siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 1   3   10   11   13   14   19   20   21   51   52   53   54   55   56   58   59   82   83   87  
88   95   96   108   109   110   111   114   115   117   118   120   134   135   138   139   140   142   147   148  
161   167   168   206   207   209   210   211   214   232   233   234   235   241   256   258   277   281   282   283  
303   305   306   338   339   341   358   359   363   367   368   369   370   371   394   395   396   397   401   402  
406   408   420   431   433   435   437   461   462   463   464   490   491   492   501   502   509   510   517   523  
524   525   529   530   531   532   534   535   537   538   539   543   544   545   557   559   563   580   581   582  
583   585   586   587   589   590   591   595   596   599   600   601   603   604   610   614   615   623   625   626  
627   654   655   656   657   660   665   666   667   668   684   685   686   687   688   690   691   712   713   714  
715   716   720   723   724   725   726   729   731   733   734   754   755   760   761   762   768   769   770   771  
772   773   775   776   778   782   783   809   810   811   812   813   814   815   816   817   818   859   860   861  
863   864   879   880   881   882   883   884   885   886   887   890   891   892   893   897   902   903   906   911  
916   920   921   989   990   999   1000   1001   1005   1006   1008   1009   1010   1011   1023   1024   1025   1026   1027   1049  
1051   1088   1089   1090   1092   1094   1095   1098   1099   1106   1107   1109   1119   1120   1154   1155   1158   1160   1163   1164  
1168   1169   1171   1172   1183   1191   1192   1195   1199   1200   1201   1203   1204   1205   1206   1214   1215   1216   1217   1218  
1237   1268   1269   1270   1271   1272   1273   1282   1283   1284   1285   1292   1293   1294   1295   1296   1336   1342   1343   1344  
1345   1350   1351   1364   1365   1366   1368   1369   1370   1407   1416   1428   1429   1430   1431   1432   1434   1435   1436   1437  
1438   1440   1445   1446   1448   1449   1474   1475   1482   1497   1499   1500   1535   1536   1537   1542   1543   1544   1547   1548  
1582   1583   1584   1585   1586   1588   1589   1590   1592   1593   1595   1596   1599   1600   1609   1610   1613   1615   1616   1617  
1618   1619   1620   1622   1623   1624   1625   1635   1636   1637   1644   1655   1675   1677   1681   1682   1684   1685   1686   1688  
1694   1695   1696   1697   1700   1709   1710   1711   1712   1714   1716   1722   1723   1728   1731   1736   1737   1738   1739   1740  
1775   1810   1814   1825   1826   1829   1830   1831   1852   1855   1856   1857   1858   1859   1860   1861   1865   1866   1867   1868  
1870   1871   1873   1880   1882   1883   1885   1886   1887   1891   1892   1893   1910   1911   1913   1914   1915   1916   1920   1921  
1922   1923   1924   1925   1928   1932   1933   1934   1935   1962   1963   1964   1965   1966   1971   1972   1973   1974  
Biltr, Ernai, Rnaxs 432   602   689   774   1050  
Biltr, Ernai, Sidirect 127  
Biltr, Ernai, Rnaxs, Sidirect 407   1447   1496   1687  
Biltr, Sidirect 268   409   473   475   477   483   505   637   728   829   854   888   907   1153   1480   1481   1530   1629   1926   1957  
1958  
Biltr, Rnaxs, Sidirect 119   130   141   149   276   360   361   362   398   436   503   536   558   658   661   662   730   732   777   904  
905   1093   1100   1108   1170   1173   1174   1202   1207   1210   1211   1297   1298   1441   1450   1451   1495   1594   1597   1598  
1614   1676   1689   1701   1715   1869   1872   1878   1879   1881   1967  


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761GCAAAGUUGCAUCCGUGGA77.8036629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502779GCAAAGTTGCATCCGTGGATCCACGGATGCAACTTTGC0.015600.008100.482800.750000.978300.62500


Target Position: 409, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409GAAAUCUACAACCAUAAGA85.4382252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
407-429GTGAAATCTACAACCATAAGAAGUCUUAUGGUUGUAGAUUUCACGAAAUCUACAACCAUAAGAAGU17.46.902


Target Position: 637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637GGAUUUUUGGCUGUAUGUU79.9824514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
635-657ATGGATTTTTGGCTGTATGTTCAAACAUACAGCCAAAAAUCCAUGGAUUUUUGGCUGUAUGUUCAU20.40.412


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712AAACCAAAGAAGGAUAUUA87.3476187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021730AAACCAAAGAAGGATATTATAATATCCTTCTTTGGTTT0.036900.004000.465500.500000.962000.87500


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138UCUGAAUAAAUCACUUGAA82.4405385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352156TCTGAATAAATCACTTGAATTCAAGTGATTTATTCAGA0.098200.041400.551700.750000.983700.75000


Target Position: 558, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GGAUACUGCCAAUAAGAAA98.242116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442576GGATACTGCCAATAAGAAATTTCTTATTGGCAGTATCC0.140300.002600.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
556-578CTGGATACTGCCAATAAGAAAGTUUUCUUAUUGGCAGUAUCCAGGGAUACUGCCAAUAAGAAAGUU6.920.322


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770CAUCCGUGGAAAUGGUUAA87.8345178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501788CATCCGTGGAAATGGTTAATTAACCATTTCCACGGATG0.022500.001300.620700.750000.978300.87500


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168UCCUUGGAAACUUAUGACA71.6567983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061186TCCTTGGAAACTTATGACATGTCATAAGTTTCCAAGGA0.073000.021800.663800.500001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593UGAUGGAAUAACUUCAGUU82.6705374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101611TGATGGAATAACTTCAGTTAACTGAAGTTATTCCATCA0.090300.015300.577600.750001.000001.00000


Target Position: 1737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737UCAAGUCUUUGAACGCCAU72.7295919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831755TCAAGTCTTTGAACGCCATATGGCGTTCAAAGACTTGA0.116300.004600.569000.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282GAUGAACUUACGCAGGGUU80.8166467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691300GATGAACTTACGCAGGGTTAACCCTGCGTAAGTTCATC0.065600.007100.534500.750001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545CAUUUGUUUUACUGGAUAC78.4214592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488563CATTTGTTTTACTGGATACGTATCCAGTAAAACAAATG0.019500.019000.474100.500001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396CUGUUACAAUGGUGAAAUC75.9211738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475414CTGTTACAATGGTGAAATCGATTTCACCATTGTAACAG0.021600.005800.603400.500001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008AGCCCAAGUACAGUAUCCU73.2903890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081026AGCCCAAGTACAGTATCCTAGGATACTGTACTTGGGCT0.304900.259000.508600.500001.000001.00000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660AGCUAAAGGUCUUGUUACA89.3409135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494678AGCTAAAGGTCTTGTTACATGTAACAAGACCTTTAGCT0.191200.023400.646600.500001.000001.00000


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965GGGUGUGAAAAAAAUAAAA94.345242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821983GGGTGTGAAAAAAATAAAATTTTATTTTTTTCACACCC0.910000.021500.991401.000001.000001.00000


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209GUGAUGAUUGCCUUUCUGU77.453651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313227GTGATGATTGCCTTTCTGTACAGAAAGGCAATCATCAC0.080200.018400.586200.500001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232UGUCUGAGUGCUAUGAAGA81.6759420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512250TGTCTGAGTGCTATGAAGATCTTCATAGCACTCAGACA0.350800.001100.482800.500001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GGUGUGUUUGCAUUUGUUU82.5499378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411553GGTGTGTTTGCATTTGTTTAAACAAATGCAAACACACC0.293500.003500.853401.000001.000001.00000


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482AGAAAUGAGAAUUCCAAAG67.88611200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741500AGAAATGAGAATTCCAAAGCTTTGGAATTCTCATTTCT0.051200.005000.586200.500000.972800.62500


Target Position: 59, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
59CCGUCAAGCUGUCCACAUC76.638699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
22077CCGTCAAGCTGTCCACATCGATGTGGACAGCTTGACGG0.120200.022000.732800.750000.983700.62500


Target Position: 1932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1932AGGGGAACAAUGAGAGUCA85.127260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561950AGGGGAACAATGAGAGTCATGACTCTCATTGTTCCCCT0.134700.099800.620700.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685CACUCCGCGACUCCCUUUU66.12081276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200703CACTCCGCGACTCCCTTTTAAAAGGGAGTCGCGGAGTG0.616900.029700.793100.750001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644CGUUGAACAUCAGGUUGAU88.6595156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611662CGTTGAACATCAGGTTGATATCAACCTGATGTTCAACG0.026800.002100.594801.000001.000001.00000


Target Position: 82, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
82GCCUCAGCCCGCCACAUCA85.1498258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268100GCCTCAGCCCGCCACATCATGATGTGGCGGGCTGAGGC0.352900.011000.775900.750000.983700.75000


Target Position: 1499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499AGAAUGGGAUAGAAAAACA90.8055102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011517AGAATGGGATAGAAAAACATGTTTTTCTATCCCATTCT0.326300.004500.517200.500001.000001.00000


Target Position: 728, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728GACACUAUGAAGUUUUGGA89.4814131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
726-748TGGACACTATGAAGTTTTGGATTUCCAAAACUUCAUAGUGUCCAGACACUAUGAAGUUUUGGAUUU18.819.013


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120CUUUUUAACUCUGAGGAAG67.83871203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581138CTTTTTAACTCTGAGGAAGCTTCCTCAGAGTTAAAAAG0.065400.021200.500000.500001.000001.00000


Target Position: 341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341ACCCGCUGUUUGGAAUGCA70.84351035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517359ACCCGCTGTTTGGAATGCATGCATTCCAAACAGCGGGT0.011600.001700.500000.500000.978300.62500


Target Position: 600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600UGGAGUCAGACCUUUGUUU72.3155940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370618TGGAGTCAGACCTTTGTTTAAACAAAGGTCTGACTCCA0.053600.004900.844800.750000.978300.75000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776UGGAAAUGGUUAAAUAUCA84.1668312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444794TGGAAATGGTTAAATATCATGATATTTAACCATTTCCA0.140200.010700.620700.500001.000001.00000


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914UGGGGACUGUGGGUAGAUA83.4278343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021932TGGGGACTGTGGGTAGATATATCTACCCACAGTCCCCA0.066000.001300.801700.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GUCAAGUCUUUGAACGCCA83.1452350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141754GTCAAGTCTTTGAACGCCATGGCGTTCAAAGACTTGAC0.032100.004800.474100.500000.972800.62500


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966GGUGUGAAAAAAAUAAAAG76.4251712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1501984GGTGTGAAAAAAATAAAAGCTTTTATTTTTTTCACACC0.905700.228400.715500.750001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880AACCUCAGGAUCCUUUUUA76.411713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334898AACCTCAGGATCCTTTTTATAAAAAGGATCCTGAGGTT0.260400.053100.612100.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350UGAGAGGCUUCUGAGGGAA77.1762669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611368TGAGAGGCTTCTGAGGGAATTCCCTCAGAAGCCTCTCA0.024500.006200.551700.750001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911AGAAACGUUUGAUGACAGA82.0215404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450929AGAAACGTTTGATGACAGATCTGTCATCAAACGTTTCT0.026800.003500.500000.500001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517ACAAUUUGUAUGUUGGAUG65.10961343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412535ACAATTTGTATGTTGGATGCATCCAACATACAAATTGT0.084500.021500.551700.500001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920CUGUGGGUAGAUAGGGGAA83.8562322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2641938CTGTGGGTAGATAGGGGAATTCCCCTATCTACCCACAG0.131500.018100.612100.750001.000001.00000


Target Position: 1169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1169CCUUGGAAACUUAUGACAU85.9832233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881187CCTTGGAAACTTATGACATATGTCATAAGTTTCCAAGG0.082200.024000.689701.000001.000001.00000


Target Position: 1450, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450CGAUUUUCUUCCUAUUACU88.4239162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041468CGATTTTCTTCCTATTACTAGTAATAGGAAGAAAATCG0.297400.262100.586200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1448-1470ATCGATTTTCTTCCTATTACTTGAGUAAUAGGAAGAAAAUCGAUCGAUUUUCUUCCUAUUACUUGU6.310.422


Target Position: 1093, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CAUAUUGGAAGUGAACAUU79.4295545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431111CATATTGGAAGTGAACATTAATGTTCACTTCCAATATG0.141300.013700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1091-1113ATCATATTGGAAGTGAACATTATAAUGUUCACUUCCAAUAUGAUCAUAUUGGAAGUGAACAUUAUU20.512.602


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430GAGUCCCAUUUCUAGAUCA94.879333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461448GAGTCCCATTTCTAGATCATGATCTAGAAATGGGACTC0.120400.018200.586200.500000.989101.00000


Target Position: 730, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730CACUAUGAAGUUUUGGAUU81.339438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503748CACTATGAAGTTTTGGATTAATCCAAAACTTCATAGTG0.015500.003600.784500.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
728-750GACACTATGAAGTTTTGGATTTAAAUCCAAAACUUCAUAGUGUCCACUAUGAAGUUUUGGAUUUAU20.120.313


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600AUAACUUCAGUUAAGAAUU74.0172852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921618ATAACTTCAGTTAAGAATTAATTCTTAACTGAAGTTAT0.016900.002800.534500.500000.983700.75000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913AUGGGGACUGUGGGUAGAU68.05961190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041931ATGGGGACTGTGGGTAGATATCTACCCACAGTCCCCAT0.071600.001200.474100.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903UGCUGUAAAGAAACGUUUG63.91061403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481921TGCTGTAAAGAAACGTTTGCAAACGTTTCTTTACAGCA0.052400.004700.706900.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211GUAUGUAUUUAAUUUCCAA101.2366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781229GTATGTATTTAATTTCCAATTGGAAATTAAATACATAC0.258900.005300.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1209-1231AGGTATGTATTTAATTTCCAAGTUUGGAAAUUAAAUACAUACCUGUAUGUAUUUAAUUUCCAAGUU20.18.212


Target Position: 58, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
58CCCGUCAAGCUGUCCACAU75.0513797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28076CCCGTCAAGCTGTCCACATATGTGGACAGCTTGACGGG0.088300.019500.836201.000000.983700.62500


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306CUGCUGCUUUGGAUUUCAC70.10821078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471324CTGCTGCTTTGGATTTCACGTGAAATCCAAAGCAGCAG0.037800.011000.491400.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921UGUGGGUAGAUAGGGGAAC51.00061838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051939TGTGGGTAGATAGGGGAACGTTCCCCTATCTACCCACA0.176000.040900.560300.500001.000001.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298GUUACAUAUAUUUUCACAA93.135154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551316GTTACATATATTTTCACAATTGTGAAAATATATGTAAC0.449200.243400.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1296-1318GGGTTACATATATTTTCACAAGGUUGUGAAAAUAUAUGUAACCCGUUACAUAUAUUUUCACAAGGU20.58.502


