siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 445   893   930   957   1088   1102   1187   1188   1258   1282   1341   1402   1436   1439   1478   1684   1859   2121   2145   2156  
2258   2270   2449   2450   2454   2464   2480   2511   2587   2624  
Biltr, Rnaxs 101   102   103   104   105   106   109   110   111   112   164   165   166   168   174   175   176   177   180   184  
189   191   194   195   202   203   207   208   214   215   216   220   221   238   239   240   244   245   247   248  
281   282   283   284   285   286   287   288   295   296   297   305   308   337   338   346   347   349   350   361  
367   368   369   375   376   377   380   382   383   384   385   386   388   389   404   405   406   407   409   432  
433   436   437   438   439   440   442   443   472   475   476   477   482   483   488   489   494   495   496   498  
500   501   502   503   504   506   507   512   513   514   537   538   539   540   541   559   560   569   570   571  
577   578   579   580   581   613   614   615   616   617   625   630   631   632   635   636   637   640   641   642  
665   670   671   672   675   676   682   683   684   702   703   704   705   706   709   710   711   712   713   714  
724   728   736   737   738   739   740   741   742   743   744   748   749   763   766   767   768   769   780   782  
792   793   794   795   796   797   798   799   800   805   806   817   818   819   821   828   829   830   831   832  
834   835   836   839   840   843   845   846   847   853   854   859   860   861   864   867   868   869   871   895  
898   899   900   904   905   907   914   917   918   920   921   923   924   925   926   928   929   932   942   943  
946   948   949   951   952   954   961   962   966   973   974   975   976   977   979   980   981   982   984   985  
994   995   996   997   998   999   1000   1001   1002   1003   1004   1005   1011   1012   1013   1017   1018   1019   1020   1021  
1022   1023   1026   1031   1032   1033   1034   1036   1037   1040   1044   1045   1054   1055   1061   1062   1063   1069   1072   1073  
1075   1080   1081   1082   1083   1084   1085   1087   1090   1094   1095   1097   1098   1104   1105   1106   1107   1108   1110   1115  
1116   1119   1126   1127   1128   1129   1130   1131   1132   1133   1134   1135   1136   1137   1138   1139   1140   1143   1161   1168  
1171   1172   1173   1174   1175   1177   1178   1192   1193   1194   1199   1200   1203   1204   1233   1234   1246   1247   1248   1253  
1254   1255   1256   1257   1261   1267   1268   1271   1272   1274   1299   1300   1302   1305   1306   1307   1308   1309   1335   1336  
1339   1340   1343   1346   1347   1348   1349   1351   1360   1366   1370   1371   1372   1373   1374   1375   1376   1380   1381   1382  
1384   1388   1389   1392   1393   1394   1397   1398   1399   1400   1403   1404   1405   1407   1410   1411   1412   1417   1418   1422  
1423   1424   1425   1426   1427   1451   1463   1464   1465   1466   1467   1468   1469   1470   1471   1472   1473   1474   1475   1476  
1477   1479   1481   1484   1485   1487   1488   1494   1495   1499   1505   1506   1507   1540   1541   1542   1543   1544   1545   1546  
1547   1548   1549   1551   1553   1560   1561   1562   1563   1566   1567   1571   1572   1573   1574   1575   1576   1629   1630   1631  
1632   1633   1636   1637   1638   1642   1643   1644   1674   1675   1676   1677   1678   1679   1680   1681   1682   1683   1691   1692  
1693   1748   1749   1750   1754   1755   1756   1758   1775   1776   1777   1778   1779   1784   1786   1787   1789   1791   1792   1794  
1795   1796   1799   1800   1809   1810   1811   1821   1822   1824   1825   1826   1827   1828   1864   1865   1868   1869   1870   1871  
1873   1878   1879   1880   1882   1883   1884   1907   1908   1909   1944   1945   1946   1956   1967   1976   1977   1984   1985   1986  
1987   1988   2061   2068   2069   2077   2078   2079   2080   2081   2082   2083   2084   2085   2086   2087   2088   2089   2090   2093  
2096   2097   2098   2099   2106   2107   2108   2109   2110   2118   2122   2144   2150   2151   2152   2153   2154   2155   2163   2164  
2195   2198   2199   2200   2209   2214   2215   2218   2219   2220   2221   2222   2223   2224   2225   2228   2229   2239   2240   2241  
2242   2243   2244   2245   2248   2249   2250   2251   2255   2256   2257   2260   2261   2262   2263   2264   2266   2267   2268   2269  
2277   2279   2291   2292   2295   2296   2297   2298   2299   2302   2304   2305   2306   2316   2325   2326   2327   2328   2329   2332  
2333   2334   2337   2338   2339   2340   2347   2348   2349   2351   2353   2354   2356   2361   2362   2364   2365   2366   2367   2368  
2374   2375   2383   2384   2385   2386   2387   2388   2389   2390   2391   2392   2393   2394   2396   2397   2400   2410   2412   2417  
2418   2419   2420   2426   2431   2440   2443   2456   2457   2458   2459   2460   2488   2489   2490   2495   2496   2497   2498   2501  
2502   2503   2506   2508   2509   2512   2513   2514   2515   2520   2522   2526   2527   2531   2532   2533   2534   2535   2540   2548  
2549   2552   2553   2554   2562   2563   2567   2568   2571   2572   2573   2574   2576   2580   2584   2585   2586   2589   2593   2594  
2595   2596   2597   2600   2601   2602   2603   2604   2607   2610   2611   2617   2618   2619   2620   2621   2622   2623   2626   2627  
2629   2631   2632   2633   2640   2641   2649   2650   2651   2673   2674   2675   2676   2677   2678   2679   2680   2682  
Biltr, Ernai, Rnaxs 167   209   210   558   677  
Biltr, Rnaxs, Sidirect 190   470   517   664   715   781   790   791   801   803   820   833   841   842   844   894   902   903   906   919  
947   953   955   983   1024   1025   1041   1074   1086   1096   1109   1117   1141   1142   1260   1273   1301   1310   1344   1345  
1385   1386   1395   1396   1408   1480   1486   1552   1634   1635   1788   1790   1797   1798   1801   1802   2091   2092   2094   2111  
2194   2196   2197   2203   2265   2275   2352   2355   2359   2360   2363   2395   2398   2399   2411   2439   2441   2442   2469   2510  
2517   2598   2599   2608   2609   2628   2630   2681  
Biltr, Ernai 241   431   458   550   663  


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346ACAUCUACAAGCCCAACAA86.236275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868364ACATCTACAAGCCCAACAATTGTTGGGCTTGTAGATGT0.017300.004300.560300.750001.000001.00000


Target Position: 2640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640ACAAUUUUUUAUCAUGCAU76.069939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442658ACAATTTTTTATCATGCATATGCATGATAAAAAATTGT0.021500.008300.551700.750001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904AACAAUUUAUGAAUUGAAU80.3282610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
658922AACAATTTATGAATTGAATATTCAATTCATAAATTGTT0.131800.082700.637900.500000.983700.62500


Target Position: 2209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2209GCUUUUUAUUCCUCCUGCU79.8604640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622227GCTTTTTATTCCTCCTGCTAGCAGGAGGAATAAAAAGC0.193600.017800.500000.750001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442ACCCUAAACACCUCAACGA76.1821931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641460ACCCTAAACACCTCAACGATCGTTGAGGTGTTTAGGGT0.082200.080300.560300.500001.000001.00000


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604GAUUGCUGAAAUUUUAUAU87.5847219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482622GATTGCTGAAATTTTATATATATAAAATTTCAGCAATC0.226700.004700.637900.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GCAUUAAGAGCUUCCUGAU89.1074174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651694GCATTAAGAGCTTCCTGATATCAGGAAGCTCTTAATGC0.088300.008700.672401.000001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676CACUAGCCCAAUGAAAUGA79.6197659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411694CACTAGCCCAATGAAATGATCATTTCATTGGGCTAGTG0.359200.037700.569000.500001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431CUGAAAAUGUGCUAUACUG79.505673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612449CTGAAAATGTGCTATACTGCAGTATAGCACATTTTCAG0.018800.003100.500000.500001.000001.00000


Target Position: 2154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154AGGAAUUUCACCUGUAAAC65.68171750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022172AGGAATTTCACCTGTAAACGTTTACAGGTGAAATTCCT0.096600.014000.698300.500000.956500.62500


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703AGUGCAUCAGCCGUGUCUA85.4161311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754721AGTGCATCAGCCGTGTCTATAGACACGGCTGATGCACT0.176900.004500.534500.750000.929300.87500


Target Position: 635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635CGCCAUUCUCUCUUUCCUG72.57491214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513653CGCCATTCTCTCTTTCCTGCAGGAAAGAGAGAATGGCG0.157200.019500.637900.750001.000001.00000


Target Position: 2595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GGUCCAAAAGAUUGCUGAA97.080518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572613GGTCCAAAAGATTGCTGAATTCAGCAATCTTTTGGACC0.041700.022200.681001.000001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423GAUAUUUUCUGUGCCUGAA90.7518118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821441GATATTTTCTGTGCCTGAATTCAGGCACAGAAAATATC0.065200.027100.508600.750001.000001.00000


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353CUGUUACCUACUUUGACUU78.9167705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632371CTGTTACCTACTTTGACTTAAGTCAAAGTAGGTAACAG0.288600.096900.646600.750001.000001.00000


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268GCAAACUCUUUUCCCACUG63.77251878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131286GCAAACTCTTTTCCCACTGCAGTGGGAAAAGAGTTTGC0.511900.006300.569000.750001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UGAGCUAUUUCAUCUAUUU83.4903408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601000TGAGCTATTTCATCTATTTAAATAGATGAAATAGCTCA0.583300.015000.724100.750001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506GGGUCUAACUCAGCAACUC76.2848916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341524GGGTCTAACTCAGCAACTCGAGTTGCTGAGTTAGACCC0.127700.097400.681000.750001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079AUGGGGGAGGAGGCAGUAA71.22211332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492097ATGGGGGAGGAGGCAGTAATTACTGCCTCCTCCCCCAT0.188600.020100.620700.500001.000001.00000


Target Position: 2480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480CUUUAUAUGAAGAAAAUCA90.0725136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2478-2500ATCTTTATATGAAGAAAATCACTUGAUUUUCUUCAUAUAAAGAUCUUUAUAUGAAGAAAAUCACUU10.4-8.023


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250GGACUUUUCUUAAACCUUC76.339907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2502268GGACTTTTCTTAAACCTTCGAAGGTTTAAGAAAAGTCC0.397600.299500.698300.750001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407UGAAAUUUUAACCUAUGAU76.2343922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861425TGAAATTTTAACCTATGATATCATAGGTTAAAATTTCA0.410400.269200.543100.750001.000001.00000


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621AUGCUUACUGAUAUAUUUU78.349753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272639ATGCTTACTGATATATTTTAAAATATATCAGTAAGCAT0.042100.022200.655200.500001.000001.00000


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873ACAUUGUGUUCCCAUUUCA84.9501329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191891ACATTGTGTTCCCATTTCATGAAATGGGAACACAATGT0.067400.015600.482800.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GACGCGCACACCAAGGAGA81.6045511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
837423GACGCGCACACCAAGGAGATCTCCTTGGTGTGCGCGTC0.090300.002000.594800.500001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917UUGAAUUAUCUUGGUUGAA69.70871445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846935TTGAATTATCTTGGTTGAATTCAACCAAGATAATTCAA0.089800.022000.474100.500001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682AGAGCUUCCUGAUUGAGAU87.078245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828700AGAGCTTCCTGATTGAGATATCTCAATCAGGAAGCTCT0.025400.019000.543100.750001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967UGACCCCUGCUCAGUAAAG61.46112010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8361985TGACCCCTGCTCAGTAAAGCTTTACTGAGCAGGGGTCA0.023100.008100.586200.500000.994600.62500


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335UCCAGUGAUCCUUACAAGU67.07921645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461353TCCAGTGATCCTTACAAGTACTTGTAAGGATCACTGGA0.021300.002300.663800.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257GCAGAUUUUCAGCAAACUC73.66331116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6151275GCAGATTTTCAGCAAACTCGAGTTTGCTGAAAATCTGC0.090700.037700.543100.750001.000001.00000


Target Position: 2450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450CAUACUUUUUAAAUGUAAA96.925819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2448-2470TGCATACTTTTTAAATGTAAAGAUUUACAUUUAAAAAGUAUGCACAUACUUUUUAAAUGUAAAGAU6.94.612


Target Position: 1802, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802GUUUAUUUUCAAGAAUAAU81.8408499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691820GTTTATTTTCAAGAATAATATTATTCTTGAAAATAAAC0.039100.012100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1800-1822TCGTTTATTTTCAAGAATAATCAAUUAUUCUUGAAAAUAAACGAGUUUAUUUUCAAGAAUAAUCAU6.9-9.722


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CUUGCUGUCUGCCCUCUUU78.1623762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850599CTTGCTGTCTGCCCTCTTTAAAGAGGGCAGACAGCAAG0.020400.005500.637900.750000.967400.87500


Target Position: 1684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684CAAUGAAAUGAAUUAAAGU88.4628193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1682-1704CCCAATGAAATGAATTAAAGTGGACUUUAAUUCAUUUCAUUGGGCAAUGAAAUGAAUUAAAGUGGU-4.37.422


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CUUGGUUGAAAAUAAAAAG70.19951398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796944CTTGGTTGAAAATAAAAAGCTTTTTATTTTCAACCAAG0.099500.025400.500000.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013AUUUUUAAAACCCAUUUAA77.9197783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441031ATTTTTAAAACCCATTTAATTAAATGGGTTTTAAAAAT0.127900.098600.474100.500001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820CAUUUCAAGGAUAGAAGUA90.7448119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852838CATTTCAAGGATAGAAGTATACTTCTATCCTTGAAATG0.047700.007100.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
818-840GACATTTCAAGGATAGAAGTATAUACUUCUAUCCUUGAAAUGUCCAUUUCAAGGAUAGAAGUAUAU18.97.421


Target Position: 2441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441GCUAUACUGCAUACUUUUU84.8801333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062459GCTATACTGCATACTTTTTAAAAAGTATGCAGTATAGC0.030000.004500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2439-2461GTGCTATACTGCATACTTTTTAAAAAAAGUAUGCAGUAUAGCACGCUAUACUGCAUACUUUUUAAU4.911.222


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268CAGUUAUGAUUUUUUUUUC76.453895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142286CAGTTATGATTTTTTTTTCGAAAAAAAAATCATAACTG0.090800.006200.612100.500001.000001.00000


Target Position: 2325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325CAGUCUUCCUGACACUUUA97.49216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842343CAGTCTTCCTGACACTTTATAAAGTGTCAGGAAGACTG0.241500.023200.750000.750000.913000.75000


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680UGCACAAUAAAAAUGUUUA82.2189483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982698TGCACAATAAAAATGTTTATAAACATTTTTATTGTGCA0.610700.059200.819000.750000.994600.75000


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907AAUUUAUGAAUUGAAUUAU78.2505759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878925AATTTATGAATTGAATTATATAATTCAATTCATAAATT0.098200.062300.465500.500001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482UGAAGAUGUGAUUGCAGAA90.2093132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758500TGAAGATGTGATTGCAGAATTCTGCAATCACATCTTCA0.041500.008600.551700.750001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684AGCUUCCUGAUUGAGAUUC53.78982381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
873702AGCTTCCTGATTGAGATTCGAATCTCAATCAGGAAGCT0.015800.008100.681000.500001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021AACCCAUUUAAAUUUUUUU72.61271209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471039AACCCATTTAAATTTTTTTAAAAAAATTTAAATGGGTT0.218800.089300.646600.500001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077AGAUGGGGGAGGAGGCAGU66.87231662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7022095AGATGGGGGAGGAGGCAGTACTGCCTCCTCCCCCATCT0.057700.017300.517200.500001.000001.00000


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143AAAAAAAAAAAAAAGAAAA80.7878573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201161AAAAAAAAAAAAAAGAAAATTTTCTTTTTTTTTTTTTT0.991000.988700.500000.500001.000001.00000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973UGUCUCUUCUGAGCUAUUU70.28371395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
887991TGTCTCTTCTGAGCTATTTAAATAGCTCAGAAGAGACA0.013100.003100.706900.750000.907600.87500


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980UCUGAGCUAUUUCAUCUAU77.3478826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684998TCTGAGCTATTTCATCTATATAGATGAAATAGCTCAGA0.606500.007400.681000.750001.000001.00000


Target Position: 2580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2580UGCAAAUCAAUUACUGGUC56.75712250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272598TGCAAATCAATTACTGGTCGACCAGTAATTGATTTGCA0.500000.034400.534500.500000.923900.62500


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928UGGUUGAAAAUAAAAAGAU74.73861042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575946TGGTTGAAAATAAAAAGATATCTTTTTATTTTCAACCA0.108500.022900.663800.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477GACUUUGAAGAUGUGAUUG71.99391261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781495GACTTTGAAGATGTGATTGCAATCACATCTTCAAAGTC0.035900.010500.672400.500001.000001.00000


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632UAUAUUUUACAAUUUUUUA83.0921431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372650TATATTTTACAATTTTTTATAAAAAATTGTAAAATATA0.113000.030000.508600.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332CCUGACACUUUAAUUACCA85.4101312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502350CCTGACACTTTAATTACCATGGTAATTAAAGTGTCAGG0.746200.153400.500000.750001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082GGCUGAGAUAUGAACAUAU96.423822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751100GGCTGAGATATGAACATATATATGTTCATATCTCAGCC0.089100.007900.956901.000001.000001.00000


Target Position: 102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
102GGGCCAACCGCGAGCAGAA89.5268155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565120GGGCCAACCGCGAGCAGAATTCTGCTCGCGGTTGGCCC0.165100.014300.819001.000000.934800.75000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463GACCUCAGUGCCUUCCUGU76.6587875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641481GACCTCAGTGCCTTCCTGTACAGGAAGGCACTGAGGTC0.315500.014300.612100.500000.902200.62500


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032AUUUUUUUCCUUACCUUUU66.43641691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8361050ATTTTTTTCCTTACCTTTTAAAAGGTAAGGAAAAAAAT0.877800.507800.508600.500001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589AUUACUGGUCCAAAAGAUU73.80411103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442607ATTACTGGTCCAAAAGATTAATCTTTTGGACCAGTAAT0.045400.018900.500000.500001.000001.00000


Target Position: 2334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2334UGACACUUUAAUUACCAAC61.9661976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312352TGACACTTTAATTACCAACGTTGGTAATTAAAGTGTCA0.742300.195200.577600.500001.000001.00000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433UCAACCGCGACCCUAAACA64.19571850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660451TCAACCGCGACCCTAAACATGTTTAGGGTCGCGGTTGA0.368600.049900.517200.500001.000001.00000


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285GGGGGCAAAUACGUAGACU78.6596724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
653303GGGGGCAAATACGTAGACTAGTCTACGTATTTGCCCCC0.132200.008700.784500.750001.000001.00000


Target Position: 1643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643GGCAACAUCUUUAUCCGUA91.1164107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231661GGCAACATCTTTATCCGTATACGGATAAAGATGTTGCC0.133300.112700.819001.000001.000001.00000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638CAUCUGGCAACAUCUUUAU82.831442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671656CATCTGGCAACATCTTTATATAAAGATGTTGCCAGATG0.278000.026500.612100.750001.000001.00000


Target Position: 930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930GUUGAAAAUAAAAAGAUCA87.5077227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
928-950TGGTTGAAAATAAAAAGATCACTUGAUCUUUUUAUUUUCAACCAGUUGAAAAUAAAAAGAUCACUU14.87.722


Target Position: 2540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540UCCAAGACAUGUCUGUUCU69.03761490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652558TCCAAGACATGTCTGTTCTAGAACAGACATGTCTTGGA0.017900.002000.646600.500000.989100.62500


Target Position: 2297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2297UGGAACUCUGCUUGAUUUU66.18781714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552315TGGAACTCTGCTTGATTTTAAAATCAAGCAGAGTTCCA0.690900.062400.844800.750001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459UAAAUGUAAAGAUAUUUUU73.82251101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742477TAAATGTAAAGATATTTTTAAAAATATCTTTACATTTA0.044800.003300.534500.500001.000001.00000


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786AUGUCUAUUCAGCUUCGUU79.2742683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901804ATGTCTATTCAGCTTCGTTAACGAAGCTGAATAGACAT0.070800.038000.508600.500001.000001.00000


Target Position: 1986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1986CACUUGCAACCGUCUGUUA91.1659104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392004CACTTGCAACCGTCTGTTATAACAGACGGTTGCAAGTG0.046900.007800.758600.750001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203GAUCUUCCUUCCUCAGUUC76.5375886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681221GATCTTCCTTCCTCAGTTCGAACTGAGGAAGGAAGATC0.222300.168600.508600.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503AGAAGGGACACACAGUUUU75.4277984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581521AGAAGGGACACACAGTTTTAAAACTGTGTGTCCCTTCT0.106400.013900.724100.750001.000001.00000


Target Position: 2340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2340UUUAAUUACCAACCUGUUA72.69081198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832358TTTAATTACCAACCTGTTATAACAGGTTGGTAATTAAA0.250700.244800.465500.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351AGUUAGAAAACAUAAUCUU83.3196416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371369AGTTAGAAAACATAATCTTAAGATTATGTTTTCTAACT0.168900.030900.569000.750000.962000.62500


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388GCGAGAAGCAAGUGUACGA89.3005163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535406GCGAGAAGCAAGTGTACGATCGTACACTTGCTTCTCGC0.126900.026800.629300.750001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573UCCCUCAUGCAAAUCAAUU65.55261758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102591TCCCTCATGCAAATCAATTAATTGATTTGCATGAGGGA0.209900.030500.862100.750001.000001.00000


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151CUGAGGAAUUUCACCUGUA92.157886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042169CTGAGGAATTTCACCTGTATACAGGTGAAATTCCTCAG0.224300.002900.603400.750000.940200.75000


Target Position: 386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386GAGCGAGAAGCAAGUGUAC77.2663832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846404GAGCGAGAAGCAAGTGTACGTACACTTGCTTCTCGCTC0.147900.011300.629300.500000.983700.75000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920AAUUAUCUUGGUUGAAAAU79.1032698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755938AATTATCTTGGTTGAAAATATTTTCAACCAAGATAATT0.234400.028500.500000.500001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810UCAAGAAUAAUCACGCUUU72.96931174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801828TCAAGAATAATCACGCTTTAAAGCGTGATTATTCTTGA0.107500.026900.724100.750001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942AAGAUCACUUUCUCAGUUU77.7755797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849960AAGATCACTTTCTCAGTTTAAACTGAGAAAGTGATCTT0.020600.004200.637900.500000.962000.75000


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140AGGAAAAAAAAAAAAAAGA77.3587825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781158AGGAAAAAAAAAAAAAAGATCTTTTTTTTTTTTTTCCT0.992000.988600.620700.500001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381UGAUCCAACUAAUGCCUUA86.7202255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071399TGATCCAACTAATGCCTTATAAGGCATTAGTTGGATCA0.833700.766300.689700.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GGCAGUAAUAAAAAGAUUG76.1997929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562108GGCAGTAATAAAAAGATTGCAATCTTTTTATTACTGCC0.476700.092300.853400.750001.000001.00000


Target Position: 1540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540CCUCCCUGAAGACCAAAAU72.6541203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261558CCTCCCTGAAGACCAAAATATTTTGGTCTTCAGGGAGG0.176700.074900.836201.000001.000001.00000


