAACUUUUCUUCCUCCAA89.5442161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
696530GAAACTTTTCTTCCTCCAATTGGAGGAAGAAAAGTTTC0.024200.007600.525900.750001.000001.00000


Target Position: 2475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475CACACACAGUGAUUCCCUC77.4851835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042493CACACACAGTGATTCCCTCGAGGGAATCACTGTGTGTG0.081800.003900.482800.500000.956500.62500


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258UGUAAAGUCUGAGUAAGAA88.2509194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272276TGTAAAGTCTGAGTAAGAATTCTTACTCAGACTTTACA0.161800.019800.534500.750001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489GAGCUCAUCCAGGACAUCA88.641184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567507GAGCTCATCCAGGACATCATGATGTCCTGGATGAGCTC0.119700.010100.586200.500001.000001.00000


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030CCGCCACGCUUGUGUCUUU82.1927502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712048CCGCCACGCTTGTGTCTTTAAAGACACAAGCGTGGCGG0.199700.006200.913801.000000.902201.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835GGCCCGAGAUGAGAAUAAG77.6345826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921853GGCCCGAGATGAGAATAAGCTTATTCTCATCTCGGGCC0.252500.023200.862100.750001.000001.00000


Target Position: 2553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2553GAGGACACUUGGAUUUUUU85.546327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5152571GAGGACACTTGGATTTTTTAAAAAATCCAAGTGTCCTC0.221500.009100.810300.750001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731UUACAGAAUAAAAGAAUUA79.7104653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272749TTACAGAATAAAAGAATTATAATTCTTTTATTCTGTAA0.298600.076000.500000.500001.000001.00000


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065CUUUCUCCUUCACAGCUAA90.3652135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183083CTTTCTCCTTCACAGCTAATTAGCTGTGAAGGAGAAAG0.051500.024900.603400.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518CGGAGGCGCAAGGAGGAUG61.17112216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351536CGGAGGCGCAAGGAGGATGCATCCTCCTTGCGCCTCCG0.322800.016200.758600.750001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432AGGCGGUGGAUCAGAUAAA85.7331315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581450AGGCGGTGGATCAGATAAATTTATCTGATCCACCGCCT0.496000.108900.844800.750001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971CAAAAAGUUUGUCAUUAAA95.194639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744989CAAAAAGTTTGTCATTAAATTTAATGACAAACTTTTTG0.027700.001000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
969-991GACAAAAAGTTTGTCATTAAACCUUUAAUGACAAACUUUUUGUCCAAAAAGUUUGUCAUUAAACCU8.93.221


Target Position: 2406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406CCAUCUUUGUAUAUUUACA95.078441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2404-2426ATCCATCTTTGTATATTTACATGUGUAAAUAUACAAAGAUGGAUCCAUCUUUGUAUAUUUACAUGU1.412.022


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182CUGAUUCUCGCGAUUAUUC66.82281728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362200CTGATTCTCGCGATTATTCGAATAATCGCGAGAATCAG0.073400.011000.612100.500001.000001.00000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254UGCCUGUAAAGUCUGAGUA78.5174753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082272TGCCTGTAAAGTCTGAGTATACTCAGACTTTACAGGCA0.088600.009800.672400.750001.000001.00000


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489CCCUCCUCCCGUCACUCCA72.69791204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6532507CCCTCCTCCCGTCACTCCATGGAGTGACGGGAGGAGGG0.036700.019000.646600.750001.000001.00000


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846AUUAUUAUUAGUGUUUUAU72.06621264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422864ATTATTATTAGTGTTTTATATAAAACACTAATAATAAT0.012100.008900.465500.500001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540GGAAUCCUUAGCGAUGAGA78.2277776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524558GGAATCCTTAGCGATGAGATCTCATCGCTAAGGATTCC0.083400.011700.646600.750000.967400.87500


Target Position: 1740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1740CGGGAUGACCGCAAUGAGG64.89071898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231758CGGGATGACCGCAATGAGGCCTCATTGCGGTCATCCCG0.137300.005100.569000.500000.934800.62500


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086CCUUUAGAAAGCAGUUACC65.47661856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762104CCTTTAGAAAGCAGTTACCGGTAACTGCTTTCTAAAGG0.321300.115700.491400.500001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471CGGAGCUUGCAGAAUACAC73.08671172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871489CGGAGCTTGCAGAATACACGTGTATTCTGCAAGCTCCG0.070300.002200.620700.750001.000001.00000


Target Position: 2937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937CUGUGAAGAGACUCUGUUU89.2312169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492955CTGTGAAGAGACTCTGTTTAAACAGAGTCTCTTCACAG0.045400.003400.784500.750001.000001.00000


