siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 3   32   33   36   37   40   41   42   43   44   49   50   51   52   53   54   57   58   59   60  
65   79   86   87   88   129   130   131   132   154   155   156   157   162   176   177   181   182   183   184  
193   205   206   209   210   211   212   213   214   215   216   217   218   219   220   222   223   242   246   263  
267   268   269   270   271   299   300   311   312   313   317   318   319   320   321   324   325   336   347   351  
352   355   357   358   363   364   365   366   367   368   369   372   373   374   376   377   378   379   381   390  
394   395   399   410   411   420   421   422   423   424   439   440   441   449   450   458   502   503   511   512  
513   516   517   518   519   520   526   529   530   531   538   543   545   551   557   558   563   564   592   593  
594   595   596   597   600   601   602   603   605   606   607   608   609   610   611   614   615   658   672   673  
675   676   678   679   680   683   684   685   702   703   704   715   716   718   719   720   726   727   729   737  
738   744   745   746   754   759   760   761   773   774   775   778   779   780   781   783   784   787   788   789  
790   792   793   802   803   804   805   820   821   822   823   824   825   826   827   830   831   832   833   834  
837   838   839   840   841   842   843   844   846   847   850   857   858   862   863   864   868   870   871   882  
883   885   886   887   888   889   890   895   899   900   911   912   914   917   920   921   922   924   930   931  
935   937   938   940   945   951   952   953   954   955   958   959   960   961   962   963   965   974   975   984  
985   986   987   988   989   990   991   992   993   996   997   998   999   1007   1008   1010   1011   1020   1025   1026  
1027   1028   1029   1046   1047   1048   1049   1050   1051   1052   1054   1057   1058   1064   1069   1070   1076   1077   1078   1079  
1122   1123   1124   1134   1137   1140   1141   1148   1151   1155   1156   1157   1158   1159   1160   1182   1183   1184   1193   1194  
1195   1202   1203   1204   1206   1228   1230   1231   1240   1255   1257   1307   1311   1313   1318   1319   1320   1324   1332   1344  
1345   1346   1347   1348   1349   1350   1352   1354   1355   1368   1370   1396   1397   1398   1399   1406   1407   1408   1410   1411  
1412   1413   1415   1416   1417   1425   1434   1435   1436   1437   1439   1440   1444   1449   1453   1454   1455   1456   1458   1459  
1460   1461   1462   1463   1465   1467   1469   1493   1494   1495   1497   1498   1500   1503   1506   1515   1516   1517   1521   1522  
1523   1550   1551   1563   1565   1566   1567   1568   1570   1571   1572   1573   1574   1577   1578   1579   1580   1583   1584   1585  
1590   1591   1592   1595   1596   1597   1601   1602   1603   1604   1605   1609   1610   1614   1617   1618   1619   1620   1621   1622  
1625   1626   1627   1628   1630   1632   1645   1663   1664   1665   1666   1667   1669   1670   1671   1672   1679   1680   1681   1682  
1689   1690   1691   1692   1693   1694   1702   1703   1704   1705   1706   1707   1708   1709   1710   1711   1712   1713   1715   1716  
1720   1721   1723   1724   1725   1731   1735   1736   1743   1744   1745   1746   1751   1752   1753   1754   1757   1758   1764   1765  
1767   1768   1769   1770   1771   1773   1774   1775   1784   1785   1786   1787   1791   1792   1793   1794   1805   1806   1807   1813  