Target Position: 1754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1754UCCCUGCCUCUCAUCAACU65.23191788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391772TCCCTGCCTCTCATCAACTAGTTGATGAGAGGCAGGGA0.160500.015500.663800.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003GGCAGUCUGAAUUUUUAAA91.3485100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2161021GGCAGTCTGAATTTTTAAATTTAAAAATTCAGACTGCC0.341400.160201.000001.000001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244ACCUCCUCACAGUUUUCAU76.2902915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382262ACCTCCTCACAGTTTTCATATGAAAACTGTGAGGAGGT0.562200.433200.698300.750001.000001.00000


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292CUUAUUGGAACUCUGCUUG63.05541919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072310CTTATTGGAACTCTGCTTGCAAGCAGAGTTCCAATAAG0.147700.011600.491400.500001.000001.00000


Target Position: 1544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544CCUGAAGACCAAAAUUAGA87.1109243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7971562CCTGAAGACCAAAATTAGATCTAATTTTGGTCTTCAGG0.160700.003100.620700.750001.000001.00000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253GUGGGCAGAUUUUCAGCAA86.6929259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381271GTGGGCAGATTTTCAGCAATTGCTGAAAATCTGCCCAC0.200600.002000.646600.750000.983700.75000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905ACAAUUUAUGAAUUGAAUU76.1496933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509923ACAATTTATGAATTGAATTAATTCAATTCATAAATTGT0.137600.080200.698300.750000.983700.62500


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020AAACCCAUUUAAAUUUUUU74.84471030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911038AAACCCATTTAAATTTTTTAAAAAATTTAAATGGGTTT0.203100.091900.500000.500001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779GGUCAGCAUGUCUAUUCAG82.5131465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521797GGTCAGCATGTCTATTCAGCTGAATAGACATGCTGACC0.090000.008700.569000.750001.000001.00000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184UUCCCCCCAUACAAUACAA73.90841097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
712202TTCCCCCCATACAATACAATTGTATTGTATGGGGGGAA0.748900.740800.525900.500001.000001.00000


Target Position: 2152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152UGAGGAAUUUCACCUGUAA89.1577171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692170TGAGGAATTTCACCTGTAATTACAGGTGAAATTCCTCA0.218900.004000.689700.750000.940200.75000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GACGAAAUACUGGUUUUAC74.84021032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842578GACGAAATACTGGTTTTACGTAAAACCAGTATTTCGTC0.021500.005300.637900.500001.000001.00000


Target Position: 208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
208UCCUUCCUCAGUUCCCUUA68.16681567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445226TCCTTCCTCAGTTCCCTTATAAGGGAACTGAGGAAGGA0.168100.122700.836200.750001.000001.00000


Target Position: 105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
105CCAACCGCGAGCAGAACAA79.3918678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326123CCAACCGCGAGCAGAACAATTGTTCTGCTCGCGGTTGG0.373000.051500.698301.000001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630UACUUCGCCAUUCUCUCUU61.1382033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588648TACTTCGCCATTCTCTCTTAAGAGAGAATGGCGAAGTA0.621700.133600.543100.500001.000001.00000


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620UAUGCUUACUGAUAUAUUU84.5717346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242638TATGCTTACTGATATATTTAAATATATCAGTAAGCATA0.035500.022400.543100.500001.000001.00000


Target Position: 616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616UCAUCUGGGGCAUUUACUU71.05071346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688634TCATCTGGGGCATTTACTTAAGTAAATGCCCCAGATGA0.740700.007200.586200.750001.000001.00000


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081UGGCUGAGAUAUGAACAUA88.5117187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901099TGGCTGAGATATGAACATATATGTTCATATCTCAGCCA0.089200.003200.801700.750001.000001.00000


Target Position: 2386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2386AGACACUGGCAUGGAUAUA83.329415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592404AGACACTGGCATGGATATATATATCCATGCCAGTGTCT0.041500.027700.681000.750001.000001.00000


Target Position: 1187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187CCAAAAUGUUGGUCAUUUU86.4497266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1185-1207CTCCAAAATGTTGGTCATTTTATAAAAUGACCAACAUUUUGGAGCCAAAAUGUUGGUCAUUUUAUU14.84.222


Target Position: 2258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258CUUAAACCUUCAGUUAUGA81.3552529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2256-2278TTCTTAAACCTTCAGTTATGATTUCAUAACUGAAGGUUUAAGAACUUAAACCUUCAGUUAUGAUUU11.614.032


Target Position: 1041, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041CUUACCUUUUUAUUUGCAU75.14511002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231059CTTACCTTTTTATTTGCATATGCAAATAAAAAGGTAAG0.238100.235400.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1039-1061TCCTTACCTTTTTATTTGCATGTAUGCAAAUAAAAAGGUAAGGACUUACCUUUUUAUUUGCAUGUU20.018.622


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637UCAUCUGGCAACAUCUUUA84.719341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861655TCATCTGGCAACATCTTTATAAAGATGTTGCCAGATGA0.280400.022900.689700.750001.000001.00000


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111GCGAGCAGAACAAACCUUU76.6196879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
157129GCGAGCAGAACAAACCTTTAAAGGTTTGTTCTGCTCGC0.468600.197700.922401.000001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104UGAAAGGUAAUUUGAGAGA72.98321172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221122TGAAAGGTAATTTGAGAGATCTCTCAAATTACCTTTCA0.198200.090100.500000.500001.000001.00000


Target Position: 202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
202AGAUCUUCCUUCCUCAGUU83.9641376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518220AGATCTTCCTTCCTCAGTTAACTGAGGAAGGAAGATCT0.239600.192500.577600.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GCAAUGUCCGCAUCAACUU79.2594688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825799GCAATGTCCGCATCAACTTAAGTTGATGCGGACATTGC0.054400.002300.715501.000000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801CAGCAATGTCCGCATCAACTTGCAAGUUGAUGCGGACAUUGCUGGCAAUGUCCGCAUCAACUUGCU19.220.533


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107AAGGUAAUUUGAGAGAAAU80.9448552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481125AAGGTAATTTGAGAGAAATATTTCTCTCAAATTACCTT0.216500.077100.629300.500001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900CAGCAACAAUUUAUGAAUU87.3511232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
751918CAGCAACAATTTATGAATTAATTCATAAATTGTTGCTG0.158800.004500.775900.750001.000001.00000


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106CAACCGCGAGCAGAACAAA87.5561221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334124CAACCGCGAGCAGAACAAATTTGTTCTGCTCGCGGTTG0.498900.068600.646600.750001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908CCAAGGAGGGGCUGUAAAA87.3408233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981926CCAAGGAGGGGCTGTAAAATTTTACAGCCCCTCCTTGG0.144000.141900.844801.000001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739CCGUCUGUGACCCACUCUU77.1853838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592757CCGTCTGTGACCCACTCTTAAGAGTGGGTCACAGACGG0.421100.012200.775901.000000.956500.75000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443UAUACUGCAUACUUUUUAA91.2683101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292461TATACTGCATACTTTTTAATTAAAAAGTATGCAGTATA0.046000.006900.508600.500001.000001.00000


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860AAUUUUCCUGGUGCCAAUU65.411773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756878AATTTTCCTGGTGCCAATTAATTGGCACCAGGAAAATT0.210200.095100.500000.500001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898UACAGCAACAAUUUAUGAA80.6132592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798916TACAGCAACAATTTATGAATTCATAAATTGTTGCTGTA0.180200.003100.508600.500001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879UGUUCCCAUUUCAGCUGAU74.19091079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6531897TGTTCCCATTTCAGCTGATATCAGCTGAAATGGGAACA0.178600.018600.525900.750001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682CACAAUAAAAAUGUUUAAC66.06641723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7092700CACAATAAAAATGTTTAACGTTAAACATTTTTATTGTG0.516600.246400.646600.500000.994600.62500


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GUCUGGGGGCAAAUACGUA88.4938189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847299GTCTGGGGGCAAATACGTATACGTATTTGCCCCCAGAC0.296600.001700.637900.750001.000001.00000


Target Position: 209, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209CCUUCCUCAGUUCCCUUAA79.7671646

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_820919CCTTCCTCAGTTCCCTTAA1/1/0/088.67CAV1NM_001753.31NANANANA00CAV1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435227CCTTCCTCAGTTCCCTTAATTAAGGGAACTGAGGAAGG0.170800.121600.810301.000001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743CUGUGACCCACUCUUUGAA87.7221212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471761CTGTGACCCACTCTTTGAATTCAAAGAGTGGGTCACAG0.531400.042200.612100.750000.978300.75000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073CGCUUUAUUGGCUGAGAUA92.869270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121091CGCTTTATTGGCTGAGATATATCTCAGCCAATAAAGCG0.092000.014000.879301.000001.000001.00000


Target Position: 1822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822ACGCUUUCCUGAAUCCAAA83.4815409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881840ACGCTTTCCTGAATCCAAATTTGGATTCAGGAAAGCGT0.033600.015700.775900.750001.000001.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295AUUGGAACUCUGCUUGAUU76.2529921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522313ATTGGAACTCTGCTTGATTAATCAAGCAGAGTTCCAAT0.134000.008600.500000.500001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884CCAUUUCAGCUGAUCAGUG75.5794975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351902CCATTTCAGCTGATCAGTGCACTGATCAGCTGAAATGG0.047400.010400.551700.750001.000001.00000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702CAGUGCAUCAGCCGUGUCU76.5005890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779720CAGTGCATCAGCCGTGTCTAGACACGGCTGATGCACTG0.152600.003700.560300.500000.929301.00000


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998UUUUUGGCAGUCUGAAUUU64.60931828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691016TTTTTGGCAGTCTGAATTTAAATTCAGACTGCCAAAAA0.237800.051600.500000.500001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869CUCAACAUUGUGUUCCCAU76.2284925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6991887CTCAACATTGTGTTCCCATATGGGAACACAATGTTGAG0.058900.026400.655200.750001.000001.00000


Target Position: 2225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225GCUCAUAUUGUGAUUCUGC71.35231316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402243GCTCATATTGTGATTCTGCGCAGAATCACAATATGAGC0.122100.061100.500000.500001.000001.00000


Target Position: 2121, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2121GGAAUAAGUUCAAAUUCUU93.000964

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2119-2141CTGGAATAAGTTCAAATTCTTCTAAGAAUUUGAACUUAUUCCAGGGAAUAAGUUCAAAUUCUUCUU5.36.932


Target Position: 833, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833GAAGUAUACCUGAUUUUUU91.690294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530851GAAGTATACCTGATTTTTTAAAAAATCAGGTATACTTC0.130500.030800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
831-853TAGAAGTATACCTGATTTTTTTTAAAAAAUCAGGUAUACUUCUAGAAGUAUACCUGAUUUUUUUUU0.46.321


Target Position: 1074, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GCUUUAUUGGCUGAGAUAU81.4111526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301092GCTTTATTGGCTGAGATATATATCTCAGCCAATAAAGC0.163400.017900.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1072-1094TCGCTTTATTGGCTGAGATATGAAUAUCUCAGCCAAUAAAGCGAGCUUUAUUGGCUGAGAUAUGAU21.4-4.332


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976CUCUUCUGAGCUAUUUCAU77.4305824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706994CTCTTCTGAGCTATTTCATATGAAATAGCTCAGAAGAG0.257700.006400.655200.750000.967400.62500


Target Position: 2411, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411CUUUUAAACUGUGUACAUA93.565254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672429CTTTTAAACTGTGTACATATATGTACACAGTTTAAAAG0.112400.073400.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2409-2431TACTTTTAAACTGTGTACATAACUAUGUACACAGUUUAAAAGUACUUUUAAACUGUGUACAUAACU20.4-9.112


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308UGCCAUUCACUUCAUAAUC61.19552029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241326TGCCATTCACTTCATAATCGATTATGAAGTGAATGGCA0.245200.129600.672400.500001.000001.00000


Target Position: 2222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2222CCUGCUCAUAUUGUGAUUC64.07291861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382240CCTGCTCATATTGTGATTCGAATCACAATATGAGCAGG0.234800.057800.672400.750001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002UGGCAGUCUGAAUUUUUAA83.4318411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271020TGGCAGTCTGAATTTTTAATTAAAAATTCAGACTGCCA0.267000.092700.810300.750001.000001.00000


Target Position: 2511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511CUUUGUGAUUCAAUCUGUA95.009434

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2509-2531GGCTTTGTGATTCAATCTGTAAAUACAGAUUGAAUCACAAAGCCCUUUGUGAUUCAAUCUGUAAAU19.220.511


Target Position: 1172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172CCUCAACUGCCUACUCCAA89.15172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301190CCTCAACTGCCTACTCCAATTGGAGTAGGCAGTTGAGG0.460700.389600.698301.000001.000001.00000


Target Position: 2576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576CUCAUGCAAAUCAAUUACU73.39981135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952594CTCATGCAAATCAATTACTAGTAATTGATTTGCATGAG0.190200.025400.603400.500000.923900.62500


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642CUCUCUUUCCUGCACAUCU77.7759796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662660CTCTCTTTCCTGCACATCTAGATGTGCAGGAAAGAGAG0.072800.045200.586200.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679UAGCCCAAUGAAAUGAAUU69.73061441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981697TAGCCCAATGAAATGAATTAATTCATTTCATTGGGCTA0.546700.093400.663800.500001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382GAUCCAACUAAUGCCUUAC72.67261200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441400GATCCAACTAATGCCTTACGTAAGGCATTAGTTGGATC0.832600.775000.500000.500001.000001.00000


Target Position: 2244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2244CUUUGGGGACUUUUCUUAA87.8116210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072262CTTTGGGGACTTTTCTTAATTAAGAAAAGTCCCCAAAG0.540200.002700.603400.750001.000001.00000


Target Position: 1086, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1086GAGAUAUGAACAUAUUGUU90.8362116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801104GAGATATGAACATATTGTTAACAATATGTTCATATCTC0.063800.008000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1084-1106CTGAGATATGAACATATTGTTGAAACAAUAUGUUCAUAUCUCAGGAGAUAUGAACAUAUUGUUGAU6.713.322


Target Position: 2306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2306GCUUGAUUUUUGCCUCUUC73.91021096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362324GCTTGATTTTTGCCTCTTCGAAGAGGCAAAAATCAAGC0.201400.094700.681000.750001.000001.00000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818GACAUUUCAAGGAUAGAAG76.1411934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731836GACATTTCAAGGATAGAAGCTTCTATCCTTGAAATGTC0.047900.006400.681000.500001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GCAACAAUUUAUGAAUUGA89.9482142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660920GCAACAATTTATGAATTGATCAATTCATAAATTGTTGC0.138400.008400.629300.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
900-922CAGCAACAATTTATGAATTGAATUCAAUUCAUAAAUUGUUGCUGGCAACAAUUUAUGAAUUGAAUU13.812.122


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GAGCUUCCUGAUUGAGAUU83.601401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847701GAGCTTCCTGATTGAGATTAATCTCAATCAGGAAGCTC0.021000.013800.801700.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360ACAUAAUCUUCUGCCUUCU73.77811109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8311378ACATAATCTTCTGCCTTCTAGAAGGCAGAAGATTATGT0.138300.075800.482800.500000.989100.62500


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110AGUAUUUUGCUGGAAUAAG66.89711658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7342128AGTATTTTGCTGGAATAAGCTTATTCCAGCAAAATACT0.047500.008900.569000.500001.000001.00000


Target Position: 2279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2279UUUUUUUCAUACACUUAUU71.73011284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062297TTTTTTTCATACACTTATTAATAAGTGTATGAAAAAAA0.137300.049800.491400.500001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932UGAAAAUAAAAAGAUCACU69.06371485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
670950TGAAAATAAAAAGATCACTAGTGATCTTTTTATTTTCA0.134800.051900.517200.500001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349CAAGUUAGAAAACAUAAUC74.32991069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841367CAAGTTAGAAAACATAATCGATTATGTTTTCTAACTTG0.781900.038000.465500.500001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CUGAGCUAUUUCAUCUAUU83.3923413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637999CTGAGCTATTTCATCTATTAATAGATGAAATAGCTCAG0.593600.009300.775900.750001.000001.00000


Target Position: 2391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2391CUGGCAUGGAUAUAGUUUU79.5353670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862409CTGGCATGGATATAGTTTTAAAACTATATCCATGCCAG0.034500.013100.784500.750001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177ACUGCCUACUCCAAAAUGU71.47441308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661195ACTGCCTACTCCAAAATGTACATTTTGGAGTAGGCAGT0.072400.036700.500000.500001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196GGUAUAUCCAAAAGCUUUU82.0698491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882214GGTATATCCAAAAGCTTTTAAAAGCTTTTGGATATACC0.146900.031300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2194-2216CTGGTATATCCAAAAGCTTTTTAAAAAGCUUUUGGAUAUACCAGGGUAUAUCCAAAAGCUUUUUAU17.011.223


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383GCUGAGCGAGAAGCAAGUG67.72041592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808401GCTGAGCGAGAAGCAAGTGCACTTGCTTCTCGCTCAGC0.055400.002700.560300.750000.983701.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864AGUGGCUCAACAUUGUGUU73.54551126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551882AGTGGCTCAACATTGTGTTAACACAATGTTGAGCCACT0.150000.031000.560300.750001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203UUUAUGUUAAGGGAAGAAU62.64451943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961221TTTATGTTAAGGGAAGAATATTCTTCCCTTAACATAAA0.082900.078700.491400.500001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092CAGUAAUAAAAAGAUUGAA92.27783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752110CAGTAATAAAAAGATTGAATTCAATCTTTTTATTACTG0.457900.083000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2090-2112GGCAGTAATAAAAAGATTGAAGTUUCAAUCUUUUUAUUACUGCCCAGUAAUAAAAAGAUUGAAGUU20.46.322


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575UAGUUUUCCAUGCGUGUUU64.68821822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101593TAGTTTTCCATGCGTGTTTAAACACGCATGGAAAACTA0.204600.101900.672400.500001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909CAAGGAGGGGCUGUAAAAU79.8719639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791927CAAGGAGGGGCTGTAAAATATTTTACAGCCCCTCCTTG0.036200.023400.637900.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327GUCUUCCUGACACUUUAAU73.38461138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742345GTCTTCCTGACACTTTAATATTAAAGTGTCAGGAAGAC0.795000.072600.810300.750000.978300.62500


Target Position: 2354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354UGUUACCUACUUUGACUUU71.95651264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3102372TGTTACCTACTTTGACTTTAAAGTCAAAGTAGGTAACA0.279100.115400.706900.750001.000001.00000


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCAAUGAAAUGAAUUAAAG77.4824820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701701CCAATGAAATGAATTAAAGCTTTAATTCATTTCATTGG0.524200.236600.706900.750001.000001.00000


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238AGGGAAACCUCCUCACAGU78.1499763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793256AGGGAAACCTCCTCACAGTACTGTGAGGAGGTTTCCCT0.570700.007900.637900.500000.913000.75000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362ACUUUGACUUUUUGCAUUU74.52891059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942380ACTTTGACTTTTTGCATTTAAATGCAAAAAGTCAAAGT0.258500.171100.706900.750001.000001.00000


Target Position: 166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166CCCCUCCAGCGCCUUUUUU62.21461960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24184CCCCTCCAGCGCCTTTTTTAAAAAAGGCGCTGGAGGGG0.894400.517500.991401.000001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161AGAACCAACAACCUCAACU72.47671223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691179AGAACCAACAACCTCAACTAGTTGAGGTTGTTGGTTCT0.401800.018200.517200.500000.989100.62500


Target Position: 470, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470CAAGAUUGACUUUGAAGAU88.3748196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890488CAAGATTGACTTTGAAGATATCTTCAAAGTCAATCTTG0.150100.022300.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
468-490GTCAAGATTGACTTTGAAGATGTAUCUUCAAAGUCAAUCUUGACCAAGAUUGACUUUGAAGAUGUU20.412.012


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083GGGAGGAGGCAGUAAUAAA101.0055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692101GGGAGGAGGCAGTAATAAATTTATTACTGCCTCCTCCC0.332800.037800.991401.000001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084CUGAGAUAUGAACAUAUUG77.2543833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091102CTGAGATATGAACATATTGCAATATGTTCATATCTCAG0.080400.006400.637900.500001.000001.00000


Target Position: 2439, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439GUGCUAUACUGCAUACUUU92.694275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822457GTGCTATACTGCATACTTTAAAGTATGCAGTATAGCAC0.025600.001100.793100.750000.907600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2437-2459ATGTGCTATACTGCATACTTTTTAAAGUAUGCAGUAUAGCACAUGUGCUAUACUGCAUACUUUUUU11.620.932


Target Position: 2454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454CUUUUUAAAUGUAAAGAUA93.348658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474TACTTTTTAAATGTAAAGATATTUAUCUUUACAUUUAAAAAGUACUUUUUAAAUGUAAAGAUAUUU6.9-9.121


Target Position: 2650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2650AUCAUGCAUGUCCUGUAAA79.4311676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502668ATCATGCATGTCCTGTAAATTTACAGGACATGCATGAT0.047000.001700.681000.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792AUCAACUUGCAGAAAGAAA78.1035767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637810ATCAACTTGCAGAAAGAAATTTCTTTCTGCAAGTTGAT0.192000.015200.681000.500001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795AACUUGCAGAAAGAAAUAU73.11961160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478813AACTTGCAGAAAGAAATATATATTTCTTTCTGCAAGTT0.433700.028000.603400.500001.000001.00000


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298GGAACUCUGCUUGAUUUUU80.2042618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2682316GGAACTCTGCTTGATTTTTAAAAATCAAGCAGAGTTCC0.692400.074900.870701.000001.000001.00000


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859UAAUUUUCCUGGUGCCAAU75.7423960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641877TAATTTTCCTGGTGCCAATATTGGCACCAGGAAAATTA0.118900.109200.525900.500001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062GGAUCAACCAUCGCUUUAU86.3853269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661080GGATCAACCATCGCTTTATATAAAGCGATGGTTGATCC0.495200.001400.827601.000000.972801.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CUAGCCCAAUGAAAUGAAU79.6156662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101696CTAGCCCAATGAAATGAATATTCATTTCATTGGGCTAG0.548900.075000.663800.750001.000001.00000


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460AAAUGUAAAGAUAUUUUUA93.389156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662478AAATGTAAAGATATTTTTATAAAAATATCTTTACATTT0.047300.001800.465500.500001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119GAGAAAUAUGAAGAACUGA90.3511128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201137GAGAAATATGAAGAACTGATCAGTTCTTCATATTTCTC0.454300.097800.586200.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793UCAACUUGCAGAAAGAAAU71.93451265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517811TCAACTTGCAGAAAGAAATATTTCTTTCTGCAAGTTGA0.238300.019400.715500.750001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352CCUGUUACCUACUUUGACU83.9735375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232370CCTGTTACCTACTTTGACTAGTCAAAGTAGGTAACAGG0.286300.097400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2350-2372AACCTGTTACCTACTTTGACTTTAGUCAAAGUAGGUAACAGGUUCCUGUUACCUACUUUGACUUUU19.219.033


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578CCGCUUGCUGUCUGCCCUC60.45862068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848596CCGCTTGCTGTCTGCCCTCGAGGGCAGACAGCAAGCGG0.020800.011500.603400.750000.967401.00000


Target Position: 2395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395CAUGGAUAUAGUUUUACUU89.5722153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662413CATGGATATAGTTTTACTTAAGTAAAACTATATCCATG0.039900.010500.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2393-2415GGCATGGATATAGTTTTACTTTTAAGUAAAACUAUAUCCAUGCCCAUGGAUAUAGUUUUACUUUUU4.921.222