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599AUGGAGUCAGACCUUUGUU71.8152970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465617ATGGAGTCAGACCTTTGTTAACAAAGGTCTGACTCCAT0.059500.002000.508600.500000.978300.75000


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531GGAUGGUGUGUUUGCAUUU87.2714190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406549GGATGGTGTGTTTGCATTTAAATGCAAACACACCATCC0.037000.005200.870701.000001.000001.00000


Target Position: 1926, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926GUAGAUAGGGGAACAAUGA87.1206196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1924-1946GGGTAGATAGGGGAACAATGAGAUCAUUGUUCCCCUAUCUACCCGUAGAUAGGGGAACAAUGAGAU12.113.003


Target Position: 14, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14GCGUUACAGGAGCCAGGUC67.71271210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44532GCGTTACAGGAGCCAGGTCGACCTGGCTCCTGTAACGC0.027600.005700.603400.750001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882UAAUGUGAAAGCAAAUAUU79.1291563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881900TAATGTGAAAGCAAATATTAATATTTGCTTTCACATTA0.128700.037800.525900.500001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592GUGAUGGAAUAACUUCAGU77.9062621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201610GTGATGGAATAACTTCAGTACTGAAGTTATTCCATCAC0.084800.011000.586200.500001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905CUGUAAAGAAACGUUUGAU80.7412476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391923CTGTAAAGAAACGTTTGATATCAAACGTTTCTTTACAG0.043200.010100.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
903-925TGCTGTAAAGAAACGTTTGATGAAUCAAACGUUUCUUUACAGCACUGUAAAGAAACGUUUGAUGAU21.111.823


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720UCUUCCUGGACACUAUGAA76.5628705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368738TCTTCCTGGACACTATGAATTCATAGTGTCCAGGAAGA0.528400.005000.551700.750001.000001.00000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192ACAGUUCGUGCUUCAGUAG67.98651194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961210ACAGTTCGTGCTTCAGTAGCTACTGAAGCACGAACTGT0.050400.004200.534500.500001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972AAAAAAAUAAAAGUCCUAA83.3301348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031990AAAAAAATAAAAGTCCTAATTAGGACTTTTATTTTTTT0.938600.859100.465500.500001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GUCAAAGCUUAGGUGGUCU74.344832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691873GTCAAAGCTTAGGTGGTCTAGACCACCTAAGCTTTGAC0.111500.017400.594800.500001.000001.00000


Target Position: 96, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
96CAUCACCCUGACCUGCUUA86.1223226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
252114CATCACCCTGACCTGCTTATAAGCAGGTCAGGGTGATG0.158600.079600.620700.750000.983700.62500


Target Position: 147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
147AUCACUUGAAGAAAGCUUA80.0315511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449165ATCACTTGAAGAAAGCTTATAAGCTTTCTTCAAGTGAT0.026800.002500.646600.500001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675GCAAAUGCAGCCCAGAAAU78.1311610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621693GCAAATGCAGCCCAGAAATATTTCTGGGCTGCATTTGC0.167000.040100.844801.000001.000001.00000


Target Position: 1292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292CGCAGGGUUACAUAUAUUU82.8184367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631310CGCAGGGTTACATATATTTAAATATATGTAACCCTGCG0.444500.091500.922401.000001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GAGCCUUUUCUUCCUGGAC67.73181209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474730GAGCCTTTTCTTCCTGGACGTCCAGGAAGAAAAGGCTC0.041900.017500.491400.500001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000CUGAAAGAAGCCCAAGUAC67.47911218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361018CTGAAAGAAGCCCAAGTACGTACTTGGGCTTCTTTCAG0.569900.100600.603400.500001.000001.00000


Target Position: 95, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
95ACAUCACCCUGACCUGCUU76.9669680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323113ACATCACCCTGACCTGCTTAAGCAGGTCAGGGTGATGT0.142600.081800.569000.750000.972800.62500


Target Position: 916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916CGUUUGAUGACAGACAGAA91.059695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478934CGTTTGATGACAGACAGAATTCTGTCTGTCATCAAACG0.053400.001800.603401.000001.000001.00000


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731CUACCGUCAAGUCUUUGAA85.8934238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581749CTACCGTCAAGTCTTTGAATTCAAAGACTTGACGGTAG0.041300.022000.500000.750000.972800.62500


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814CUGCACGCCCUCUAUGACA79.8584518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428832CTGCACGCCCTCTATGACATGTCATAGAGGGCGTGCAG0.135900.015700.577600.500000.918500.62500


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715CCUUUUCUUCCUGGACACU69.78021090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409733CCTTTTCTTCCTGGACACTAGTGTCCAGGAAGAAAAGG0.036500.016800.637900.750001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810GCCACUGACCCUUCUGCCC57.17591670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131828GCCACTGACCCTTCTGCCCGGGCAGAAGGGTCAGTGGC0.392700.155300.508600.500000.923900.62500


Target Position: 53, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
53CGCCGCCCGUCAAGCUGUC59.08841612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42271CGCCGCCCGTCAAGCTGTCGACAGCTTGACGGGCGGCG0.033300.004500.603400.750000.918501.00000


Target Position: 1174, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174GAAACUUAUGACAUUACAA101.1617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971192GAAACTTATGACATTACAATTGTAATGTCATAAGTTTC0.148200.041100.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1172-1194TGGAAACTTATGACATTACAACAUUGUAAUGUCAUAAGUUUCCAGAAACUUAUGACAUUACAACAU13.54.923


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117CCCAGAUUUUCUUCAAUCA89.0951142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284135CCCAGATTTTCTTCAATCATGATTGAAGAAAATCTGGG0.129400.012000.767200.750000.907600.62500


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303CAACUGCUGCUUUGGAUUU78.0852611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422321CAACTGCTGCTTTGGATTTAAATCCAAAGCAGCAGTTG0.089400.003200.646600.750001.000001.00000


Target Position: 602, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602GAGUCAGACCUUUGUUUAA99.039813

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_360219GAGTCAGACCTTTGTTTAA1/1/0/097.75ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA7:97493618..97493636(-)|Y:13300101..13300119(+)|21:9897828..9897846(+)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297620GAGTCAGACCTTTGTTTAATTAAACAAAGGTCTGACTC0.078000.027200.775900.750001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685CCCAGAAAUUUCCCUUCAA87.7747180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1451703CCCAGAAATTTCCCTTCAATTGAAGGGAAATTTCTGGG0.186600.185100.844801.000000.978300.75000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677AAAUGCAGCCCAGAAAUUU72.1446953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311695AAATGCAGCCCAGAAATTTAAATTTCTGGGCTGCATTT0.568800.058300.500000.500001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CCGUGGAAAUGGUUAAAUA97.400223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441791CCGTGGAAATGGTTAAATATATTTAACCATTTCCACGG0.047500.002700.870701.000001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620CUGGUUUAAGAUUUUACAG70.1451077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711638CTGGTTTAAGATTTTACAGCTGTAAAATCTTAAACCAG0.097300.011900.500000.500001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923UGGGUAGAUAGGGGAACAA76.2455721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201941TGGGTAGATAGGGGAACAATTGTTCCCCTATCTACCCA0.583000.085400.698300.750001.000001.00000


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697CCUUCAAUACUCCUAAAAC78.1612607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1181715CCTTCAATACTCCTAAAACGTTTTAGGAGTATTGAAGG0.863100.135000.698300.750001.000001.00000


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109UGCUUACGCCCAGAUUUUC56.39791696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509127TGCTTACGCCCAGATTTTCGAAAATCTGGGCGTAAGCA0.037300.023700.681000.500000.918500.75000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580UUCCUGGGUAGAGAUACAU63.64561413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399598TTCCTGGGTAGAGATACATATGTATCTCTACCCAGGAA0.152900.005000.517200.500001.000001.00000


Target Position: 1170, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1170CUUGGAAACUUAUGACAUU86.8139204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741188CTTGGAAACTTATGACATTAATGTCATAAGTTTCCAAG0.089800.026800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1168-1190TCCTTGGAAACTTATGACATTACAAUGUCAUAAGUUUCCAAGGACUUGGAAACUUAUGACAUUACU20.520.122


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394CUCUGUUACAAUGGUGAAA81.5769428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509412CTCTGTTACAATGGTGAAATTTCACCATTGTAACAGAG0.014200.007100.810300.750001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420CCAUAAGAAGAUGCAACAG72.9167908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507438CCATAAGAAGATGCAACAGCTGTTGCATCTTCTTATGG0.014300.001500.560300.750001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724CCUGGACACUAUGAAGUUU83.8305324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433742CCTGGACACTATGAAGTTTAAACTTCATAGTGTCCAGG0.030900.004600.844801.000000.989100.75000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686CCAGAAAUUUCCCUUCAAU86.3689219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1431704CCAGAAATTTCCCTTCAATATTGAAGGGAAATTTCTGG0.190700.188400.836201.000000.978300.75000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731ACUAUGAAGUUUUGGAUUU74.4332827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498749ACTATGAAGTTTTGGATTTAAATCCAAAACTTCATAGT0.016000.005800.706900.750001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272AGAAGGAUCAGAUGAACUU82.4038387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811290AGAAGGATCAGATGAACTTAAGTTCATCTGATCCTTCT0.054100.001700.586200.750001.000001.00000


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547AUCUGAUACCCAAAGAGAU80.7675472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761565ATCTGATACCCAAAGAGATATCTCTTTGGGTATCAGAT0.021400.009900.500000.500000.994600.62500


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665AAGGUCUUGUUACAUUGAA82.4604381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506683AAGGTCTTGTTACATTGAATTCAATGTAACAAGACCTT0.337700.021000.465500.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GAGGAAUUGAGCAAACAAU89.1827140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504521GAGGAATTGAGCAAACAATATTGTTTGCTCAATTCCTC0.015300.004700.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
501-523AGGAGGAATTGAGCAAACAATTTAUUGUUUGCUCAAUUCCUCCUGAGGAAUUGAGCAAACAAUUUU12.218.703


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GGGUUACAUAUAUUUUCAC78.6791581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221314GGGTTACATATATTTTCACGTGAAAATATATGTAACCC0.476700.158300.698300.750001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922GUGGGUAGAUAGGGGAACA84.9041271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431940GTGGGTAGATAGGGGAACATGTTCCCCTATCTACCCAC0.180100.044000.586200.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GGAAGACAGCCCCGAUUUA92.028884

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10105019GGAAGACAGCCCCGATTTA1/1/0/094.96ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA7:97487605..97487623(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511068GGAAGACAGCCCCGATTTATAAATCGGGGCTGTCTTCC0.407400.012400.836201.000000.994600.62500


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637AGGAAUACGUUGAACAUCA89.3124137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181655AGGAATACGTTGAACATCATGATGTTCAACGTATTCCT0.057500.003300.620700.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590CAGUGAUGGAAUAACUUCA95.007531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761608CAGTGATGGAATAACTTCATGAAGTTATTCCATCACTG0.072500.007700.560300.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534UGGUGUGUUUGCAUUUGUU80.1857502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404552TGGTGTGTTTGCATTTGTTAACAAATGCAAACACACCA0.111100.003900.698300.750001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210GGUAUGUAUUUAAUUUCCA93.191153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201228GGTATGTATTTAATTTCCATGGAAATTAAATACATACC0.290400.004200.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1208-1230TAGGTATGTATTTAATTTCCAAGUGGAAAUUAAAUACAUACCUAGGUAUGUAUUUAAUUUCCAAGU14.215.812


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694UUCCCUUCAAUACUCCUAA72.1382955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691712TTCCCTTCAATACTCCTAATTAGGAGTATTGAAGGGAA0.881000.121400.637900.500001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524GUAUGUUGGAUGGUGUGUU79.0136568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382542GTATGTTGGATGGTGTGTTAACACACCATCCAACATAC0.146700.042100.534500.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CUGGGUAGAGAUACAUAUG77.59644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415601CTGGGTAGAGATACATATGCATATGTATCTCTACCCAG0.249700.016600.629300.500001.000001.00000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19ACAGGAGCCAGGUCGGUAU75.1324790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51037ACAGGAGCCAGGTCGGTATATACCGACCTGGCTCCTGT0.014000.002700.663800.750000.989100.87500


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342GAGGAGAGUGAGAGGCUUC76.3113718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161360GAGGAGAGTGAGAGGCTTCGAAGCCTCTCACTCTCCTC0.097700.001000.637900.500001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001UGAAAGAAGCCCAAGUACA80.7995470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981019TGAAAGAAGCCCAAGTACATGTACTTGGGCTTCTTTCA0.580300.125300.517200.500001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614UGUUUAAAGCAAUGACAGA82.7256372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480632TGTTTAAAGCAATGACAGATCTGTCATTGCTTTAAACA0.144300.040000.482800.500001.000001.00000


Target Position: 505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GGAAUUGAGCAAACAAUUU84.5263296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
503-525GAGGAATTGAGCAAACAATTTGTAAAUUGUUUGCUCAAUUCCUCGGAAUUGAGCAAACAAUUUGUU5.316.303


Target Position: 1869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869GGUCUUUAUGCUGUAAUGU78.0848612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141887GGTCTTTATGCTGTAATGTACATTACAGCATAAAGACC0.034700.005600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1867-1889GTGGTCTTTATGCTGTAATGTGAACAUUACAGCAUAAAGACCACGGUCUUUAUGCUGUAAUGUGAU13.514.622


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139CUGAAUAAAUCACUUGAAG73.4717884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489157CTGAATAAATCACTTGAAGCTTCAAGTGATTTATTCAG0.077100.034500.646600.500000.983700.62500


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GGAAGUGAACAUUAUGAAG83.622335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171117GGAAGTGAACATTATGAAGCTTCATAATGTTCACTTCC0.121100.028500.732800.750001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682CAGCCCAGAAAUUUCCCUU74.4349826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971700CAGCCCAGAAATTTCCCTTAAGGGAAATTTCTGGGCTG0.232300.020900.646600.750001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CAAAGUUGCAUCCGUGGAA86.2034222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497780CAAAGTTGCATCCGTGGAATTCCACGGATGCAACTTTG0.016100.007700.474100.750001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100GAAGUGAACAUUAUGAAGU81.3077441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981118GAAGTGAACATTATGAAGTACTTCATAATGTTCACTTC0.076400.020900.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1098-1120TGGAAGTGAACATTATGAAGTCCACUUCAUAAUGUUCACUUCCAGAAGUGAACAUUAUGAAGUCCU13.419.213


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595AUGGAAUAACUUCAGUUAA84.0033317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931613ATGGAATAACTTCAGTTAATTAACTGAAGTTATTCCAT0.111700.025000.620700.500000.994600.62500


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158AGUCAUAUUUUCCUUGGAA90.6845106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501176AGTCATATTTTCCTTGGAATTCCAAGGAAAATATGACT0.071500.002500.534500.750000.983700.62500