Target Position: 2876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2876ACUAUGCACACUUUUAAUU73.39621147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3172894ACTATGCACACTTTTAATTAATTAAAAGTGTGCATAGT0.460000.136200.698300.750001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814UGUAUGGAAUCAACUAUUU77.4359842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632832TGTATGGAATCAACTATTTAAATAGTTGATTCCATACA0.046300.008400.706900.750001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434GCGGUGGAUCAGAUAAAGA88.6301185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851452GCGGTGGATCAGATAAAGATCTTTATCTGATCCACCGC0.148900.033300.698300.750001.000001.00000


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83GCGCGGCAGGAGGACGAGG53.3392749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719101GCGCGGCAGGAGGACGAGGCCTCGTCCTCCTGCCGCGC0.179100.001500.577600.500001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CGAAAUGAGCUCAAAUUGA89.1361172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212383CGAAATGAGCTCAAATTGATCAATTTGAGCTCATTTCG0.084000.011500.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2363-2385TTCGAAATGAGCTCAAATTGATTUCAAUUUGAGCUCAUUUCGAACGAAAUGAGCUCAAAUUGAUUU4.216.323


Target Position: 2650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2650UAUUUAUAUACAAGUGAUA86.6843264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062668TATTTATATACAAGTGATATATCACTTGTATATAAATA0.022400.004300.500000.500001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823UCAACUAUUUCGAGAUAAA88.0778201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295841TCAACTATTTCGAGATAAATTTATCTCGAAATAGTTGA0.238800.044400.724100.750001.000001.00000


Target Position: 357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
357CACUAUGUGGAUAAUAAAG79.0728712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
673375CACTATGTGGATAATAAAGCTTTATTATCCACATAGTG0.186600.002500.655200.500001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414AGGAGGAGCUGGAGAGACA89.1125173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641432AGGAGGAGCTGGAGAGACATGTCTCTCCAGCTCCTCCT0.130800.002800.637900.500001.000001.00000


Target Position: 2031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031CGCCACGCUUGUGUCUUUA82.1273505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5032049CGCCACGCTTGTGTCTTTATAAAGACACAAGCGTGGCG0.155900.010000.887901.000000.902200.87500


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655GGUGAGCUACCAUGUCCAG77.4492841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6841673GGTGAGCTACCATGTCCAGCTGGACATGGTAGCTCACC0.061300.002300.569000.750000.994600.62500


Target Position: 2669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669AUACAGAUUUGUAACAUUA92.049591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852687ATACAGATTTGTAACATTATAATGTTACAAATCTGTAT0.084500.033900.508600.500000.956500.62500


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GAAUACACUGCCAAGAUUG77.3483848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6181500GAATACACTGCCAAGATTGCAATCTTGGCAGTGTATTC0.118300.029500.525900.500001.000001.00000


Target Position: 2611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611CAUUGUACUUAUACACCUU93.644258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632629CATTGTACTTATACACCTTAAGGTGTATAAGTACAATG0.391000.108900.517200.750000.978300.87500


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175GCAACAGCUGGAAACAGAG77.1831863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691193GCAACAGCTGGAAACAGAGCTCTGTTTCCAGCTGTTGC0.552700.002700.543100.750000.994600.75000


Target Position: 1182, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CUGGAAACAGAGAAGAAAA92.438479

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7118219CTGGAAACAGAGAAGAAAA1/1/0/094.96EZRNM_001111077.1+NM_003379.41+1NANANA2:42035741..42035759(+)|1:53856614..53856632(-)00EZR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391200CTGGAAACAGAGAAGAAAATTTTCTTCTCTGTTTCCAG0.929900.496100.784500.750001.000001.00000


Target Position: 2599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2599AGUUUUAGAAUACAUUGUA89.2498167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522617AGTTTTAGAATACATTGTATACAATGTATTCTAAAACT0.117900.055400.525900.750001.000001.00000