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037UUUCCUUACCUUUUUAUUU66.66021678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761055TTTCCTTACCTTTTTATTTAAATAAAAAGGTAAGGAAA0.684400.408200.500000.500001.000001.00000


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219CCUCCUGCUCAUAUUGUGA85.847286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502237CCTCCTGCTCATATTGTGATCACAATATGAGCAGGAGG0.242000.050000.620700.750001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426AUUUUCUGUGCCUGAAUAU73.02271168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641444ATTTTCTGTGCCTGAATATATATTCAGGCACAGAAAAT0.040100.017400.465500.500001.000001.00000


Target Position: 103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
103GGCCAACCGCGAGCAGAAC63.32341903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
472121GGCCAACCGCGAGCAGAACGTTCTGCTCGCGGTTGGCC0.212300.024100.853400.750000.934800.75000


Target Position: 2531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531ACUGUGUAUUCCAAGACAU82.5876457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382549ACTGTGTATTCCAAGACATATGTCTTGGAATACACAGT0.022600.009000.551700.750001.000001.00000


Target Position: 2587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587CAAUUACUGGUCCAAAAGA87.7101213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2585-2607ATCAATTACTGGTCCAAAAGATTUCUUUUGGACCAGUAAUUGAUCAAUUACUGGUCCAAAAGAUUU16.14.623


Target Position: 1439, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439GAAUAUUUGUUAUGUAGAU94.701438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1437-1459CTGAATATTTGTTATGTAGATAAAUCUACAUAACAAAUAUUCAGGAAUAUUUGUUAUGUAGAUAAU20.3-10.322


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371UGCCUUCUCAUGAUCCAAC61.5042005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741389TGCCTTCTCATGATCCAACGTTGGATCATGAGAAGGCA0.467600.133800.706900.500001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356UUACCUACUUUGACUUUUU73.37321139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152374TTACCTACTTTGACTTTTTAAAAAGTCAAAGTAGGTAA0.260500.216500.534500.500001.000001.00000


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798UUGCAGAAAGAAAUAUAAA81.0223545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799816TTGCAGAAAGAAATATAAATTTATATTTCTTTCTGCAA0.519200.037500.646600.500001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UUGCAUGUGGAUCAACCAU67.4981612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411072TTGCATGTGGATCAACCATATGGTTGATCCACATGCAA0.028600.001900.491400.500000.923900.62500


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GUGCAUCAGCCGUGUCUAU84.5115352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
737722GTGCATCAGCCGTGTCTATATAGACACGGCTGATGCAC0.182700.005100.750000.750000.929300.75000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347UACAAGUUAGAAAACAUAA83.9404377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6311365TACAAGTTAGAAAACATAATTATGTTTTCTAACTTGTA0.248000.051900.646600.500001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256UUCUUAAACCUUCAGUUAU70.62511372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512274TTCTTAAACCTTCAGTTATATAACTGAAGGTTTAAGAA0.043500.040800.629300.500001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801CGUUUAUUUUCAAGAAUAA98.097915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7681819CGTTTATTTTCAAGAATAATTATTCTTGAAAATAAACG0.039100.014900.741401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1799-1821TTCGTTTATTTTCAAGAATAATCUUAUUCUUGAAAAUAAACGAACGUUUAUUUUCAAGAAUAAUCU6.9-0.322


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CUCAGUAAAGCACUUGCAA85.331315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6241994CTCAGTAAAGCACTTGCAATTGCAAGTGCTTTACTGAG0.088800.010600.663800.750000.972800.75000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867CUGGUGCCAAUUUCAAGUU70.5411377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436885CTGGTGCCAATTTCAAGTTAACTTGAAATTGGCACCAG0.170200.036600.637900.750001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847UUUUUUUCCUUUUAAUUUU64.27721845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741865TTTTTTTCCTTTTAATTTTAAAATTAAAAGGAAAAAAA0.834500.193500.500000.500001.000001.00000


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495AUCACUUAGGAAAUGGCUU67.06981646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542513ATCACTTAGGAAATGGCTTAAGCCATTTCCTAAGTGAT0.047900.027900.543100.500000.967400.75000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865GUGGCUCAACAUUGUGUUC69.20431475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451883GTGGCTCAACATTGTGTTCGAACACAATGTTGAGCCAC0.059400.011400.620700.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411AUUUUAACCUAUGAUAUUU77.9727776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391429ATTTTAACCTATGATATTTAAATATCATAGGTTAAAAT0.318000.247000.508600.500001.000001.00000


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918UGAAUUAUCUUGGUUGAAA83.2118420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494936TGAATTATCTTGGTTGAAATTTCAACCAAGATAATTCA0.242300.022200.724100.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427UUUUCUGUGCCUGAAUAUU64.81271815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511445TTTTCTGTGCCTGAATATTAATATTCAGGCACAGAAAA0.020300.010500.491400.500001.000001.00000


Target Position: 1061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061UGGAUCAACCAUCGCUUUA74.36891068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711079TGGATCAACCATCGCTTTATAAAGCGATGGTTGATCCA0.492100.001300.810300.750000.940200.62500


Target Position: 2601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2601AAAGAUUGCUGAAAUUUUA90.2599130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772619AAAGATTGCTGAAATTTTATAAAATTTCAGCAATCTTT0.225800.025500.465500.500001.000001.00000


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929GGUUGAAAAUAAAAAGAUC84.0941366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560947GGTTGAAAATAAAAAGATCGATCTTTTTATTTTCAACC0.114400.024200.672400.750001.000001.00000


Target Position: 1755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755CCCUGCCUCUCAUCAACUG68.7821514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091773CCCTGCCTCTCATCAACTGCAGTTGATGAGAGGCAGGG0.146100.011000.706900.750001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348ACAAGUUAGAAAACAUAAU78.5411738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471366ACAAGTTAGAAAACATAATATTATGTTTTCTAACTTGT0.771400.044200.698300.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234CCAUGGAGUGUACAAGUAU89.4858157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911252CCATGGAGTGTACAAGTATATACTTGTACACTCCATGG0.274700.003200.801701.000001.000001.00000


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351ACCUGUUACCUACUUUGAC66.01011729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6642369ACCTGTTACCTACTTTGACGTCAAAGTAGGTAACAGGT0.291400.103300.534500.500001.000001.00000


Target Position: 1545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1545CUGAAGACCAAAAUUAGAA87.5099226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621563CTGAAGACCAAAATTAGAATTCTAATTTTGGTCTTCAG0.151800.001500.612100.750001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090UAUGAACAUAUUGUUGAAA78.6557725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371108TATGAACATATTGTTGAAATTTCAACAATATGTTCATA0.083700.010400.543100.500001.000001.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265CUUCAGUUAUGAUUUUUUU82.4325469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6812283CTTCAGTTATGATTTTTTTAAAAAAATCATAACTGAAG0.063700.012700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2263-2285ACCTTCAGTTATGATTTTTTTTTAAAAAAAUCAUAACUGAAGGUCUUCAGUUAUGAUUUUUUUUUU-12.019.221


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366UGACUUUUUGCAUUUAAAA81.8164502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2452384TGACTTTTTGCATTTAAAATTTTAAATGCAAAAAGTCA0.295300.085500.724100.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102GUUGAAAGGUAAUUUGAGA89.6911148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1100-1122TTGTTGAAAGGTAATTTGAGAGAUCUCAAAUUACCUUUCAACAAGUUGAAAGGUAAUUUGAGAGAU12.012.233


Target Position: 2629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629UGAUAUAUUUUACAAUUUU82.0539492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922647TGATATATTTTACAATTTTAAAATTGTAAAATATATCA0.694800.033900.724100.750001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349UCUACAAGCCCAACAACAA83.5426404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
725367TCTACAAGCCCAACAACAATTGTTGTTGGGCTTGTAGA0.901500.005700.577600.750001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024CCAUUUAAAUUUUUUUCCU77.5018817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101042CCATTTAAATTTTTTTCCTAGGAAAAAAATTTAAATGG0.525300.124200.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1022-1044ACCCATTTAAATTTTTTTCCTTAAGGAAAAAAAUUUAAAUGGGUCCAUUUAAAUUUUUUUCCUUAU14.3-1.411


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805AAGAAAUAUAAAUGACAUU80.8933558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878823AAGAAATATAAATGACATTAATGTCATTTATATTTCTT0.242700.178300.629300.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382AGCUGAGCGAGAAGCAAGU71.07221342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859400AGCTGAGCGAGAAGCAAGTACTTGCTTCTCGCTCAGCT0.051600.001500.646600.500000.929300.62500


Target Position: 2651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651UCAUGCAUGUCCUGUAAAG68.10171571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832669TCATGCATGTCCTGTAAAGCTTTACAGGACATGCATGA0.022300.001100.586200.500001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CACCGUCUGUGACCCACUC70.36391387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829755CACCGTCTGTGACCCACTCGAGTGGGTCACAGACGGTG0.229700.009000.482800.500000.956501.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300UGGAUUACUGCCAUUCACU72.66091201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901318TGGATTACTGCCATTCACTAGTGAATGGCAGTAATCCA0.290100.012300.637900.500001.000001.00000


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484UUCACAUUUUCCUUUUCAA79.6601656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191502TTCACATTTTCCTTTTCAATTGAAAAGGAAAATGTGAA0.145300.105800.525900.500001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476UCCUGUUUUUCACAUUUUC59.2542135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571494TCCTGTTTTTCACATTTTCGAAAATGTGAAAAACAGGA0.620500.149100.698300.500000.978300.87500


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368GGCCAUGGCAGACGAGCUG65.27551786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843386GGCCATGGCAGACGAGCTGCAGCTCGTCTGCCATGGCC0.021500.004400.715500.750000.902200.62500


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255UUUCUUAAACCUUCAGUUA76.4361899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652273TTTCTTAAACCTTCAGTTATAACTGAAGGTTTAAGAAA0.055800.052000.465500.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GCUAAUACAGCAACAAUUU83.149423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913TTGCTAATACAGCAACAATTTATAAAUUGUUGCUGUAUUAGCAAGCUAAUACAGCAACAAUUUAUU5.36.332


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337AACAGGGCAACAUCUACAA82.3822473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827355AACAGGGCAACATCTACAATTGTAGATGTTGCCCTGTT0.920300.002200.500000.500001.000001.00000


Target Position: 2649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649UAUCAUGCAUGUCCUGUAA85.3137316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992667TATCATGCATGTCCTGTAATTACAGGACATGCATGATA0.093400.003100.508600.500001.000001.00000


Target Position: 1552, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1552CCAAAAUUAGAAUAUCCAU87.1388241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491570CCAAAATTAGAATATCCATATGGATATTCTAATTTTGG0.293800.080200.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1550-1572GACCAAAATTAGAATATCCATGAAUGGAUAUUCUAAUUUUGGUCCCAAAAUUAGAAUAUCCAUGAU21.2-3.322


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985GCACUUGCAACCGUCUGUU75.11921004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132003GCACTTGCAACCGTCTGTTAACAGACGGTTGCAAGTGC0.054000.008900.706901.000001.000001.00000


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597UCCAAAAGAUUGCUGAAAU73.91071095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472615TCCAAAAGATTGCTGAAATATTTCAGCAATCTTTTGGA0.080500.023400.862100.750001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155GGAAUUUCACCUGUAAACC65.34711779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632173GGAATTTCACCTGTAAACCGGTTTACAGGTGAAATTCC0.090500.013500.517200.500001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677ACUAGCCCAAUGAAAUGAA79.5977664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131695ACTAGCCCAATGAAATGAATTCATTTCATTGGGCTAGT0.446000.068500.534500.750001.000001.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418CCUAUGAUAUUUUCUGUGC65.8041740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401436CCTATGATATTTTCTGTGCGCACAGAAAATATCATAGG0.079600.068400.491400.500001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736ACACCGUCUGUGACCCACU72.86881183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713754ACACCGTCTGTGACCCACTAGTGGGTCACAGACGGTGT0.074400.006600.500000.500000.956501.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347CAUCUACAAGCCCAACAAC75.14121003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823365CATCTACAAGCCCAACAACGTTGTTGGGCTTGTAGATG0.026700.004600.508600.500001.000001.00000


Target Position: 1478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478CUGUUUUUCACAUUUUCCU71.25851329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1476-1498TCCTGTTTTTCACATTTTCCTTTAGGAAAAUGUGAAAAACAGGACUGUUUUUCACAUUUUCCUUUU14.25.622


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440CGACCCUAAACACCUCAAC65.66151752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536458CGACCCTAAACACCTCAACGTTGAGGTGTTTAGGGTCG0.126500.083100.646600.750001.000001.00000


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329CUUCCUGACACUUUAAUUA88.6563184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832347CTTCCTGACACTTTAATTATAATTAAAGTGTCAGGAAG0.875800.082000.603400.750001.000001.00000


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665AGUUGUACCAUGCAUUAAG73.78811108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715683AGTTGTACCATGCATTAAGCTTAATGCATGGTACAACT0.053200.010500.569000.500001.000001.00000


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674GACACUAGCCCAAUGAAAU88.5108188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931692GACACTAGCCCAATGAAATATTTCATTGGGCTAGTGTC0.281600.033700.810300.750000.972800.62500


Target Position: 2602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2602AAGAUUGCUGAAAUUUUAU77.2986830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882620AAGATTGCTGAAATTTTATATAAAATTTCAGCAATCTT0.314300.010900.594800.500001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540AGCUUCACCACCUUCACUG64.09241859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811558AGCTTCACCACCTTCACTGCAGTGAAGGTGGTGAAGCT0.087300.002600.569000.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507GGUCUAACUCAGCAACUCG80.2228617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931525GGTCTAACTCAGCAACTCGCGAGTTGCTGAGTTAGACC0.113000.084200.560300.500001.000001.00000


Target Position: 2215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2215UAUUCCUCCUGCUCAUAUU77.4819821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152233TATTCCTCCTGCTCATATTAATATGAGCAGGAGGAATA0.139100.104500.534500.500001.000001.00000


Target Position: 1480, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480GUUUUUCACAUUUUCCUUU74.91111022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651498GTTTTTCACATTTTCCTTTAAAGGAAAATGTGAAAAAC0.624500.233200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1478-1500CTGTTTTTCACATTTTCCTTTTCAAAGGAAAAUGUGAAAAACAGGUUUUUCACAUUUUCCUUUUCU18.77.722


Target Position: 104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
104GCCAACCGCGAGCAGAACA76.1615932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362122GCCAACCGCGAGCAGAACATGTTCTGCTCGCGGTTGGC0.307600.039300.793100.750000.978300.75000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469AGUGCCUUCCUGUUUUUCA80.1482619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171487AGTGCCTTCCTGTTTTTCATGAAAAACAGGAAGGCACT0.263700.025900.482800.500001.000001.00000


Target Position: 2393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2393GGCAUGGAUAUAGUUUUAC68.07031576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112411GGCATGGATATAGTTTTACGTAAAACTATATCCATGCC0.028700.012800.819000.750001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069CAGAAAGAAGAUGGGGGAG63.60771886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8482087CAGAAAGAAGATGGGGGAGCTCCCCCATCTTCTTTCTG0.113100.043300.474100.500001.000001.00000


Target Position: 2359, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359CCUACUUUGACUUUUUGCA80.8297569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7942377CCTACTTTGACTTTTTGCATGCAAAAAGTCAAAGTAGG0.294400.190500.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2357-2379TACCTACTTTGACTTTTTGCATTUGCAAAAAGUCAAAGUAGGUACCUACUUUGACUUUUUGCAUUU14.19.821


Target Position: 2275, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275GAUUUUUUUUUCAUACACU87.1514239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392293GATTTTTTTTTCATACACTAGTGTATGAAAAAAAAATC0.163800.062300.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2273-2295ATGATTTTTTTTTCATACACTTAAGUGUAUGAAAAAAAAAUCAUGAUUUUUUUUUCAUACACUUAU20.4-12.012


Target Position: 2600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2600AAAAGAUUGCUGAAAUUUU80.7816575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472618AAAAGATTGCTGAAATTTTAAAATTTCAGCAATCTTTT0.178000.025000.500000.500001.000001.00000


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369GCCAUGGCAGACGAGCUGA76.0942938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830387GCCATGGCAGACGAGCTGATCAGCTCGTCTGCCATGGC0.025200.004200.775900.750000.940200.87500


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542UCCCUGAAGACCAAAAUUA76.2284924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541560TCCCTGAAGACCAAAATTATAATTTTGGTCTTCAGGGA0.117200.050800.836200.750001.000001.00000


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174UCAACUGCCUACUCCAAAA84.0656367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581192TCAACTGCCTACTCCAAAATTTTGGAGTAGGCAGTTGA0.443300.461400.724100.750001.000001.00000


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607UGCUGAAAUUUUAUAUGCU79.184693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432625TGCTGAAATTTTATATGCTAGCATATAAAATTTCAGCA0.177800.012900.500000.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526UGUAAACUGUGUAUUCCAA89.0447177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902544TGTAAACTGTGTATTCCAATTGGAATACACAGTTTACA0.102300.060600.560300.750001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636UUCAUCUGGCAACAUCUUU61.27432023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491654TTCATCTGGCAACATCTTTAAAGATGTTGCCAGATGAA0.311800.019700.672400.500001.000001.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393UGCCUUACUCUUCUUGAAA79.5496667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201411TGCCTTACTCTTCTTGAAATTTCAAGAAGAGTAAGGCA0.269200.253400.853400.750001.000001.00000


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994UCUAUUUUUGGCAGUCUGA71.8981268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291012TCTATTTTTGGCAGTCTGATCAGACTGCCAAAAATAGA0.137400.063600.500000.500001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714CGUGUCUAUUCCAUCUACG73.3621141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764732CGTGTCTATTCCATCTACGCGTAGATGGAATAGACACG0.353200.042600.500000.500001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272ACUCUUUUCCCACUGUUUA79.9905630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691290ACTCTTTTCCCACTGTTTATAAACAGTGGGAAAAGAGT0.111300.022600.672400.750001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946UCACUUUCUCAGUUUUCAU77.0589850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872964TCACTTTCTCAGTTTTCATATGAAAACTGAGAAAGTGA0.016200.002300.569000.750000.962000.75000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811CAAGAAUAAUCACGCUUUC73.87131100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571829CAAGAATAATCACGCTTTCGAAAGCGTGATTATTCTTG0.133400.034100.474100.500001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580GCUUGCUGUCUGCCCUCUU77.0397852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
817598GCTTGCTGTCTGCCCTCTTAAGAGGGCAGACAGCAAGC0.027600.008200.715501.000000.967401.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681GCACAAUAAAAAUGUUUAA92.714274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1082699GCACAATAAAAATGTTTAATTAAACATTTTTATTGTGC0.571900.189400.819001.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2679-2701CTGCACAATAAAAATGTTTAACGUUAAACAUUUUUAUUGUGCAGGCACAAUAAAAAUGUUUAACGU6.913.522


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549UGUCUGUUCUACAUAGAUG75.10271006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862567TGTCTGTTCTACATAGATGCATCTATGTAGAACAGACA0.043100.003400.551700.500001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458UUAAAUGUAAAGAUAUUUU70.94811354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422476TTAAATGTAAAGATATTTTAAAATATCTTTACATTTAA0.046100.006000.534500.500001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472AGAUUGACUUUGAAGAUGU82.2744481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
666490AGATTGACTTTGAAGATGTACATCTTCAAAGTCAATCT0.071300.014000.517200.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CAUUUUCCUUUUCAAAUAG74.62271049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791506CATTTTCCTTTTCAAATAGCTATTTGAAAAGGAAAATG0.015100.009200.482800.500001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GCCUUCCUGUUUUUCACAU77.1884837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881490GCCTTCCTGTTTTTCACATATGTGAAAAACAGGAAGGC0.399900.213000.844801.000000.978300.62500


Target Position: 2111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111GUAUUUUGCUGGAAUAAGU83.2645419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422129GTATTTTGCTGGAATAAGTACTTATTCCAGCAAAATAC0.147200.009300.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2109-2131AAGTATTTTGCTGGAATAAGTTCACUUAUUCCAGCAAAAUACUUGUAUUUUGCUGGAAUAAGUUCU6.9-1.420


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512UUUGUGAUUCAAUCUGUAA80.5386596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742530TTTGTGATTCAATCTGTAATTACAGATTGAATCACAAA0.499800.079500.465500.500001.000001.00000


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440UGCUAUACUGCAUACUUUU78.345754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192458TGCTATACTGCATACTTTTAAAAGTATGCAGTATAGCA0.027000.003800.853400.750000.923900.62500


Target Position: 2417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2417AACUGUGUACAUAACUGAA93.877348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552435AACTGTGTACATAACTGAATTCAGTTATGTACACAGTT0.069900.013400.474100.500001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424AUAUUUUCUGUGCCUGAAU72.31061237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061442ATATTTTCTGTGCCTGAATATTCAGGCACAGAAAATAT0.059600.026300.534500.500001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806AGAAAUAUAAAUGACAUUU77.8643787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373824AGAAATATAAATGACATTTAAATGTCATTTATATTTCT0.206700.145800.724100.750001.000001.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522AAUCUGUAAACUGUGUAUU72.49941222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062540AATCTGTAAACTGTGTATTAATACACAGTTTACAGATT0.119700.034000.500000.500001.000001.00000


Target Position: 1629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629UCUGGGCUUCAUCUGGCAA74.18881080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671647TCTGGGCTTCATCTGGCAATTGCCAGATGAAGCCCAGA0.036900.001300.577600.750001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868UGGUGCCAAUUUCAAGUUC58.1992188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794886TGGTGCCAATTTCAAGTTCGAACTTGAAATTGGCACCA0.139300.041700.672400.500001.000001.00000


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131GAACUGAGGAGGAAAAAAA96.231427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821149GAACTGAGGAGGAAAAAAATTTTTTTCCTCCTCAGTTC0.584400.275100.672400.750001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260GAUUUUCAGCAAACUCUUU84.73340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621278GATTTTCAGCAAACTCTTTAAAGAGTTTGCTGAAAATC0.040300.027100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1258-1280CAGATTTTCAGCAAACTCTTTTCAAAGAGUUUGCUGAAAAUCUGGAUUUUCAGCAAACUCUUUUCU17.77.421


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546UGAAGACCAAAAUUAGAAU78.7129720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631564TGAAGACCAAAATTAGAATATTCTAATTTTGGTCTTCA0.161800.001500.715500.750001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373CCUUCUCAUGAUCCAACUA90.4459124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791391CCTTCTCATGATCCAACTATAGTTGGATCATGAGAAGG0.830800.184700.672401.000001.000001.00000


Target Position: 2349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349CAACCUGUUACCUACUUUG76.2588919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7342367CAACCTGTTACCTACTTTGCAAAGTAGGTAACAGGTTG0.318000.120100.500000.500001.000001.00000


Target Position: 2630, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2630GAUAUAUUUUACAAUUUUU93.428355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662648GATATATTTTACAATTTTTAAAAATTGTAAAATATATC0.689000.038200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2628-2650CTGATATATTTTACAATTTTTTAAAAAAUUGUAAAAUAUAUCAGGAUAUAUUUUACAAUUUUUUAU-3.3-8.621