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893CAAAUAUUUCUUCGUGUUG70.15581076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901911CAAATATTTCTTCGTGTTGCAACACGAAGAAATATTTG0.017100.012600.500000.500001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615AAUUCCUGGUUUAAGAUUU75.1221792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581633AATTCCTGGTTTAAGATTTAAATCTTAAACCAGGAATT0.852300.002300.508600.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CCCUGCACGCCCUCUAUGA77.7466632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226830CCCTGCACGCCCTCTATGATCATAGAGGGCGTGCAGGG0.196900.022800.767200.750001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UCCGUGGAAAUGGUUAAAU60.10111574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480790TCCGTGGAAATGGTTAAATATTTAACCATTTCCACGGA0.029600.001700.862100.750000.978300.75000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345GAGAGUGAGAGGCUUCUGA89.0719143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091363GAGAGTGAGAGGCTTCTGATCAGAAGCCTCTCACTCTC0.078500.010700.586200.500001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775GGCUGAGCCAUUACUGGAU83.7722326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991793GGCTGAGCCATTACTGGATATCCAGTAATGGCTCAGCC0.018700.001400.819001.000000.918500.75000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201GCUUCAGUAGGUAUGUAUU89.8171120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121219GCTTCAGTAGGTATGTATTAATACATACCTACTGAAGC0.035200.005800.844801.000001.000001.00000


Target Position: 774, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774CGUGGAAAUGGUUAAAUAU92.363871

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_577419CGTGGAAATGGTTAAATAT1/1/0/097.75ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA7:97488586..97488604(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428792CGTGGAAATGGTTAAATATATATTTAACCATTTCCACG0.124500.002900.732801.000001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GCAGCCCAGAAAUUUCCCU67.95651196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131699GCAGCCCAGAAATTTCCCTAGGGAAATTTCTGGGCTGC0.251600.018900.508600.750001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025CUCUCCAGACAUUUGCAAU81.1985448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791043CTCTCCAGACATTTGCAATATTGCAAATGTCTGGAGAG0.653900.031400.801700.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108CAUUAUGAAGUCCUUUUUA92.772862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3601126CATTATGAAGTCCTTTTTATAAAAAGGACTTCATAATG0.053100.007300.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1106-1128AACATTATGAAGTCCTTTTTAACUAAAAAGGACUUCAUAAUGUUCAUUAUGAAGUCCUUUUUAACU9.58.722


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258CAGAGGUCCAGAUGCAUUC70.62341047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496276CAGAGGTCCAGATGCATTCGAATGCATCTGGACCTCTG0.057700.003100.612100.500001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027CUCCAGACAUUUGCAAUUG64.98441352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941045CTCCAGACATTTGCAATTGCAATTGCAAATGTCTGGAG0.016700.002900.663800.500001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868UGGUCUUUAUGCUGUAAUG72.3159939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071886TGGTCTTTATGCTGTAATGCATTACAGCATAAAGACCA0.022300.004800.689700.500001.000001.00000


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369AGUGAAGAAAUAUCCGUAU80.869465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166387AGTGAAGAAATATCCGTATATACGGATATTTCTTCACT0.181200.060900.663800.750000.989101.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656CAGAAGCUAAAGGUCUUGU72.2511945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484674CAGAAGCTAAAGGTCTTGTACAAGACCTTTAGCTTCTG0.057600.008600.577600.500001.000001.00000


Target Position: 358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358CAGCCAAUUCGAGUGAAGA86.1999223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514376CAGCCAATTCGAGTGAAGATCTTCACTCGAATTGGCTG0.074900.001000.560300.500001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491UUUAUGACAAAGGAGGAAU62.1441479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467509TTTATGACAAAGGAGGAATATTCCTCCTTTGTCATAAA0.051000.010200.491400.500001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501AGGAGGAAUUGAGCAAACA82.9933356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476519AGGAGGAATTGAGCAAACATGTTTGCTCAATTCCTCCT0.037900.001800.637900.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GUGUUUGCAUUUGUUUUAC65.60221306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345556GTGTTTGCATTTGTTTTACGTAAAACAAATGCAAACAC0.258900.010700.612100.500001.000001.00000


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3ACUUCCCGCACGCGUUACA68.85771140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42721ACTTCCCGCACGCGTTACATGTAACGCGTGCGGGAAGT0.130700.015700.500000.500001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437AGCAUUUUGAAUUUGAAUA80.9487462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463455AGCATTTTGAATTTGAATATATTCAAATTCAAAATGCT0.156100.002100.810300.750001.000001.00000


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431AGUCCCAUUUCUAGAUCAU82.0503402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551449AGTCCCATTTCTAGATCATATGATCTAGAAATGGGACT0.129100.023900.551700.750000.989101.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817CACGCCCUCUAUGACAAUG67.12181235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438835CACGCCCTCTATGACAATGCATTGTCATAGAGGGCGTG0.085900.041900.637900.500000.918500.87500


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920UGAUGACAGACAGAAGGAU77.6708639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394938TGATGACAGACAGAAGGATATCCTTCTGTCTGTCATCA0.169100.004400.543100.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860AGCUUAGGUGGUCUUUAUG69.34491108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741878AGCTTAGGTGGTCTTTATGCATAAAGACCACCTAAGCT0.021700.008400.698300.500001.000001.00000


Target Position: 148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
148UCACUUGAAGAAAGCUUAU72.355934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451166TCACTTGAAGAAAGCTTATATAAGCTTTCTTCAAGTGA0.032900.002500.681000.750001.000001.00000


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582GAAGCCUUCAGUGAUGGAA84.2802306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931600GAAGCCTTCAGTGATGGAATTCCATCACTGAAGGCTTC0.028800.001500.500000.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284UGAACUUACGCAGGGUUAC55.81491719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051302TGAACTTACGCAGGGTTACGTAACCCTGCGTAAGTTCA0.089800.013900.543100.500000.994600.62500


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408UGAAAUCUACAACCAUAAG68.04271192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497426TGAAATCTACAACCATAAGCTTATGGTTGTAGATTTCA0.105900.047600.586200.500001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214GAUUGCCUUUCUGUUCAGU75.4988769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489232GATTGCCTTTCTGTTCAGTACTGAACAGAAAGGCAATC0.091000.011500.474100.500001.000001.00000


Target Position: 1173, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173GGAAACUUAUGACAUUACA92.358172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021191GGAAACTTATGACATTACATGTAATGTCATAAGTTTCC0.129800.035900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1171-1193TTGGAAACTTATGACATTACAACUGUAAUGUCAUAAGUUUCCAAGGAAACUUAUGACAUUACAACU14.613.322


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684GCACUCCGCGACUCCCUUU75.0021804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
132702GCACTCCGCGACTCCCTTTAAAGGGAGTCGCGGAGTGC0.593400.033300.853401.000001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676CAAAUGCAGCCCAGAAAUU79.3256552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2261694CAAATGCAGCCCAGAAATTAATTTCTGGGCTGCATTTG0.577600.050000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1674-1696GGCAAATGCAGCCCAGAAATTTCAAUUUCUGGGCUGCAUUUGCCCAAAUGCAGCCCAGAAAUUUCU12.020.002


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CAUAUGGAGUCAGACCUUU81.6421421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420614CATATGGAGTCAGACCTTTAAAGGTCTGACTCCATATG0.068800.003300.655200.750000.978300.87500


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684GCCCAGAAAUUUCCCUUCA80.3746487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801702GCCCAGAAATTTCCCTTCATGAAGGGAAATTTCTGGGC0.198600.192100.775900.750000.978300.62500


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609GUUAAGAAUUCCUGGUUUA90.8852100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901627GTTAAGAATTCCTGGTTTATAAACCAGGAATTCTTAAC0.030100.001500.612100.750001.000001.00000


Target Position: 463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463AAAGUGGAUGGUGAGAUAA83.7149330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507481AAAGTGGATGGTGAGATAATTATCTCACCATCCACTTT0.114500.011800.465500.500001.000001.00000


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135ACAUCUGAAUAAAUCACUU85.2546256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327153ACATCTGAATAAATCACTTAAGTGATTTATTCAGATGT0.124000.036200.569000.750000.983700.87500


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351GAGAGGCUUCUGAGGGAAC71.5403990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141369GAGAGGCTTCTGAGGGAACGTTCCCTCAGAAGCCTCTC0.012500.004000.663800.500001.000001.00000


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269UGGAGAAGGAUCAGAUGAA87.8721176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571287TGGAGAAGGATCAGATGAATTCATCTGATCCTTCTCCA0.048800.002300.672400.750001.000001.00000


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83CCUCAGCCCGCCACAUCAC64.62351373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358101CCTCAGCCCGCCACATCACGTGATGTGGCGGGCTGAGG0.410500.017500.551700.750001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890UCCUUUUUAAUAAUGCUGU59.91961577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384908TCCTTTTTAATAATGCTGTACAGCATTATTAAAAAGGA0.227900.088300.663800.500001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160UCAUAUUUUCCUUGGAAAC59.61761589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501178TCATATTTTCCTTGGAAACGTTTCCAAGGAAAATATGA0.049100.011100.577600.500000.934800.62500


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723GGAUAUUACUACCGUCAAG85.0838266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2561741GGATATTACTACCGTCAAGCTTGACGGTAGTAATATCC0.099600.075500.732800.750000.951100.62500


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734AUGAAGUUUUGGAUUUAAA84.9435268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498752ATGAAGTTTTGGATTTAAATTTAAATCCAAAACTTCAT0.026300.011400.655200.500001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164AUUUUCCUUGGAAACUUAU68.57671161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151182ATTTTCCTTGGAAACTTATATAAGTTTCCAAGGAAAAT0.053800.017100.465500.500000.934800.75000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728UUACUACCGUCAAGUCUUU71.02761022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961746TTACTACCGTCAAGTCTTTAAAGACTTGACGGTAGTAA0.053300.032300.534500.500001.000001.00000


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120AGAUUUUCUUCAAUCACAU86.1846225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345138AGATTTTCTTCAATCACATATGTGATTGAAGAAAATCT0.056300.027200.569000.750000.907600.62500


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616AUUCCUGGUUUAAGAUUUU73.4959883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711634ATTCCTGGTTTAAGATTTTAAAATCTTAAACCAGGAAT0.849400.001900.508600.500001.000001.00000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595ACAUAUGGAGUCAGACCUU80.2072500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365613ACATATGGAGTCAGACCTTAAGGTCTGACTCCATATGT0.074200.005100.569000.750000.978300.75000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596UGGAAUAACUUCAGUUAAG70.4331059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861614TGGAATAACTTCAGTTAAGCTTAACTGAAGTTATTCCA0.114400.030400.706900.500000.994600.75000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204UCAGUAGGUAUGUAUUUAA88.4693159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531222TCAGTAGGTATGTATTTAATTAAATACATACCTACTGA0.108300.012100.689700.750001.000001.00000


Target Position: 407, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GUGAAAUCUACAACCAUAA90.7212104

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_940719GTGAAATCTACAACCATAA1/1/0/094.96ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA21:9892204..9892222(+)|7:97498224..97498242(-)|8:47525903..47525921(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251425GTGAAATCTACAACCATAATTATGGTTGTAGATTTCAC0.101600.037700.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
405-427TGGTGAAATCTACAACCATAAGAUUAUGGUUGUAGAUUUCACCAGUGAAAUCUACAACCAUAAGAU20.016.302


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283GAGAAUGUCAAUGGAUACA85.759240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510301GAGAATGTCAATGGATACATGTATCCATTGACATTCTC0.127300.014600.603400.500001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CUGCCAAUAAGAAAGUGUU80.1926501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508581CTGCCAATAAGAAAGTGTTAACACTTTCTTATTGGCAG0.014300.001900.637900.750001.000001.00000


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445AUCAUCGAUUUUCUUCCUA74.1288847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241463ATCATCGATTTTCTTCCTATAGGAAGAAAATCGATGAT0.700400.129300.508600.500001.000001.00000


Target Position: 142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
142AAUAAAUCACUUGAAGAAA84.2284311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491160AATAAATCACTTGAAGAAATTTCTTCAAGTGATTTATT0.020500.009700.508600.500001.000001.00000


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964UGGGUGUGAAAAAAAUAAA80.2305497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381982TGGGTGTGAAAAAAATAAATTTATTTTTTTCACACCCA0.917000.002700.844800.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617UUCCUGGUUUAAGAUUUUA71.23551013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731635TTCCTGGTTTAAGATTTTATAAAATCTTAAACCAGGAA0.832300.004800.637900.500001.000001.00000


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613AGAAUUCCUGGUUUAAGAU80.4945484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551631AGAATTCCTGGTTTAAGATATCTTAAACCAGGAATTCT0.841100.002300.543100.750001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011CCAAGUACAGUAUCCUCUC72.9766903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841029CCAAGTACAGTATCCTCTCGAGAGGATACTGTACTTGG0.190800.133200.534500.750000.983700.75000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581UCCUGGGUAGAGAUACAUA86.757206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246599TCCTGGGTAGAGATACATATATGTATCTCTACCCAGGA0.259900.012800.827600.750001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688UCCGCGACUCCCUUUUUAA76.1546730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
237706TCCGCGACTCCCTTTTTAATTAAAAAGGGAGTCGCGGA0.596400.020400.836200.750001.000001.00000


Target Position: 1825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1825GCCCGCACGCUGACCCACU68.78181148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581843GCCCGCACGCTGACCCACTAGTGGGTCAGCGTGCGGGC0.025300.010100.793100.750000.967400.75000


Target Position: 1544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544CCAAUCUGAUACCCAAAGA82.5153380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931562CCAATCTGATACCCAAAGATCTTTGGGTATCAGATTGG0.042500.032300.620700.750000.994600.75000


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688AGAAAUUUCCCUUCAAUAC69.12611123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611706AGAAATTTCCCTTCAATACGTATTGAAGGGAAATTTCT0.206900.175100.543100.500000.978300.62500


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365GGAACUCUAUUUGUUUGAU86.9793198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811383GGAACTCTATTTGTTTGATATCAAACAAATAGAGTTCC0.136300.004600.689701.000001.000001.00000


Target Position: 1614, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614GAAUUCCUGGUUUAAGAUU79.7658523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401632GAATTCCTGGTTTAAGATTAATCTTAAACCAGGAATTC0.853200.002700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1612-1634AAGAATTCCTGGTTTAAGATTTTAAUCUUAAACCAGGAAUUCUUGAAUUCCUGGUUUAAGAUUUUU6.918.702


Target Position: 13, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
13CGCGUUACAGGAGCCAGGU66.0831277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41831CGCGTTACAGGAGCCAGGTACCTGGCTCCTGTAACGCG0.033800.004900.569000.750001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726UGGACACUAUGAAGUUUUG69.55011096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489744TGGACACTATGAAGTTTTGCAAAACTTCATAGTGTCCA0.022500.001500.698300.500000.989101.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591AGAUACAUAUGGAGUCAGA91.284893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444609AGATACATATGGAGTCAGATCTGACTCCATATGTATCT0.027800.018500.500000.500001.000001.00000