1814   1816   1817   1818   1828   1829   1830   1831   1835   1840   1842   1850   1851   1856   1860   1861   1864   1865   1870   1872  
1876   1877   1879   1881   1882   1883   1884   1885   1888   1889   1890   1891   1893   1894   1895   1899   1901   1902   1912   1913  
1917   1918   1919   1935   1936   1937   1938   1939   1940   1944   1945   1948   1949   1955   1956   1958   1960   1961   1962   1963  
1968   1970   1971   1972   1973   1975   1982   1983   1984   1985   1995   1998   1999   2003   2007   2008   2009   2010   2016   2017  
2018   2020   2022   2023   2024   2029   2035   2038   2039   2040   2041   2042   2061   2062   2063   2064   2065   2066   2067   2068  
2069   2070   2071   2072   2073   2074   2075   2077   2079   2080   2085   2086   2091   2092   2093   2094   2095   2096   2097   2098  
2099   2100   2101   2105   2106   2107   2123   2126   2127   2153   2174   2175   2176   2177   2179   2180   2181   2186   2187   2190  
2192   2193   2199   2200   2210   2212   2218   2219   2229   2230   2239   2240   2241   2242   2243   2244   2245   2246   2248   2249  
2250   2252   2253   2254   2256   2257   2258   2261   2264   2266   2267   2268   2290   2297   2298   2299   2303   2304   2307   2308  
2309   2310   2311   2317   2318   2319   2323   2324   2325   2326   2327   2328   2329   2330   2351   2352   2375   2378   2387   2388  
2406   2407   2408   2409   2410   2411   2414   2415   2418   2419   2424   2425   2426   2427   2428   2431   2432   2433   2434   2435  
2438   2439   2441   2442   2445   2446   2447   2448   2461   2462   2463   2464   2465   2466   2482   2483   2489   2490   2491   2492  
2494   2495   2499   2500   2502   2503   2504   2511   2512   2513   2518   2521   2522   2523   2524   2530   2531   2532   2533   2534  
2536   2541   2542   2544   2545   2546   2547   2548   2555   2556   2559   2560   2561   2562   2563   2566   2567   2568   2569   2570  
2571   2572   2574   2575   2597   2605   2610   2612   2613   2614   2615   2617   2624   2625   2628   2635   2636   2637   2642   2643  
2646   2649   2655   2656   2657   2658   2659   2660   2661   2663   2664   2672   2673   2674   2675   2676   2680   2681   2682   2683  
2685   2690   2700   2719   2720   2721   2722   2723   2724   2726   2727   2729   2730   2738   2741   2751   2752   2756   2757   2758  
2761   2763   2765   2768   2769   2771   2796   2797   2802   2805   2806   2807   2812   2813   2814   2815  
Biltr, Rnaxs, Sidirect 158   322   323   356   380   425   426   432   452   539   544   717   728   845   901   913   923   925   926   932  
936   939   964   966   967   1053   1055   1056   1138   1312   1351   1438   1441   1445   1464   1466   1468   1496   1499   1504  
1507   1518   1586   1593   1594   1615   1616   1623   1624   1629   1631   1673   1685   1722   1747   1755   1766   1776   1777   1798  
1799   1819   1841   1843   1866   1871   1878   1880   1892   1946   1947   1950   1957   1959   1969   1974   2076   2081   2178   2211  
2213   2228   2255   2265   2440   2493   2535   2537   2573   2576   2616   2638   2647   2648   2650   2662   2684   2686   2725   2731  
2762   2764   2770  
Biltr, Sidirect 382   430   527   549   659   730   835   892   893   1005   1013   1098   1222   1280   1291   1527   1537   1543   1546   1547  
1552   1714   1717   1750   1779   1821   1832   1869   1875   1886   1942   2119   2138   2182   2194   2205   2206   2220   2269   2467  
2754   2760  