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004GCAGUCUGAAUUUUUAAAA85.9483281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131022GCAGTCTGAATTTTTAAAATTTTAAAAATTCAGACTGC0.345500.159400.853401.000001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832AGAAGUAUACCUGAUUUUU80.4859598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
594850AGAAGTATACCTGATTTTTAAAAATCAGGTATACTTCT0.099700.025800.724100.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871UGCCAAUUUCAAGUUCCAA77.7321802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415889TGCCAATTTCAAGTTCCAATTGGAACTTGAAATTGGCA0.205400.093700.706900.750001.000001.00000


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GAAUUGAAUUAUCUUGGUU89.2131168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656932GAATTGAATTATCTTGGTTAACCAAGATAATTCAATTC0.155900.028300.525900.750001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216CAGUUCCCUUAAAGCACAG70.30641390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735234CAGTTCCCTTAAAGCACAGCTGTGCTTTAAGGGAACTG0.231100.054900.500000.500001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548AAGACCAAAAUUAGAAUAU74.90581023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131566AAGACCAAAATTAGAATATATATTCTAATTTTGGTCTT0.147500.002500.594800.500001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474CUUCCUGUUUUUCACAUUU77.7178805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111492CTTCCTGTTTTTCACATTTAAATGTGAAAAACAGGAAG0.765800.193800.637900.750000.978300.87500


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845AUUUUUUUUCCUUUUAAUU68.74111517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860863ATTTTTTTTCCTTTTAATTAATTAAAAGGAAAAAAAAT0.361800.182700.500000.500001.000001.00000


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827UUCCUGAAUCCAAACUAAU69.87291429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841845TTCCTGAATCCAAACTAATATTAGTTTGGATTCAGGAA0.054600.003500.663800.500001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400AUAUAGUUUUACUUUUAAA92.870369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492418ATATAGTTTTACTTTTAAATTTAAAAGTAAAACTATAT0.080700.004600.543100.500001.000001.00000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923UAUCUUGGUUGAAAAUAAA87.5368224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592941TATCTTGGTTGAAAATAAATTTATTTTCAACCAAGATA0.315500.043500.543100.500001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617CAUCUGGGGCAUUUACUUC72.39661233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824635CATCTGGGGCATTTACTTCGAAGTAAATGCCCCAGATG0.719200.007200.482800.500001.000001.00000


Target Position: 715, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715GUGUCUAUUCCAUCUACGU81.4528524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
658733GTGTCTATTCCATCTACGTACGTAGATGGAATAGACAC0.343300.081000.517200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
713-735CCGTGTCTATTCCATCTACGTCCACGUAGAUGGAAUAGACACGGGUGUCUAUUCCAUCUACGUCCU20.920.323


Target Position: 2091, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091GCAGUAAUAAAAAGAUUGA88.2949198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322109GCAGTAATAAAAAGATTGATCAATCTTTTTATTACTGC0.474800.086600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2089-2111AGGCAGTAATAAAAAGATTGAAGUCAAUCUUUUUAUUACUGCCUGCAGUAAUAAAAAGAUUGAAGU12.011.622


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031AAUUUUUUUCCUUACCUUU74.56311056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831049AATTTTTTTCCTTACCTTTAAAGGTAAGGAAAAAAATT0.799200.497600.508600.500001.000001.00000


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308GGGACAUCUCUACACCGUU86.8174251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867326GGGACATCTCTACACCGTTAACGGTGTAGAGATGTCCC0.017500.010000.844801.000001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800GCAGAAAGAAAUAUAAAUG79.9892631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384818GCAGAAAGAAATATAAATGCATTTATATTTCTTTCTGC0.396900.094300.698300.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286GGGGCAAAUACGUAGACUC76.83862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572304GGGGCAAATACGTAGACTCGAGTCTACGTATTTGCCCC0.110900.014000.681000.750001.000001.00000


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243CCUUUGGGGACUUUUCUUA82.6233453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192261CCTTTGGGGACTTTTCTTATAAGAAAAGTCCCCAAAGG0.543500.002400.810301.000001.000001.00000


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396AUGGAUAUAGUUUUACUUU77.6485809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002414ATGGATATAGTTTTACTTTAAAGTAAAACTATATCCAT0.058400.010300.655200.500001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505AGGGUCUAACUCAGCAACU71.37551314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301523AGGGTCTAACTCAGCAACTAGTTGCTGAGTTAGACCCT0.120200.051100.637900.500001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366UCUUCUGCCUUCUCAUGAU78.7517717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911384TCTTCTGCCTTCTCATGATATCATGAGAAGGCAGAAGA0.403800.084400.543100.750001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953CUCAGUUUUCAUAAGUAUU81.5248518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
673971CTCAGTTTTCATAAGTATTAATACTTATGAAAACTGAG0.258300.008000.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
951-973TTCTCAGTTTTCATAAGTATTATAAUACUUAUGAAAACUGAGAACUCAGUUUUCAUAAGUAUUAUU6.319.222


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883CCCAUUUCAGCUGAUCAGU66.25241705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961901CCCATTTCAGCTGATCAGTACTGATCAGCTGAAATGGG0.031300.013100.784500.750001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404UCUUGAAAUUUUAACCUAU81.4729521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891422TCTTGAAATTTTAACCTATATAGGTTAAAATTTCAAGA0.598400.207600.681000.750001.000001.00000


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513UUGUGAUUCAAUCUGUAAA80.263616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452531TTGTGATTCAATCTGTAAATTTACAGATTGAATCACAA0.478500.090700.646600.500001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CUGAGCGAGAAGCAAGUGU67.22471631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
780402CTGAGCGAGAAGCAAGTGTACACTTGCTTCTCGCTCAG0.059800.003700.577600.500000.983701.00000


Target Position: 541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541GCUUCACCACCUUCACUGU81.4684522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710559GCTTCACCACCTTCACTGTACAGTGAAGGTGGTGAAGC0.096600.006400.646600.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GGAAAAUAUUCAGCAAUGU81.4832520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777787GGAAAATATTCAGCAATGTACATTGCTGAATATTTTCC0.036500.026200.663800.750001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296CGUAGACUCGGAGGGACAU79.4967674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876314CGTAGACTCGGAGGGACATATGTCCCTCCGAGTCTACG0.015500.001200.620701.000001.000001.00000


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547GAAGACCAAAAUUAGAAUA90.5017122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701565GAAGACCAAAATTAGAATATATTCTAATTTTGGTCTTC0.160000.001300.629300.750001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437CCGCGACCCUAAACACCUC68.62811523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489455CCGCGACCCTAAACACCTCGAGGTGTTTAGGGTCGCGG0.500300.095900.603400.750000.913000.62500


Target Position: 2627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627ACUGAUAUAUUUUACAAUU83.8412380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502645ACTGATATATTTTACAATTAATTGTAAAATATATCAGT0.769100.026300.698300.750001.000001.00000


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784GCAUGUCUAUUCAGCUUCG76.5718882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251802GCATGTCTATTCAGCTTCGCGAAGCTGAATAGACATGC0.050600.047200.560300.500001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836GUAUACCUGAUUUUUUUUC63.3841899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692854GTATACCTGATTTTTTTTCGAAAAAAAATCAGGTATAC0.181100.052100.508600.500001.000001.00000


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498ACUUAGGAAAUGGCUUUGU61.18842031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152516ACTTAGGAAATGGCTTTGTACAAAGCCATTTCCTAAGT0.028300.004500.500000.500001.000001.00000


Target Position: 957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GUUUUCAUAAGUAUUAUGU74.96141018

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
955-977CAGTTTTCATAAGTATTATGTCTACAUAAUACUUAUGAAAACUGGUUUUCAUAAGUAUUAUGUCUU0.07.422


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899ACAGCAACAAUUUAUGAAU79.7143652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773917ACAGCAACAATTTATGAATATTCATAAATTGTTGCTGT0.164600.003900.698300.750001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640UUCUCUCUUUCCUGCACAU72.57781213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662658TTCTCTCTTTCCTGCACATATGTGCAGGAAAGAGAGAA0.073100.075500.517200.500001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CUGCCAUUCACUUCAUAAU82.3791475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101325CTGCCATTCACTTCATAATATTATGAAGTGAATGGCAG0.200700.097200.775900.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625GCAUUUACUUCGCCAUUCU82.0947489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427643GCATTTACTTCGCCATTCTAGAATGGCGAAGTAAATGC0.253500.157600.629300.750001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCUUUUUAUUUGCAUGUGG63.69811882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711063CCTTTTTATTTGCATGTGGCCACATGCAAATAAAAAGG0.016800.016400.500000.500001.000001.00000


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305GGAGGGACAUCUCUACACC76.9975854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802323GGAGGGACATCTCTACACCGGTGTAGAGATGTCCCTCC0.378100.002900.517200.500000.913000.62500


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763CUGUUGGGAAAAUAUUCAG69.52841456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823781CTGTTGGGAAAATATTCAGCTGAATATTTTCCCAACAG0.114600.002300.500000.500001.000001.00000


Target Position: 1385, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385CCAACUAAUGCCUUACUCU84.0251370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601403CCAACTAATGCCTTACTCTAGAGTAAGGCATTAGTTGG0.787100.701900.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1383-1405ATCCAACTAATGCCTTACTCTTCAGAGUAAGGCAUUAGUUGGAUCCAACUAAUGCCUUACUCUUCU18.911.833


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CCAGAAAGAAGAUGGGGGA78.2448760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402086CCAGAAAGAAGATGGGGGATCCCCCATCTTCTTTCTGG0.106200.033600.474100.750001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670UACCAUGCAUUAAGAGCUU71.08321340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760688TACCATGCATTAAGAGCTTAAGCTCTTAATGCATGGTA0.049600.005000.543100.500000.945700.75000


Target Position: 2388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388ACACUGGCAUGGAUAUAGU78.6242728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222406ACACTGGCATGGATATAGTACTATATCCATGCCAGTGT0.026700.015600.500000.500001.000001.00000


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637CCAUUCUCUCUUUCCUGCA80.5931593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791655CCATTCTCTCTTTCCTGCATGCAGGAAAGAGAGAATGG0.133700.131500.491400.750001.000001.00000


Target Position: 180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
180UUUUUUCCCCCCAUACAAU65.77241743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881198TTTTTTCCCCCCATACAATATTGTATGGGGGGAAAAAA0.961500.942300.491400.500001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200UAUCCAAAAGCUUUUUAUU75.3291988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922218TATCCAAAAGCTTTTTATTAATAAAAAGCTTTTGGATA0.129300.020400.534500.500001.000001.00000


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069CCAUCGCUUUAUUGGCUGA84.0394369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691087CCATCGCTTTATTGGCTGATCAGCCAATAAAGCGATGG0.042200.001300.620700.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854CCUUUUAAUUUUCCUGGUG65.96451733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579872CCTTTTAATTTTCCTGGTGCACCAGGAAAATTAAAAGG0.169100.052300.551700.750001.000001.00000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GGCAGAUUUUCAGCAAACU80.123622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921274GGCAGATTTTCAGCAAACTAGTTTGCTGAAAATCTGCC0.100300.043100.793100.750000.983700.75000


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375GCAGACGAGCUGAGCGAGA80.4296601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879393GCAGACGAGCTGAGCGAGATCTCGCTCAGCTCGTCTGC0.524700.001200.629300.750000.983700.75000


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106UUGAAGUAUUUUGCUGGAA69.48431461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412124TTGAAGTATTTTGCTGGAATTCCAGCAAAATACTTCAA0.051200.007100.474100.500001.000001.00000


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343UCCUUACAAGUUAGAAAAC59.65032120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711361TCCTTACAAGTTAGAAAACGTTTTCTAACTTGTAAGGA0.088000.003900.724100.500001.000001.00000


Target Position: 2360, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360CUACUUUGACUUUUUGCAU80.0503627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762378CTACTTTGACTTTTTGCATATGCAAAAAGTCAAAGTAG0.278800.184700.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2358-2380ACCTACTTTGACTTTTTGCATTTAUGCAAAAAGUCAAAGUAGGUCUACUUUGACUUUUUGCAUUUU20.011.822


Target Position: 1301, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301GGAUUACUGCCAUUCACUU90.3603127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181319GGATTACTGCCATTCACTTAAGTGAATGGCAGTAATCC0.291900.019200.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1299-1321GTGGATTACTGCCATTCACTTCAAAGUGAAUGGCAGUAAUCCACGGAUUACUGCCAUUCACUUCAU19.214.512


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085GAGGAGGCAGUAAUAAAAA93.739750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452103GAGGAGGCAGTAATAAAAATTTTTATTACTGCCTCCTC0.399200.046100.810300.750001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504GAAGGGACACACAGUUUUG80.1423620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643522GAAGGGACACACAGTTTTGCAAAACTGTGTGTCCCTTC0.107800.015500.525900.500001.000001.00000


Target Position: 1778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1778AGGUCAGCAUGUCUAUUCA93.061862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671796AGGTCAGCATGTCTATTCATGAATAGACATGCTGACCT0.177600.011100.620700.500001.000001.00000


Target Position: 569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
569CUGGUUUUACCGCUUGCUG61.37142016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730587CTGGTTTTACCGCTTGCTGCAGCAAGCGGTAAAACCAG0.146700.005800.500000.500000.940200.75000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372GCCUUCUCAUGAUCCAACU77.3103828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1481390GCCTTCTCATGATCCAACTAGTTGGATCATGAGAAGGC0.494800.139300.793100.750001.000001.00000


Target Position: 164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164CCCCCCUCCAGCGCCUUUU53.25982399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83182CCCCCCTCCAGCGCCTTTTAAAAGGCGCTGGAGGGGGG0.618400.473200.991401.000000.934800.75000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264CCUUCAGUUAUGAUUUUUU83.5385405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412282CCTTCAGTTATGATTTTTTAAAAAATCATAACTGAAGG0.046200.015300.844801.000001.000001.00000


Target Position: 2678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2678CCUGCACAAUAAAAAUGUU86.6542260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142696CCTGCACAATAAAAATGTTAACATTTTTATTGTGCAGG0.674100.019400.698301.000000.994600.62500


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682CCCAAUGAAAUGAAUUAAA85.7648290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1171700CCCAATGAAATGAATTAAATTTAATTCATTTCATTGGG0.567400.175800.991401.000001.000001.00000


Target Position: 2269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269AGUUAUGAUUUUUUUUUCA86.25274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272287AGTTATGATTTTTTTTTCATGAAAAAAAAATCATAACT0.093700.003900.482800.500001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295ACGUAGACUCGGAGGGACA80.3458609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878313ACGTAGACTCGGAGGGACATGTCCCTCCGAGTCTACGT0.017200.001200.569000.500001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083GCUGAGAUAUGAACAUAUU92.687176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641101GCTGAGATATGAACATATTAATATGTTCATATCTCAGC0.086000.008200.844801.000001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563AGAUGCUUAGUCCCUCAUG68.07521575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6972581AGATGCTTAGTCCCTCATGCATGAGGGACTAAGCATCT0.059100.035500.569000.500001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615CUCAUCUGGGGCAUUUACU68.58861527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858633CTCATCTGGGGCATTTACTAGTAAATGCCCCAGATGAG0.322100.007300.603400.500001.000001.00000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512ACACAGUUUUGACGGCAUU73.70741113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475530ACACAGTTTTGACGGCATTAATGCCGTCAAAACTGTGT0.153000.038400.698300.750001.000001.00000


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207UUCCUUCCUCAGUUCCCUU63.96391870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655225TTCCTTCCTCAGTTCCCTTAAGGGAACTGAGGAAGGAA0.176000.131300.534500.500001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GUAAUUUGAGAGAAAUAUG77.8462788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701128GTAATTTGAGAGAAATATGCATATTTCTCTCAAATTAC0.246800.104600.525900.500001.000001.00000


Target Position: 2221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2221UCCUGCUCAUAUUGUGAUU70.41611383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3332239TCCTGCTCATATTGTGATTAATCACAATATGAGCAGGA0.237900.061100.862100.750001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487ACAUUUUCCUUUUCAAAUA84.9739327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501505ACATTTTCCTTTTCAAATATATTTGAAAAGGAAAATGT0.119100.057500.663800.750001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022ACCCAUUUAAAUUUUUUUC55.92572289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041040ACCCATTTAAATTTTTTTCGAAAAAAATTTAAATGGGT0.310900.095200.681000.500001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951UUCUCAGUUUUCAUAAGUA86.2275276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801969TTCTCAGTTTTCATAAGTATACTTATGAAAACTGAGAA0.033600.003000.491400.500001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503GGAAAUGGCUUUGUGAUUC70.1111408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782521GGAAATGGCTTTGTGATTCGAATCACAAAGCCATTTCC0.064500.008300.698300.750001.000001.00000


Target Position: 2260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2260UAAACCUUCAGUUAUGAUU69.65651448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952278TAAACCTTCAGTTATGATTAATCATAACTGAAGGTTTA0.031900.023900.525900.500001.000001.00000


Target Position: 1543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543CCCUGAAGACCAAAAUUAG78.4967742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321561CCCTGAAGACCAAAATTAGCTAATTTTGGTCTTCAGGG0.190200.009800.819000.750001.000001.00000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GGAUAGAAGUAUACCUGAU98.513714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641846GGATAGAAGTATACCTGATATCAGGTATACTTCTATCC0.406000.009200.689701.000000.994600.62500


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306ACUGCCAUUCACUUCAUAA88.9257179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081324ACTGCCATTCACTTCATAATTATGAAGTGAATGGCAGT0.184500.066100.672400.750001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841CCUGAUUUUUUUUCCUUUU75.6656968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
304859CCTGATTTTTTTTCCTTTTAAAAGGAAAAAAAATCAGG0.253600.094600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
839-861TACCTGATTTTTTTTCCTTTTAAAAAAGGAAAAAAAAUCAGGUACCUGAUUUUUUUUCCUUUUAAU18.712.020


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116UGAGAGAAAUAUGAAGAAC68.86911503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631134TGAGAGAAATATGAAGAACGTTCTTCATATTTCTCTCA0.334600.199100.577600.500001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631ACUUCGCCAUUCUCUCUUU78.261758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430649ACTTCGCCATTCTCTCTTTAAAGAGAGAATGGCGAAGT0.613200.139100.706900.750001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817UGACAUUUCAAGGAUAGAA83.3059418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709835TGACATTTCAAGGATAGAATTCTATCCTTGAAATGTCA0.054800.007800.551700.750001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085UGAGAUAUGAACAUAUUGU77.5855811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821103TGAGATATGAACATATTGTACAATATGTTCATATCTCA0.068000.009900.517200.500001.000001.00000


Target Position: 1340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340UGAUCCUUACAAGUUAGAA82.586458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641358TGATCCTTACAAGTTAGAATTCTAACTTGTAAGGATCA0.107900.001400.551700.750001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800UCGUUUAUUUUCAAGAAUA83.786387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901818TCGTTTATTTTCAAGAATATATTCTTGAAAATAAACGA0.033500.017200.750000.750001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486CACAUUUUCCUUUUCAAAU80.1295621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721504CACATTTTCCTTTTCAAATATTTGAAAAGGAAAATGTG0.428600.074300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1484-1506TTCACATTTTCCTTTTCAAATAGAUUUGAAAAGGAAAAUGUGAACACAUUUUCCUUUUCAAAUAGU7.75.321


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671ACCAUGCAUUAAGAGCUUC59.03232145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740689ACCATGCATTAAGAGCTTCGAAGCTCTTAATGCATGGT0.051000.005000.681000.500000.945700.87500


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571GACCUAGUUUUCCAUGCGU77.9694777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341589GACCTAGTTTTCCATGCGTACGCATGGAAAACTAGGTC0.187500.051600.543100.500001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255GGGCAGAUUUUCAGCAAAC76.3148911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661273GGGCAGATTTTCAGCAAACGTTTGCTGAAAATCTGCCC0.149900.004100.844800.750000.983700.75000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192AUGUUGGUCAUUUUAUGUU71.50221303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421210ATGTTGGTCATTTTATGTTAACATAAAATGACCAACAT0.350200.001800.508600.500001.000001.00000


Target Position: 2251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2251GACUUUUCUUAAACCUUCA90.4416125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352269GACTTTTCTTAAACCTTCATGAAGGTTTAAGAAAAGTC0.221200.196600.594800.500001.000001.00000


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198UAUAUCCAAAAGCUUUUUA73.62441118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572216TATATCCAAAAGCTTTTTATAAAAAGCTTTTGGATATA0.165200.049100.508600.500001.000001.00000


Target Position: 2347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2347ACCAACCUGUUACCUACUU65.7721744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1912365ACCAACCTGTTACCTACTTAAGTAGGTAACAGGTTGGT0.462300.164000.715500.750001.000001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406ACGCGCACACCAAGGAGAU69.96761419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846424ACGCGCACACCAAGGAGATATCTCCTTGGTGTGCGCGT0.062600.001700.594800.750001.000001.00000


Target Position: 2385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2385CAGACACUGGCAUGGAUAU86.3195270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142403CAGACACTGGCATGGATATATATCCATGCCAGTGTCTG0.053400.036000.741400.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538CCAGCUUCACCACCUUCAC66.90371657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776556CCAGCTTCACCACCTTCACGTGAAGGTGGTGAAGCTGG0.094400.003800.551700.750000.994600.75000


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705UGCAUCAGCCGUGUCUAUU66.32051702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501723TGCATCAGCCGTGTCTATTAATAGACACGGCTGATGCA0.188900.021500.844800.750000.929300.75000


Target Position: 495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495GCAGAACCAGAAGGGACAC65.50191763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635513GCAGAACCAGAAGGGACACGTGTCCCTTCTGGTTCTGC0.144700.009400.560300.750000.956501.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465CCUCAGUGCCUUCCUGUUU74.39831066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401483CCTCAGTGCCTTCCTGTTTAAACAGGAAGGCACTGAGG0.291500.016800.844801.000000.902200.75000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CUGAGGAGGAAAAAAAAAA85.6198298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1131152CTGAGGAGGAAAAAAAAAATTTTTTTTTTCCTCCTCAG0.997800.260600.784500.750001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375UUCUCAUGAUCCAACUAAU80.8475568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341393TTCTCATGATCCAACTAATATTAGTTGGATCATGAGAA0.801200.333200.663800.500001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828UCCUGAAUCCAAACUAAUC65.2851784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141846TCCTGAATCCAAACTAATCGATTAGTTTGGATTCAGGA0.048700.002500.689700.500001.000001.00000


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617UUAUAUGCUUACUGAUAUA90.0472138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952635TTATATGCTTACTGATATATATATCAGTAAGCATATAA0.037800.024700.491400.500001.000001.00000


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457UUUAAAUGUAAAGAUAUUU66.21511710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322475TTTAAATGTAAAGATATTTAAATATCTTTACATTTAAA0.051200.002500.500000.500001.000001.00000


Target Position: 840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
840ACCUGAUUUUUUUUCCUUU76.2918913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358858ACCTGATTTTTTTTCCTTTAAAGGAAAAAAAATCAGGT0.225300.078700.853400.750001.000001.00000


Target Position: 2242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2242GCCUUUGGGGACUUUUCUU75.7664956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262260GCCTTTGGGGACTTTTCTTAAGAAAAGTCCCCAAAGGC0.546300.002200.862101.000001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040CCUUACCUUUUUAUUUGCA80.7475578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931058CCTTACCTTTTTATTTGCATGCAAATAAAAAGGTAAGG0.287000.275600.491400.750001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846UUUUUUUUCCUUUUAAUUU62.99221923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771864TTTTTTTTCCTTTTAATTTAAATTAAAAGGAAAAAAAA0.496100.197900.500000.500001.000001.00000