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232GGACUGAUUGAAUUACGGA93.104668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552250GGACTGATTGAATTACGGATCCGTAATTCAATCAGTCC0.121900.009700.500000.750001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428AGACAGGCGGUGGAUCAGA75.7595969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011446AGACAGGCGGTGGATCAGATCTGATCCACCGCCTGTCT0.396000.033700.500000.500001.000001.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556AGAUCUACUGCCCCCCUGA79.6177659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699574AGATCTACTGCCCCCCTGATCAGGGGGGCAGTAGATCT0.023400.015500.500000.500001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CUCAAAGAUAAUGCUAUGU69.12581515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445780CTCAAAGATAATGCTATGTACATAGCATTATCTTTGAG0.159700.077800.603400.500001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GGACCCACAAUGACAUCAU86.4756275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301873GGACCCACAATGACATCATATGATGTCATTGTGGGTCC0.081900.015700.715501.000001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UCUCUUUCAAUGACAAAAA77.9937797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728976TCTCTTTCAATGACAAAAATTTTTGTCATTGAAAGAGA0.016000.005000.724100.750001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906GAUGAUAAGUUAACCCCAA96.279931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531924GATGATAAGTTAACCCCAATTGGGGTTAACTTATCATC0.136600.015500.534500.750000.962000.62500


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364UCGAAAUGAGCUCAAAUUG60.59322260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902382TCGAAATGAGCTCAAATTGCAATTTGAGCTCATTTCGA0.101000.013300.646600.500001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825AACUAUUUCGAGAUAAAAA90.6417124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511843AACTATTTCGAGATAAAAATTTTTATCTCGAAATAGTT0.304900.058200.646600.500001.000001.00000


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838CCGAGAUGAGAAUAAGAGG70.81281386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621856CCGAGATGAGAATAAGAGGCCTCTTATTCTCATCTCGG0.218100.035300.569000.500001.000001.00000


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925UUCAGACUCCAGCUGUGAA80.5922599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822943TTCAGACTCCAGCTGTGAATTCACAGCTGGAGTCTGAA0.093100.004400.500000.500000.983700.75000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744AUGACCGCAAUGAGGAGAA72.36251241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081762ATGACCGCAATGAGGAGAATTCTCCTCATTGCGGTCAT0.443400.009200.482800.500001.000001.00000


Target Position: 2689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689UUUUAAAAAGGGAAAGUUU68.59321580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062707TTTTAAAAAGGGAAAGTTTAAACTTTCCCTTTTTAAAA0.105100.063000.500000.500001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CAGGAACAUCUCUUUCAAU91.5721104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662968CAGGAACATCTCTTTCAATATTGAAAGAGATGTTCCTG0.033700.006200.775900.750001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GGCCGGGACAAGUACAAGA86.1015289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631914GGCCGGGACAAGTACAAGATCTTGTACTTGTCCCGGCC0.343700.014200.775900.750001.000001.00000


Target Position: 3144, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GAAGCAAAAAAAAAAAAAA92.4777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5643162GAAGCAAAAAAAAAAAAAATTTTTTTTTTTTTTGCTTC0.999000.006500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164ACGAAGCAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUGCUUCGUGAAGCAAAAAAAAAAAAAAAAU-11.318.610


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192GAGGAUACUCACCAGAAAC79.4778673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483210GAGGATACTCACCAGAAACGTTTCTGGTGAGTATCCTC0.194900.018800.663800.500000.994600.75000


Target Position: 2844, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844GGAUUAUUAUUAGUGUUUU89.3014166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822862GGATTATTATTAGTGTTTTAAAACACTAATAATAATCC0.028000.005500.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2842-2864CAGGATTATTATTAGTGTTTTATAAAACACUAAUAAUAAUCCUGGGAUUAUUAUUAGUGUUUUAUU17.81.822


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363GUGGAUAAUAAAGGAUUUC64.09481971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529381GTGGATAATAAAGGATTTCGAAATCCTTTATTATCCAC0.081900.011300.620700.500001.000001.00000


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387UGGCUGAAGCUGGAUAAGA73.73851119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738405TGGCTGAAGCTGGATAAGATCTTATCCAGCTTCAGCCA0.458800.001600.620700.500001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141CCCGGGAGGAGAAGCAUCA76.9169881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281159CCCGGGAGGAGAAGCATCATGATGCTTCTCCTCCCGGG0.124200.027900.767200.750000.967400.75000


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635UGAUCAGCUAUAUACUAUU85.0545349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3022653TGATCAGCTATATACTATTAATAGTATATAGCTGATCA0.210900.128700.715500.750000.989100.75000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818UGGAAUCAACUAUUUCGAG66.70371740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671836TGGAATCAACTATTTCGAGCTCGAAATAGTTGATTCCA0.060300.015200.534500.500001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GAAACCGAAAAUGCCGAAA75.34891003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256224GAAACCGAAAATGCCGAAATTTCGGCATTTTCGGTTTC0.419500.257300.672400.750001.000001.00000


Target Position: 289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289CUGGAAAACAGCUUUUUGA82.3018493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
739307CTGGAAAACAGCTTTTTGATCAAAAAGCTGTTTTCCAG0.204700.024300.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
287-309AACTGGAAAACAGCTTTTTGATCUCAAAAAGCUGUUUUCCAGUUCUGGAAAACAGCUUUUUGAUCU2.120.112