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611UGUUCUAUUAUGAGAUUCU77.9945974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970629TGTTCTATTATGAGATTCTAGAATCTCATAATAGAACA0.449200.008100.482800.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350AGAAGUGUUCCUUUAGACA87.9364296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851368AGAAGTGTTCCTTTAGACATGTCTAAAGGAACACTTCT0.091500.018200.517200.500001.000001.00000


Target Position: 58, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
58UCUAGGAGAUAAAAAGAAC69.32771690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60176TCTAGGAGATAAAAAGAACGTTCTTTTTATCTCCTAGA0.626600.159500.577600.500001.000001.00000


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332ACCUUUGACUACAGCUGCA82.61616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521350ACCTTTGACTACAGCTGCATGCAGCTGTAGTCAAAGGT0.027000.012400.500000.500001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518CACAACAAGCAUACCAAGA82.0176661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835536CACAACAAGCATACCAAGATCTTGGTATGCTTGTTGTG0.562300.090200.569000.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UUUUUUGAUACUUGCCUAA72.67791439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941663TTTTTTGATACTTGCCTAATTAGGCAAGTATCAAAAAA0.089600.081900.465500.500001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307UCCUGUUUUAGCCUUCUGU63.00082156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942325TCCTGTTTTAGCCTTCTGTACAGAAGGCTAAAACAGGA0.226900.146100.663800.500001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCCUCAUUCUAAAAUUUAC79.5091845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327862GCCTCATTCTAAAATTTACGTAAATTTTAGAATGAGGC0.916600.881500.819000.750001.000001.00000


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959CCCAUGUGGUUUUUAUGUU78.1887956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364977CCCATGTGGTTTTTATGTTAACATAAAAACCACATGGG0.460100.054000.844801.000000.956500.75000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765UGUUAAGAACACGUGUAUU77.14931043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161783TGTTAAGAACACGTGTATTAATACACGTGTTCTTAACA0.113500.022400.698300.750001.000001.00000


Target Position: 86, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
86UGGAUAAAAAUGAGCUGGU66.34991932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917104TGGATAAAAATGAGCTGGTACCAGCTCATTTTTATCCA0.036100.014000.491400.500001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381UCUUUUGGAAAAGUUCUUG53.35152589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840399TCTTTTGGAAAAGTTCTTGCAAGAACTTTTCCAAAAGA0.191000.036200.577600.500001.000001.00000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GCUCGAGAAUACAGAGAGA96.023544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516337GCTCGAGAATACAGAGAGATCTCTCTGTATTCTCGAGC0.532900.031200.629300.750001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690CAGGGAAAUAACUUGAGAU91.1173161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391708CAGGGAAATAACTTGAGATATCTCAAGTTATTTCCCTG0.052600.016500.603400.750001.000001.00000


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GAGAGCAAAGUCUUCUAUU87.2986329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904439GAGAGCAAAGTCTTCTATTAATAGAAGACTTTGCTCTC0.049100.002600.801700.750001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364UGCAAUGAUGUACUGUCUC60.40062296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754382TGCAATGATGTACTGTCTCGAGACAGTACATCATTGCA0.072200.012100.543100.500001.000001.00000


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542UCUGCCUUUAAAAUCCUUC51.62422639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6652560TCTGCCTTTAAAATCCTTCGAAGGATTTTAAAGGCAGA0.921000.469800.551700.500001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020CUGUUUUCAUCUUGAGGUG69.63471655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411038CTGTTTTCATCTTGAGGTGCACCTCAAGATGAAAACAG0.036700.002000.491400.500001.000001.00000


Target Position: 1750, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750CAAUCCAAGCAUAAUUGUU84.4756491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1748-1770AACAATCCAAGCATAATTGTTAAAACAAUUAUGCUUGGAUUGUUCAAUCCAAGCAUAAUUGUUAAU6.920.102


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603CUUCUCUGUGUUCUAUUAU78.8559896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
683621CTTCTCTGTGTTCTATTATATAATAGAACACAGAGAAG0.146700.014000.594800.750001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931UGUUACUUCUAUUUGAAUU76.63041092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292949TGTTACTTCTATTTGAATTAATTCAAATAGAAGTAACA0.305900.096100.698300.750001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778ACCCAAGGAGACGAAGCUG59.19812354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
892796ACCCAAGGAGACGAAGCTGCAGCTTCGTCTCCTTGGGT0.184300.066100.569000.500001.000001.00000


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3CCACUCCCACCGCCAGCUG56.52412479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93821CCACTCCCACCGCCAGCTGCAGCTGGCGGTGGGAGTGG0.029700.006300.560300.750000.967400.62500