Target Position: 2554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554GUUCUACAUAGAUGCUUAG76.4432897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8592572GTTCTACATAGATGCTTAGCTAAGCATCTATGTAGAAC0.216200.025800.474100.500001.000001.00000


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173CUCAACUGCCUACUCCAAA80.9315554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721191CTCAACTGCCTACTCCAAATTTGGAGTAGGCAGTTGAG0.451100.476900.810300.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398GGAUAUAGUUUUACUUUUA103.6672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682416GGATATAGTTTTACTTTTATAAAAGTAAAACTATATCC0.102800.008100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2396-2418ATGGATATAGTTTTACTTTTAAAUAAAAGUAAAACUAUAUCCAUGGAUAUAGUUUUACUUUUAAAU4.98.222


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UAGAAGUAUACCUGAUUUU75.0381011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657849TAGAAGTATACCTGATTTTAAAATCAGGTATACTTCTA0.080900.021200.672400.500001.000001.00000


Target Position: 2197, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197GUAUAUCCAAAAGCUUUUU73.47921130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722215GTATATCCAAAAGCTTTTTAAAAAGCTTTTGGATATAC0.156100.040800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2195-2217TGGTATATCCAAAAGCTTTTTATAAAAAGCUUUUGGAUAUACCAGUAUAUCCAAAAGCUUUUUAUU17.016.722


Target Position: 1087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087AGAUAUGAACAUAUUGUUG77.3464827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821105AGATATGAACATATTGTTGCAACAATATGTTCATATCT0.063200.007700.577600.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977UCUUCUGAGCUAUUUCAUC64.67781823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711995TCTTCTGAGCTATTTCATCGATGAAATAGCTCAGAAGA0.243000.006300.543100.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680AGCCCAAUGAAAUGAAUUA86.7047257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2201698AGCCCAATGAAATGAATTATAATTCATTTCATTGGGCT0.554000.090700.819000.750001.000001.00000


Target Position: 241, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241GAAACCUCCUCACAGUUUU80.7864574

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_724119GAAACCTCCTCACAGTTTT1/1/0/090.92CAV1NM_001753.31NANANA7:116165079..116165097(+)00CAV1(0.002)


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672CCAUGCAUUAAGAGCUUCC64.15521853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838690CCATGCATTAAGAGCTTCCGGAAGCTCTTAATGCATGG0.038900.004200.474100.500000.945701.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044ACCUUUUUAUUUGCAUGUG58.4792175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161062ACCTTTTTATTTGCATGTGCACATGCAAATAAAAAGGT0.027800.028400.560300.500001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CCGUGUCUAUUCCAUCUAC78.0858768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296731CCGTGTCTATTCCATCTACGTAGATGGAATAGACACGG0.621900.112400.732800.750001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574CCCUCAUGCAAAUCAAUUA91.489697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222592CCCTCATGCAAATCAATTATAATTGATTTGCATGAGGG0.216800.028600.956901.000001.000001.00000


Target Position: 2611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611GAAAUUUUAUAUGCUUACU80.9426553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682629GAAATTTTATATGCTTACTAGTAAGCATATAAAATTTC0.104600.097300.465500.500001.000001.00000


Target Position: 2328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2328UCUUCCUGACACUUUAAUU74.45181062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2562346TCTTCCTGACACTTTAATTAATTAAAGTGTCAGGAAGA0.876900.077500.715500.750001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534GUGUAUUCCAAGACAUGUC72.64931204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562552GTGTATTCCAAGACATGTCGACATGTCTTGGAATACAC0.023400.005000.474100.500001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559UGACGAAAUACUGGUUUUA79.9161635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852577TGACGAAATACTGGTTTTATAAAACCAGTATTTCGTCA0.020000.003800.689700.750001.000001.00000


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577ACCGCUUGCUGUCUGCCCU65.57991755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845595ACCGCTTGCTGTCTGCCCTAGGGCAGACAGCAAGCGGT0.021400.010900.508600.500000.967400.87500


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137AGGAGGAAAAAAAAAAAAA83.5242406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681155AGGAGGAAAAAAAAAAAAATTTTTTTTTTTTTCCTCCT0.998600.383500.844800.750001.000001.00000


Target Position: 2266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2266UUCAGUUAUGAUUUUUUUU66.33871701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252284TTCAGTTATGATTTTTTTTAAAAAAAATCATAACTGAA0.988600.010100.672400.500001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709UCAGCCGUGUCUAUUCCAU70.69691368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529727TCAGCCGTGTCTATTCCATATGGAATAGACACGGCTGA0.506400.091200.569000.750001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UAUUUUCUGUGCCUGAAUA84.1854362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421443TATTTTCTGTGCCTGAATATATTCAGGCACAGAAAATA0.057100.023300.500000.500001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675ACACUAGCCCAAUGAAAUG68.8331507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541693ACACTAGCCCAATGAAATGCATTTCATTGGGCTAGTGT0.351700.035800.551700.500001.000001.00000


Target Position: 2624, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624CUUACUGAUAUAUUUUACA87.2781235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2622-2644TGCTTACTGATATATTTTACAATUGUAAAAUAUAUCAGUAAGCACUUACUGAUAUAUUUUACAAUU-0.320.322


Target Position: 458, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458CGAUGACGUGGUCAAGAUU89.7568146

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_945819CGATGACGTGGTCAAGATT1/1/0/088.31CAV1NM_001753.31NANANANA00CAV1(0.002)


Target Position: 2339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339CUUUAAUUACCAACCUGUU79.941633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032357CTTTAATTACCAACCTGTTAACAGGTTGGTAATTAAAG0.256600.252300.491400.750001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947CACUUUCUCAGUUUUCAUA91.866791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
837965CACTTTCTCAGTTTTCATATATGAAAACTGAGAAAGTG0.023000.002300.750000.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
945-967ATCACTTTCTCAGTTTTCATAAGUAUGAAAACUGAGAAAGUGAUCACUUUCUCAGUUUUCAUAAGU7.417.722


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943AGAUCACUUUCUCAGUUUU85.6238297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857961AGATCACTTTCTCAGTTTTAAAACTGAGAAAGTGATCT0.019300.004100.724100.750000.962000.87500


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367GACUUUUUGCAUUUAAAAC73.4431131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592385GACTTTTTGCATTTAAAACGTTTTAAATGCAAAAAGTC0.185300.058600.672400.500001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608GCUGAAAUUUUAUAUGCUU87.5896218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772626GCTGAAATTTTATATGCTTAAGCATATAAAATTTCAGC0.174400.013200.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2606-2628TTGCTGAAATTTTATATGCTTACAAGCAUAUAAAAUUUCAGCAAGCUGAAAUUUUAUAUGCUUACU19.712.022


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619AUAUGCUUACUGAUAUAUU82.6217454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842637ATATGCTTACTGATATATTAATATATCAGTAAGCATAT0.035200.022600.534500.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UGCAUUAAGAGCUUCCUGA75.7738954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
855693TGCATTAAGAGCTTCCTGATCAGGAAGCTCTTAATGCA0.094500.004100.629300.500000.945700.75000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061CCUUUGCCCAGAAAGAAGA76.2616918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962079CCTTTGCCCAGAAAGAAGATCTTCTTTCTGGGCAAAGG0.949100.003100.620700.750000.994600.62500


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644GCAACAUCUUUAUCCGUAG78.7901711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421662GCAACATCTTTATCCGTAGCTACGGATAAAGATGTTGC0.121900.103500.681000.750001.000001.00000


Target Position: 1386, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386CAACUAAUGCCUUACUCUU88.5501186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951404CAACTAATGCCTTACTCTTAAGAGTAAGGCATTAGTTG0.509700.399900.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1384-1406TCCAACTAATGCCTTACTCTTCTAAGAGUAAGGCAUUAGUUGGACAACUAAUGCCUUACUCUUCUU18.94.632


Target Position: 550, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550CCUUCACUGUGACGAAAUA94.1944

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_155019CCTTCACTGTGACGAAATA1/1/0/097.21CAV1NM_001753.31NANANA7:116199076..116199094(+)00CAV1(0.002)


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110CGCGAGCAGAACAAACCUU78.4677744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153128CGCGAGCAGAACAAACCTTAAGGTTTGTTCTGCTCGCG0.474500.158700.784501.000001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489GUGAUUGCAGAACCAGAAG67.53621608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706507GTGATTGCAGAACCAGAAGCTTCTGGTTCTGCAATCAC0.056300.006500.655200.500000.967400.62500


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869GGUGCCAAUUUCAAGUUCC68.85921505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815887GGTGCCAATTTCAAGTTCCGGAACTTGAAATTGGCACC0.182200.051600.482800.500001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738ACCGUCUGUGACCCACUCU65.74111748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
614756ACCGTCTGTGACCCACTCTAGAGTGGGTCACAGACGGT0.232200.010600.629300.500000.956500.87500


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535UGUAUUCCAAGACAUGUCU68.16991565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892553TGTATTCCAAGACATGTCTAGACATGTCTTGGAATACA0.012900.005000.482800.500001.000001.00000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794UCAGCUUCGUUUAUUUUCA76.3704904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651812TCAGCTTCGTTTATTTTCATGAAAATAAACGAAGCTGA0.091500.038800.500000.500001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924AUCUUGGUUGAAAAUAAAA80.352608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800942ATCTTGGTTGAAAATAAAATTTTATTTTCAACCAAGAT0.187400.040100.681000.500001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333CUGACACUUUAAUUACCAA96.157428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022351CTGACACTTTAATTACCAATTGGTAATTAAAGTGTCAG0.739800.184500.637900.750001.000001.00000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706GCAUCAGCCGUGUCUAUUC77.168841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
380724GCATCAGCCGTGTCTATTCGAATAGACACGGCTGATGC0.203900.036400.681000.750001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CUGAUUUUUUUUCCUUUUA79.8336641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445860CTGATTTTTTTTCCTTTTATAAAAGGAAAAAAAATCAG0.242800.114500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
840-862ACCTGATTTTTTTTCCTTTTAATUAAAAGGAAAAAAAAUCAGGUCUGAUUUUUUUUCCUUUUAAUU18.77.421


Target Position: 1344, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344CCUUACAAGUUAGAAAACA83.0325434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381362CCTTACAAGTTAGAAAACATGTTTTCTAACTTGTAAGG0.086600.009200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1342-1364ATCCTTACAAGTTAGAAAACATAUGUUUUCUAACUUGUAAGGAUCCUUACAAGUUAGAAAACAUAU13.311.821


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361ACAACAAGGCCAUGGCAGA78.0727773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830379ACAACAAGGCCATGGCAGATCTGCCATGGCCTTGTTGT0.073700.046600.482800.500001.000001.00000


Target Position: 2245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2245UUUGGGGACUUUUCUUAAA74.65321045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872263TTTGGGGACTTTTCTTAAATTTAAGAAAAGTCCCCAAA0.540400.003400.500000.500001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603AGAUUGCUGAAAUUUUAUA88.4296194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362621AGATTGCTGAAATTTTATATATAAAATTTCAGCAATCT0.252900.005300.681000.750001.000001.00000


Target Position: 2497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497CACUUAGGAAAUGGCUUUG64.70951819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162515CACTTAGGAAATGGCTTTGCAAAGCCATTTCCTAAGTG0.029500.011300.646600.500001.000001.00000


Target Position: 2464, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464GUAAAGAUAUUUUUAUCUU87.6442217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2462-2484ATGTAAAGATATTTTTATCTTTAAAGAUAAAAAUAUCUUUACAUGUAAAGAUAUUUUUAUCUUUAU6.96.921


Target Position: 844, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GAUUUUUUUUCCUUUUAAU87.9409207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283862GATTTTTTTTCCTTTTAATATTAAAAGGAAAAAAAATC0.283900.168800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
842-864CTGATTTTTTTTCCTTTTAATTTAUUAAAAGGAAAAAAAAUCAGGAUUUUUUUUCCUUUUAAUUUU-3.8-12.011


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490AGAAAAUCACUUAGGAAAU80.7329581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162508AGAAAATCACTTAGGAAATATTTCCTAAGTGATTTTCT0.090700.036600.715500.750001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985GCUAUUUCAUCUAUUUUUG74.89491025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101003GCTATTTCATCTATTTTTGCAAAAATAGATGAAATAGC0.182800.094500.706900.750001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983GAGCUAUUUCAUCUAUUUU90.2589131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271001GAGCTATTTCATCTATTTTAAAATAGATGAAATAGCTC0.727300.116600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
981-1003CTGAGCTATTTCATCTATTTTTGAAAAUAGAUGAAAUAGCUCAGGAGCUAUUUCAUCUAUUUUUGU6.918.322


Target Position: 1635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635CUUCAUCUGGCAACAUCUU76.4286900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531653CTTCATCTGGCAACATCTTAAGATGTTGCCAGATGAAG0.439100.019500.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1633-1655GGCTTCATCTGGCAACATCTTTAAAGAUGUUGCCAGAUGAAGCCCUUCAUCUGGCAACAUCUUUAU19.220.422


Target Position: 1408, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1408GAAAUUUUAACCUAUGAUA94.728437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371426GAAATTTTAACCTATGATATATCATAGGTTAAAATTTC0.384400.268600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1406-1428TTGAAATTTTAACCTATGATATTUAUCAUAGGUUAAAAUUUCAAGAAAUUUUAACCUAUGAUAUUU13.3-12.021


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GUGCCUUCCUGUUUUUCAC70.7831363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791488GTGCCTTCCTGTTTTTCACGTGAAAAACAGGAAGGCAC0.289100.028300.500000.500001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370CUGCCUUCUCAUGAUCCAA85.1586324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901388CTGCCTTCTCATGATCCAATTGGATCATGAGAAGGCAG0.430600.120700.637900.750001.000001.00000


Target Position: 2626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626UACUGAUAUAUUUUACAAU83.0996430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222644TACTGATATATTTTACAATATTGTAAAATATATCAGTA0.767200.026600.672400.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011GAAUUUUUAAAACCCAUUU77.7281803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601029GAATTTTTAAAACCCATTTAAATGGGTTTTAAAAATTC0.161100.113700.672400.750001.000001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451UGUAGAUAACAAGACCUCA83.991374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321469TGTAGATAACAAGACCTCATGAGGTCTTGTTATCTACA0.113000.014700.482800.500000.989100.62500


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710CAGCCGUGUCUAUUCCAUC75.1789995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537728CAGCCGTGTCTATTCCATCGATGGAATAGACACGGCTG0.600800.092200.603400.500001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501CCAGAAGGGACACACAGUU79.2986680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661519CCAGAAGGGACACACAGTTAACTGTGTGTCCCTTCTGG0.111200.008400.698301.000000.994600.75000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693GAAUUAAAGUGGACCAAUA103.0864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001711GAATTAAAGTGGACCAATATATTGGTCCACTTTAATTC0.142200.111500.629300.750001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792AUUCAGCUUCGUUUAUUUU72.79661191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711810ATTCAGCTTCGTTTATTTTAAAATAAACGAAGCTGAAT0.100700.013200.508600.500001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496CAGAACCAGAAGGGACACA76.5698883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842514CAGAACCAGAAGGGACACATGTGTCCCTTCTGGTTCTG0.158900.008500.577600.500000.956501.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397UUACUCUUCUUGAAAUUUU69.08011483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221415TTACTCTTCTTGAAATTTTAAAATTTCAAGAAGAGTAA0.264100.244700.534500.500001.000001.00000


Target Position: 2267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2267UCAGUUAUGAUUUUUUUUU67.44211615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782285TCAGTTATGATTTTTTTTTAAAAAAAAATCATAACTGA0.094700.007800.724100.750001.000001.00000


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288GGCAAAUACGUAGACUCGG62.80031935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885306GGCAAATACGTAGACTCGGCCGAGTCTACGTATTTGCC0.013600.012300.586200.500001.000001.00000


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194ACAAUACAAGAUCUUCCUU76.6872873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543212ACAATACAAGATCTTCCTTAAGGAAGATCTTGTATTGT0.649700.572000.569000.750001.000001.00000


Target Position: 2355, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355GUUACCUACUUUGACUUUU73.98571090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4512373GTTACCTACTTTGACTTTTAAAAGTCAAAGTAGGTAAC0.274300.202500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2353-2375CTGTTACCTACTTTGACTTTTTGAAAAGUCAAAGUAGGUAACAGGUUACCUACUUUGACUUUUUGU19.219.823


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997AUUUUUGGCAGUCUGAAUU67.30991623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461015ATTTTTGGCAGTCTGAATTAATTCAGACTGCCAAAAAT0.260000.058600.500000.500001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GCCUUUUUUUCCCCCCAUA80.3756606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83194GCCTTTTTTTCCCCCCATATATGGGGGGAAAAAAAGGC0.975600.919000.956901.000001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221CCCUUAAAGCACAGCCCAG69.25531472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882239CCCTTAAAGCACAGCCCAGCTGGGCTGTGCTTTAAGGG0.014400.011300.706900.750000.967400.75000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571GGUUUUACCGCUUGCUGUC69.4141464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
624589GGTTTTACCGCTTGCTGTCGACAGCAAGCGGTAAAACC0.193800.023600.534500.750001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095ACAUAUUGUUGAAAGGUAA91.742893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791113ACATATTGTTGAAAGGTAATTACCTTTCAACAATATGT0.150600.028700.672400.750001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GGAAAAAAAAAAAAAAGAA92.274284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321159GGAAAAAAAAAAAAAAGAATTCTTTTTTTTTTTTTTCC0.992200.989200.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1139-1161GAGGAAAAAAAAAAAAAAGAAAAUUCUUUUUUUUUUUUUUCCUCGGAAAAAAAAAAAAAAGAAAAU5.50.700


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636GCCAUUCUCUCUUUCCUGC62.98521924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703654GCCATTCTCTCTTTCCTGCGCAGGAAAGAGAGAATGGC0.145500.116000.646600.500001.000001.00000


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562AAUAUCCAUGACCUAGUUU74.28491070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571580AATATCCATGACCTAGTTTAAACTAGGTCATGGATATT0.718900.003200.508600.500001.000001.00000


Target Position: 2316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316UGCCUCUUCCAGUCUUCCU64.1581852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842334TGCCTCTTCCAGTCTTCCTAGGAAGACTGGAAGAGGCA0.014200.004800.508600.500001.000001.00000


Target Position: 2456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456UUUUAAAUGUAAAGAUAUU75.9262946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442474TTTTAAATGTAAAGATATTAATATCTTTACATTTAAAA0.059900.001800.491400.500001.000001.00000


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299GUGGAUUACUGCCAUUCAC73.75531111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701317GTGGATTACTGCCATTCACGTGAATGGCAGTAATCCAC0.276500.003900.500000.500001.000001.00000


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195UGGUAUAUCCAAAAGCUUU77.542815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5132213TGGTATATCCAAAAGCTTTAAAGCTTTTGGATATACCA0.136400.021900.844800.750000.972800.62500


Target Position: 1345, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345CUUACAAGUUAGAAAACAU92.625378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221363CTTACAAGTTAGAAAACATATGTTTTCTAACTTGTAAG0.103100.008900.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1343-1365TCCTTACAAGTTAGAAAACATAAAUGUUUUCUAACUUGUAAGGACUUACAAGUUAGAAAACAUAAU14.911.822


Target Position: 167, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167CCCUCCAGCGCCUUUUUUU69.95411421

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_316719CCCTCCAGCGCCTTTTTTT1/1/0/091.46CAV1NM_001753.31NANANA7:116165005..116165023(+)00CAV1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
20185CCCTCCAGCGCCTTTTTTTAAAAAAAGGCGCTGGAGGG0.944700.574600.991401.000001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691AUGAAUUAAAGUGGACCAA72.91971176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931709ATGAATTAAAGTGGACCAATTGGTCCACTTTAATTCAT0.283600.230900.508600.500001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240GGAAACCUCCUCACAGUUU80.9111557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142258GGAAACCTCCTCACAGTTTAAACTGTGAGGAGGTTTCC0.616800.144600.870701.000000.956500.62500


Target Position: 2515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515GUGAUUCAAUCUGUAAACU77.228836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202533GTGATTCAATCTGTAAACTAGTTTACAGATTGAATCAC0.134900.005900.586200.500001.000001.00000


Target Position: 2240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2240CUGCCUUUGGGGACUUUUC60.39922075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8492258CTGCCTTTGGGGACTTTTCGAAAAGTCCCCAAAGGCAG0.066500.001700.612100.500000.940200.75000


Target Position: 2257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257UCUUAAACCUUCAGUUAUG68.50721537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872275TCTTAAACCTTCAGTTATGCATAACTGAAGGTTTAAGA0.033700.031700.569000.500001.000001.00000


Target Position: 2384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2384ACAGACACUGGCAUGGAUA83.8156384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712402ACAGACACTGGCATGGATATATCCATGCCAGTGTCTGT0.111000.008000.663800.750001.000001.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495CUUUUCAAAUAGGGUCUAA84.6774344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861513CTTTTCAAATAGGGTCTAATTAGACCCTATTTGAAAAG0.013300.006600.603400.750001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572ACCUAGUUUUCCAUGCGUG66.27141704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8501590ACCTAGTTTTCCATGCGTGCACGCATGGAAAACTAGGT0.182300.062900.560300.500001.000001.00000


Target Position: 377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
377AGACGAGCUGAGCGAGAAG72.91851177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890395AGACGAGCTGAGCGAGAAGCTTCTCGCTCAGCTCGTCT0.017100.001000.586200.500001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677GCCUGCACAAUAAAAAUGU72.42231232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312695GCCTGCACAATAAAAATGTACATTTTTATTGTGCAGGC0.654200.009900.793100.750001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363CUUUGACUUUUUGCAUUUA85.552301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902381CTTTGACTTTTTGCATTTATAAATGCAAAAAGTCAAAG0.258800.168800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2361-2383TACTTTGACTTTTTGCATTTAAAUAAAUGCAAAAAGUCAAAGUACUUUGACUUUUUGCAUUUAAAU20.019.222


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794CAACUUGCAGAAAGAAAUA91.490596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481812CAACTTGCAGAAAGAAATATATTTCTTTCTGCAAGTTG0.367900.025400.603400.750001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799UGCAGAAAGAAAUAUAAAU79.5984663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413817TGCAGAAAGAAATATAAATATTTATATTTCTTTCTGCA0.496100.169000.844800.750001.000001.00000


Target Position: 1790, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790CUAUUCAGCUUCGUUUAUU77.7474800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571808CTATTCAGCTTCGTTTATTAATAAACGAAGCTGAATAG0.169100.025600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1788-1810GTCTATTCAGCTTCGTTTATTTTAAUAAACGAAGCUGAAUAGACCUAUUCAGCUUCGUUUAUUUUU6.913.432


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248CCUCACAGUUUUCAUCCAG71.21211333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564266CCTCACAGTTTTCATCCAGCTGGATGAAAACTGTGAGG0.176600.160500.560300.750001.000001.00000


Target Position: 2419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419CUGUGUACAUAACUGAAAA96.550320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272437CTGTGTACATAACTGAAAATTTTCAGTTATGTACACAG0.162700.018000.784500.750001.000001.00000


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283CUGGGGGCAAAUACGUAGA73.2061154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782301CTGGGGGCAAATACGTAGATCTACGTATTTGCCCCCAG0.264700.007000.560300.500001.000001.00000


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374CUUCUCAUGAUCCAACUAA85.7884289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931392CTTCTCATGATCCAACTAATTAGTTGGATCATGAGAAG0.800700.332100.603400.750001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829GAUAGAAGUAUACCUGAUU89.9584141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
596847GATAGAAGTATACCTGATTAATCAGGTATACTTCTATC0.135800.011900.672400.750001.000001.00000