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GCCUGUAAAGUCUGAGUAA96.706830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052273GCCTGTAAAGTCTGAGTAATTACTCAGACTTTACAGGC0.091800.012700.965501.000001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365GGAUAAUAAAGGAUUUCCU87.7029216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
605383GGATAATAAAGGATTTCCTAGGAAATCCTTTATTATCC0.057100.021200.525900.750000.951100.62500


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448UCAAGUUCCGGGCCAAGUU63.41562029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745466TCAAGTTCCGGGCCAAGTTAACTTGGCCCGGAACTTGA0.036300.001000.577600.750001.000001.00000


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142ACGAAGCAAAAAAAAAAAA75.7076974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5413160ACGAAGCAAAAAAAAAAAATTTTTTTTTTTTGCTTCGT0.997800.007800.775900.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861ACAAUGACAUCAUCCACAA90.5332129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971879ACAATGACATCATCCACAATTGTGGATGATGTCATTGT0.195400.048700.560300.750000.962000.75000


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319AGGAAACGUGGCAGGACUU74.76291041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122337AGGAAACGTGGCAGGACTTAAGTCCTGCCACGTTTCCT0.020400.009800.706900.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GCGAGAAGGAGGAGUUGAU85.6047322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941258GCGAGAAGGAGGAGTTGATATCAACTCCTCCTTCTCGC0.094700.059500.741401.000001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291GGAAAACAGCUUUUUGAUC73.34931150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253309GGAAAACAGCTTTTTGATCGATCAAAAAGCTGTTTTCC0.259000.054100.689700.750001.000001.00000


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058UGCACUGCUUUCUCCUUCA79.4713675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813076TGCACTGCTTTCTCCTTCATGAAGGAGAAAGCAGTGCA0.268100.065800.629300.500001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369AUGAGCUCAAAUUGAUUUU66.33991771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892387ATGAGCTCAAATTGATTTTAAAATCAATTTGAGCTCAT0.066100.015800.655200.500001.000001.00000


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947ACUCUGUUUGCUUGUGUUU71.07281369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2902965ACTCTGTTTGCTTGTGTTTAAACACAAGCAAACAGAGT0.566400.117400.706900.750001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880CCCUUGGACUGAAUAUUUA92.471276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572898CCCTTGGACTGAATATTTATAAATATTCAGTCCAAGGG0.232600.006100.956901.000001.000001.00000


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276AUGAGGAGAAGACAAAGAA84.6823370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021294ATGAGGAGAAGACAAAGAATTCTTTGTCTTCTCCTCAT0.581400.487200.482800.500001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684GUGAUGGACCAGCACAAAC70.99351375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718702GTGATGGACCAGCACAAACGTTTGTGCTGGTCCATCAC0.105200.018200.646600.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094AAGCAGUUACCCAACAGAA88.8135181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282112AAGCAGTTACCCAACAGAATTCTGTTGGGTAACTGCTT0.063500.066100.465500.500001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569UUUUUUUUGUUUUUUUUUU59.35542365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312587TTTTTTTTGTTTTTTTTTTAAAAAAAAAACAAAAAAAA0.214000.069600.500000.500001.000001.00000


Target Position: 1214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GGAGAGAGAGAAAGAGCAG80.9448568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271232GGAGAGAGAGAAAGAGCAGCTGCTCTTTCTCTCTCTCC0.305600.294900.586200.750001.000001.00000


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499AGGACAUCACCCAGAAACU78.5336751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461517AGGACATCACCCAGAAACTAGTTTCTGGGTGATGTCCT0.372900.217300.637900.500000.929300.62500


Target Position: 2558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558CACUUGGAUUUUUUUUUUU79.0607713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952576CACTTGGATTTTTTTTTTTAAAAAAAAAAATCCAAGTG0.142000.072900.793100.750001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983CAUUAAACCCAUCGACAAG77.0657870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581001CATTAAACCCATCGACAAGCTTGTCGATGGGTTTAATG0.159300.036500.517200.500001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433GGGGUGAAAAUUAUUUUGG63.16442060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382451GGGGTGAAAATTATTTTGGCCAAAATAATTTTCACCCC0.257500.023200.646600.500001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505UCACCCAGAAACUUUUCUU68.66111573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650523TCACCCAGAAACTTTTCTTAAGAAAAGTTTCTGGGTGA0.038000.008600.586200.750000.951100.62500