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GCUGAAUUAUCCAAUGAGG73.01041402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997202GCTGAATTATCCAATGAGGCCTCATTGGATAATTCAGC0.012400.001800.508600.500000.956500.75000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506ACAAAUGUAAAAGUAAAGA73.70691337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311524ACAAATGTAAAAGTAAAGATCTTTACTTTTACATTTGT0.603100.311500.482800.500001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764GUAAAUGCUCAAUAAAUAU88.8112249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672782GTAAATGCTCAATAAATATATATTTATTGAGCATTTAC0.126500.025200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2762-2784CTGTAAATGCTCAATAAATATTGAUAUUUAUUGAGCAUUUACAGGUAAAUGCUCAAUAAAUAUUGU-8.015.301


Target Position: 356, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356GAGAUAUCUGCAAUGAUGU84.3212504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
977374GAGATATCTGCAATGATGTACATCATTGCAGATATCTC0.036600.001300.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
354-376AAGAGATATCTGCAATGATGTACACAUCAUUGCAGAUAUCUCUUGAGAUAUCUGCAAUGAUGUACU13.615.912


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707AUGAUGGCUAGCUUUGUUU69.2141700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521725ATGATGGCTAGCTTTGTTTAAACAAAGCTAGCCATCAT0.153700.048500.655200.500001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517UCACAACAAGCAUACCAAG67.51441835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
673535TCACAACAAGCATACCAAGCTTGGTATGCTTGTTGTGA0.563900.074400.586200.500001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787UUCAUGUAAGUGGAAUAAA73.06981401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941805TTCATGTAAGTGGAATAAATTTATTCCACTTACATGAA0.133700.001100.672400.500001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483UGAUGAGACUGUGUUUAUC71.89441494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372501TGATGAGACTGTGTTTATCGATAAACACAGTCTCATCA0.109800.002100.543100.500001.000001.00000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831ACUUUCUCUACAGCUUUUC52.08882629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231849ACTTTCTCTACAGCTTTTCGAAAAGCTGTAGAGAAAGT0.117900.038100.534500.500000.978300.62500


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AGCAUUAACUGUAAGUUUU80.9234737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672198AGCATTAACTGTAAGTTTTAAAACTTACAGTTAATGCT0.047600.009600.853400.750001.000001.00000


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435CCUGCUGUUAGCUUUCAUU81.5245709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921453CCTGCTGTTAGCTTTCATTAATGAAAGCTAACAGCAGG0.030200.001100.836201.000000.940200.87500


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784AAAUUCAUGUAAGUGGAAU75.34681192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381802AAATTCATGTAAGTGGAATATTCCACTTACATGAATTT0.078500.002100.491400.500001.000001.00000


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912UCCUUAUUCCCUCUUGGCA69.29581692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531930TCCTTATTCCCTCTTGGCATGCCAAGAGGGAATAAGGA0.035200.001800.517200.500000.951100.62500


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GGAGUAGAGCCAGUUAACA90.9674168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431006GGAGTAGAGCCAGTTAACATGTTAACTGGCTCTACTCC0.198800.004300.663800.750001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396AGGGCAGAAACGGUUCACA77.49221018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931414AGGGCAGAAACGGTTCACATGTGAACCGTTTCTGCCCT0.024400.001100.637900.500001.000001.00000


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107AUUUAAAAUUUUGGCAUAU72.36581462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722125ATTTAAAATTTTGGCATATATATGCCAAAATTTTAAAT0.045500.037600.465500.500001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CCUUCCAACUUUUGUCUGC60.83812267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974845CCTTCCAACTTTTGTCTGCGCAGACAAAAGTTGGAAGG0.062000.015300.491400.500001.000001.00000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494GGCAACCUAAGAACAAAUG66.65111910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261512GGCAACCTAAGAACAAATGCATTTGTTCTTAGGTTGCC0.177000.025400.844800.750001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129GGCUGAGCGAUAUGAUGAC77.01031057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
932147GGCTGAGCGATATGATGACGTCATCATATCGCTCAGCC0.444700.002100.681000.750001.000001.00000


Target Position: 1947, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947CAAGUUUAAACACAAAAUU79.3512858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591965CAAGTTTAAACACAAAATTAATTTTGTGTTTAAACTTG0.831600.193600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1945-1967ACCAAGTTTAAACACAAAATTTAAAUUUUGUGUUUAAACUUGGUCAAGUUUAAACACAAAAUUUAU5.34.912