Target Position: 1749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1749AGCUUUCCCUGCCUCUCAU77.1802840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021767AGCTTTCCCTGCCTCTCATATGAGAGGCAGGGAAAGCT0.057600.011300.698300.750000.956500.62500


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641UCUCUCUUUCCUGCACAUC51.10242465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882659TCTCTCTTTCCTGCACATCGATGTGCAGGAAAGAGAGA0.081200.061900.543100.500001.000001.00000


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199AUAUCCAAAAGCUUUUUAU75.0991007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012217ATATCCAAAAGCTTTTTATATAAAAAGCTTTTGGATAT0.168900.055900.500000.500001.000001.00000


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239UCUGCCUUUGGGGACUUUU56.93092244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662257TCTGCCTTTGGGGACTTTTAAAAGTCCCCAAAGGCAGA0.017600.001600.724100.750000.940200.87500


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407CGCGCACACCAAGGAGAUC65.74471747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738425CGCGCACACCAAGGAGATCGATCTCCTTGGTGTGCGCG0.052600.005100.741400.750001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596GUCCAAAAGAUUGCUGAAA79.7667647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032614GTCCAAAAGATTGCTGAAATTTCAGCAATCTTTTGGAC0.057400.022700.819000.750001.000001.00000


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622UGCUUACUGAUAUAUUUUA85.4685305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7182640TGCTTACTGATATATTTTATAAAATATATCAGTAAGCA0.052300.029300.819000.750001.000001.00000


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175CAACUGCCUACUCCAAAAU78.8935706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081193CAACTGCCTACTCCAAAATATTTTGGAGTAGGCAGTTG0.299100.128200.637900.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748ACCCACUCUUUGAAGCUGU65.85741738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677766ACCCACTCTTTGAAGCTGTACAGCTTCAAAGAGTGGGT0.065000.031100.646600.500000.951100.62500


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404CGACGCGCACACCAAGGAG70.64981371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833422CGACGCGCACACCAAGGAGCTCCTTGGTGTGCGCGTCG0.043800.002000.482800.750001.000001.00000


Target Position: 2348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2348CCAACCUGUUACCUACUUU82.494467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1772366CCAACCTGTTACCTACTTTAAAGTAGGTAACAGGTTGG0.421900.150500.844801.000001.000001.00000


Target Position: 2389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389CACUGGCAUGGAUAUAGUU88.1507202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032407CACTGGCATGGATATAGTTAACTATATCCATGCCAGTG0.030300.012700.646600.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080UGGGGGAGGAGGCAGUAAU69.08261482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042098TGGGGGAGGAGGCAGTAATATTACTGCCTCCTCCCCCA0.189700.021200.836200.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012AAUUUUUAAAACCCAUUUA80.0904625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531030AATTTTTAAAACCCATTTATAAATGGGTTTTAAAAATT0.134700.105700.474100.500001.000001.00000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574CUAGUUUUCCAUGCGUGUU70.99741349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421592CTAGTTTTCCATGCGTGTTAACACGCATGGAAAACTAG0.193800.087200.525900.750001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676AGCCUGCACAAUAAAAAUG64.83971812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552694AGCCTGCACAATAAAAATGCATTTTTATTGTGCAGGCT0.671300.008600.698300.500001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471UGCCUUCCUGUUUUUCACA72.93071175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731489TGCCTTCCTGTTTTTCACATGTGAAAAACAGGAAGGCA0.307900.223100.646600.500000.978300.62500


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514ACAGUUUUGACGGCAUUUG55.96432285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592532ACAGTTTTGACGGCATTTGCAAATGCCGTCAAAACTGT0.163900.047200.560300.500001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267AGCAAACUCUUUUCCCACU73.60461120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151285AGCAAACTCTTTTCCCACTAGTGGGAAAAGAGTTTGCT0.119700.006200.646600.500001.000001.00000


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130AGAACUGAGGAGGAAAAAA85.4324309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381148AGAACTGAGGAGGAAAAAATTTTTTCCTCCTCAGTTCT0.416300.281300.724100.750001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397UGGAUAUAGUUUUACUUUU78.7216718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6262415TGGATATAGTTTTACTTTTAAAAGTAAAACTATATCCA0.103900.010000.844800.750001.000001.00000


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613CACUCAUCUGGGGCAUUUA89.5024156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859631CACTCATCTGGGGCATTTATAAATGCCCCAGATGAGTG0.018900.007200.758600.750001.000001.00000


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284UGGGGGCAAAUACGUAGAC54.73592341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762302TGGGGGCAAATACGTAGACGTCTACGTATTTGCCCCCA0.138500.004200.525900.500001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476UGACUUUGAAGAUGUGAUU74.70861044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763494TGACTTTGAAGATGTGATTAATCACATCTTCAAAGTCA0.040200.008100.715500.750001.000001.00000


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175CGCCUUUUUUUCCCCCCAU69.99011414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135193CGCCTTTTTTTCCCCCCATATGGGGGGAAAAAAAGGCG0.985000.928200.767201.000001.000001.00000


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089AGGCAGUAAUAAAAAGAUU83.0352433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292107AGGCAGTAATAAAAAGATTAATCTTTTTATTACTGCCT0.567400.144300.836200.750001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199UCAUUUUAUGUUAAGGGAA77.7901793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761217TCATTTTATGTTAAGGGAATTCCCTTAACATAAAATGA0.233100.138300.551700.750001.000001.00000


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502AGGAAAUGGCUUUGUGAUU75.1541000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7212520AGGAAATGGCTTTGTGATTAATCACAAAGCCATTTCCT0.054700.005900.836200.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098UAUUGUUGAAAGGUAAUUU73.18221155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6491116TATTGTTGAAAGGTAATTTAAATTACCTTTCAACAATA0.141200.035000.543100.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368ACUUUUUGCAUUUAAAACA76.9947855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332386ACTTTTTGCATTTAAAACATGTTTTAAATGCAAAAAGT0.187500.057500.500000.500001.000001.00000


Target Position: 2641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2641CAAUUUUUUAUCAUGCAUG73.81721102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582659CAATTTTTTATCATGCATGCATGCATGATAAAAAATTG0.018900.009200.491400.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500ACCAGAAGGGACACACAGU74.25411071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811518ACCAGAAGGGACACACAGTACTGTGTGTCCCTTCTGGT0.086300.007400.646600.500000.956500.75000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777GAGGUCAGCAUGUCUAUUC73.54521127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021795GAGGTCAGCATGTCTATTCGAATAGACATGCTGACCTC0.231000.006600.637900.500001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799UUCGUUUAUUUUCAAGAAU64.9971805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741817TTCGTTTATTTTCAAGAATATTCTTGAAAATAAACGAA0.038100.023200.663800.500001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388ACUAAUGCCUUACUCUUCU73.04671164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831406ACTAATGCCTTACTCTTCTAGAAGAGTAAGGCATTAGT0.459800.370800.482800.500001.000001.00000


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078GAUGGGGGAGGAGGCAGUA82.6186456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672096GATGGGGGAGGAGGCAGTATACTGCCTCCTCCCCCATC0.198700.019200.500000.750001.000001.00000


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304CUGCUUGAUUUUUGCCUCU72.59111210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412322CTGCTTGATTTTTGCCTCTAGAGGCAAAAATCAAGCAG0.203700.083400.560300.500001.000001.00000


Target Position: 1402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402CUUCUUGAAAUUUUAACCU68.1281570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1400-1422CTCTTCTTGAAATTTTAACCTATAGGUUAAAAUUUCAAGAAGAGCUUCUUGAAAUUUUAACCUAUU14.020.422


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193UGUUGGUCAUUUUAUGUUA87.5652220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291211TGTTGGTCATTTTATGTTATAACATAAAATGACCAACA0.357800.002100.672400.750001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376UCUCAUGAUCCAACUAAUG64.86911810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701394TCTCATGATCCAACTAATGCATTAGTTGGATCATGAGA0.795700.345500.569000.500001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178CUGCCUACUCCAAAAUGUU80.7894572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931196CTGCCTACTCCAAAATGTTAACATTTTGGAGTAGGCAG0.032400.019700.637900.750001.000001.00000


Target Position: 2261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261AAACCUUCAGUUAUGAUUU77.7276804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092279AAACCTTCAGTTATGATTTAAATCATAACTGAAGGTTT0.029000.023200.500000.500001.000001.00000


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966AGUAUUAUGUCUCUUCUGA87.2779236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
820984AGTATTATGTCTCTTCTGATCAGAAGAGACATAATACT0.060100.027100.482800.500001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579CGCUUGCUGUCUGCCCUCU71.47851307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801597CGCTTGCTGTCTGCCCTCTAGAGGGCAGACAGCAAGCG0.030900.010000.698300.750000.967401.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174GCGCCUUUUUUUCCCCCCA70.87321359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517192GCGCCTTTTTTTCCCCCCATGGGGGGAAAAAAAGGCGC0.981100.872400.577600.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742UCUGUGACCCACUCUUUGA76.8037866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872760TCTGTGACCCACTCTTTGATCAAAGAGTGGGTCACAGA0.351400.020100.500000.500000.978300.87500


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106AAAGGUAAUUUGAGAGAAA92.924668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591124AAAGGTAATTTGAGAGAAATTTCTCTCAAATTACCTTT0.204800.070800.500000.500001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506AAUGGCUUUGUGAUUCAAU76.5961881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372524AATGGCTTTGTGATTCAATATTGAATCACAAAGCCATT0.106000.021900.500000.500001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819ACAUUUCAAGGAUAGAAGU73.39381137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745837ACATTTCAAGGATAGAAGTACTTCTATCCTTGAAATGT0.046200.005400.500000.500001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310CCAUUCACUUCAUAAUCCA89.6997147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141328CCATTCACTTCATAATCCATGGATTATGAAGTGAATGG0.389800.132200.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1308-1330TGCCATTCACTTCATAATCCAGTUGGAUUAUGAAGUGAAUGGCACCAUUCACUUCAUAAUCCAGUU15.420.531


Target Position: 1395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395CCUUACUCUUCUUGAAAUU79.8966637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761413CCTTACTCTTCTTGAAATTAATTTCAAGAAGAGTAAGG0.271100.248400.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1393-1415TGCCTTACTCTTCTTGAAATTTTAAUUUCAAGAAGAGUAAGGCACCUUACUCUUCUUGAAAUUUUU7.418.922


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274UCUUUUCCCACUGUUUAAG52.38412435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731292TCTTTTCCCACTGTTTAAGCTTAAACAGTGGGAAAAGA0.075700.001300.586200.500001.000001.00000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563AUAUCCAUGACCUAGUUUU74.15731084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741581ATATCCATGACCTAGTTTTAAAACTAGGTCATGGATAT0.643100.003900.543100.500001.000001.00000


Target Position: 2302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302CUCUGCUUGAUUUUUGCCU64.12361856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792320CTCTGCTTGATTTTTGCCTAGGCAAAAATCAAGCAGAG0.201500.074700.465500.500001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882UCCCAUUUCAGCUGAUCAG59.68262116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911900TCCCATTTCAGCTGATCAGCTGATCAGCTGAAATGGGA0.033100.007700.586200.500001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GCCGUGUCUAUUCCAUCUA82.9459436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185730GCCGTGTCTATTCCATCTATAGATGGAATAGACACGGC0.612200.107700.827601.000001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098UAAAAAGAUUGAAGUAUUU78.2696757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722116TAAAAAGATTGAAGTATTTAAATACTTCAATCTTTTTA0.067700.055100.534500.500001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502CAGAAGGGACACACAGUUU85.449308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
611520CAGAAGGGACACACAGTTTAAACTGTGTGTCCCTTCTG0.132800.010900.784500.750001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336CCAGUGAUCCUUACAAGUU83.1248426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651354CCAGTGATCCTTACAAGTTAACTTGTAAGGATCACTGG0.026800.001400.698301.000001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UAGAUGCUUAGUCCCUCAU68.99741493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612580TAGATGCTTAGTCCCTCATATGAGGGACTAAGCATCTA0.341600.058100.517200.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948ACUUUCUCAGUUUUCAUAA81.7244506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835966ACTTTCTCAGTTTTCATAATTATGAAAACTGAGAAAGT0.023300.002100.672400.750001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508UGGCUUUGUGAUUCAAUCU71.73831283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322526TGGCTTTGTGATTCAATCTAGATTGAATCACAAAGCCA0.174400.036500.620700.500001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CGCACACCAAGGAGAUCGA83.6422398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
634427CGCACACCAAGGAGATCGATCGATCTCCTTGGTGTGCG0.110400.009700.629300.750001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796ACUUGCAGAAAGAAAUAUA88.2093200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409814ACTTGCAGAAAGAAATATATATATTTCTTTCTGCAAGT0.470500.030500.663800.750001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142GAAAAAAAAAAAAAAGAAA90.1816133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401160GAAAAAAAAAAAAAAGAAATTTCTTTTTTTTTTTTTTC0.992400.990100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1140-1162AGGAAAAAAAAAAAAAAGAAAAGUUUCUUUUUUUUUUUUUUCCUGAAAAAAAAAAAAAAGAAAAGU5.5-11.300


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326AGUCUUCCUGACACUUUAA89.8927144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3052344AGTCTTCCTGACACTTTAATTAAAGTGTCAGGAAGACT0.257700.067400.672400.750000.913000.62500


Target Position: 1634, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634GCUUCAUCUGGCAACAUCU86.4689265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451652GCTTCATCTGGCAACATCTAGATGTTGCCAGATGAAGC0.248500.016300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1632-1654GGGCTTCATCTGGCAACATCTTTAGAUGUUGCCAGAUGAAGCCCGCUUCAUCUGGCAACAUCUUUU20.520.432


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443CCCUAAACACCUCAACGAU82.912437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654461CCCTAAACACCTCAACGATATCGTTGAGGTGTTTAGGG0.074500.074400.810301.000001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191CAUACAAUACAAGAUCUUC78.4083749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834209CATACAATACAAGATCTTCGAAGATCTTGTATTGTATG0.605800.595200.482800.500001.000001.00000


Target Position: 2609, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609CUGAAAUUUUAUAUGCUUA92.968566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552627CTGAAATTTTATATGCTTATAAGCATATAAAATTTCAG0.163100.028300.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2607-2629TGCTGAAATTTTATATGCTTACTUAAGCAUAUAAAAUUUCAGCACUGAAAUUUUAUAUGCUUACUU19.77.413


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412UUUUAACCUAUGAUAUUUU71.74991281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151430TTTTAACCTATGATATTTTAAAATATCATAGGTTAAAA0.312900.239800.500000.500001.000001.00000


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532CUGUGUAUUCCAAGACAUG76.4389898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782550CTGTGTATTCCAAGACATGCATGTCTTGGAATACACAG0.015200.006800.629300.500001.000001.00000


Target Position: 2449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2449GCAUACUUUUUAAAUGUAA93.079961

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2447-2469CTGCATACTTTTTAAATGTAAAGUUACAUUUAAAAAGUAUGCAGGCAUACUUUUUAAAUGUAAAGU6.911.611


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586UCAAUUACUGGUCCAAAAG59.63962121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872604TCAATTACTGGTCCAAAAGCTTTTGGACCAGTAATTGA0.086900.063200.586200.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859GGUUUAGUGGCUCAACAUU85.6288296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1857-1879GTGGTTTAGTGGCTCAACATTGTAAUGUUGAGCCACUAAACCACGGUUUAGUGGCUCAACAUUGUU20.512.933


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168ACAACCUCAACUGCCUACU59.67962117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391186ACAACCTCAACTGCCTACTAGTAGGCAGTTGAGGTTGT0.529600.388700.500000.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087GGAGGCAGUAAUAAAAAGA88.9131180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3462105GGAGGCAGTAATAAAAAGATCTTTTTATTACTGCCTCC0.627600.142800.646600.750001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821AUUUCAAGGAUAGAAGUAU76.1335935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
873839ATTTCAAGGATAGAAGTATATACTTCTATCCTTGAAAT0.042900.008500.465500.500001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776UGAGGUCAGCAUGUCUAUU75.5344977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861794TGAGGTCAGCATGTCTATTAATAGACATGCTGACCTCA0.257200.001000.715500.750001.000001.00000


Target Position: 1088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088GAUAUGAACAUAUUGUUGA90.3444129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1086-1108GAGATATGAACATATTGTTGAAAUCAACAAUAUGUUCAUAUCUCGAUAUGAACAUAUUGUUGAAAU12.18.723


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548AUGUCUGUUCUACAUAGAU81.3585528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602566ATGTCTGTTCTACATAGATATCTATGTAGAACAGACAT0.038100.001500.474100.500001.000001.00000


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489AAGAAAAUCACUUAGGAAA86.0382279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382507AAGAAAATCACTTAGGAAATTTCCTAAGTGATTTTCTT0.096700.037600.637900.500001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108AGGUAAUUUGAGAGAAAUA94.225443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161126AGGTAATTTGAGAGAAATATATTTCTCTCAAATTACCT0.246000.083700.801700.750001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109GGUAAUUUGAGAGAAAUAU84.4961354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191127GGTAATTTGAGAGAAATATATATTTCTCTCAAATTACC0.243500.095100.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1107-1129AAGGTAATTTGAGAGAAATATGAAUAUUUCUCUCAAAUUACCUUGGUAAUUUGAGAGAAAUAUGAU6.9-0.322


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337CACUUUAAUUACCAACCUG78.1054766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912355CACTTTAATTACCAACCTGCAGGTTGGTAATTAAAGTG0.278800.273200.508600.500001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974GUCUCUUCUGAGCUAUUUC73.02131169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805992GTCTCTTCTGAGCTATTTCGAAATAGCTCAGAAGAGAC0.030200.005800.646600.500000.907600.75000


Target Position: 2418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418ACUGUGUACAUAACUGAAA83.4124412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592436ACTGTGTACATAACTGAAATTTCAGTTATGTACACAGT0.290800.015200.706900.750001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809UUCAAGAAUAAUCACGCUU61.52522003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201827TTCAAGAATAATCACGCTTAAGCGTGATTATTCTTGAA0.121700.017800.534500.500001.000001.00000


Target Position: 2442, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442CUAUACUGCAUACUUUUUA85.7967288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802460CTATACTGCATACTTTTTATAAAAAGTATGCAGTATAG0.036100.005400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2440-2462TGCTATACTGCATACTTTTTAAAUAAAAAGUAUGCAGUAUAGCACUAUACUGCAUACUUUUUAAAU3.213.132


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775AUGAGGUCAGCAUGUCUAU77.2508834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891793ATGAGGTCAGCATGTCTATATAGACATGCTGACCTCAT0.330100.001000.612100.500001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795CAGCUUCGUUUAUUUUCAA92.931867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061813CAGCTTCGTTTATTTTCAATTGAAAATAAACGAAGCTG0.094700.047900.637900.750001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675AAGCCUGCACAAUAAAAAU80.6359588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522693AAGCCTGCACAATAAAAATATTTTTATTGTGCAGGCTT0.698400.001600.629300.500001.000001.00000


Target Position: 2679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679CUGCACAAUAAAAAUGUUU73.25231151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922697CTGCACAATAAAAATGTTTAAACATTTTTATTGTGCAG0.644100.022300.784500.750000.994600.75000


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195CAAUACAAGAUCUUCCUUC73.21771153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847213CAATACAAGATCTTCCTTCGAAGGAAGATCTTGTATTG0.646400.563900.474100.500001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168CCUCCAGCGCCUUUUUUUC62.82981934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336186CCTCCAGCGCCTTTTTTTCGAAAAAAAGGCGCTGGAGG0.945700.576200.672400.750001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271AACUCUUUUCCCACUGUUU75.8207951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411289AACTCTTTTCCCACTGTTTAAACAGTGGGAAAAGAGTT0.500800.016700.646600.500001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826UUUCCUGAAUCCAAACUAA83.1267425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631844TTTCCTGAATCCAAACTAATTAGTTTGGATTCAGGAAA0.056500.003600.465500.500001.000001.00000


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585AUCAAUUACUGGUCCAAAA84.4439357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672603ATCAATTACTGGTCCAAAATTTTGGACCAGTAATTGAT0.437000.454900.681000.500001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CCUAGUUUUCCAUGCGUGU72.00261260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071591CCTAGTTTTCCATGCGTGTACACGCATGGAAAACTAGG0.185100.074900.637900.750001.000001.00000


Target Position: 2392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2392UGGCAUGGAUAUAGUUUUA86.5217264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002410TGGCATGGATATAGTTTTATAAAACTATATCCATGCCA0.031000.014000.810300.750001.000001.00000


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566UCCAUGACCUAGUUUUCCA77.7888794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6401584TCCATGACCTAGTTTTCCATGGAAAACTAGGTCATGGA0.099100.011200.525900.500001.000001.00000


Target Position: 1821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1821CACGCUUUCCUGAAUCCAA90.9234111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151839CACGCTTTCCTGAATCCAATTGGATTCAGGAAAGCGTG0.181200.090100.646600.750001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834AAGUAUACCUGAUUUUUUU84.4841356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
817852AAGTATACCTGATTTTTTTAAAAAAATCAGGTATACTT0.146500.049100.637900.500001.000001.00000


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610UGAAAUUUUAUAUGCUUAC62.15131964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182628TGAAATTTTATATGCTTACGTAAGCATATAAAATTTCA0.153000.140600.543100.500001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919GAAUUAUCUUGGUUGAAAA103.1873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497937GAATTATCTTGGTTGAAAATTTTCAACCAAGATAATTC0.242500.022200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
917-939TTGAATTATCTTGGTTGAAAATAUUUUCAACCAAGAUAAUUCAAGAAUUAUCUUGGUUGAAAAUAU14.91.822


Target Position: 664, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664CAGUUGUACCAUGCAUUAA91.914489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687682CAGTTGTACCATGCATTAATTAATGCATGGTACAACTG0.061000.016000.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
662-684GGCAGTTGTACCATGCATTAAGAUUAAUGCAUGGUACAACUGCCCAGUUGUACCAUGCAUUAAGAU21.119.022


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673ACAAGCCUGCACAAUAAAA83.5223407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542691ACAAGCCTGCACAATAAAATTTTATTGTGCAGGCTTGT0.144900.001600.706900.750001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GUUCCCAUUUCAGCUGAUC61.89411981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871898GTTCCCATTTCAGCTGATCGATCAGCTGAAATGGGAAC0.095300.008800.465500.500001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403UUCUUGAAAUUUUAACCUA78.6802722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7111421TTCTTGAAATTTTAACCTATAGGTTAAAATTTCAAGAA0.577500.208500.500000.500001.000001.00000


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194GUUGGUCAUUUUAUGUUAA92.99465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061212GTTGGTCATTTTATGTTAATTAACATAAAATGACCAAC0.364800.002800.612100.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864UUCCUGGUGCCAAUUUCAA69.90921426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644882TTCCTGGTGCCAATTTCAATTGAAATTGGCACCAGGAA0.788300.047200.525900.500001.000001.00000


Target Position: 1576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1576AGUUUUCCAUGCGUGUUUC63.60221887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511594AGTTTTCCATGCGTGTTTCGAAACACGCATGGAAAACT0.233200.114000.534500.500001.000001.00000


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171ACCUCAACUGCCUACUCCA84.1011365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871189ACCTCAACTGCCTACTCCATGGAGTAGGCAGTTGAGGT0.469700.387900.508600.500001.000001.00000