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613AGUUUGGGGACUACAACAA83.7511416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661631AGTTTGGGGACTACAACAATTGTTGTAGTCCCCAAACT0.184800.002900.560300.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181CCUGAUUCUCGCGAUUAUU77.4699837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6092199CCTGATTCTCGCGATTATTAATAATCGCGAGAATCAGG0.073200.004800.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2179-2201GGCCTGATTCTCGCGATTATTCTAAUAAUCGCGAGAAUCAGGCCCCUGAUUCUCGCGAUUAUUCUU8.820.433


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763CUCUAAACCAUGGCACUUG65.14821879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692781CTCTAAACCATGGCACTTGCAAGTGCCATGGTTTAGAG0.031100.020700.663800.500001.000001.00000


Target Position: 2306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2306UCAGCAUCAUUAAAGGAAA84.1763398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2872324TCAGCATCATTAAAGGAAATTTCCTTTAATGATGCTGA0.470100.099700.724100.750001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831UCACGUGUAAACAGGAUUA80.9356570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942849TCACGTGTAAACAGGATTATAATCCTGTTTACACGTGA0.136700.010700.689700.750001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GUUCCGGGCCAAGUUCUAC63.7011999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727470GTTCCGGGCCAAGTTCTACGTAGAACTTGGCCCGGAAC0.209700.004700.465500.500001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267UGCAGGACUAUGAGGAGAA81.9122514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121285TGCAGGACTATGAGGAGAATTCTCCTCATAGTCCTGCA0.619400.220900.681000.750001.000001.00000


Target Position: 2557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2557ACACUUGGAUUUUUUUUUU74.20871083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382575ACACTTGGATTTTTTTTTTAAAAAAAAAATCCAAGTGT0.215800.086600.706900.750001.000001.00000


Target Position: 2652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652UUUAUAUACAAGUGAUAAU76.1644926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152670TTTATATACAAGTGATAATATTATCACTTGTATATAAA0.019400.002800.491400.500001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775CUAUGUUGGAAUACCUGAA90.785121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691793CTATGTTGGAATACCTGAATTCAGGTATTCCAACATAG0.025400.002000.500000.750000.956501.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219GAGAGAAAGAGCAGAUGAU93.45863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141237GAGAGAAAGAGCAGATGATATCATCTGCTCTTTCTCTC0.085700.085300.629300.750001.000001.00000


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488GGAGCUCAUCCAGGACAUC72.26311247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553506GGAGCTCATCCAGGACATCGATGTCCTGGATGAGCTCC0.120900.007400.689700.750000.983700.62500


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CAGAUCCCAGUUCCUUUAG63.39732030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752092CAGATCCCAGTTCCTTTAGCTAAAGGAACTGGGATCTG0.160100.089100.612100.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425GAGAGACAGGCGGUGGAUC68.39641600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951443GAGAGACAGGCGGTGGATCGATCCACCGCCTGTCTCTC0.177600.010600.629300.500001.000001.00000


Target Position: 1280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280GGAGAAGACAAAGAAGGCA86.7472261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601298GGAGAAGACAAAGAAGGCATGCCTTCTTTGTCTTCTCC0.286200.229300.517200.750001.000001.00000


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952GUUUGCUUGUGUUUGUUUG68.91241540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982970GTTTGCTTGTGTTTGTTTGCAAACAAACACAAGCAAAC0.303200.090400.500000.500001.000001.00000


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437UGAAAAUUAUUUUGGAAAU75.4679994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612455TGAAAATTATTTTGGAAATATTTCCAAAATAATTTTCA0.234700.202200.715500.750001.000001.00000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721UUGUUACCUUUUACAGAAU72.01731271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232739TTGTTACCTTTTACAGAATATTCTGTAAAAGGTAACAA0.047700.001400.637900.500001.000001.00000


Target Position: 2842, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2842CAGGAUUAUUAUUAGUGUU90.1799139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562860CAGGATTATTATTAGTGTTAACACTAATAATAATCCTG0.043000.003100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2840-2862AACAGGATTATTATTAGTGTTTTAACACUAAUAAUAAUCCUGUUCAGGAUUAUUAUUAGUGUUUUU19.019.922


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071CCUCAGAUCCCAGUUCCUU75.4641996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072089CCTCAGATCCCAGTTCCTTAAGGAACTGGGATCTGAGG0.132100.064500.706901.000001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081CAGUUCCUUUAGAAAGCAG75.08321018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942099CAGTTCCTTTAGAAAGCAGCTGCTTTCTAAAGGAACTG0.310200.136300.500000.500001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603UUAGAAUACAUUGUACUUA78.2024781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082621TTAGAATACATTGTACTTATAAGTACAATGTATTCTAA0.131800.050400.500000.500000.983700.75000