Target Position: 377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
377UGUCUCUUUUGGAAAAGUU73.8881319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849395TGTCTCTTTTGGAAAAGTTAACTTTTCCAAAAGAGACA0.087900.004100.560300.750000.967400.62500


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459UGCUACACUCAUUUUAUUU75.08391213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461477TGCTACACTCATTTTATTTAAATAAAATGAGTGTAGCA0.289500.113300.853400.750001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132UGAGCGAUAUGAUGACAUG75.99731136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749150TGAGCGATATGATGACATGCATGTCATCATATCGCTCA0.072700.047800.569000.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CACAAAUAGUUUUUUGUUU82.1812642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913CCCACAAATAGTTTTTTGTTTACAAACAAAAAACUAUUUGUGGGCACAAAUAGUUUUUUGUUUACU5.66.902


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769UGCUCAAUAAAUAUUGAUG69.23531699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622787TGCTCAATAAATATTGATGCATCAATATTTATTGAGCA0.048400.005100.698300.500000.918500.62500


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156ACUGCCUACAUACUGGUUU66.52911919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721174ACTGCCTACATACTGGTTTAAACCAGTATGTAGGCAGT0.046600.001400.706900.750000.978300.87500


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725UAAUGUCUUAUGAAAUUUU78.266950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141743TAATGTCTTATGAAATTTTAAAATTTCATAAGACATTA0.061600.002400.534500.500001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563UGCAACCAACACAUCCUAU74.01471309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449581TGCAACCAACACATCCTATATAGGATGTGTTGGTTGCA0.176000.125800.810300.750001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313UGGAAUACUCAAUGUGUAC67.92441812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351331TGGAATACTCAATGTGTACGTACACATTGAGTATTCCA0.030200.021500.663800.500001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GGAUACCCAAGGAGACGAA90.2823188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431792GGATACCCAAGGAGACGAATTCGTCTCCTTGGGTATCC0.261700.040500.698301.000001.000001.00000


Target Position: 1950, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GUUUAAACACAAAAUUUAU87.6511312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721968GTTTAAACACAAAATTTATATAAATTTTGTGTTTAAAC0.839400.729500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1948-1970AAGTTTAAACACAAAATTTATCAAUAAAUUUUGUGUUUAAACUUGUUUAAACACAAAAUUUAUCAU-9.70.012


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37CGACGUCCCUCAAACCUUG75.81011148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94455CGACGTCCCTCAAACCTTGCAAGGTTTGAGGGACGTCG0.125700.001900.646600.750001.000001.00000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712GGCUAGCUUUGUUUAAUGU84.0607518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441730GGCTAGCTTTGTTTAATGTACATTAAACAAAGCTAGCC0.029100.011600.793100.750001.000001.00000


Target Position: 1766, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766GUUAAGAACACGUGUAUUA90.696179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771784GTTAAGAACACGTGTATTATAATACACGTGTTCTTAAC0.123500.052000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1764-1786TTGTTAAGAACACGTGTATTAAAUAAUACACGUGUUCUUAACAAGUUAAGAACACGUGUAUUAAAU14.67.101


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619UUUUGCUUUUGUGAUUUUU59.72052329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771637TTTTGCTTTTGTGATTTTTAAAAATCACAAAAGCAAAA0.512200.085100.500000.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673GAUGAAGCCAUUGCUGAAC66.18841939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933691GATGAAGCCATTGCTGAACGTTCAGCAATGGCTTCATC0.031000.003600.534500.500000.923901.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GCUAAUAAUGCAAUUACUG75.47661179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623747GCTAATAATGCAATTACTGCAGTAATTGCATTATTAGC0.202000.018900.569000.750001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439UUGAAAAUGAAAGGAGAUU60.17192302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934457TTGAAAATGAAAGGAGATTAATCTCCTTTCATTTTCAA0.030300.012300.637900.500001.000001.00000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595GCCCUUAACUUCUCUGUGU78.4563930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841613GCCCTTAACTTCTCTGTGTACACAGAGAAGTTAAGGGC0.052200.044200.793100.750001.000001.00000