Target Position: 2383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2383AACAGACACUGGCAUGGAU83.6751396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892401AACAGACACTGGCATGGATATCCATGCCAGTGTCTGTT0.130100.012400.465500.500001.000001.00000


Target Position: 2469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2469GAUAUUUUUAUCUUUAUAU91.135105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612487GATATTTTTATCTTTATATATATAAAGATAAAAATATC0.040700.009100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2467-2489AAGATATTTTTATCTTTATATGAAUAUAAAGAUAAAAAUAUCUUGAUAUUUUUAUCUUUAUAUGAU-2.3-10.322


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105GAAAGGUAAUUUGAGAGAA93.836249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511123GAAAGGTAATTTGAGAGAATTCTCTCAAATTACCTTTC0.182900.068700.500000.750001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533UGUGUAUUCCAAGACAUGU70.5831373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322551TGTGTATTCCAAGACATGTACATGTCTTGGAATACACA0.023900.005700.500000.500001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000UUUGGCAGUCUGAAUUUUU66.75381671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7491018TTTGGCAGTCTGAATTTTTAAAAATTCAGACTGCCAAA0.225600.046600.500000.500001.000001.00000


Target Position: 483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483GAAGAUGUGAUUGCAGAAC68.40461544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856501GAAGATGTGATTGCAGAACGTTCTGCAATCACATCTTC0.019400.005000.525900.500001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CAUCAACUUGCAGAAAGAA91.532595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835809CATCAACTTGCAGAAAGAATTCTTTCTGCAAGTTGATG0.193600.012500.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
789-811CGCATCAACTTGCAGAAAGAAATUUCUUUCUGCAAGUUGAUGCGCAUCAACUUGCAGAAAGAAAUU19.119.232


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984AGCACUUGCAACCGUCUGU68.34581552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902002AGCACTTGCAACCGTCTGTACAGACGGTTGCAAGTGCT0.062500.003700.646600.500000.972800.75000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128GAAGAACUGAGGAGGAAAA93.892746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891146GAAGAACTGAGGAGGAAAATTTTCCTCCTCAGTTCTTC0.289300.289500.672400.750001.000001.00000


Target Position: 1341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341GAUCCUUACAAGUUAGAAA99.277611

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1339-1361GTGATCCTTACAAGTTAGAAAACUUUCUAACUUGUAAGGAUCACGAUCCUUACAAGUUAGAAAACU14.619.932


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144ACUCAAACUGAGGAAUUUC65.6261753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262162ACTCAAACTGAGGAATTTCGAAATTCCTCAGTTTGAGT0.026000.002900.534500.500000.907600.62500


Target Position: 1025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025CAUUUAAAUUUUUUUCCUU85.2463320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641043CATTTAAATTTTTTTCCTTAAGGAAAAAAATTTAAATG0.552800.147700.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1023-1045CCCATTTAAATTTTTTTCCTTACAAGGAAAAAAAUUUAAAUGGGCAUUUAAAUUUUUUUCCUUACU18.7-9.711


Target Position: 2399, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399GAUAUAGUUUUACUUUUAA99.515810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002417GATATAGTTTTACTTTTAATTAAAAGTAAAACTATATC0.077000.006700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2397-2419TGGATATAGTTTTACTTTTAAACUUAAAAGUAAAACUAUAUCCAGAUAUAGUUUUACUUUUAAACU4.96.121


Target Position: 1499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499UCAAAUAGGGUCUAACUCA81.8897496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881517TCAAATAGGGTCTAACTCATGAGTTAGACCCTATTTGA0.268200.003300.500000.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677CAUUAAGAGCUUCCUGAUU82.5651460

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1067719CATTAAGAGCTTCCTGATT1/1/0/088.31CAV1NM_001753.31NANANA7:116199203..116199221(+)00CAV1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674695CATTAAGAGCTTCCTGATTAATCAGGAAGCTCTTAATG0.088100.008000.646600.750001.000001.00000


Target Position: 287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
287GGGCAAAUACGUAGACUCG76.5044889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818305GGGCAAATACGTAGACTCGCGAGTCTACGTATTTGCCC0.027400.003100.698300.500001.000001.00000


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380AUGAUCCAACUAAUGCCUU66.02821727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671398ATGATCCAACTAATGCCTTAAGGCATTAGTTGGATCAT0.832000.402700.517200.500001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410ACUUUUAAACUGUGUACAU81.4678523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892428ACTTTTAAACTGTGTACATATGTACACAGTTTAAAAGT0.102400.067100.551700.750001.000001.00000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426CAUAACUGAAAAUGUGCUA85.8057287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832444CATAACTGAAAATGTGCTATAGCACATTTTCAGTTATG0.014300.007300.482800.750001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055UGCAUGUGGAUCAACCAUC60.60592061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481073TGCATGTGGATCAACCATCGATGGTTGATCCACATGCA0.025400.001700.672400.500000.923900.75000


Target Position: 1956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956UGCUGCAAACCUGACCCCU59.14652138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8851974TGCTGCAAACCTGACCCCTAGGGGTCAGGTTTGCAGCA0.018100.001100.508600.500001.000001.00000


Target Position: 445, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445CUAAACACCUCAACGAUGA80.2797615

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
443-465CCCTAAACACCTCAACGATGACGUCAUCGUUGAGGUGUUUAGGGCUAAACACCUCAACGAUGACGU21.114.732


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001UUGGCAGUCUGAAUUUUUA80.9735549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801019TTGGCAGTCTGAATTTTTATAAAAATTCAGACTGCCAA0.235600.058300.612100.500001.000001.00000


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034UUUUUUCCUUACCUUUUUA74.42361064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701052TTTTTTCCTTACCTTTTTATAAAAAGGTAAGGAAAAAA0.675000.331200.465500.500001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432GUCAACCGCGACCCUAAAC58.40082179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700450GTCAACCGCGACCCTAAACGTTTAGGGTCGCGGTTGAC0.324000.040000.672400.500000.962000.62500


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150ACUGAGGAAUUUCACCUGU69.91251425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182168ACTGAGGAATTTCACCTGTACAGGTGAAATTCCTCAGT0.225400.002400.500000.500000.940200.75000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553CAAAAUUAGAAUAUCCAUG74.60251052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021571CAAAATTAGAATATCCATGCATGGATATTCTAATTTTG0.281200.075400.491400.500001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870UCAACAUUGUGUUCCCAUU75.07741009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921888TCAACATTGTGTTCCCATTAATGGGAACACAATGTTGA0.060000.027000.715500.750001.000001.00000


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136GAGGAGGAAAAAAAAAAAA88.5717185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781154GAGGAGGAAAAAAAAAAAATTTTTTTTTTTTCCTCCTC0.998300.247900.810300.750001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254UGGGCAGAUUUUCAGCAAA82.1719484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561272TGGGCAGATTTTCAGCAAATTTGCTGAAAATCTGCCCA0.160800.001600.844800.750000.983700.75000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506AGGGACACACAGUUUUGAC69.68191446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
639524AGGGACACACAGTTTTGACGTCAAAACTGTGTGTCCCT0.089000.029300.525900.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853UCCUUUUAAUUUUCCUGGU60.07772089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852871TCCTTTTAATTTTCCTGGTACCAGGAAAATTAAAAGGA0.195900.016900.517200.500001.000001.00000


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249GGGACUUUUCUUAAACCUU83.3139417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1872267GGGACTTTTCTTAAACCTTAAGGTTTAAGAAAAGTCCC0.401000.108300.853401.000001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096AAUAAAAAGAUUGAAGUAU75.7139963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882114AATAAAAAGATTGAAGTATATACTTCAATCTTTTTATT0.354500.388900.465500.500001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871CAACAUUGUGUUCCCAUUU79.9307634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641889CAACATTGTGTTCCCATTTAAATGGGAACACAATGTTG0.072000.024900.646600.750001.000001.00000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248GGGGACUUUUCUUAAACCU77.566812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3822266GGGGACTTTTCTTAAACCTAGGTTTAAGAAAAGTCCCC0.451800.035900.646600.750001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GAUCAACCAUCGCUUUAUU89.0297178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751081GATCAACCATCGCTTTATTAATAAAGCGATGGTTGATC0.026800.001200.672400.750000.972801.00000


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830AUAGAAGUAUACCUGAUUU83.6035400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769848ATAGAAGTATACCTGATTTAAATCAGGTATACTTCTAT0.085300.015500.543100.500001.000001.00000


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473CCUUCCUGUUUUUCACAUU79.5528666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951491CCTTCCTGTTTTTCACATTAATGTGAAAAACAGGAAGG0.755200.202800.836201.000000.978300.75000


Target Position: 2097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2097AUAAAAAGAUUGAAGUAUU82.9008438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6112115ATAAAAAGATTGAAGTATTAATACTTCAATCTTTTTAT0.346700.379900.534500.500001.000001.00000


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488UGUGAUUGCAGAACCAGAA83.1108429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830506TGTGATTGCAGAACCAGAATTCTGGTTCTGCAATCACA0.133700.002100.534500.750000.967400.62500


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139GAGGAAAAAAAAAAAAAAG73.91121094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6051157GAGGAAAAAAAAAAAAAAGCTTTTTTTTTTTTTTCCTC0.991700.532600.672400.500001.000001.00000


Target Position: 2164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164CCUGUAAACCUGAGUCGUA93.267760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442182CCTGTAAACCTGAGTCGTATACGACTCAGGTTTACAGG0.120200.037300.663801.000001.000001.00000


Target Position: 2553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2553UGUUCUACAUAGAUGCUUA95.803230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612571TGTTCTACATAGATGCTTATAAGCATCTATGTAGAACA0.073000.019500.672400.750001.000001.00000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099AAAAAGAUUGAAGUAUUUU74.91361020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502117AAAAAGATTGAAGTATTTTAAAATACTTCAATCTTTTT0.043500.026400.500000.500001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475UUCCUGUUUUUCACAUUUU66.2151711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091493TTCCTGTTTTTCACATTTTAAAATGTGAAAAACAGGAA0.706400.178000.672400.500000.978301.00000


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570UGGUUUUACCGCUUGCUGU67.79351588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
645588TGGTTTTACCGCTTGCTGTACAGCAAGCGGTAAAACCA0.165400.008900.637900.500000.940200.62500


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CUACGUCCACACCGUCUGU75.2539993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886746CTACGTCCACACCGTCTGTACAGACGGTGTGGACGTAG0.022600.004300.465500.500000.907600.75000


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674CAAGCCUGCACAAUAAAAA88.0822204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572692CAAGCCTGCACAATAAAAATTTTTATTGTGCAGGCTTG0.228900.001600.646600.750001.000001.00000


Target Position: 2118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2118GCUGGAAUAAGUUCAAAUU85.6078299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8812136GCTGGAATAAGTTCAAATTAATTTGAACTTATTCCAGC0.014500.001100.844801.000001.000001.00000


Target Position: 1258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258CAGAUUUUCAGCAAACUCU80.886561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1256-1278GGCAGATTTTCAGCAAACTCTTTAGAGUUUGCUGAAAAUCUGCCCAGAUUUUCAGCAAACUCUUUU19.25.322


Target Position: 2241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2241UGCCUUUGGGGACUUUUCU60.32412079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322259TGCCTTTGGGGACTTTTCTAGAAAAGTCCCCAAAGGCA0.204300.002100.629300.500000.940200.62500


Target Position: 2631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2631AUAUAUUUUACAAUUUUUU73.68151114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872649ATATATTTTACAATTTTTTAAAAAATTGTAAAATATAT0.125200.035700.543100.500001.000001.00000


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594UGGUCCAAAAGAUUGCUGA73.35141142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992612TGGTCCAAAAGATTGCTGATCAGCAATCTTTTGGACCA0.031100.017600.620700.500001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247AAGUAUGUGGGCAGAUUUU77.4442822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771265AAGTATGTGGGCAGATTTTAAAATCTGCCCACATACTT0.028400.001200.637900.500001.000001.00000


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138GGAGGAAAAAAAAAAAAAA94.385440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691156GGAGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCTCC0.995700.386400.870701.000001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CAGUCUGAAUUUUUAAAAC78.4134748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011023CAGTCTGAATTTTTAAAACGTTTTAAAAATTCAGACTG0.256100.126100.637900.500001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464ACCUCAGUGCCUUCCUGUU73.64061117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491482ACCTCAGTGCCTTCCTGTTAACAGGAAGGCACTGAGGT0.303700.015800.706900.750000.902200.75000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692UGAAUUAAAGUGGACCAAU72.85581184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241710TGAATTAAAGTGGACCAATATTGGTCCACTTTAATTCA0.243100.187800.715500.750001.000001.00000


Target Position: 1788, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788GUCUAUUCAGCUUCGUUUA86.5733263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581806GTCTATTCAGCTTCGTTTATAAACGAAGCTGAATAGAC0.116000.029100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1786-1808ATGTCTATTCAGCTTCGTTTATTUAAACGAAGCUGAAUAGACAUGUCUAUUCAGCUUCGUUUAUUU15.316.033


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949CUUUCUCAGUUUUCAUAAG74.5771054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836967CTTTCTCAGTTTTCATAAGCTTATGAAAACTGAGAAAG0.025100.002000.500000.500001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801CAGAAAGAAAUAUAAAUGA89.8065145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553819CAGAAAGAAATATAAATGATCATTTATATTTCTTTCTG0.678100.111700.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
799-821TGCAGAAAGAAATATAAATGACAUCAUUUAUAUUUCUUUCUGCACAGAAAGAAAUAUAAAUGACAU-1.819.122


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642UGGCAACAUCUUUAUCCGU69.30371468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6111660TGGCAACATCTTTATCCGTACGGATAAAGATGTTGCCA0.155900.054300.569000.500001.000001.00000


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107UGAAGUAUUUUGCUGGAAU78.7654714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862125TGAAGTATTTTGCTGGAATATTCCAGCAAAATACTTCA0.062300.008800.715500.750001.000001.00000


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261AUUUUCAGCAAACUCUUUU65.77361742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651279ATTTTCAGCAAACTCTTTTAAAAGAGTTTGCTGAAAAT0.040000.024800.508600.500001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494UGCAGAACCAGAAGGGACA74.38131067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843512TGCAGAACCAGAAGGGACATGTCCCTTCTGGTTCTGCA0.160300.013800.646600.500000.956501.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299GAACUCUGCUUGAUUUUUG76.7213868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7292317GAACTCTGCTTGATTTTTGCAAAAATCAAGCAGAGTTC0.145400.077400.525900.500001.000001.00000


Target Position: 2488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2488GAAGAAAAUCACUUAGGAA104.1721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202506GAAGAAAATCACTTAGGAATTCCTAAGTGATTTTCTTC0.099200.041800.500000.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282CACUGUUUAAGGAGUUAGU79.2507689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1280-1302CCCACTGTTTAAGGAGTTAGTGGACUAACUCCUUAAACAGUGGGCACUGUUUAAGGAGUUAGUGGU18.917.823


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215UCAGUUCCCUUAAAGCACA75.4084985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
666233TCAGTTCCCTTAAAGCACATGTGCTTTAAGGGAACTGA0.321600.088300.517200.500001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567CCAUGACCUAGUUUUCCAU85.85285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791585CCATGACCTAGTTTTCCATATGGAAAACTAGGTCATGG0.107600.016900.689701.000001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233GCCAUGGAGUGUACAAGUA9288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511251GCCATGGAGTGTACAAGTATACTTGTACACTCCATGGC0.278100.001700.819001.000001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878GUGUUCCCAUUUCAGCUGA77.142843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661896GTGTTCCCATTTCAGCTGATCAGCTGAAATGGGAACAC0.180500.017700.569000.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127UGAAGAACUGAGGAGGAAA84.0189372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771145TGAAGAACTGAGGAGGAAATTTCCTCCTCAGTTCTTCA0.293900.294500.724100.750001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CGAGCUGAGCGAGAAGCAA89.2562165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872398CGAGCTGAGCGAGAAGCAATTGCTTCTCGCTCAGCTCG0.117200.001300.646601.000000.929300.62500


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477CCUGUUUUUCACAUUUUCC65.13711796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541495CCTGTTTTTCACATTTTCCGGAAAATGTGAAAAACAGG0.634600.139100.474100.500000.978300.75000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CAGACGAGCUGAGCGAGAA92.240385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874394CAGACGAGCTGAGCGAGAATTCTCGCTCAGCTCGTCTG0.023600.001300.612100.750001.000001.00000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996UAUUUUUGGCAGUCUGAAU76.2065927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881014TATTTTTGGCAGTCTGAATATTCAGACTGCCAAAAATA0.246700.059700.534500.500001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096CAUAUUGUUGAAAGGUAAU82.6201455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581114CATATTGTTGAAAGGTAATATTACCTTTCAACAATATG0.161400.030900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1094-1116AACATATTGTTGAAAGGTAATTTAUUACCUUUCAACAAUAUGUUCAUAUUGUUGAAAGGUAAUUUU18.66.722


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744UGUGACCCACUCUUUGAAG62.53441950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884762TGTGACCCACTCTTTGAAGCTTCAAAGAGTGGGTCACA0.421800.030800.569000.500000.978300.62500


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094AACAUAUUGUUGAAAGGUA89.2468166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671112AACATATTGTTGAAAGGTATACCTTTCAACAATATGTT0.159200.031200.465500.500001.000001.00000


Target Position: 1436, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436CCUGAAUAUUUGUUAUGUA100.0577

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1434-1456TGCCTGAATATTTGTTATGTAGAUACAUAACAAAUAUUCAGGCACCUGAAUAUUUGUUAUGUAGAU14.613.422


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CGUCUGUGACCCACUCUUU86.4283267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543758CGTCTGTGACCCACTCTTTAAAGAGTGGGTCACAGACG0.391600.016500.775901.000000.956500.62500


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399ACUCUUCUUGAAAUUUUAA84.509353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771417ACTCTTCTTGAAATTTTAATTAAAATTTCAAGAAGAGT0.600500.242500.672400.750001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACUGAGGAGGAAAAAAAAA81.663508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891151ACTGAGGAGGAAAAAAAAATTTTTTTTTCCTCCTCAGT0.997000.268300.706900.750001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790GCAUCAACUUGCAGAAAGA96.521321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770808GCATCAACTTGCAGAAAGATCTTTCTGCAAGTTGATGC0.039100.010000.629300.750000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
788-810CCGCATCAACTTGCAGAAAGAAAUCUUUCUGCAAGUUGAUGCGGGCAUCAACUUGCAGAAAGAAAU16.620.532


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514UGUGAUUCAAUCUGUAAAC64.44671836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942532TGTGATTCAATCTGTAAACGTTTACAGATTGAATCACA0.159800.007000.560300.500001.000001.00000


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088GAGGCAGUAAUAAAAAGAU89.1711170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232106GAGGCAGTAATAAAAAGATATCTTTTTATTACTGCCTC0.566000.130900.629300.750001.000001.00000


Target Position: 2203, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2203CCAAAAGCUUUUUAUUCCU76.5244888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842221CCAAAAGCTTTTTATTCCTAGGAATAAAAAGCTTTTGG0.240300.016600.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2201-2223ATCCAAAAGCTTTTTATTCCTCCAGGAAUAAAAAGCUUUUGGAUCCAAAAGCUUUUUAUUCCUCCU15.518.622


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097AUAUUGUUGAAAGGUAAUU66.49361686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6141115ATATTGTTGAAAGGTAATTAATTACCTTTCAACAATAT0.156900.035700.534500.500001.000001.00000


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263ACCUUCAGUUAUGAUUUUU71.34961318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022281ACCTTCAGTTATGATTTTTAAAAATCATAACTGAAGGT0.030800.017900.853400.750001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245CCUCCUCACAGUUUUCAUC69.85131431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308263CCTCCTCACAGTTTTCATCGATGAAAACTGTGAGGAGG0.541700.429500.663800.750001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614ACUCAUCUGGGGCAUUUAC63.27231910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
690632ACTCATCTGGGGCATTTACGTAAATGCCCCAGATGAGT0.119500.007200.525900.500001.000001.00000


Target Position: 2598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598CCAAAAGAUUGCUGAAAUU85.4511307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742616CCAAAAGATTGCTGAAATTAATTTCAGCAATCTTTTGG0.108900.024700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2596-2618GTCCAAAAGATTGCTGAAATTTTAAUUUCAGCAAUCUUUUGGACCCAAAAGAUUGCUGAAAUUUUU12.012.222


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501UAGGAAAUGGCUUUGUGAU74.4311063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8052519TAGGAAATGGCTTTGTGATATCACAAAGCCATTTCCTA0.047400.003500.491400.500001.000001.00000


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309GCCAUUCACUUCAUAAUCC70.33221389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281327GCCATTCACTTCATAATCCGGATTATGAAGTGAATGGC0.251400.121100.629300.500001.000001.00000


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223CUGCUCAUAUUGUGAUUCU79.5325671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612241CTGCTCATATTGTGATTCTAGAATCACAATATGAGCAG0.231400.057200.560300.500001.000001.00000


Target Position: 165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
165CCCCCUCCAGCGCCUUUUU62.97091926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82183CCCCCTCCAGCGCCTTTTTAAAAAGGCGCTGGAGGGGG0.660300.484200.991401.000001.000001.00000


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527GUAAACUGUGUAUUCCAAG71.29551322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512545GTAAACTGTGTATTCCAAGCTTGGAATACACAGTTTAC0.164300.041000.543100.500001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921AUUAUCUUGGUUGAAAAUA70.2951391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872939ATTATCTTGGTTGAAAATATATTTTCAACCAAGATAAT0.237400.056500.465500.500001.000001.00000


Target Position: 2387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387GACACUGGCAUGGAUAUAG74.80391036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8102405GACACTGGCATGGATATAGCTATATCCATGCCAGTGTC0.028800.019400.646600.500001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017UUAAAACCCAUUUAAAUUU64.081860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121035TTAAAACCCATTTAAATTTAAATTTAAATGGGTTTTAA0.168900.088300.534500.500001.000001.00000


Target Position: 2122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2122GAAUAAGUUCAAAUUCUUC81.6334510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122140GAATAAGTTCAAATTCTTCGAAGAATTTGAACTTATTC0.308600.002500.500000.500001.000001.00000


Target Position: 2262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262AACCUUCAGUUAUGAUUUU76.7104870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452280AACCTTCAGTTATGATTTTAAAATCATAACTGAAGGTT0.029300.020500.646600.500001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925UCUUGGUUGAAAAUAAAAA78.9925702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431943TCTTGGTTGAAAATAAAAATTTTTATTTTCAACCAAGA0.175700.030800.724100.750001.000001.00000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494CCUUUUCAAAUAGGGUCUA76.8824861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901512CCTTTTCAAATAGGGTCTATAGACCCTATTTGAAAAGG0.012400.005700.672401.000000.962000.62500


Target Position: 1115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115UUGAGAGAAAUAUGAAGAA80.2863614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691133TTGAGAGAAATATGAAGAATTCTTCATATTTCTCTCAA0.361800.196600.474100.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094GUAAUAAAAAGAUUGAAGU78.3066756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602112GTAATAAAAAGATTGAAGTACTTCAATCTTTTTATTAC0.397600.094300.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2092-2114CAGTAATAAAAAGATTGAAGTATACUUCAAUCUUUUUAUUACUGGUAAUAAAAAGAUUGAAGUAUU12.0-7.522


Target Position: 2153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153GAGGAAUUUCACCUGUAAA97.372617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852171GAGGAATTTCACCTGTAAATTTACAGGTGAAATTCCTC0.221500.012700.810300.750000.940200.62500