Target Position: 2722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722UGUUACCUUUUACAGAAUA81.2731553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922740TGTTACCTTTTACAGAATATATTCTGTAAAAGGTAACA0.061300.002000.663800.750001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567UUUUUUUUUUGUUUUUUUU61.50672194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022585TTTTTTTTTTGTTTTTTTTAAAAAAAACAAAAAAAAAA0.119500.069300.500000.500001.000001.00000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886CUUUUAAUUUUGUCAGAUU85.0893348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3592904CTTTTAATTTTGTCAGATTAATCTGACAAAATTAAAAG0.333900.161100.629300.750001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628UUAUUAAUGAUCAGCUAUA83.5119433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792646TTATTAATGATCAGCTATATATAGCTGATCATTAATAA0.224900.130400.491400.500001.000001.00000


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808UGGAAAUGUAUGGAAUCAA81.4407542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487826TGGAAATGTATGGAATCAATTGATTCCATACATTTCCA0.097300.033100.698300.750001.000001.00000


Target Position: 2882, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882CACACUUUUAAUUUUGUCA84.8425360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302900CACACTTTTAATTTTGTCATGACAAAATTAAAAGTGTG0.449300.173500.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2880-2902TGCACACTTTTAATTTTGTCAGAUGACAAAAUUAAAAGUGUGCACACACUUUUAAUUUUGUCAGAU14.917.822


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037GCUUGUGUCUUUAGUGCUC73.1751164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142055GCTTGTGTCTTTAGTGCTCGAGCACTAAAGACACAAGC0.219000.036800.543100.750001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764CAAAGAUAAUGCUAUGUUG85.7927306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615782CAAAGATAATGCTATGTTGCAACATAGCATTATCTTTG0.147900.082100.500000.500001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833CAGGCCCGAGAUGAGAAUA81.6788531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201851CAGGCCCGAGATGAGAATATATTCTCATCTCGGGCCTG0.282800.035400.741400.750001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333GACUUCCAUCUGUGCCAUA91.2844112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5752351GACTTCCATCTGTGCCATATATGGCACAGATGGAAGTC0.064800.034700.775900.750001.000001.00000


Target Position: 2564, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564GAUUUUUUUUUUUGUUUUU78.5329752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292582GATTTTTTTTTTTGTTTTTAAAAACAAAAAAAAAAATC0.124100.074100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2562-2584TGGATTTTTTTTTTTGTTTTTTTAAAAACAAAAAAAAAAAUCCAGAUUUUUUUUUUUGUUUUUUUU5.6-12.010


Target Position: 2302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302AGAGUCAGCAUCAUUAAAG71.99181275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592320AGAGTCAGCATCATTAAAGCTTTAATGATGCTGACTCT0.487900.067900.586200.500001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237GAUUGAAUUACGGAAAAUG76.7901891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132255GATTGAATTACGGAAAATGCATTTTCCGTAATTCAATC0.043200.034600.525900.500001.000001.00000


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769CACUGAGGCAGAGAAGAAC72.82361190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311787CACTGAGGCAGAGAAGAACGTTCTTCTCTGCCTCAGTG0.543600.067000.646600.500001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UGCCGAAACCAAUCAAUGU71.74761299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574235TGCCGAAACCAATCAATGTACATTGATTGGTTTCGGCA0.191700.156700.646600.500000.989100.62500


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146AGCAAAAAAAAAAAAAAAA80.5888600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703164AGCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGCT0.999100.993100.853400.750001.000001.00000


Target Position: 2606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2606GAAUACAUUGUACUUAUAC78.9295722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822624GAATACATTGTACTTATACGTATAAGTACAATGTATTC0.359600.086800.491400.500000.983700.62500


Target Position: 2592, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592GCUUAACAGUUUUAGAAUA97.346625

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5259219GCTTAACAGTTTTAGAATA1/1/0/096.22EZRNM_001111077.1+NM_003379.41+1NANANA6:159187312..159187330(-)00EZR(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2052610GCTTAACAGTTTTAGAATATATTCTAAAACTGTTAAGC0.295700.126100.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2590-2612TTGCTTAACAGTTTTAGAATACAUAUUCUAAAACUGUUAAGCAAGCUUAACAGUUUUAGAAUACAU6.911.822