Target Position: 1497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497AAAGAAUGGGAUAGAAAAA88.1023169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321515AAAGAATGGGATAGAAAAATTTTTCTATCCCATTCTTT0.070200.003900.500000.500001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130CAAUCACAUCUGAAUAAAU97.028126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216148CAATCACATCTGAATAAATATTTATTCAGATGTGATTG0.281900.247300.637900.750000.983700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
128-150TTCAATCACATCTGAATAAATCAAUUUAUUCAGAUGUGAUUGAACAAUCACAUCUGAAUAAAUCAU2.120.522


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691GCGACUCCCUUUUUAAAAG71.7496977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329709GCGACTCCCTTTTTAAAAGCTTTTAAAAAGGGAGTCGC0.060600.014800.784500.750001.000001.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217AUUUAAUUUCCAAGUAUAU79.6358534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131235ATTTAATTTCCAAGTATATATATACTTGGAAATTAAAT0.372700.149700.465500.500001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870GUCUUUAUGCUGUAAUGUG76.7917690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431888GTCTTTATGCTGTAATGTGCACATTACAGCATAAAGAC0.591700.008500.525900.500001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872CUUUAUGCUGUAAUGUGAA88.9984147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091890CTTTATGCTGTAATGTGAATTCACATTACAGCATAAAG0.598600.007400.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1870-1892GTCTTTATGCTGTAATGTGAAAGUUCACAUUACAGCAUAAAGACCUUUAUGCUGUAAUGUGAAAGU20.515.312


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1AAACUUCCCGCACGCGUUA72.6315922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51119AAACTTCCCGCACGCGTTATAACGCGTGCGGGAAGTTT0.088400.013800.465500.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711AAAACCAAAGAAGGAUAUU68.83511142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701729AAAACCAAAGAAGGATATTAATATCCTTCTTTGGTTTT0.033000.003800.491400.500000.962001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GCAGUGAUGAUUGCCUUUC62.56431461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358224GCAGTGATGATTGCCTTTCGAAAGGCAATCATCACTGC0.061800.005400.681000.750000.972800.62500


Target Position: 1911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1911GGAUGGGGACUGUGGGUAG77.1998666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131929GGATGGGGACTGTGGGTAGCTACCCACAGTCCCCATCC0.046100.001100.698300.750001.000001.00000


Target Position: 277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277CGUUUUGAGAAUGUCAAUG68.49051171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486295CGTTTTGAGAATGTCAATGCATTGACATTCTCAAAACG0.018000.002900.620700.750000.989100.75000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921GAUGACAGACAGAAGGAUU88.7426152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378939GATGACAGACAGAAGGATTAATCCTTCTGTCTGTCATC0.169800.004700.672400.750001.000001.00000


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543UGCAUUUGUUUUACUGGAU72.1496952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402561TGCATTTGTTTTACTGGATATCCAGTAAAACAAATGCA0.037800.032200.672400.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584AGCCUUCAGUGAUGGAAUA86.6311213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531602AGCCTTCAGTGATGGAATATATTCCATCACTGAAGGCT0.031800.002400.810300.750001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109AUUAUGAAGUCCUUUUUAA86.9492199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861127ATTATGAAGTCCTTTTTAATTAAAAAGGACTTCATAAT0.051500.005600.474100.500001.000001.00000


Target Position: 1214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214UGUAUUUAAUUUCCAAGUA81.8982410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951232TGTATTTAATTTCCAAGTATACTTGGAAATTAAATACA0.220900.093900.525900.750001.000001.00000


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440UCUAGAUCAUCGAUUUUCU77.6773637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421458TCTAGATCATCGATTTTCTAGAAAATCGATGATCTAGA0.348100.060000.500000.500001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GUUCGUGCUUCAGUAGGUA88.1838166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111213GTTCGTGCTTCAGTAGGTATACCTACTGAAGCACGAAC0.017700.001100.465500.750001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237CGGAAGAACACAGAUAGCG64.97481354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631255CGGAAGAACACAGATAGCGCGCTATCTGTGTTCTTCCG0.318700.005200.491400.500000.951100.62500


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916GGGACUGUGGGUAGAUAGG67.08771236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191934GGGACTGTGGGTAGATAGGCCTATCTACCCACAGTCCC0.093600.003300.646600.500001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548UCUGAUACCCAAAGAGAUU72.479928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931566TCTGATACCCAAAGAGATTAATCTCTTTGGGTATCAGA0.016700.007600.715500.750001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814CUGACCCUUCUGCCCGCAC53.8621778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021832CTGACCCTTCTGCCCGCACGTGCGGGCAGAAGGGTCAG0.130800.106800.491400.500000.923900.75000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368ACUCUAUUUGUUUGAUGUU76.4891710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421386ACTCTATTTGTTTGATGTTAACATCAAACAAATAGAGT0.075800.013600.560300.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585GGGUAGAGAUACAUAUGGA102.9253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
254603GGGTAGAGATACATATGGATCCATATGTATCTCTACCC0.249400.026800.620700.750001.000001.00000


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860AGAUAGAAACUGUGAAGAA97.784120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348878AGATAGAAACTGTGAAGAATTCTTCACAGTTTCTATCT0.062300.047900.551700.750001.000001.00000


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861GAUAGAAACUGUGAAGAAC81.4337432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371879GATAGAAACTGTGAAGAACGTTCTTCACAGTTTCTATC0.134700.050000.534500.500001.000001.00000


Target Position: 477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477GAUAAUCCUUCAUCUUUAU91.630789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
475-497GAGATAATCCTTCATCTTTATGAAUAAAGAUGAAGGAUUAUCUCGAUAAUCCUUCAUCUUUAUGAU6.915.412


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709CUAAAACCAAAGAAGGAUA86.6889209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151727CTAAAACCAAAGAAGGATATATCCTTCTTTGGTTTTAG0.012400.003500.629300.750000.962000.87500


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GGUGGUCUUUAUGCUGUAA94.045445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401884GGTGGTCTTTATGCTGTAATTACAGCATAAAGACCACC0.028500.005300.819001.000001.000001.00000


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293GCAGGGUUACAUAUAUUUU88.6999154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
611311GCAGGGTTACATATATTTTAAAATATATGTAACCCTGC0.455700.102300.853401.000001.000001.00000


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118CCAGAUUUUCUUCAAUCAC70.58061050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347136CCAGATTTTCTTCAATCACGTGATTGAAGAAAATCTGG0.123600.010300.551700.750000.907600.62500


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371UGAAGAAAUAUCCGUAUUU76.1906724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420389TGAAGAAATATCCGTATTTAAATACGGATATTTCTTCA0.033600.016700.724100.750000.989100.87500


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635ACAGGAAUACGUUGAACAU84.4376300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451653ACAGGAATACGTTGAACATATGTTCAACGTATTCCTGT0.062600.002600.551700.750001.000001.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154AUGAAGUCAUAUUUUCCUU76.1465731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791172ATGAAGTCATATTTTCCTTAAGGAAAATATGACTTCAT0.050600.004200.517200.500001.000001.00000


Target Position: 268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268GAUGCAUUCCGUUUUGAGA90.1069114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
266-288CAGATGCATTCCGTTTTGAGAATUCUCAAAACGGAAUGCAUCUGGAUGCAUUCCGUUUUGAGAAUU12.219.923


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006GAAGCCCAAGUACAGUAUC69.17711122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691024GAAGCCCAAGTACAGTATCGATACTGTACTTGGGCTTC0.511100.153400.491400.500001.000001.00000


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603AGUCAGACCUUUGUUUAAA86.735208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379621AGTCAGACCTTTGTTTAAATTTAAACAAAGGTCTGACT0.048800.020400.706900.750001.000001.00000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809AACCCCUGCACGCCCUCUA69.26391114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487827AACCCCTGCACGCCCTCTATAGAGGGCGTGCAGGGGTT0.199400.027900.474100.500001.000001.00000


Target Position: 1543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543UCCAAUCUGAUACCCAAAG52.55941802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971561TCCAATCTGATACCCAAAGCTTTGGGTATCAGATTGGA0.131100.035700.732800.500000.994600.62500


Target Position: 1153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153GAUGAAGUCAUAUUUUCCU81.1713449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1151-1173TGGATGAAGTCATATTTTCCTTGAGGAAAAUAUGACUUCAUCCAGAUGAAGUCAUAUUUUCCUUGU14.219.202


Target Position: 361, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361CCAAUUCGAGUGAAGAAAU82.0276403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193379CCAATTCGAGTGAAGAAATATTTCTTCACTCGAATTGG0.135400.036200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
359-381AGCCAATTCGAGTGAAGAAATATAUUUCUUCACUCGAAUUGGCUCCAAUUCGAGUGAAGAAAUAUU14.814.112


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462CAAAGUGGAUGGUGAGAUA100.04111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287480CAAAGTGGATGGTGAGATATATCTCACCATCCACTTTG0.120700.010000.603400.750001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557UGGAUACUGCCAAUAAGAA86.0099230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500575TGGATACTGCCAATAAGAATTCTTATTGGCAGTATCCA0.272200.001300.672400.750000.989100.62500


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339UGACCCGCUGUUUGGAAUG53.73831781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368357TGACCCGCTGTTTGGAATGCATTCCAAACAGCGGGTCA0.050600.005500.569000.500000.978300.75000


Target Position: 1714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714ACCAAAGAAGGAUAUUACU74.5271822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671732ACCAAAGAAGGATATTACTAGTAATATCCTTCTTTGGT0.481600.007600.646600.500000.962000.75000


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537GAGGAUUCCAAUCUGAUAC73.5132881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901555GAGGATTCCAATCTGATACGTATCAGATTGGAATCCTC0.202300.015200.629300.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884UCAGGAUCCUUUUUAAUAA88.043173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
257902TCAGGATCCTTTTTAATAATTATTAAAAAGGATCCTGA0.327300.060200.689700.750001.000001.00000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88GCCCGCCACAUCACCCUGA72.1824950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228106GCCCGCCACATCACCCTGATCAGGGTGATGTGGCGGGC0.310000.156000.775900.750001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CCUUCAGUGAUGGAAUAAC70.47341056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311604CCTTCAGTGATGGAATAACGTTATTCCATCACTGAAGG0.059700.011400.698300.750001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885CAGGAUCCUUUUUAAUAAU87.8354177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201903CAGGATCCTTTTTAATAATATTATTAAAAAGGATCCTG0.298300.076500.775900.750001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686ACUCCGCGACUCCCUUUUU68.27911183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177704ACTCCGCGACTCCCTTTTTAAAAAGGGAGTCGCGGAGT0.616900.027400.706900.750001.000001.00000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GAACUUACGCAGGGUUACA86.5661215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171303GAACTTACGCAGGGTTACATGTAACCCTGCGTAAGTTC0.099700.019800.465500.500001.000001.00000


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140UGAAUAAAUCACUUGAAGA86.1885224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430158TGAATAAATCACTTGAAGATCTTCAAGTGATTTATTCA0.082400.040900.500000.500001.000001.00000


Target Position: 523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
523UGUAUGUUGGAUGGUGUGU60.56071552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444541TGTATGTTGGATGGTGTGTACACACCATCCAACATACA0.092200.026800.500000.500001.000001.00000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433CAACAGCAUUUUGAAUUUG71.21051017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441451CAACAGCATTTTGAATTTGCAAATTCAAAATGCTGTTG0.160500.013300.500000.500001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023UCCUCUCCAGACAUUUGCA76.855684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291041TCCTCTCCAGACATTTGCATGCAAATGTCTGGAGAGGA0.180500.041400.517200.500001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GCAUCCGUGGAAAUGGUUA84.3222305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498787GCATCCGTGGAAATGGTTATAACCATTTCCACGGATGC0.022700.001400.819001.000000.978300.87500


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGAGGAAUUGAGCAAACAA101.0168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454520GGAGGAATTGAGCAAACAATTGTTTGCTCAATTCCTCC0.026200.008100.724101.000001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436CAUUUCUAGAUCAUCGAUU80.5968482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471454CATTTCTAGATCATCGATTAATCGATGATCTAGAAATG0.118900.037400.646600.750001.000001.00000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818ACGCCCUCUAUGACAAUGU64.83471359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460836ACGCCCTCTATGACAATGTACATTGTCATAGAGGGCGT0.024900.020000.569000.500000.918500.75000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492UUAUGACAAAGGAGGAAUU71.24881010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389510TTATGACAAAGGAGGAATTAATTCCTCCTTTGTCATAA0.055100.014100.525900.500001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024CCUCUCCAGACAUUUGCAA80.801469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1381042CCTCTCCAGACATTTGCAATTGCAAATGTCTGGAGAGG0.192100.033100.698301.000001.000001.00000


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535UUGAGGAUUCCAAUCUGAU73.0832897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971553TTGAGGATTCCAATCTGATATCAGATTGGAATCCTCAA0.242200.014400.465500.500001.000001.00000


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282UGAGAAUGUCAAUGGAUAC72.261943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487300TGAGAATGTCAATGGATACGTATCCATTGACATTCTCA0.097300.011900.543100.500001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437AUUUCUAGAUCAUCGAUUU81.3525437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071455ATTTCTAGATCATCGATTTAAATCGATGATCTAGAAAT0.152700.041200.508600.500001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GAACUCUAUUUGUUUGAUG78.2018606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001384GAACTCTATTTGTTTGATGCATCAAACAAATAGAGTTC0.068200.007500.517200.500001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367CGAGUGAAGAAAUAUCCGU79.2332554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405385CGAGTGAAGAAATATCCGTACGGATATTTCTTCACTCG0.188500.046100.517200.750000.989100.75000


Target Position: 1295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295AGGGUUACAUAUAUUUUCA89.9867116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121313AGGGTTACATATATTTTCATGAAAATATATGTAACCCT0.493400.111400.620700.500001.000001.00000


Target Position: 11, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11CACGCGUUACAGGAGCCAG68.37841178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45929CACGCGTTACAGGAGCCAGCTGGCTCCTGTAACGCGTG0.025100.010400.508600.500001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163UAUUUUCCUUGGAAACUUA86.0382228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121181TATTTTCCTTGGAAACTTATAAGTTTCCAAGGAAAATA0.054600.015700.508600.500000.934800.87500


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110GCUUACGCCCAGAUUUUCU75.5298765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427128GCTTACGCCCAGATTTTCTAGAAAATCTGGGCGTAAGC0.032300.020200.629300.750000.994600.75000


Target Position: 1857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857CAAAGCUUAGGUGGUCUUU72.1305957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311875CAAAGCTTAGGTGGTCTTTAAAGACCACCTAAGCTTTG0.113500.016900.646600.750001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407UGCUGCCCAUGGUCUUGAA81.157450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361425TGCTGCCCATGGTCTTGAATTCAAGACCATGGGCAGCA0.032400.002800.681000.750001.000001.00000