Target Position: 41, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
41GUCCCUCAAACCUUGCUUC63.98672080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98759GTCCCTCAAACCTTGCTTCGAAGCAAGGTTTGAGGGAC0.115000.003200.646600.500001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151AGAAAACUGCCUACAUACU79.1764874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461169AGAAAACTGCCTACATACTAGTATGTAGGCAGTTTTCT0.284700.018300.517200.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075GGGAUUGAUUAGAAAAAAA98.979919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232093GGGATTGATTAGAAAAAAATTTTTTTCTAATCAATCCC0.326000.042800.991401.000001.000001.00000


Target Position: 430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430GUCUUCUAUUUGAAAAUGA85.0296459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
428-450AAGTCTTCTATTTGAAAATGAAAUCAUUUUCAAAUAGAAGACUUGUCUUCUAUUUGAAAAUGAAAU7.420.202


Target Position: 1468, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468CAUUUUAUUUGUAUUUAAA98.488423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571486CATTTTATTTGTATTTAAATTTAAATACAAATAAAATG0.172000.129500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1466-1488CTCATTTTATTTGTATTTAAATGUUUAAAUACAAAUAAAAUGAGCAUUUUAUUUGUAUUUAAAUGU-7.5-10.301


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GUUCCAGUCACAGGUGUAG67.45781844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501222GTTCCAGTCACAGGTGTAGCTACACCTGTGACTGGAAC0.238400.036500.474100.500000.972800.87500


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216CUCAGUUGCUUAUAAAAAU85.4495431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483234CTCAGTTGCTTATAAAAATATTTTTATAAGCAACTGAG0.159700.039300.801700.750001.000001.00000


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516GUCACAACAAGCAUACCAA94.208774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557534GTCACAACAAGCATACCAATTGGTATGCTTGTTGTGAC0.128700.079300.672400.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GUGAAGAGUCAUACAAAGA89.7138210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699722GTGAAGAGTCATACAAAGATCTTTGTATGACTCTTCAC0.150200.012500.569000.500001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127GCAUUUUCUAACUUAGGAA93.867185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552145GCATTTTCTAACTTAGGAATTCCTAAGTTAGAAAATGC0.061900.004000.681001.000001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684UGCUGAACUUGAUACAUUA95.379857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629702TGCTGAACTTGATACATTATAATGTATCAAGTTCAGCA0.108300.026700.819000.750001.000001.00000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345GCUGCAGAAGUGUUCCUUU85.9078409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281363GCTGCAGAAGTGTTCCTTTAAAGGAACACTTCTGCAGC0.032600.010500.853401.000000.978300.75000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254CCUUCAAUUUUGAUCCUUU88.162281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3472272CCTTCAATTTTGATCCTTTAAAGGATCAAAATTGAAGG0.251400.170400.844801.000001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938UCUAUUUGAAUUUCUAUAU73.11261394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492956TCTATTTGAATTTCTATATATATAGAAATTCAAATAGA0.155200.060300.681000.750001.000001.00000


Target Position: 211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211CUUCUCUCAGUUGCUUAUA77.42751023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850229CTTCTCTCAGTTGCTTATATATAAGCAACTGAGAGAAG0.059200.004100.594800.750001.000001.00000


Target Position: 2194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194GUUUUGUGCUUCCAAAUCA87.8713302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2192-2214AAGTTTTGTGCTTCCAAATCACTUGAUUUGGAAGCACAAAACUUGUUUUGUGCUUCCAAAUCACUU20.112.202