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183UGGAAACAGAGAAGAAAAG63.61462006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911201TGGAAACAGAGAAGAAAAGCTTTTCTTCTCTGTTTCCA0.718600.379800.706900.500001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210CCGAAAAUGCCGAAACCAA86.9342251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101228CCGAAAATGCCGAAACCAATTGGTTTCGGCATTTTCGG0.597600.229200.767201.000001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761GCUCAAAGAUAAUGCUAUG83.0478457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366779GCTCAAAGATAATGCTATGCATAGCATTATCTTTGAGC0.167000.068600.698300.750001.000001.00000


Target Position: 2301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301AAGAGUCAGCAUCAUUAAA89.2415168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702319AAGAGTCAGCATCATTAAATTTAATGATGCTGACTCTT0.303500.072100.637900.500001.000001.00000


Target Position: 2827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827GCAGUCACGUGUAAACAGG68.93191536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922845GCAGTCACGTGTAAACAGGCCTGTTTACACGTGACTGC0.060700.011800.508600.500001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767AGAUAAUGCUAUGUUGGAA93.834854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504785AGATAATGCTATGTTGGAATTCCAACATAGCATTATCT0.204900.096700.551700.750001.000001.00000


Target Position: 2823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2823UGCUGCAGUCACGUGUAAA82.5677481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072841TGCTGCAGTCACGTGTAAATTTACACGTGACTGCAGCA0.033100.001600.853400.750001.000001.00000


Target Position: 2878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878UAUGCACACUUUUAAUUUU78.8098727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432896TATGCACACTTTTAATTTTAAAATTAAAAGTGTGCATA0.443700.140500.543100.500001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GAGGUCAGGAAGGAGAAUC65.18791875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
725438GAGGTCAGGAAGGAGAATCGATTCTCCTTCCTGACCTC0.017200.004400.629300.500001.000001.00000


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994UCGACAAGAAGGCACCUGA75.01341023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6511012TCGACAAGAAGGCACCTGATCAGGTGCCTTCTTGTCGA0.121400.003500.569000.500000.907600.62500


Target Position: 2835, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2835GUGUAAACAGGAUUAUUAU92.007193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542853GTGTAAACAGGATTATTATATAATAATCCTGTTTACAC0.116200.016500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2833-2855ACGTGTAAACAGGATTATTATTAAUAAUAAUCCUGUUUACACGUGUGUAAACAGGAUUAUUAUUAU-8.014.732


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109GCCGCAGACAUGAAAUAAA92.214885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5393127GCCGCAGACATGAAATAAATTTATTTCATGTCTGCGGC0.350300.007901.000001.000001.000001.00000


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174GGCAACAGCUGGAAACAGA89.6897156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801192GGCAACAGCTGGAAACAGATCTGTTTCCAGCTGTTGCC0.554800.002400.775900.750000.951100.75000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181GCUGGAAACAGAGAAGAAA90.9284117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611199GCTGGAAACAGAGAAGAAATTTCTTCTCTGTTTCCAGC0.897700.051600.853401.000000.994600.62500


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867ACAUCAUCCACAACGAGAA87.5354223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261885ACATCATCCACAACGAGAATTCTCGTTGTGGATGATGT0.545700.069400.534500.750000.951100.75000


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524CGCAAGGAGGAUGAAGUUG64.14471963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941542CGCAAGGAGGATGAAGTTGCAACTTCATCCTCCTTGCG0.501600.133100.775900.750001.000001.00000


Target Position: 2082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082AGUUCCUUUAGAAAGCAGU68.83021552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252100AGTTCCTTTAGAAAGCAGTACTGCTTTCTAAAGGAACT0.388000.148600.500000.500001.000001.00000


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880UGCACACUUUUAAUUUUGU69.85111459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842898TGCACACTTTTAATTTTGTACAAAATTAAAAGTGTGCA0.281600.103300.646600.500001.000001.00000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840GAGAUGAGAAUAAGAGGAC75.28471007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751858GAGATGAGAATAAGAGGACGTCCTCTTATTCTCATCTC0.207500.023600.491400.500001.000001.00000


Target Position: 2641, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2641GCUAUAUACUAUUUAUAUA107.5391

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6264119GCTATATACTATTTATATA1/1/0/096.22EZRNM_001111077.1+NM_003379.41+1NANANA6:159187263..159187281(-)00EZR(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2639-2661CAGCTATATACTATTTATATACAUAUAUAAAUAGUAUAUAGCUGGCUAUAUACUAUUUAUAUACAU-8.0-0.822


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272GACUAUGAGGAGAAGACAA98.876114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401290GACTATGAGGAGAAGACAATTGTCTTCTCCTCATAGTC0.649100.398800.672400.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941GAGUGAAAUCAGGAACAUC83.038458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674959GAGTGAAATCAGGAACATCGATGTTCCTGATTTCACTC0.101200.010800.629300.500001.000001.00000