Target Position: 149, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
149CACUUGAAGAAAGCUUAUA86.0843227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446167CACTTGAAGAAAGCTTATATATAAGCTTTCTTCAAGTG0.053500.002600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
147-169ATCACTTGAAGAAAGCTTATAGCUAUAAGCUUUCUUCAAGUGAUCACUUGAAGAAAGCUUAUAGCU18.319.222


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171UUGGAAACUUAUGACAUUA79.7361527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581189TTGGAAACTTATGACATTATAATGTCATAAGTTTCCAA0.098100.033400.612100.500001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210UGAUGAUUGCCUUUCUGUU79.96515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320228TGATGATTGCCTTTCTGTTAACAGAAAGGCAATCATCA0.476100.022900.577600.750001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897UAAUAAUGCUGUAAAGAAA93.090355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389915TAATAATGCTGTAAAGAAATTTCTTTACAGCATTATTA0.318900.121400.534500.500001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891CCUUUUUAAUAAUGCUGUA91.894687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172909CCTTTTTAATAATGCTGTATACAGCATTATTAAAAAGG0.181700.089700.663801.000001.000001.00000


Target Position: 907, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907GUAAAGAAACGUUUGAUGA85.9867232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
905-927CTGTAAAGAAACGTTTGATGACAUCAUCAAACGUUUCUUUACAGGUAAAGAAACGUUUGAUGACAU13.87.132


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623CAAUGACAGAAGAUGGAUU89.7515122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508641CAATGACAGAAGATGGATTAATCCATCTTCTGTCATTG0.056100.001200.637900.750001.000001.00000


Target Position: 1722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722AGGAUAUUACUACCGUCAA87.0468197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551740AGGATATTACTACCGTCAATTGACGGTAGTAATATCCT0.121700.079300.698300.750000.951100.75000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624UUUAAGAUUUUACAGGAAU68.69591152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621642TTTAAGATTTTACAGGAATATTCCTGTAAAATCTTAAA0.115700.039000.491400.500001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090GAUCAUAUUGGAAGUGAAC77.5215649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771108GATCATATTGGAAGTGAACGTTCACTTCCAATATGATC0.144500.001800.534500.500001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687CUCCGCGACUCCCUUUUUA78.6356583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169705CTCCGCGACTCCCTTTTTATAAAAAGGGAGTCGCGGAG0.603600.023900.775900.750001.000001.00000


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604GUCAGACCUUUGUUUAAAG77.364656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400622GTCAGACCTTTGTTTAAAGCTTTAAACAAAGGTCTGAC0.050700.016100.681000.500001.000001.00000


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343AGGAGAGUGAGAGGCUUCU69.50591101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821361AGGAGAGTGAGAGGCTTCTAGAAGCCTCTCACTCTCCT0.090700.001700.620700.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589AGAGAUACAUAUGGAGUCA88.7303153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466607AGAGATACATATGGAGTCATGACTCCATATGTATCTCT0.028000.019900.500000.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402CAAUGGUGAAAUCUACAAC77.6144643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434420CAATGGTGAAATCTACAACGTTGTAGATTTCACCATTG0.105000.003400.500000.500001.000001.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438UUUCUAGAUCAUCGAUUUU69.36251107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331456TTTCTAGATCATCGATTTTAAAATCGATGATCTAGAAA0.194000.045200.500000.500001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474CUGCCACCAGAAAUGAGAA89.2655138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561492CTGCCACCAGAAATGAGAATTCTCATTTCTGGTGGCAG0.025600.004900.612100.750000.951100.62500


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448AUCGAUUUUCUUCCUAUUA77.2421663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051466ATCGATTTTCTTCCTATTATAATAGGAAGAAAATCGAT0.762600.299100.646600.500001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026UCUCCAGACAUUUGCAAUU69.40651105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751044TCTCCAGACATTTGCAATTAATTGCAAATGTCTGGAGA0.150400.038300.715500.750001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536GUGUGUUUGCAUUUGUUUU81.2848442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
421554GTGTGTTTGCATTTGTTTTAAAACAAATGCAAACACAC0.281500.003200.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
534-556TGGTGTGTTTGCATTTGTTTTACAAAACAAAUGCAAACACACCAGUGUGUUUGCAUUUGUUUUACU5.619.312


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461CCAAAGUGGAUGGUGAGAU75.6567760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316479CCAAAGTGGATGGTGAGATATCTCACCATCCACTTTGG0.105600.007700.663801.000000.940200.62500


Target Position: 483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483CCUUCAUCUUUAUGACAAA97.790919

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
481-503ATCCTTCATCTTTATGACAAAGGUUUGUCAUAAAGAUGAAGGAUCCUUCAUCUUUAUGACAAAGGU20.520.402


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865AGGUGGUCUUUAUGCUGUA90.940697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171883AGGTGGTCTTTATGCTGTATACAGCATAAAGACCACCT0.034400.005500.663800.750001.000001.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655AGGUUGAUGAUGCAAUGAU81.6254424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431673AGGTTGATGATGCAATGATATCATTGCATCATCAACCT0.041800.002600.663800.750001.000001.00000


Target Position: 1480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480CCAGAAAUGAGAAUUCCAA92.098981

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1478-1500CACCAGAAATGAGAATTCCAAAGUUGGAAUUCUCAUUUCUGGUGCCAGAAAUGAGAAUUCCAAAGU20.112.012


Target Position: 1594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GAUGGAAUAACUUCAGUUA98.275615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521612GATGGAATAACTTCAGTTATAACTGAAGTTATTCCATC0.100200.019900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1592-1614GTGATGGAATAACTTCAGTTAAGUAACUGAAGUUAUUCCAUCACGAUGGAAUAACUUCAGUUAAGU19.220.102


Target Position: 51, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
51CUCGCCGCCCGUCAAGCUG51.75031817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44169CTCGCCGCCCGTCAAGCTGCAGCTTGACGGGCGGCGAG0.028200.003100.525900.500000.918500.75000


Target Position: 235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235CUGAGUGCUAUGAAGAUUG71.34971004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457253CTGAGTGCTATGAAGATTGCAATCTTCATAGCACTCAG0.062600.002600.637900.500001.000001.00000


Target Position: 1172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172UGGAAACUUAUGACAUUAC66.3871263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851190TGGAAACTTATGACATTACGTAATGTCATAAGTTTCCA0.107400.032300.663800.500001.000001.00000


Target Position: 1202, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202CUUCAGUAGGUAUGUAUUU80.2305496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091220CTTCAGTAGGTATGTATTTAAATACATACCTACTGAAG0.073000.008000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1200-1222TGCTTCAGTAGGTATGTATTTAAAAAUACAUACCUACUGAAGCACUUCAGUAGGUAUGUAUUUAAU6.720.312


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873UUUAUGCUGUAAUGUGAAA77.36657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161891TTTATGCTGTAATGTGAAATTTCACATTACAGCATAAA0.096300.007700.500000.500001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429AGAGUCCCAUUUCUAGAUC64.81671360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511447AGAGTCCCATTTCTAGATCGATCTAGAAATGGGACTCT0.117900.012400.543100.500000.989100.87500


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005AGAAGCCCAAGUACAGUAU75.7034753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401023AGAAGCCCAAGTACAGTATATACTGTACTTGGGCTTCT0.500100.148300.681000.750001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168GCUUCAUUGCACCAUGUGU81.7691415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477186GCTTCATTGCACCATGTGTACACATGGTGCAATGAAGC0.021100.001800.646600.750000.978300.87500


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990GUUGAAGCAGCUGAAAGAA85.9419236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091008GTTGAAGCAGCTGAAAGAATTCTTTCAGCTGCTTCAAC0.089000.001200.474100.750001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582CCUGGGUAGAGAUACAUAU87.2887189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230600CCTGGGTAGAGATACATATATATGTATCTCTACCCAGG0.256200.015300.801701.000001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536UGAGGAUUCCAAUCUGAUA89.9871115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421554TGAGGATTCCAATCTGATATATCAGATTGGAATCCTCA0.242300.013700.681000.750001.000001.00000


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816GCACGCCCUCUAUGACAAU81.601425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285834GCACGCCCTCTATGACAATATTGTCATAGAGGGCGTGC0.084500.048200.844801.000000.918500.87500


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431UGCAACAGCAUUUUGAAUU65.24461332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320449TGCAACAGCATTTTGAATTAATTCAAAATGCTGTTGCA0.080900.007600.844800.750000.902200.62500


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530UGGAUGGUGUGUUUGCAUU73.8009865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465548TGGATGGTGTGTTTGCATTAATGCAAACACACCATCCA0.023000.004800.836200.750001.000001.00000


Target Position: 1740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1740AGUCUUUGAACGCCAUUAC65.38661324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871758AGTCTTTGAACGCCATTACGTAATGGCGTTCAAAGACT0.127900.007000.525900.500001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CCUCAGGAUCCUUUUUAAU81.9717406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82900CCTCAGGATCCTTTTTAATATTAAAAAGGATCCTGAGG0.396000.050500.836201.000001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654UUCAGAAGCUAAAGGUCUU71.23271014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461672TTCAGAAGCTAAAGGTCTTAAGACCTTTAGCTTCTGAA0.059100.005100.534500.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089AGAUCAUAUUGGAAGUGAA101.9485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741107AGATCATATTGGAAGTGAATTCACTTCCAATATGATCT0.771700.001800.551700.750001.000001.00000


Target Position: 658, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658GAAGCUAAAGGUCUUGUUA94.594238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264676GAAGCTAAAGGTCTTGTTATAACAAGACCTTTAGCTTC0.100100.011200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
656-678CAGAAGCTAAAGGTCTTGTTACAUAACAAGACCUUUAGCUUCUGGAAGCUAAAGGUCUUGUUACAU19.218.322


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401ACAAUGGUGAAAUCUACAA82.8366366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412419ACAATGGTGAAATCTACAATTGTAGATTTCACCATTGT0.109800.003500.560300.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601GGAGUCAGACCUUUGUUUA94.038346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362619GGAGTCAGACCTTTGTTTATAAACAAAGGTCTGACTCC0.052200.027200.836201.000001.000001.00000


Target Position: 1687, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687CAGAAAUUUCCCUUCAAUA95.263330

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7168719CAGAAATTTCCCTTCAATA1/1/0/097.75ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA8:47610131..47610149(+)|8:47491125..47491143(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331705CAGAAATTTCCCTTCAATATATTGAAGGGAAATTTCTG0.196900.182000.741400.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1685-1707CCCAGAAATTTCCCTTCAATACTUAUUGAAGGGAAAUUUCUGGGCAGAAAUUUCCCUUCAAUACUU12.05.302


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395UCUGUUACAAUGGUGAAAU67.37531223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512413TCTGTTACAATGGTGAAATATTTCACCATTGTAACAGA0.013200.006100.715500.750001.000001.00000


Target Position: 432, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432GCAACAGCAUUUUGAAUUU84.4201301

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_143219GCAACAGCATTTTGAATTT1/1/0/0100.00ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA7:97493788..97493806(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286450GCAACAGCATTTTGAATTTAAATTCAAAATGCTGTTGC0.109900.010100.853401.000001.000001.00000


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725CUGGACACUAUGAAGUUUU75.3164778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432743CTGGACACTATGAAGTTTTAAAACTTCATAGTGTCCAG0.031300.003400.784500.750000.989100.87500


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883CUCAGGAUCCUUUUUAAUA89.034145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80901CTCAGGATCCTTTTTAATATATTAAAAAGGATCCTGAG0.398800.054400.767200.750001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852GCUGUCAAAGCUUAGGUGG59.77941585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451870GCTGTCAAAGCTTAGGTGGCCACCTAAGCTTTGACAGC0.104000.004600.508600.500000.994600.62500


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723UCCUGGACACUAUGAAGUU74.3001836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453741TCCTGGACACTATGAAGTTAACTTCATAGTGTCCAGGA0.026200.004500.724100.750000.989100.62500


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810ACCCCUGCACGCCCUCUAU68.72321150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212828ACCCCTGCACGCCCTCTATATAGAGGGCGTGCAGGGGT0.223900.025300.810300.750001.000001.00000


Target Position: 1963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1963UUGGGUGUGAAAAAAAUAA74.493823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601981TTGGGTGTGAAAAAAATAATTATTTTTTTCACACCCAA0.910200.002200.612100.500001.000001.00000


Target Position: 1481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481CAGAAAUGAGAAUUCCAAA96.713327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1479-1501ACCAGAAATGAGAATTCCAAAGAUUUGGAAUUCUCAUUUCUGGUCAGAAAUGAGAAUUCCAAAGAU20.112.012


Target Position: 777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777GGAAAUGGUUAAAUAUCAU94.354541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295795GGAAATGGTTAAATATCATATGATATTTAACCATTTCC0.146200.009100.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
775-797GTGGAAATGGTTAAATATCATCAAUGAUAUUUAACCAUUUCCACGGAAAUGGUUAAAUAUCAUCAU8.720.112


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241GCUAUGAAGAUUGCACACA81.9235409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203259GCTATGAAGATTGCACACATGTGTGCAATCTTCATAGC0.130400.038000.646600.750001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464AAGUGGAUGGUGAGAUAAU84.5325295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462482AAGTGGATGGTGAGATAATATTATCTCACCATCCACTT0.066700.002100.629300.500001.000001.00000


Target Position: 829, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829GACAAUGUGGAGAAACUCU84.581290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
827-849ATGACAATGTGGAGAAACTCTTTAGAGUUUCUCCACAUUGUCAUGACAAUGUGGAGAAACUCUUUU21.519.311


Target Position: 1957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957GCUAACUUGGGUGUGAAAA78.8526572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1955-1977AGGCTAACTTGGGTGTGAAAAAAUUUUCACACCCAAGUUAGCCUGCUAACUUGGGUGUGAAAAAAU20.59.822


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924GGGUAGAUAGGGGAACAAU87.2017195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981942GGGTAGATAGGGGAACAATATTGTTCCCCTATCTACCC0.482000.043300.982801.000001.000001.00000


Target Position: 1934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1934GGGAACAAUGAGAGUCAAC74.6929818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341952GGGAACAATGAGAGTCAACGTTGACTCTCATTGTTCCC0.030300.024700.844800.750001.000001.00000


Target Position: 114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
114ACGCCCAGAUUUUCUUCAA80.2132498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250132ACGCCCAGATTTTCTTCAATTGAAGAAAATCTGGGCGT0.153900.012500.629300.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092UCAUAUUGGAAGUGAACAU76.7947688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321110TCATATTGGAAGTGAACATATGTTCACTTCCAATATGA0.144000.012600.569000.750001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155UGAAGUCAUAUUUUCCUUG65.21821334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681173TGAAGTCATATTTTCCTTGCAAGGAAAATATGACTTCA0.054000.001900.577600.500001.000001.00000


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368GAGUGAAGAAAUAUCCGUA101.964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247386GAGTGAAGAAATATCCGTATACGGATATTTCTTCACTC0.191800.049700.629300.750000.989100.87500