Target Position: 2105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2105CCAUUUAAAAUUUUGGCAU75.58941167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462123CCATTTAAAATTTTGGCATATGCCAAAATTTTAAATGG0.131500.091200.689701.000001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761CAUUGUGGACAUCGGAUAC75.54751172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
957779CATTGTGGACATCGGATACGTATCCGATGTCCACAATG0.031300.001700.474100.500001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GAAUAAAAGUUUUAUGAAU94.991561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911817GAATAAAAGTTTTATGAATATTCATAAAACTTTTATTC0.068300.001100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1797-1819TGGAATAAAAGTTTTATGAATGGAUUCAUAAAACUUUUAUUCCAGAAUAAAAGUUUUAUGAAUGGU8.9-9.701


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716ACAAAGACAGCACGCUAAU73.67681339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635734ACAAAGACAGCACGCTAATATTAGCGTGCTGTCTTTGT0.107100.023500.698300.750001.000001.00000


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456UUUUGCUACACUCAUUUUA71.11091547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961474TTTTGCTACACTCATTTTATAAAATGAGTGTAGCAAAA0.411300.097600.465500.500001.000001.00000


Target Position: 2255, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255CUUCAAUUUUGAUCCUUUA91.223158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712273CTTCAATTTTGATCCTTTATAAAGGATCAAAATTGAAG0.281000.166500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2253-2275GCCTTCAATTTTGATCCTTTATTUAAAGGAUCAAAAUUGAAGGCCUUCAAUUUUGAUCCUUUAUUU18.77.412


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822ACCGGCCUUCCAACUUUUG51.67342638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956840ACCGGCCTTCCAACTTTTGCAAAAGTTGGAAGGCCGGT0.069300.001700.706900.500000.945700.62500


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123GUGUAAAACUGCUUCCAUG82.033659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711141GTGTAAAACTGCTTCCATGCATGGAAGCAGTTTTACAC0.046700.004700.637900.500001.000001.00000


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930AUGUUACUUCUAUUUGAAU79.9041812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709948ATGTTACTTCTATTTGAATATTCAAATAGAAGTAACAT0.297600.082600.646600.500001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494UGUUUAUCUCCCUUUAAAA88.0786289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812512TGTTTATCTCCCTTTAAAATTTTAAAGGGAGATAAACA0.658900.424100.706900.750001.000001.00000


Target Position: 2041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2041AAAAAAUGAGUUCCUAUUU75.48061177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392059AAAAAATGAGTTCCTATTTAAATAGGAACTCATTTTTT0.029700.007000.500000.500001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566UCUUCCUCCUCUAUUCUCU69.63991653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832584TCTTCCTCCTCTATTCTCTAGAGAATAGAGGAGGAAGA0.499000.320400.500000.500001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884AGGAAAUUGUACAUUUUUU83.0937583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671902AGGAAATTGTACATTTTTTAAAAAATGTACAATTTCCT0.324000.046200.844800.750001.000001.00000


Target Position: 967, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967GUUUUUAUGUUUAAUAUUA94.126278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543985GTTTTTATGTTTAATATTATAATATTAAACATAAAAAC0.185900.072300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
965-987TGGTTTTTATGTTTAATATTAGGUAAUAUUAAACAUAAAAACCAGUUUUUAUGUUUAAUAUUAGGU-8.0-9.712


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007UUUAGGGAGUUAUCUGUUU68.32711775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511025TTTAGGGAGTTATCTGTTTAAACAGATAACTCCCTAAA0.065800.004100.500000.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594CAUGUAUUUAACUUUUUUU84.9532464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841612CATGTATTTAACTTTTTTTAAAAAAAGTTAAATACATG0.644300.483100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1592-1614CCCATGTATTTAACTTTTTTTTAAAAAAAAGUUAAAUACAUGGGCAUGUAUUUAACUUUUUUUUAU-5.96.702


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318UACUCAAUGUGUACACCUU82.2542636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561336TACTCAATGTGTACACCTTAAGGTGTACACATTGAGTA0.024500.011000.543100.500001.000001.00000


Target Position: 1747, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747GAACAAUCCAAGCAUAAUU87.7148308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841765GAACAATCCAAGCATAATTAATTATGCTTGGATTGTTC0.044700.012900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1745-1767ATGAACAATCCAAGCATAATTGTAAUUAUGCUUGGAUUGUUCAUGAACAAUCCAAGCAUAAUUGUU15.214.803