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160GCUGCUGCUGGAUAGUCGU76.2843919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672178GCTGCTGCTGGATAGTCGTACGACTATCCAGCAGCAGC0.092600.002600.577600.750001.000001.00000


Target Position: 2824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2824GCUGCAGUCACGUGUAAAC75.31281005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712842GCTGCAGTCACGTGTAAACGTTTACACGTGACTGCAGC0.053100.002600.706900.750001.000001.00000


Target Position: 2305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2305GUCAGCAUCAUUAAAGGAA84.2167393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3622323GTCAGCATCATTAAAGGAATTCCTTTAATGATGCTGAC0.478300.087200.646600.750001.000001.00000


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GAGAGAGAGAAAGAGCAGA86.8956252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681233GAGAGAGAGAAAGAGCAGATCTGCTCTTTCTCTCTCTC0.291200.281900.586200.500001.000001.00000


Target Position: 2833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833ACGUGUAAACAGGAUUAUU79.3994682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412851ACGTGTAAACAGGATTATTAATAATCCTGTTTACACGT0.077300.013000.767200.750001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CUGCAGGACUAUGAGGAGA79.5357670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141284CTGCAGGACTATGAGGAGATCTCCTCATAGTCCTGCAG0.608900.034800.560300.500001.000001.00000


Target Position: 2735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735AGAAUAAAAGAAUUACAUA96.932427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2222753AGAATAAAAGAATTACATATATGTAATTCTTTTATTCT0.781000.143000.681000.750001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821AAUCAACUAUUUCGAGAUA88.7606182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730839AATCAACTATTTCGAGATATATCTCGAAATAGTTGATT0.095000.031900.465500.500001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256CCUGUAAAGUCUGAGUAAG74.58391048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762274CCTGTAAAGTCTGAGTAAGCTTACTCAGACTTTACAGG0.126700.012100.706900.750001.000001.00000


Target Position: 2036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036CGCUUGUGUCUUUAGUGCU80.6137598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652054CGCTTGTGTCTTTAGTGCTAGCACTAAAGACACAAGCG0.255400.018000.569000.750001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483GUGAUUCCCUCCUCCCGUC64.47951932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112501GTGATTCCCTCCTCCCGTCGACGGGAGGAGGGAATCAC0.168000.046900.474100.500001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545UGGUGGAGGAGGACACUUG66.99591716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322563TGGTGGAGGAGGACACTTGCAAGTGTCCTCCTCCACCA0.015400.002900.698300.500000.956500.62500


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067ACUCCCUCAGAUCCCAGUU66.12351788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772085ACTCCCTCAGATCCCAGTTAACTGGGATCTGAGGGAGT0.111800.037100.560300.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427GAGACAGGCGGUGGAUCAG71.31731350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431445GAGACAGGCGGTGGATCAGCTGATCCACCGCCTGTCTC0.228900.025500.525900.500001.000001.00000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375UCAAAUUGAUUUUUUAAUU72.05921267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642393TCAAATTGATTTTTTAATTAATTAAAAAATCAATTTGA0.068900.019600.715500.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733ACAGAAUAAAAGAAUUACA86.7055263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392751ACAGAATAAAAGAATTACATGTAATTCTTTTATTCTGT0.686100.106600.500000.500001.000001.00000


Target Position: 2829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829AGUCACGUGUAAACAGGAU79.3194690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5552847AGTCACGTGTAAACAGGATATCCTGTTTACACGTGACT0.101600.007300.525900.750001.000001.00000


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409GGCUAAGGAGGAGCUGGAG69.1051518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411427GGCTAAGGAGGAGCTGGAGCTCCAGCTCCTCCTTAGCC0.012200.004400.689700.750000.972800.62500


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209ACCGUGGAGAGAGAGAAAG56.40112573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711227ACCGTGGAGAGAGAGAAAGCTTTCTCTCTCTCCACGGT0.735200.414700.715500.500001.000001.00000


Target Position: 486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
486GAGGAGCUCAUCCAGGACA84.8724359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
693504GAGGAGCTCATCCAGGACATGTCCTGGATGAGCTCCTC0.118400.002000.603400.500000.918500.75000


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907AUGAUAAGUUAACCCCAAA84.9518356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650925ATGATAAGTTAACCCCAAATTTGGGGTTAACTTATCAT0.129500.014500.655200.500000.962000.75000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775GGCAGAGAAGAACGAGCGU75.25121010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331793GGCAGAGAAGAACGAGCGTACGCTCGTTCTTCTCTGCC0.046200.024400.724100.750001.000001.00000