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108CUGCUUACGCCCAGAUUUU74.8995809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385126CTGCTTACGCCCAGATTTTAAAATCTGGGCGTAAGCAG0.045400.015700.784500.750000.918500.75000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475UGCCACCAGAAAUGAGAAU65.90951288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111493TGCCACCAGAAATGAGAATATTCTCATTTCTGGTGGCA0.013600.003000.844800.750001.000001.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495CCAAAGAAUGGGAUAGAAA92.659464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631513CCAAAGAATGGGATAGAAATTTCTATCCCATTCTTTGG0.023700.003800.844801.000000.934800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1493-1515TTCCAAAGAATGGGATAGAAAAAUUUCUAUCCCAUUCUUUGGAACCAAAGAAUGGGAUAGAAAAAU16.012.212


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859AAGCUUAGGUGGUCUUUAU84.6355286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141877AAGCTTAGGTGGTCTTTATATAAAGACCACCTAAGCTT0.056600.008900.594800.500001.000001.00000


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971GAAAAAAAUAAAAGUCCUA92.952358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371989GAAAAAAATAAAAGTCCTATAGGACTTTTATTTTTTTC0.943900.863500.500000.750001.000001.00000


Target Position: 1935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1935GGAACAAUGAGAGUCAACU83.7053331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131953GGAACAATGAGAGTCAACTAGTTGACTCTCATTGTTCC0.012800.011200.663800.750001.000001.00000


Target Position: 141, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
141GAAUAAAUCACUUGAAGAA100.10310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454159GAATAAATCACTTGAAGAATTCTTCAAGTGATTTATTC0.032000.016000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
139-161CTGAATAAATCACTTGAAGAAAGUUCUUCAAGUGAUUUAUUCAGGAAUAAAUCACUUGAAGAAAGU20.4-10.322


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106AACAUUAUGAAGUCCUUUU75.2041787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701124AACATTATGAAGTCCTTTTAAAAGGACTTCATAATGTT0.053500.008900.646600.500001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281UUGAGAAUGUCAAUGGAUA83.6093337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364299TTGAGAATGTCAATGGATATATCCATTGACATTCTCAA0.073700.009600.603400.500001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GCUGUAAAGAAACGUUUGA81.0325457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392922GCTGTAAAGAAACGTTTGATCAAACGTTTCTTTACAGC0.049700.004400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
902-924ATGCTGTAAAGAAACGTTTGATGUCAAACGUUUCUUUACAGCAUGCUGUAAAGAAACGUUUGAUGU19.811.822


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098UGGAAGUGAACAUUAUGAA85.0531267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571116TGGAAGTGAACATTATGAATTCATAATGTTCACTTCCA0.172300.027700.672400.750001.000001.00000


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435CCAUUUCUAGAUCAUCGAU85.118262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401453CCATTTCTAGATCATCGATATCGATGATCTAGAAATGG0.109200.033300.663801.000001.000001.00000


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305ACUGCUGCUUUGGAUUUCA77.8126628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482323ACTGCTGCTTTGGATTTCATGAAATCCAAAGCAGCAGT0.054900.002900.482800.500001.000001.00000


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859GAGAUAGAAACUGUGAAGA84.7709279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343877GAGATAGAAACTGTGAAGATCTTCACAGTTTCTATCTC0.056900.047800.586200.500001.000001.00000


Target Position: 1496, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496CAAAGAAUGGGAUAGAAAA97.39924

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6149619CAAAGAATGGGATAGAAAA1/1/0/097.75ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA3:23241818..23241836(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191514CAAAGAATGGGATAGAAAATTTTCTATCCCATTCTTTG0.033600.003700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1494-1516TCCAAAGAATGGGATAGAAAAACUUUUCUAUCCCAUUCUUUGGACAAAGAAUGGGAUAGAAAAACU6.95.312


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119CCUUUUUAACUCUGAGGAA89.7125123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3391137CCTTTTTAACTCTGAGGAATTCCTCAGAGTTAAAAAGG0.057600.012600.672401.000001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666AGGUCUUGUUACAUUGAAG79.5282542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475684AGGTCTTGTTACATTGAAGCTTCAATGTAACAAGACCT0.191400.018500.706900.500001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167AGCUUCAUUGCACCAUGUG62.57151459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488185AGCTTCATTGCACCATGTGCACATGGTGCAATGAAGCT0.025700.001600.560300.500000.962000.75000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887GGAUCCUUUUUAAUAAUGC70.32751065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410905GGATCCTTTTTAATAATGCGCATTATTAAAAAGGATCC0.203900.039900.517200.500001.000001.00000


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GUAUUUAAUUUCCAAGUAU89.451132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181233GTATTTAATTTCCAAGTATATACTTGGAAATTAAATAC0.209200.102400.637900.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861GCUUAGGUGGUCUUUAUGC66.02851278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791879GCTTAGGTGGTCTTTATGCGCATAAAGACCACCTAAGC0.020400.007000.500000.500001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GCAUUUGUUUUACUGGAUA91.146694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446562GCATTTGTTTTACTGGATATATCCAGTAAAACAAATGC0.027400.023500.810301.000001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662CUAAAGGUCUUGUUACAUU85.7091242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
278680CTAAAGGTCTTGTTACATTAATGTAACAAGACCTTTAG0.530400.039300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
660-682AGCTAAAGGTCTTGTTACATTGAAAUGUAACAAGACCUUUAGCUCUAAAGGUCUUGUUACAUUGAU14.618.622


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428GAGAGUCCCAUUUCUAGAU85.7318241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281446GAGAGTCCCATTTCTAGATATCTAGAAATGGGACTCTC0.114500.007200.629300.750000.989100.75000


Target Position: 1967, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967GUGUGAAAAAAAUAAAAGU80.2617492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001985GTGTGAAAAAAATAAAAGTACTTTTATTTTTTTCACAC0.901600.240000.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1965-1987GGGTGTGAAAAAAATAAAAGTCCACUUUUAUUUUUUUCACACCCGUGUGAAAAAAAUAAAAGUCCU-4.320.511


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369CUCUAUUUGUUUGAUGUUC63.93061402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931387CTCTATTTGTTTGATGTTCGAACATCAAACAAATAGAG0.080200.018700.637900.500001.000001.00000


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999GCUGAAAGAAGCCCAAGUA90.8334101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581017GCTGAAAGAAGCCCAAGTATACTTGGGCTTCTTTCAGC0.232100.085000.672401.000000.989100.62500


Target Position: 1689, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689GAAAUUUCCCUUCAAUACU79.331551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101707GAAATTTCCCTTCAATACTAGTATTGAAGGGAAATTTC0.203400.159400.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1687-1709CAGAAATTTCCCTTCAATACTCCAGUAUUGAAGGGAAAUUUCUGGAAAUUUCCCUUCAAUACUCCU16.10.402


Target Position: 1598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GAAUAACUUCAGUUAAGAA106.841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461616GAATAACTTCAGTTAAGAATTCTTAACTGAAGTTATTC0.045100.012100.500000.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1596-1618TGGAATAACTTCAGTTAAGAATTUUCUUAACUGAAGUUAUUCCAGAAUAACUUCAGUUAAGAAUUU14.64.602


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UCUUUAUGCUGUAAUGUGA82.2504391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921889TCTTTATGCTGTAATGTGATCACATTACAGCATAAAGA0.602400.008000.500000.500001.000001.00000


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739AAGUCUUUGAACGCCAUUA79.4062548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441757AAGTCTTTGAACGCCATTATAATGGCGTTCAAAGACTT0.126100.006100.603400.500001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UCAGAAGCUAAAGGUCUUG55.87151716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423673TCAGAAGCTAAAGGTCTTGCAAGACCTTTAGCTTCTGA0.044700.006200.577600.500001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782UGGUUAAAUAUCAUCACUG70.92561028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500800TGGTTAAATATCATCACTGCAGTGATGATATTTAACCA0.015800.006300.560300.500001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GCAAAUAUUUCUUCGUGUU83.6139336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511910GCAAATATTTCTTCGTGTTAACACGAAGAAATATTTGC0.026500.015900.706901.000000.972800.62500


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885UGUGAAAGCAAAUAUUUCU75.4757772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771903TGTGAAAGCAAATATTTCTAGAAATATTTGCTTTCACA0.070900.003900.482800.500001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529UUGGAUGGUGUGUUUGCAU68.47481174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473547TTGGATGGTGTGTTTGCATATGCAAACACACCATCCAA0.022000.004600.491400.500001.000001.00000


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754CCAAAUGGCAAAGUUGCAU71.21121016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424772CCAAATGGCAAAGTTGCATATGCAACTTTGCCATTTGG0.209000.003100.689701.000000.934800.75000


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449UCGAUUUUCUUCCUAUUAC62.00181486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251467TCGATTTTCTTCCTATTACGTAATAGGAAGAAAATCGA0.293100.284800.612100.500001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GUCUUGUUACAUUGAAGCA86.7565207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508686GTCTTGTTACATTGAAGCATGCTTCAATGTAACAAGAC0.182000.046400.465500.500000.972800.62500


Target Position: 473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473GUGAGAUAAUCCUUCAUCU89.8511119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
471-493TGGTGAGATAATCCTTCATCTTTAGAUGAAGGAUUAUCUCACCAGUGAGAUAAUCCUUCAUCUUUU20.421.412


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585GCCUUCAGUGAUGGAAUAA84.5209297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371603GCCTTCAGTGATGGAATAATTATTCCATCACTGAAGGC0.057700.014000.965501.000001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283AUGAACUUACGCAGGGUUA73.8966860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301301ATGAACTTACGCAGGGTTATAACCCTGCGTAAGTTCAT0.080600.010100.620700.500001.000001.00000


Target Position: 161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
161GCUUAUAGCUUCAUUGCAC79.6627531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
416179GCTTATAGCTTCATTGCACGTGCAATGAAGCTATAAGC0.034500.004200.560300.750000.962000.75000


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867GUGGUCUUUAUGCUGUAAU75.1122793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921885GTGGTCTTTATGCTGTAATATTACAGCATAAAGACCAC0.043200.004500.784500.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGCAUCCGUGGAAAUGGUU62.51721463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495786TGCATCCGTGGAAATGGTTAACCATTTCCACGGATGCA0.022700.001400.706900.750000.978300.75000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UGAAAGCAAAUAUUUCUUC60.7361540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701905TGAAAGCAAATATTTCTTCGAAGAAATATTTGCTTTCA0.044900.002800.551700.500001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625AUGACAGAAGAUGGAUUUU70.42881060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510643ATGACAGAAGATGGATTTTAAAATCCATCTTCTGTCAT0.038100.001200.655200.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CCUUUGUUUAAAGCAAUGA74.9154807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390628CCTTTGTTTAAAGCAATGATCATTGCTTTAAACAAAGG0.096600.004500.620700.750001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826CCCGCACGCUGACCCACUA84.553293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081844CCCGCACGCTGACCCACTATAGTGGGTCAGCGTGCGGG0.036700.009000.819001.000000.972800.62500


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893UUUUUAAUAAUGCUGUAAA77.352658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439911TTTTTAATAATGCTGTAAATTTACAGCATTATTAAAAA0.155600.093400.500000.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619CCUGGUUUAAGAUUUUACA85.631243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811637CCTGGTTTAAGATTTTACATGTAAAATCTTAAACCAGG0.097700.010200.637900.750001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589UCAGUGAUGGAAUAACUUC65.01771349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461607TCAGTGATGGAATAACTTCGAAGTTATTCCATCACTGA0.068600.007300.551700.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GAAGACAGCCCCGAUUUAC69.20431118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641069GAAGACAGCCCCGATTTACGTAAATCGGGGCTGTCTTC0.382400.010900.491400.500001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559GAUACUGCCAAUAAGAAAG76.1647727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467577GATACTGCCAATAAGAAAGCTTTCTTATTGGCAGTATC0.104700.002900.543100.500001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294CAGGGUUACAUAUAUUUUC74.0801850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211312CAGGGTTACATATATTTTCGAAAATATATGTAACCCTG0.496400.083200.612100.500001.000001.00000


Target Position: 1088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088CAGAUCAUAUUGGAAGUGA84.8876274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751106CAGATCATATTGGAAGTGATCACTTCCAATATGATCTG0.023100.001800.560300.500001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UGGUCUUGAACUGAGAGUC59.90731579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161434TGGTCTTGAACTGAGAGTCGACTCTCAGTTCAAGACCA0.011800.001200.525900.500001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714GCCUUUUCUUCCUGGACAC68.94771137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404732GCCTTTTCTTCCTGGACACGTGTCCAGGAAGAAAAGGC0.037400.019200.706900.750001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626UGACAGAAGAUGGAUUUUU71.4764994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517644TGACAGAAGATGGATTTTTAAAAATCCATCTTCTGTCA0.029600.001000.724100.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854GUUUUGAGAUAGAAACUGU86.5871214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
852-874AGGTTTTGAGATAGAAACTGTGAACAGUUUCUAUCUCAAAACCUGUUUUGAGAUAGAAACUGUGAU19.212.213


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636CAGGAAUACGUUGAACAUC70.50661054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351654CAGGAATACGTTGAACATCGATGTTCAACGTATTCCTG0.058900.002800.603400.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881GUAAUGUGAAAGCAAAUAU84.3545303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431899GTAATGTGAAAGCAAATATATATTTGCTTTCACATTAC0.107600.034800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1879-1901CTGTAATGTGAAAGCAAATATTTAUAUUUGCUUUCACAUUACAGGUAAUGUGAAAGCAAAUAUUUU15.313.512


Target Position: 1886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886GUGAAAGCAAAUAUUUCUU78.1505608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161904GTGAAAGCAAATATTTCTTAAGAAATATTTGCTTTCAC0.057000.003400.655200.750001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915GGGGACUGUGGGUAGAUAG75.9083742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071933GGGGACTGTGGGTAGATAGCTATCTACCCACAGTCCCC0.096400.001200.819000.750001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925GGUAGAUAGGGGAACAAUG81.1295451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721943GGTAGATAGGGGAACAATGCATTGTTCCCCTATCTACC0.505200.058400.698300.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586GGUAGAGAUACAUAUGGAG84.6763284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364604GGTAGAGATACATATGGAGCTCCATATGTATCTCTACC0.051400.006300.543100.750001.000001.00000


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270GGAGAAGGAUCAGAUGAAC79.587537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961288GGAGAAGGATCAGATGAACGTTCATCTGATCCTTCTCC0.016300.002400.724100.750001.000001.00000


Target Position: 1447, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447CAUCGAUUUUCUUCCUAUU88.8207150

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2144719CATCGATTTTCTTCCTATT1/1/0/0100.00ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANANA00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021465CATCGATTTTCTTCCTATTAATAGGAAGAAAATCGATG0.745900.288900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1445-1467ATCATCGATTTTCTTCCTATTACAAUAGGAAGAAAAUCGAUGAUCAUCGAUUUUCUUCCUAUUACU19.916.622


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583AAGCCUUCAGUGAUGGAAU77.6474641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521601AAGCCTTCAGTGATGGAATATTCCATCACTGAAGGCTT0.029400.002400.629300.500001.000001.00000