Target Position: 1789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789UCUAUUCAGCUUCGUUUAU66.9891649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381807TCTATTCAGCTTCGTTTATATAAACGAAGCTGAATAGA0.169400.028200.681000.750001.000001.00000


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394GCAUGGAUAUAGUUUUACU94.375341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972412GCATGGATATAGTTTTACTAGTAAAACTATATCCATGC0.031300.012100.646600.750001.000001.00000


Target Position: 507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
507GGGACACACAGUUUUGACG72.56561217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642525GGGACACACAGTTTTGACGCGTCAAAACTGTGTGTCCC0.082200.030900.715500.500001.000001.00000


Target Position: 1302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302GAUUACUGCCAUUCACUUC75.4361982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861320GATTACTGCCATTCACTTCGAAGTGAATGGCAGTAATC0.212700.026700.508600.500001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UUUUCCUUACCUUUUUAUU63.2771909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001054TTTTCCTTACCTTTTTATTAATAAAAAGGTAAGGAAAA0.690400.406800.491400.500001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750GCUUUCCCUGCCUCUCAUC63.97151869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381768GCTTTCCCTGCCTCTCATCGATGAGAGGCAGGGAAAGC0.083400.018300.672400.750001.000001.00000


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305UACUGCCAUUCACUUCAUA82.5626461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441323TACTGCCATTCACTTCATATATGAAGTGAATGGCAGTA0.180100.056900.637900.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UCAGUUUUCAUAAGUAUUA78.6116729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
633972TCAGTTTTCATAAGTATTATAATACTTATGAAAACTGA0.234600.009800.689700.750001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796AGCUUCGUUUAUUUUCAAG67.14691639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141814AGCTTCGTTTATTTTCAAGCTTGAAAATAAACGAAGCT0.064100.025100.715500.500001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277UUUUUUUUUCAUACACUUA76.5986880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822295TTTTTTTTTCATACACTTATAAGTGTATGAAAAAAAAA0.174600.078700.465500.500001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572GUCCCUCAUGCAAAUCAAU81.1552536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292590GTCCCTCATGCAAATCAATATTGATTTGCATGAGGGAC0.087200.030200.810300.750001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109AAGUAUUUUGCUGGAAUAA81.5456515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722127AAGTATTTTGCTGGAATAATTATTCCAGCAAAATACTT0.038600.010300.603400.500001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396CUUACUCUUCUUGAAAUUU75.3522987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091414CTTACTCTTCTTGAAATTTAAATTTCAAGAAGAGTAAG0.268000.245900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1394-1416GCCTTACTCTTCTTGAAATTTTAAAAUUUCAAGAAGAGUAAGGCCUUACUCUUCUUGAAAUUUUAU7.418.922


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767UGGGAAAAUAUUCAGCAAU72.61351208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
698785TGGGAAAATATTCAGCAATATTGCTGAATATTTTCCCA0.070900.006800.836200.750001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132AACUGAGGAGGAAAAAAAA89.3502161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331150AACTGAGGAGGAAAAAAAATTTTTTTTCCTCCTCAGTT0.996600.269000.646600.500001.000001.00000


Target Position: 2270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2270GUUAUGAUUUUUUUUUCAU81.9904493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2268-2290CAGTTATGATTTTTTTTTCATACAUGAAAAAAAAAUCAUAACUGGUUAUGAUUUUUUUUUCAUACU7.78.721


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979UUCUGAGCUAUUUCAUCUA79.1354696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768997TTCTGAGCTATTTCATCTATAGATGAAATAGCTCAGAA0.611100.007000.500000.500001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405CUUGAAAUUUUAACCUAUG73.04851162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281423CTTGAAATTTTAACCTATGCATAGGTTAAAATTTCAAG0.447900.146600.482800.500001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466CUCAGUGCCUUCCUGUUUU75.6837966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261484CTCAGTGCCTTCCTGTTTTAAAACAGGAAGGCACTGAG0.280300.018200.810300.750000.902200.75000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758UGCCUCUCAUCAACUGAAU71.58451296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471776TGCCTCTCATCAACTGAATATTCAGTTGATGAGAGGCA0.116900.004700.844800.750000.972800.75000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UGAUUUUUUUUCCUUUUAA82.6782449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301861TGATTTTTTTTCCTTTTAATTAAAAGGAAAAAAAATCA0.256500.154000.689700.750001.000001.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398UACUCUUCUUGAAAUUUUA86.6075262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361416TACTCTTCTTGAAATTTTATAAAATTTCAAGAAGAGTA0.318900.245400.646600.500001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392AUGCCUUACUCUUCUUGAA85.3804313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251410ATGCCTTACTCTTCTTGAATTCAAGAAGAGTAAGGCAT0.278100.259700.482800.500001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961UCAUAAGUAUUAUGUCUCU79.8209642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732979TCATAAGTATTATGTCTCTAGAGACATAATACTTATGA0.097200.076400.500000.500000.967400.62500


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780AGCAAUGUCCGCAUCAACU75.7454959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
855798AGCAATGTCCGCATCAACTAGTTGATGCGGACATTGCT0.019600.001600.646600.500000.956500.62500


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436ACCGCGACCCUAAACACCU65.54711759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830454ACCGCGACCCTAAACACCTAGGTGTTTAGGGTCGCGGT0.508200.084300.508600.500000.913000.62500


Target Position: 1946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1946CUAUCAGAGUUGCUGCAAA95.84129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801964CTATCAGAGTTGCTGCAAATTTGCAGCAACTCTGATAG0.014500.002000.672400.750000.983701.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018UAAAACCCAUUUAAAUUUU66.89521659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171036TAAAACCCATTTAAATTTTAAAATTTAAATGGGTTTTA0.175800.087800.534500.500001.000001.00000


Target Position: 663, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663GCAGUUGUACCAUGCAUUA92.800471

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_466319GCAGTTGTACCATGCATTA1/1/0/091.46CAV1NM_001753.31NANANA7:116199189..116199207(+)00CAV1(0.002)


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109CCGCGAGCAGAACAAACCU74.2161075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531127CCGCGAGCAGAACAAACCTAGGTTTGTTCTGCTCGCGG0.511200.130400.569000.750001.000001.00000


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467UCAGUGCCUUCCUGUUUUU69.71121444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151485TCAGTGCCTTCCTGTTTTTAAAAACAGGAAGGCACTGA0.276000.019400.724100.750000.902200.62500


Target Position: 1633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633GGCUUCAUCUGGCAACAUC75.1071005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5971651GGCTTCATCTGGCAACATCGATGTTGCCAGATGAAGCC0.233400.011700.819000.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026AUUUAAAUUUUUUUCCUUA84.9253330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491044ATTTAAATTTTTTTCCTTATAAGGAAAAAAATTTAAAT0.584500.158700.474100.500001.000001.00000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129AAGAACUGAGGAGGAAAAA75.7384962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641147AAGAACTGAGGAGGAAAAATTTTTCCTCCTCAGTTCTT0.410300.284300.637900.500001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539CAGCUUCACCACCUUCACU81.0213546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783557CAGCTTCACCACCTTCACTAGTGAAGGTGGTGAAGCTG0.107900.005000.577600.500000.994600.62500


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361UACUUUGACUUUUUGCAUU72.57311216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422379TACTTTGACTTTTTGCATTAATGCAAAAAGTCAAAGTA0.254100.181400.672400.500001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220UCCCUUAAAGCACAGCCCA65.36781776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721238TCCCTTAAAGCACAGCCCATGGGCTGTGCTTTAAGGGA0.051600.025200.525900.500000.967400.62500


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496UCACUUAGGAAAUGGCUUU67.46041614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602514TCACTTAGGAAATGGCTTTAAAGCCATTTCCTAAGTGA0.041100.019200.724100.750000.967400.62500


Target Position: 558, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GUGACGAAAUACUGGUUUU84.3119360

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_255819GTGACGAAATACTGGTTTT1/1/0/093.71CAV1NM_001753.31NANANA7:116199084..116199102(+)00CAV1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860576GTGACGAAATACTGGTTTTAAAACCAGTATTTCGTCAC0.018900.002500.793100.750001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988CUUGCAACCGUCUGUUAUG71.18531335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882006CTTGCAACCGTCTGTTATGCATAACAGACGGTTGCAAG0.012900.005500.482800.500001.000001.00000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791UAUUCAGCUUCGUUUAUUU81.3339531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851809TATTCAGCTTCGTTTATTTAAATAAACGAAGCTGAATA0.122900.017900.543100.500001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632GGGCUUCAUCUGGCAACAU80.6882583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7121650GGGCTTCATCTGGCAACATATGTTGCCAGATGAAGCCC0.249800.006300.836201.000001.000001.00000


Target Position: 2228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228CAUAUUGUGAUUCUGCCUU76.0607940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792246CATATTGTGATTCTGCCTTAAGGCAGAATCACAATATG0.080700.034000.517200.750001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194CUGGUAUAUCCAAAAGCUU79.8851638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5992212CTGGTATATCCAAAAGCTTAAGCTTTTGGATATACCAG0.097300.012500.646600.750000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2192-2214GCCTGGTATATCCAAAAGCTTTTAAGCUUUUGGAUAUACCAGGCCUGGUAUAUCCAAAAGCUUUUU17.021.132


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410AAUUUUAACCUAUGAUAUU82.4031472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241428AATTTTAACCTATGATATTAATATCATAGGTTAAAATT0.333700.266400.500000.500001.000001.00000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551ACCAAAAUUAGAAUAUCCA81.1305538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7951569ACCAAAATTAGAATATCCATGGATATTCTAATTTTGGT0.301000.088700.508600.500001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248AGUAUGUGGGCAGAUUUUC60.45232069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841266AGTATGTGGGCAGATTTTCGAAAATCTGCCCACATACT0.258400.001100.534500.500001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080UUGGCUGAGAUAUGAACAU68.20621563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591098TTGGCTGAGATATGAACATATGTTCATATCTCAGCCAA0.039500.002000.491400.500001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567GCUUAGUCCCUCAUGCAAA93.299159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452585GCTTAGTCCCTCATGCAAATTTGCATGAGGGACTAAGC0.045200.027900.853401.000001.000001.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412UUUUAAACUGUGUACAUAA85.91283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8802430TTTTAAACTGTGTACATAATTATGTACACAGTTTAAAA0.124500.078100.465500.500001.000001.00000


Target Position: 1987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987ACUUGCAACCGUCUGUUAU75.3163990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252005ACTTGCAACCGTCTGTTATATAACAGACGGTTGCAAGT0.026400.006400.663800.750001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975UCUCUUCUGAGCUAUUUCA77.8775785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770993TCTCTTCTGAGCTATTTCATGAAATAGCTCAGAAGAGA0.240000.006100.500000.500000.907600.62500


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247UCCUCACAGUUUUCAUCCA78.7761713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
638265TCCTCACAGTTTTCATCCATGGATGAAAACTGTGAGGA0.556900.430300.525900.500001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549AGACCAAAAUUAGAAUAUC74.52931058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241567AGACCAAAATTAGAATATCGATATTCTAATTTTGGTCT0.134900.002300.543100.500001.000001.00000


Target Position: 1748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1748CAGCUUUCCCUGCCUCUCA82.633452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771766CAGCTTTCCCTGCCTCTCATGAGAGGCAGGGAAAGCTG0.049400.005500.560300.500000.934800.62500


Target Position: 1400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400CUCUUCUUGAAAUUUUAAC61.34062017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7561418CTCTTCTTGAAATTTTAACGTTAAAATTTCAAGAAGAG0.608600.245000.663800.500001.000001.00000


Target Position: 2509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2509GGCUUUGUGAUUCAAUCUG70.0591411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3932527GGCTTTGTGATTCAATCTGCAGATTGAATCACAAAGCC0.261000.048000.715500.750001.000001.00000


Target Position: 431, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431GGUCAACCGCGACCCUAAA88.4837190

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_543119GGTCAACCGCGACCCTAAA1/1/0/091.19CAV1NM_001753.31NANANA7:116166701..116166719(+)00CAV1(0.002)


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081GGGGGAGGAGGCAGUAAUA93.645852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362099GGGGGAGGAGGCAGTAATATATTACTGCCTCCTCCCCC0.284600.027400.948301.000001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CUAAUACAGCAACAAUUUA90.9846110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875912CTAATACAGCAACAATTTATAAATTGTTGCTGTATTAG0.015600.001800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
892-914TGCTAATACAGCAACAATTTATGUAAAUUGUUGCUGUAUUAGCACUAAUACAGCAACAAUUUAUGU5.38.532


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944GCCUAUCAGAGUUGCUGCA83.5927402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621962GCCTATCAGAGTTGCTGCATGCAGCAACTCTGATAGGC0.018800.002600.646600.750000.983700.75000


Target Position: 2082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082GGGGAGGAGGCAGUAAUAA87.1246242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232100GGGGAGGAGGCAGTAATAATTATTACTGCCTCCTCCCC0.320800.028600.956901.000001.000001.00000


Target Position: 2420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2420UGUGUACAUAACUGAAAAU80.629590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392438TGTGTACATAACTGAAAATATTTTCAGTTATGTACACA0.071400.005000.698300.750001.000001.00000


Target Position: 2305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2305UGCUUGAUUUUUGCCUCUU65.59281754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3902323TGCTTGATTTTTGCCTCTTAAGAGGCAAAAATCAAGCA0.194600.088100.715500.750001.000001.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593CUGGUCCAAAAGAUUGCUG59.93352097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242611CTGGTCCAAAAGATTGCTGCAGCAATCTTTTGGACCAG0.026600.016000.500000.500001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517GUUUUGACGGCAUUUGGAA84.0228371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845535GTTTTGACGGCATTTGGAATTCCAAATGCCGTCAAAAC0.132000.023800.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
515-537CAGTTTTGACGGCATTTGGAAGGUUCCAAAUGCCGUCAAAACUGGUUUUGACGGCAUUUGGAAGGU20.114.923


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GCCAGCUUCACCACCUUCA77.7483799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805555GCCAGCTTCACCACCTTCATGAAGGTGGTGAAGCTGGC0.084300.002800.775900.750000.962000.62500


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019AAAACCCAUUUAAAUUUUU70.99561351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791037AAAACCCATTTAAATTTTTAAAAATTTAAATGGGTTTT0.186000.088600.500000.500001.000001.00000


Target Position: 1117, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117GAGAGAAAUAUGAAGAACU89.6019150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721135GAGAGAAATATGAAGAACTAGTTCTTCATATTTCTCTC0.365900.219900.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1115-1137TTGAGAGAAATATGAAGAACTGAAGUUCUUCAUAUUUCUCUCAAGAGAGAAAUAUGAAGAACUGAU21.519.122


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072UCGCUUUAUUGGCUGAGAU72.43811231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261090TCGCTTTATTGGCTGAGATATCTCAGCCAATAAAGCGA0.076300.005700.612100.750001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385UGAGCGAGAAGCAAGUGUA87.1393240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753403TGAGCGAGAAGCAAGTGTATACACTTGCTTCTCGCTCA0.079100.004500.543100.750000.983700.87500


Target Position: 2229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229AUAUUGUGAUUCUGCCUUU78.6327727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892247ATATTGTGATTCTGCCTTTAAAGGCAGAATCACAATAT0.060600.026100.543100.500001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520UCAAUCUGUAAACUGUGUA74.84131031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082538TCAATCTGTAAACTGTGTATACACAGTTTACAGATTGA0.143800.038900.543100.750000.940200.62500


Target Position: 1422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422UGAUAUUUUCUGUGCCUGA81.5447516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281440TGATATTTTCTGTGCCTGATCAGGCACAGAAAATATCA0.069100.031400.500000.500001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630CUGGGCUUCAUCUGGCAAC58.72832161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581648CTGGGCTTCATCTGGCAACGTTGCCAGATGAAGCCCAG0.041700.001500.637900.500001.000001.00000


Target Position: 1339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339GUGAUCCUUACAAGUUAGA75.9894944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871357GTGATCCTTACAAGTTAGATCTAACTTGTAAGGATCAC0.118000.001000.569000.500001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297GUAGACUCGGAGGGACAUC61.00952036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888315GTAGACTCGGAGGGACATCGATGTCCCTCCGAGTCTAC0.015400.001000.500000.500001.000001.00000


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632CUUCGCCAUUCUCUCUUUC62.95631927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876650CTTCGCCATTCTCTCTTTCGAAAGAGAGAATGGCGAAG0.588100.142400.465500.500001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220CUCCUGCUCAUAUUGUGAU77.7625798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432238CTCCTGCTCATATTGTGATATCACAATATGAGCAGGAG0.246500.050900.629300.750001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CCCAUUUAAAUUUUUUUCC53.81832378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881041CCCATTTAAATTTTTTTCCGGAAAAAAATTTAAATGGG0.513800.107100.620700.500001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204UUAUGUUAAGGGAAGAAUU73.11371161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301222TTATGTTAAGGGAAGAATTAATTCTTCCCTTAACATAA0.048100.029500.525900.500001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033UUUUUUUCCUUACCUUUUU60.30522081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631051TTTTTTTCCTTACCTTTTTAAAAAGGTAAGGAAAAAAA0.872900.527400.500000.500001.000001.00000


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824GCUUUCCUGAAUCCAAACU68.27161558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571842GCTTTCCTGAATCCAAACTAGTTTGGATTCAGGAAAGC0.060900.004300.646600.750001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365UUGACUUUUUGCAUUUAAA79.4312675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142383TTGACTTTTTGCATTTAAATTTAAATGCAAAAAGTCAA0.234800.098100.646600.500001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389CGAGAAGCAAGUGUACGAC72.5551218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858407CGAGAAGCAAGTGTACGACGTCGTACACTTGCTTCTCG0.019600.005700.474100.750001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374UGCAUUUAAAACAGACACU68.50261538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092392TGCATTTAAAACAGACACTAGTGTCTGTTTTAAATGCA0.233400.146900.646600.500001.000001.00000


Target Position: 2108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108GAAGUAUUUUGCUGGAAUA99.78299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592126GAAGTATTTTGCTGGAATATATTCCAGCAAAATACTTC0.073200.012600.629300.750001.000001.00000


Target Position: 101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
101CGGGCCAACCGCGAGCAGA71.89091271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
817119CGGGCCAACCGCGAGCAGATCTGCTCGCGGTTGGCCCG0.125700.002400.689700.750000.934800.87500


Target Position: 803, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GAAAGAAAUAUAAAUGACA95.611431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881821GAAAGAAATATAAATGACATGTCATTTATATTTCTTTC0.358200.196000.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
801-823CAGAAAGAAATATAAATGACATTUGUCAUUUAUAUUUCUUUCUGGAAAGAAAUAUAAAUGACAUUU14.85.522


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282UCUGGGGGCAAAUACGUAG58.36112180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
785300TCTGGGGGCAAATACGTAGCTACGTATTTGCCCCCAGA0.268700.003600.551700.500001.000001.00000


Target Position: 189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
189CCCAUACAAUACAAGAUCU85.0886325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361207CCCATACAATACAAGATCTAGATCTTGTATTGTATGGG0.616200.609300.767200.750001.000001.00000


Target Position: 1273, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273CUCUUUUCCCACUGUUUAA86.9226248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931291CTCTTTTCCCACTGTTTAATTAAACAGTGGGAAAAGAG0.100300.030400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1271-1293AACTCTTTTCCCACTGTTTAAGGUUAAACAGUGGGAAAAGAGUUCUCUUUUCCCACUGUUUAAGGU11.814.823


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439GCGACCCUAAACACCUCAA82.8463440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149457GCGACCCTAAACACCTCAATTGAGGTGTTTAGGGTCGC0.482600.206100.775901.000001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394GCCUUACUCUUCUUGAAAU89.081175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781412GCCTTACTCTTCTTGAAATATTTCAAGAAGAGTAAGGC0.269100.253300.991401.000001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984AGCUAUUUCAUCUAUUUUU80.2983613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221002AGCTATTTCATCTATTTTTAAAAATAGATGAAATAGCT0.247300.121300.853400.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571AGUCCCUCAUGCAAAUCAA89.94143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272589AGTCCCTCATGCAAATCAATTGATTTGCATGAGGGACT0.049400.030100.560300.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GGGAAAAUAUUCAGCAAUG80.3164611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657786GGGAAAATATTCAGCAATGCATTGCTGAATATTTTCCC0.073800.049200.836200.750001.000001.00000


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756CCUGCCUCUCAUCAACUGA81.1541537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771774CCTGCCTCTCATCAACTGATCAGTTGATGAGAGGCAGG0.137200.007900.620700.750000.983700.62500


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239GGGAAACCUCCUCACAGUU82.5755459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316257GGGAAACCTCCTCACAGTTAACTGTGAGGAGGTTTCCC0.575000.054800.844801.000000.913000.62500


Target Position: 2628, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628CUGAUAUAUUUUACAAUUU84.7426339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432646CTGATATATTTTACAATTTAAATTGTAAAATATATCAG0.766000.026800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2626-2648TACTGATATATTTTACAATTTTTAAAUUGUAAAAUAUAUCAGUACUGAUAUAUUUUACAAUUUUUU6.910.222


Target Position: 1188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CAAAAUGUUGGUCAUUUUA88.8563181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1186-1208TCCAAAATGTTGGTCATTTTATGUAAAAUGACCAACAUUUUGGACAAAAUGUUGGUCAUUUUAUGU7.45.322


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389CUAAUGCCUUACUCUUCUU82.2704482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321407CTAATGCCTTACTCTTCTTAAGAAGAGTAAGGCATTAG0.444500.349200.534500.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513CACAGUUUUGACGGCAUUU75.1638998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490531CACAGTTTTGACGGCATTTAAATGCCGTCAAAACTGTG0.146700.043600.793100.750001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CUUUAUUGGCUGAGAUAUG73.27271150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511093CTTTATTGGCTGAGATATGCATATCTCAGCCAATAAAG0.175800.023400.482800.500001.000001.00000


Target Position: 2552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552CUGUUCUACAUAGAUGCUU70.28831394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832570CTGTTCTACATAGATGCTTAAGCATCTATGTAGAACAG0.063200.014400.646600.750001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962CAUAAGUAUUAUGUCUCUU86.4283268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675980CATAAGTATTATGTCTCTTAAGAGACATAATACTTATG0.084900.066300.517200.750001.000001.00000


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481UUUUUCACAUUUUCCUUUU61.37632014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661499TTTTTCACATTTTCCTTTTAAAAGGAAAATGTGAAAAA0.609800.617700.500000.500001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214CUCAGUUCCCUUAAAGCAC64.69651820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
668232CTCAGTTCCCTTAAAGCACGTGCTTTAAGGGAACTGAG0.324400.099100.517200.500001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633AUAUUUUACAAUUUUUUAU75.7403961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172651ATATTTTACAATTTTTTATATAAAAAATTGTAAAATAT0.113800.063800.500000.500001.000001.00000


Target Position: 2084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084GGAGGAGGCAGUAAUAAAA99.156712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3552102GGAGGAGGCAGTAATAAAATTTTATTACTGCCTCCTCC0.313300.041700.870701.000001.000001.00000


Target Position: 1541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1541CUCCCUGAAGACCAAAAUU76.2001928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241559CTCCCTGAAGACCAAAATTAATTTTGGTCTTCAGGGAG0.177100.076800.801700.750001.000001.00000


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112CGAGCAGAACAAACCUUUG76.808864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782130CGAGCAGAACAAACCTTTGCAAAGGTTTGTTCTGCTCG0.035600.027400.646600.75000