Input target sequence

Length: 1994
AAACTTCCCGCACGCGTTACAGGAGCCAGGTCGGTATAAGCGCCAGCGGCCTCGCCGCCCGTCAAGCTGTCCACATCCCTGGCCTCAGCCCGCCACATCACCCTGACCTGCTTACGCCCAGATTTTCTTCAATCACATCTGAATAAATCACTTGAAGAAAGCTTATAGCTTCATTGCACCATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGTGCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATACACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAGCCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAACCATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATAATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTGTTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATATGGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAAGCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTTCTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAAATGGTTAAATATCATCACTGTCGGGATGAACCCCTGCACGCCCTCTATGACAATGTGGAGAAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAATAATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGCTTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAGTATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGAAAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGCATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGTGCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTGATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCTCCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTTGATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTTCTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAGAATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAAGAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCCTGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAATGCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAAGTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAGTGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAAGCTTAGGTGGTCTTTATGCTGTAATGTGAAAGCAAATATTTCTTCGTGTTGGATGGGGACTGTGGGTAGATAGGGGAACAATGAGAGTCAACTCAGGCTAACTTGGGTGTGAAAAAAATAAAAGTCCTAAATCT