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111CUUACGCCCAGAUUUUCUU72.1298958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436129CTTACGCCCAGATTTTCTTAAGAAAATCTGGGCGTAAG0.109700.017500.500000.750001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271GAGAAGGAUCAGAUGAACU87.7328182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641289GAGAAGGATCAGATGAACTAGTTCATCTGATCCTTCTC0.054100.002100.603400.500001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657AGAAGCUAAAGGUCUUGUU75.6851757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311675AGAAGCTAAAGGTCTTGTTAACAAGACCTTTAGCTTCT0.080400.009900.577600.750001.000001.00000


Target Position: 398, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398GUUACAAUGGUGAAAUCUA94.884332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490416GTTACAATGGTGAAATCTATAGATTTCACCATTGTAAC0.772600.005700.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
396-418CTGTTACAATGGTGAAATCTACAUAGAUUUCACCAUUGUAACAGGUUACAAUGGUGAAAUCUACAU14.86.913


Target Position: 10, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10GCACGCGUUACAGGAGCCA72.1923948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41928GCACGCGTTACAGGAGCCATGGCTCCTGTAACGCGTGC0.081700.007200.508600.750001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GAAAUGGUUAAAUAUCAUC75.5673764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511796GAAATGGTTAAATATCATCGATGATATTTAACCATTTC0.155800.008200.491400.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783GGUUAAAUAUCAUCACUGU92.963957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506801GGTTAAATATCATCACTGTACAGTGATGATATTTAACC0.014600.005900.646600.750001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622GGUUUAAGAUUUUACAGGA96.188728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831640GGTTTAAGATTTTACAGGATCCTGTAAAATCTTAAACC0.115600.027100.482800.750001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GGUCUUGUUACAUUGAAGC66.74981253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465685GGTCTTGTTACATTGAAGCGCTTCAATGTAACAAGACC0.185200.024300.500000.500001.000001.00000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AAUGUGAAAGCAAAUAUUU78.0002617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111901AATGTGAAAGCAAATATTTAAATATTTGCTTTCACATT0.071100.010500.508600.500001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974AAAAAUAAAAGUCCUAAAU75.3786776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651992AAAAATAAAAGTCCTAAATATTTAGGACTTTTATTTTT0.946400.855200.491400.500001.000001.00000


Target Position: 127, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CUUCAAUCACAUCUGAAUA92.067483

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_812719CTTCAATCACATCTGAATA1/1/0/094.96ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANANA00ASNS(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
125-147TTCTTCAATCACATCTGAATAAAUAUUCAGAUGUGAUUGAAGAACUUCAAUCACAUCUGAAUAAAU20.416.322


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CUUUUUAAUAAUGCUGUAA82.1973394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287910CTTTTTAATAATGCTGTAATTACAGCATTATTAAAAAG0.166100.090900.603400.750001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815UGCACGCCCUCUAUGACAA81.4417431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
239833TGCACGCCCTCTATGACAATTGTCATAGAGGGCGTGCA0.109200.023300.706900.750000.918500.75000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049UGGAAGACAGCCCCGAUUU65.00871351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441067TGGAAGACAGCCCCGATTTAAATCGGGGCTGTCTTCCA0.113900.002600.844800.750000.929300.62500


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891AGCAAAUAUUUCUUCGUGU76.2313723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951909AGCAAATATTTCTTCGTGTACACGAAGAAATATTTGCT0.022300.005200.646600.500000.972800.62500


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434CCCAUUUCUAGAUCAUCGA78.7942576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001452CCCATTTCTAGATCATCGATCGATGATCTAGAAATGGG0.076000.029200.698300.750000.989100.62500


Target Position: 1830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830CACGCUGACCCACUACAAG74.3735829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271848CACGCTGACCCACTACAAGCTTGTAGTGGGTCAGCGTG0.032400.003000.655200.500001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344GGAGAGUGAGAGGCUUCUG74.2106843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921362GGAGAGTGAGAGGCTTCTGCAGAAGCCTCTCACTCTCC0.063000.001500.586200.750001.000001.00000


Target Position: 52, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
52UCGCCGCCCGUCAAGCUGU56.16361700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
40870TCGCCGCCCGTCAAGCTGTACAGCTTGACGGGCGGCGA0.039900.003700.586200.500000.918500.87500


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509UUGAGCAAACAAUUUGUAU69.12591124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483527TTGAGCAAACAATTTGTATATACAAATTGTTTGCTCAA0.041600.001700.603400.500001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490CUUUAUGACAAAGGAGGAA80.115504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501508CTTTATGACAAAGGAGGAATTCCTCCTTTGTCATAAAG0.058400.009900.465500.750001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205CAGUAGGUAUGUAUUUAAU94.738934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761223CAGTAGGTATGTATTTAATATTAAATACATACCTACTG0.228000.010600.775900.750001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362CAAUUCGAGUGAAGAAAUA92.354473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277380CAATTCGAGTGAAGAAATATATTTCTTCACTCGAATTG0.218300.035700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
360-382GCCAATTCGAGTGAAGAAATATCUAUUUCUUCACUCGAAUUGGCCAAUUCGAGUGAAGAAAUAUCU5.316.712


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397UGUUACAAUGGUGAAAUCU67.88271201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506415TGTTACAATGGTGAAATCTAGATTTCACCATTGTAACA0.061800.007800.482800.500001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199GUGCUUCAGUAGGUAUGUA92.265776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851217GTGCTTCAGTAGGTATGTATACATACCTACTGAAGCAC0.018800.001700.612100.750001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500GAAUGGGAUAGAAAAACAU90.3324111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971518GAATGGGATAGAAAAACATATGTTTTTCTATCCCATTC0.227800.001400.517200.750001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618UCCUGGUUUAAGAUUUUAC61.36151512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991636TCCTGGTTTAAGATTTTACGTAAAATCTTAAACCAGGA0.097500.011200.689700.500001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539UGUUUGCAUUUGUUUUACU74.2712841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429557TGTTTGCATTTGTTTTACTAGTAAAACAAATGCAAACA0.205200.024900.500000.500001.000001.00000


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881ACCUCAGGAUCCUUUUUAA91.437692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205899ACCTCAGGATCCTTTTTAATTAAAAAGGATCCTGAGGT0.391000.052100.819000.750001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010CCCAAGUACAGUAUCCUCU75.9472735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1451028CCCAAGTACAGTATCCTCTAGAGGATACTGTACTTGGG0.201500.153000.767200.750001.000001.00000


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207CAGUGAUGAUUGCCUUUCU87.7222183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517225CAGTGATGATTGCCTTTCTAGAAAGGCAATCATCACTG0.068600.009000.560300.500001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441CUAGAUCAUCGAUUUUCUU83.4226344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721459CTAGATCATCGATTTTCTTAAGAAAATCGATGATCTAG0.604700.066800.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1439-1461TTCTAGATCATCGATTTTCTTCCAAGAAAAUCGAUGAUCUAGAACUAGAUCAUCGAUUUUCUUCCU5.321.422


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218UUUAAUUUCCAAGUAUAUU65.87811291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681236TTTAATTTCCAAGTATATTAATATACTTGGAAATTAAA0.360400.133700.491400.500001.000001.00000


Target Position: 1200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1200UGCUUCAGUAGGUAUGUAU77.8941623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571218TGCTTCAGTAGGTATGTATATACATACCTACTGAAGCA0.025300.003900.810300.750001.000001.00000


Target Position: 689, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689CCGCGACUCCCUUUUUAAA86.8998202

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_468919CCGCGACTCCCTTTTTAAA1/1/0/097.75ASNSNM_133436.2+NM_183356.2+NM_001673.31+1+1NANANA7:97488671..97488689(-)00ASNS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216707CCGCGACTCCCTTTTTAAATTTAAAAAGGGAGTCGCGG0.597200.017000.913801.000001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729ACACUAUGAAGUUUUGGAU79.7496524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505747ACACTATGAAGTTTTGGATATCCAAAACTTCATAGTGT0.015100.001600.525900.750000.989100.75000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CACAGAGGUCCAGAUGCAU83.4591341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486274CACAGAGGTCCAGATGCATATGCATCTGGACCTCTGTG0.093400.001600.637900.750001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206AGUAGGUAUGUAUUUAAUU84.6748285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311224AGTAGGTATGTATTTAATTAATTAAATACATACCTACT0.178500.007100.698300.750001.000001.00000


Target Position: 21, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
21AGGAGCCAGGUCGGUAUAA75.186788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48039AGGAGCCAGGTCGGTATAATTATACCGACCTGGCTCCT0.020200.002000.810300.750000.989101.00000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363AAUUCGAGUGAAGAAAUAU82.2007393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514381AATTCGAGTGAAGAAATATATATTTCTTCACTCGAATT0.218600.034100.465500.500001.000001.00000


Target Position: 1701, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701CAAUACUCCUAAAACCAAA94.627636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881719CAATACTCCTAAAACCAAATTTGGTTTTAGGAGTATTG0.784000.745600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1699-1721TTCAATACTCCTAAAACCAAAGAUUUGGUUUUAGGAGUAUUGAACAAUACUCCUAAAACCAAAGAU18.814.502


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CAACCUCAGGAUCCUUUUU78.3602599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201897CAACCTCAGGATCCTTTTTAAAAAGGATCCTGAGGTTG0.171900.054800.646600.750001.000001.00000


Target Position: 1446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446UCAUCGAUUUUCUUCCUAU82.4452384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421464TCATCGATTTTCTTCCTATATAGGAAGAAAATCGATGA0.695300.175900.681000.750001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532GAUGGUGUGUUUGCAUUUG72.2599944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463550GATGGTGTGTTTGCATTTGCAAATGCAAACACACCATC0.048900.008100.534500.500001.000001.00000


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700UCAAUACUCCUAAAACCAA82.9585358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161718TCAATACTCCTAAAACCAATTGGTTTTAGGAGTATTGA0.806300.759800.577600.750001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760GGCAAAGUUGCAUCCGUGG62.50241464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501778GGCAAAGTTGCATCCGTGGCCACGGATGCAACTTTGCC0.015700.008400.655200.500000.934800.62500


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095UAUUGGAAGUGAACAUUAU84.127313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431113TATTGGAAGTGAACATTATATAATGTTCACTTCCAATA0.108000.006200.500000.500001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599AAUAACUUCAGUUAAGAAU75.6361761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551617AATAACTTCAGTTAAGAATATTCTTAACTGAAGTTATT0.027900.007800.500000.500000.983700.62500


Target Position: 1958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958CUAACUUGGGUGUGAAAAA87.7361181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1956-1978GGCTAACTTGGGTGTGAAAAAAAUUUUUCACACCCAAGUUAGCCCUAACUUGGGUGUGAAAAAAAU14.911.821


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216UAUUUAAUUUCCAAGUAUA92.007985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401234TATTTAATTTCCAAGTATATATACTTGGAAATTAAATA0.209300.131700.500000.500001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CCUGCACGCCCUCUAUGAC70.67641042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390831CCTGCACGCCCTCTATGACGTCATAGAGGGCGTGCAGG0.194800.020000.525900.750000.907600.62500


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GGUUACAUAUAUUUUCACA97.958117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511315GGTTACATATATTTTCACATGTGAAAATATATGTAACC0.472600.180900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317AGGGTTACATATATTTTCACAAGUGUGAAAAUAUAUGUAACCCUGGUUACAUAUAUUUUCACAAGU14.914.601


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811CCCCUGCACGCCCUCUAUG60.14391572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223829CCCCTGCACGCCCTCTATGCATAGAGGGCGTGCAGGGG0.207800.022400.836200.750001.000001.00000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56CGCCCGUCAAGCUGUCCAC66.56011258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
38774CGCCCGTCAAGCTGTCCACGTGGACAGCTTGACGGGCG0.045000.014400.629300.750000.918500.62500


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234UCUGAGUGCUAUGAAGAUU73.449886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393252TCTGAGTGCTATGAAGATTAATCTTCATAGCACTCAGA0.367600.004400.715500.750001.000001.00000


Target Position: 1530, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530GACGUUUGAGGAUUCCAAU85.1162263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1528-1550GAGACGTTTGAGGATTCCAATCTAUUGGAAUCCUCAAACGUCUCGACGUUUGAGGAUUCCAAUCUU20.119.823


Target Position: 1207, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207GUAGGUAUGUAUUUAAUUU92.452368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341225GTAGGTATGTATTTAATTTAAATTAAATACATACCTAC0.166800.006700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1205-1227CAGTAGGTATGTATTTAATTTCCAAAUUAAAUACAUACCUACUGGUAGGUAUGUAUUUAAUUUCCU-9.719.812


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902AUGCUGUAAAGAAACGUUU68.44811175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486920ATGCTGTAAAGAAACGTTTAAACGTTTCTTTACAGCAT0.060400.006300.655200.500001.000001.00000


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273GAAGGAUCAGAUGAACUUA97.927118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941291GAAGGATCAGATGAACTTATAAGTTCATCTGATCCTTC0.049900.001400.637900.750001.000001.00000


Target Position: 119, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CAGAUUUUCUUCAAUCACA93.262851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
472137CAGATTTTCTTCAATCACATGTGATTGAAGAAAATCTG0.054400.034500.577600.500000.907600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
117-139CCCAGATTTTCTTCAATCACATCUGUGAUUGAAGAAAAUCUGGGCAGAUUUUCUUCAAUCACAUCU20.55.322


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627GACAGAAGAUGGAUUUUUG85.5921247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428645GACAGAAGATGGATTTTTGCAAAAATCCATCTTCTGTC0.032100.019900.672400.500001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879CUGUAAUGUGAAAGCAAAU83.9903318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2861897CTGTAATGTGAAAGCAAATATTTGCTTTCACATTACAG0.084300.029400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1877-1899TGCTGTAATGTGAAAGCAAATATAUUUGCUUUCACAUUACAGCACUGUAAUGUGAAAGCAAAUAUU18.613.512


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87AGCCCGCCACAUCACCCUG58.93241617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356105AGCCCGCCACATCACCCTGCAGGGTGATGTGGCGGGCT0.317300.154600.569000.500001.000001.00000


Target Position: 1715, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715CCAAAGAAGGAUAUUACUA92.567966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931733CCAAAGAAGGATATTACTATAGTAATATCCTTCTTTGG0.545800.009300.672401.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1713-1735AACCAAAGAAGGATATTACTACCUAGUAAUAUCCUUCUUUGGUUCCAAAGAAGGAUAUUACUACCU6.312.222


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733UAUGAAGUUUUGGAUUUAA83.8457323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515751TATGAAGTTTTGGATTTAATTAAATCCAAAACTTCATA0.017500.009300.508600.500001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203UUCAGUAGGUAUGUAUUUA81.1197452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911221TTCAGTAGGTATGTATTTATAAATACATACCTACTGAA0.081200.010100.637900.500001.000001.00000


Target Position: 1695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1695UCCCUUCAAUACUCCUAAA82.0759401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801713TCCCTTCAATACTCCTAAATTTAGGAGTATTGAAGGGA0.874200.125700.870700.750001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094AUAUUGGAAGUGAACAUUA86.5426216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101112ATATTGGAAGTGAACATTATAATGTTCACTTCCAATAT0.143600.014900.508600.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989UGUUGAAGCAGCUGAAAGA84.1183316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151007TGTTGAAGCAGCTGAAAGATCTTTCAGCTGCTTCAACA0.015800.001000.482800.500001.000001.00000


Target Position: 360, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360GCCAAUUCGAGUGAAGAAA79.996513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232378GCCAATTCGAGTGAAGAAATTTCTTCACTCGAATTGGC0.111700.039601.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
358-380CAGCCAATTCGAGTGAAGAAATAUUUCUUCACUCGAAUUGGCUGGCCAAUUCGAGUGAAGAAAUAU20.420.113


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588UUCAGUGAUGGAAUAACUU69.67561093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521606TTCAGTGATGGAATAACTTAAGTTATTCCATCACTGAA0.046700.008400.534500.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625UUAAGAUUUUACAGGAAUA84.7112282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661643TTAAGATTTTACAGGAATATATTCCTGTAAAATCTTAA0.124000.047100.491400.500001.000001.00000


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115CGCCCAGAUUUUCUUCAAU84.125314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228133CGCCCAGATTTTCTTCAATATTGAAGAAAATCTGGGCG0.147400.015500.913801.000001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GGGGAACAAUGAGAGUCAA94.654235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361951GGGGAACAATGAGAGTCAATTGACTCTCATTGTTCCCC0.057800.049500.844801.000001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370GUGAAGAAAUAUCCGUAUU81.8178414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190388GTGAAGAAATATCCGTATTAATACGGATATTTCTTCAC0.136400.060100.784500.750000.989101.00000


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510UGAGCAAACAAUUUGUAUG69.11641125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505528TGAGCAAACAATTTGTATGCATACAAATTGTTTGCTCA0.050400.001200.569000.500001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537UGUGUUUGCAUUUGUUUUA76.5914703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266555TGTGTTTGCATTTGTTTTATAAAACAAATGCAAACACA0.282900.011100.672400.750001.000001.00000


Target Position: 359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359AGCCAAUUCGAGUGAAGAA89.6128127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255377AGCCAATTCGAGTGAAGAATTCTTCACTCGAATTGGCT0.099600.042700.681000.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864AGAAACUGUGAAGAACAAC64.391388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376882AGAAACTGTGAAGAACAACGTTGTTCTTCACAGTTTCT0.320900.051800.577600.500001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973AAAAAAUAAAAGUCCUAAA87.2672191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641991AAAAAATAAAAGTCCTAAATTTAGGACTTTTATTTTTT0.936100.858000.500000.500001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GGAAUAACUUCAGUUAAGA92.236277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761615GGAATAACTTCAGTTAAGATCTTAACTGAAGTTATTCC0.176200.044500.646600.750000.994600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1595-1617ATGGAATAACTTCAGTTAAGAATUCUUAACUGAAGUUAUUCCAUGGAAUAACUUCAGUUAAGAAUU9.810.002


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738CAAGUCUUUGAACGCCAUU73.5137880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821756CAAGTCTTTGAACGCCATTAATGGCGTTCAAAGACTTG0.126100.004600.637900.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338UUGACCCGCUGUUUGGAAU62.01971485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317356TTGACCCGCTGTTTGGAATATTCCAAACAGCGGGTCAA0.070000.007900.637900.500000.978300.75000


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268CUGGAGAAGGAUCAGAUGA81.6352423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481286CTGGAGAAGGATCAGATGATCATCTGATCCTTCTCCAG0.049900.002500.560300.500001.000001.00000


Target Position: 54, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
54GCCGCCCGUCAAGCUGUCC48.9831875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41172GCCGCCCGTCAAGCTGTCCGGACAGCTTGACGGGCGGC0.035800.005400.629300.500000.918500.87500


Target Position: 732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732CUAUGAAGUUUUGGAUUUA92.080482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491750CTATGAAGTTTTGGATTTATAAATCCAAAACTTCATAG0.017000.007300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
730-752CACTATGAAGTTTTGGATTTAAAUAAAUCCAAAACUUCAUAGUGCUAUGAAGUUUUGGAUUUAAAU20.113.412


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183GACAUUACAACAGUUCGUG69.24231115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861201GACATTACAACAGTTCGTGCACGAACTGTTGTAATGTC0.047400.040900.525900.500001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615GUUUAAAGCAAUGACAGAA89.7016124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492633GTTTAAAGCAATGACAGAATTCTGTCATTGCTTTAAAC0.164700.053600.474100.750001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906UGUAAAGAAACGUUUGAUG64.46311382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396924TGTAAAGAAACGTTTGATGCATCAAACGTTTCTTTACA0.041700.033500.551700.500001.000001.00000


Target Position: 1716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1716CAAAGAAGGAUAUUACUAC82.3949388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001734CAAAGAAGGATATTACTACGTAGTAATATCCTTCTTTG0.680800.011200.465500.500001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878GCUGUAAUGUGAAAGCAAA97.717522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021896GCTGTAATGTGAAAGCAAATTTGCTTTCACATTACAGC0.075100.025100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1876-1898ATGCTGTAATGTGAAAGCAAATAUUUGCUUUCACAUUACAGCAUGCUGUAAUGUGAAAGCAAAUAU18.611.612


Target Position: 276, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
276CCGUUUUGAGAAUGUCAAU82.0786400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488294CCGTTTTGAGAATGTCAATATTGACATTCTCAAAACGG0.017500.002300.905201.000000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
274-296TTCCGTTTTGAGAATGTCAATGGAUUGACAUUCUCAAAACGGAACCGUUUUGAGAAUGUCAAUGGU20.512.533


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771AUCCGUGGAAAUGGUUAAA70.88991029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503789ATCCGTGGAAATGGTTAAATTTAACCATTTCCACGGAT0.023800.001200.681000.500000.978300.75000


Target Position: 55, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
55CCGCCCGUCAAGCUGUCCA71.2441011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41073CCGCCCGTCAAGCTGTCCATGGACAGCTTGACGGGCGG0.035900.006600.569000.750000.918500.75000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755CAAAUGGCAAAGUUGCAUC68.64461156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516773CAAATGGCAAAGTTGCATCGATGCAACTTTGCCATTTG0.123600.002300.465500.500000.934800.87500


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886AGGAUCCUUUUUAAUAAUG65.71351300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307904AGGATCCTTTTTAATAATGCATTATTAAAAAGGATCCT0.269200.076100.689700.500001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GAGAUACAUAUGGAGUCAG76.8407686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459608GAGATACATATGGAGTCAGCTGACTCCATATGTATCTC0.027300.019600.525900.500001.000001.00000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716CUUUUCUUCCUGGACACUA79.5587540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505734CTTTTCTTCCTGGACACTATAGTGTCCAGGAAGAAAAG0.035100.014500.465500.750001.000001.00000


Target Position: 20, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
20CAGGAGCCAGGUCGGUAUA82.9926357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48238CAGGAGCCAGGTCGGTATATATACCGACCTGGCTCCTG0.019100.002900.741400.750000.989101.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233GUCUGAGUGCUAUGAAGAU89.0555144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345251GTCTGAGTGCTATGAAGATATCTTCATAGCACTCAGAC0.359900.006000.637900.750001.000001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451GAUUUUCUUCCUAUUACUU87.2332193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621469GATTTTCTTCCTATTACTTAAGTAATAGGAAGAAAATC0.283200.262300.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1449-1471TCGATTTTCTTCCTATTACTTGTAAGUAAUAGGAAGAAAAUCGAGAUUUUCUUCCUAUUACUUGUU6.35.311


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928AGAUAGGGGAACAAUGAGA83.7725325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041946AGATAGGGGAACAATGAGATCTCATTGTTCCCCTATCT0.436200.032200.500000.500001.000001.00000


Target Position: 888, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888GAUCCUUUUUAAUAAUGCU85.6099245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
886-908AGGATCCTTTTTAATAATGCTGTAGCAUUAUUAAAAAGGAUCCUGAUCCUUUUUAAUAAUGCUGUU15.218.723


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435ACAGCAUUUUGAAUUUGAA90.738103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376453ACAGCATTTTGAATTTGAATTCAAATTCAAAATGCTGT0.510500.024900.534500.750001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370UCUAUUUGUUUGAUGUUCU71.8609966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821388TCTATTTGTTTGATGTTCTAGAACATCAAACAAATAGA0.086800.023400.500000.500001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829GCACGCUGACCCACUACAA92.137879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561847GCACGCTGACCCACTACAATTGTAGTGGGTCAGCGTGC0.736200.005500.706901.000001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GCCGAGGAGGAGAGUGAGA79.735528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001354GCCGAGGAGGAGAGTGAGATCTCACTCTCCTCCTCGGC0.130400.090500.775900.750001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432GUCCCAUUUCUAGAUCAUC69.29231111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341450GTCCCATTTCTAGATCATCGATGATCTAGAAATGGGAC0.140300.099700.637900.500000.989100.87500


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GUUUAAGAUUUUACAGGAA93.460849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951641GTTTAAGATTTTACAGGAATTCCTGTAAAATCTTAAAC0.106700.031000.474100.750001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710UAAAACCAAAGAAGGAUAU66.67731254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951728TAAAACCAAAGAAGGATATATATCCTTCTTTGGTTTTA0.016300.003700.491400.500000.962001.00000


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858AAAGCUUAGGUGGUCUUUA81.3888436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121876AAAGCTTAGGTGGTCTTTATAAAGACCACCTAAGCTTT0.127100.018800.465500.500001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436CAGCAUUUUGAAUUUGAAU83.7518327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271454CAGCATTTTGAATTTGAATATTCAAATTCAAAATGCTG0.300800.011000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
434-456AACAGCATTTTGAATTTGAATACAUUCAAAUUCAAAAUGCUGUUCAGCAUUUUGAAUUUGAAUACU7.418.501


Target Position: 211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211GAUGAUUGCCUUUCUGUUC72.9727904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501229GATGATTGCCTTTCTGTTCGAACAGAAAGGCAATCATC0.169100.027800.508600.500001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661GCUAAAGGUCUUGUUACAU82.4555382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135679GCTAAAGGTCTTGTTACATATGTAACAAGACCTTTAGC0.476100.032700.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
659-681AAGCTAAAGGTCTTGTTACATTGAUGUAACAAGACCUUUAGCUUGCUAAAGGUCUUGUUACAUUGU20.415.832


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525UAUGUUGGAUGGUGUGUUU76.4956709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411543TATGTTGGATGGTGTGTTTAAACACACCATCCAACATA0.175200.035800.543100.500001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134CACAUCUGAAUAAAUCACU76.5237708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503152CACATCTGAATAAATCACTAGTGATTTATTCAGATGTG0.193800.083100.586200.500000.983700.75000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542UUCCAAUCUGAUACCCAAA75.8702743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491560TTCCAATCTGATACCCAAATTTGGGTATCAGATTGGAA0.180200.046400.672400.500001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690CGCGACUCCCUUUUUAAAA81.7124417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
55708CGCGACTCCCTTTTTAAAATTTTAAAAAGGGAGTCGCG0.587700.607400.922401.000001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880UGUAAUGUGAAAGCAAAUA75.813745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2571898TGTAATGTGAAAGCAAATATATTTGCTTTCACATTACA0.098400.031600.663800.750001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713AGCCUUUUCUUCCUGGACA77.6247642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415731AGCCTTTTCTTCCTGGACATGTCCAGGAAGAAAAGGCT0.034700.018000.646600.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962CUUGGGUGUGAAAAAAAUA87.9343175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961980CTTGGGTGTGAAAAAAATATATTTTTTTCACACCCAAG0.902100.001400.594800.750001.000001.00000


Target Position: 1910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910UGGAUGGGGACUGUGGGUA66.35881264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661928TGGATGGGGACTGTGGGTATACCCACAGTCCCCATCCA0.046200.002000.663800.750001.000001.00000


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009GCCCAAGUACAGUAUCCUC76.3994714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711027GCCCAAGTACAGTATCCTCGAGGATACTGTACTTGGGC0.272900.244600.689700.750001.000001.00000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831ACGCUGACCCACUACAAGU73.9408857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851849ACGCTGACCCACTACAAGTACTTGTAGTGGGTCAGCGT0.018100.001800.569000.500001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GUGGAAAUGGUUAAAUAUC71.5853987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377793GTGGAAATGGTTAAATATCGATATTTAACCATTTCCAC0.153100.004700.612100.500001.000001.00000


Target Position: 1629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629GAUUUUACAGGAAUACGUU88.4515161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1627-1649AAGATTTTACAGGAATACGTTGAAACGUAUUCCUGUAAAAUCUUGAUUUUACAGGAAUACGUUGAU14.9-0.322


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610UUAAGAAUUCCUGGUUUAA75.2787782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691628TTAAGAATTCCTGGTTTAATTAAACCAGGAATTCTTAA0.050100.001900.500000.500001.000001.00000


Target Position: 1364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364GGGAACUCUAUUUGUUUGA78.8313573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841382GGGAACTCTATTTGTTTGATCAAACAAATAGAGTTCCC0.139000.001700.767200.750001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GUAGAGAUACAUAUGGAGU83.5993338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485605GTAGAGATACATATGGAGTACTCCATATGTATCTCTAC0.033400.005300.474100.500001.000001.00000


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856UCAAAGCUUAGGUGGUCUU65.94031281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011874TCAAAGCTTAGGTGGTCTTAAGACCACCTAAGCTTTGA0.115400.017900.586200.750001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191AACAGUUCGUGCUUCAGUA90.6435108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041209AACAGTTCGTGCTTCAGTATACTGAAGCACGAACTGTT0.022100.006500.465500.500001.000001.00000


Target Position: 475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475GAGAUAAUCCUUCAUCUUU89.3402136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
473-495GTGAGATAATCCTTCATCTTTATAAAGAUGAAGGAUUAUCUCACGAGAUAAUCCUUCAUCUUUAUU20.46.612


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107ACAUUAUGAAGUCCUUUUU75.2097785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901125ACATTATGAAGTCCTTTTTAAAAAGGACTTCATAATGT0.044100.007700.706900.750001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863UAGAAACUGUGAAGAACAA86.9148201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385881TAGAAACTGTGAAGAACAATTGTTCTTCACAGTTTCTA0.328600.051200.525900.500001.000001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406GGUGAAAUCUACAACCAUA106.5662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277424GGTGAAATCTACAACCATATATGGTTGTAGATTTCACC0.089200.027900.810301.000001.000001.00000


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696CCCUUCAAUACUCCUAAAA80.6446480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371714CCCTTCAATACTCCTAAAATTTTAGGAGTATTGAAGGG0.867900.132300.991401.000001.000001.00000