Target Position: 1875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875CUUCUCUAAAGGAAAUUGU69.88161634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1873-1895AACTTCTCTAAAGGAAATTGTACACAAUUUCCUUUAGAGAAGUUCUUCUCUAAAGGAAAUUGUACU7.420.202


Target Position: 1631, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631GAUUUUUUUUUUUUUUUUU78.5418921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891649GATTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAATC0.584400.490400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1629-1651GTGATTTTTTTTTTTTTTTTTTGAAAAAAAAAAAAAAAAAUCACGAUUUUUUUUUUUUUUUUUUGU-11.3-12.000


Target Position: 2323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2323UGUCUUGUCACCAACCAUU73.86651321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6002341TGTCTTGTCACCAACCATTAATGGTTGGTGACAAGACA0.116800.019000.698300.750000.983700.62500


Target Position: 2193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2193AGUUUUGUGCUUCCAAAUC62.27272195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582211AGTTTTGTGCTTCCAAATCGATTTGGAAGCACAAAACT0.130600.011100.525900.500000.929300.62500


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768UAAGAACACGUGUAUUAAA89.1128239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221786TAAGAACACGTGTATTAAATTTAATACACGTGTTCTTA0.120300.037400.534500.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723UUUAAUGUCUUAUGAAAUU70.19441607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401741TTTAATGTCTTATGAAATTAATTTCATAAGACATTAAA0.033600.002000.491400.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158UGCCUACAUACUGGUUUGU60.1232308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541176TGCCTACATACTGGTTTGTACAAACCAGTATGTAGGCA0.025600.002700.646600.500000.978300.75000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094UGUAGUGUGUUCCAUUUAA87.865303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382112TGTAGTGTGTTCCATTTAATTAAATGGAACACACTACA0.135700.016200.672400.750001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596UGUAUUUAACUUUUUUUUA80.4205770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231614TGTATTTAACTTTTTTTTATAAAAAAAAGTTAAATACA0.542200.451000.672400.750001.000001.00000


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520CAACAAGCAUACCAAGAAG81.7823690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857538CAACAAGCATACCAAGAAGCTTCTTGGTATGCTTGTTG0.084300.052800.508600.500001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176AGCAAGGAGCUGAAUUAUC66.86671893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936194AGCAAGGAGCTGAATTATCGATAATTCAGCTCCTTGCT0.110200.003300.672400.500000.907600.62500


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769AAGAACACGUGUAUUAAAU79.4238850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491787AAGAACACGTGTATTAAATATTTAATACACGTGTTCTT0.535800.024300.629300.500001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GCUACACUCAUUUUAUUUG75.18651204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561478GCTACACTCATTTTATTTGCAAATAAAATGAGTGTAGC0.241800.102500.706900.750001.000001.00000


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961AAAUUUAUCAUAACAAAAA87.356326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621979AAATTTATCATAACAAAAATTTTTGTTATGATAAATTT0.843300.742500.500000.500001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026UCAUCUUGAGGUGGCCAAU67.40891849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021044TCATCTTGAGGTGGCCAATATTGGCCACCTCAAGATGA0.042600.002600.715500.750001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743UCAUGAACAAUCCAAGCAU76.53991099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371761TCATGAACAATCCAAGCATATGCTTGGATTGTTCATGA0.178300.004400.569000.750001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351GAAGUGUUCCUUUAGACAA95.534253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471369GAAGTGTTCCTTTAGACAATTGTCTAAAGGAACACTTC0.098300.020100.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1349-1371CAGAAGTGTTCCTTTAGACAAAGUUGUCUAAAGGAACACUUCUGGAAGUGUUCCUUUAGACAAAGU20.317.812


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UGAAGCCAUUGCUGAACUU74.2881282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906693TGAAGCCATTGCTGAACTTAAGTTCAGCAATGGCTTCA0.037900.010500.586200.750000.923900.87500


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870UGAAACUUCUCUAAAGGAA82.2784634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9581888TGAAACTTCTCTAAAGGAATTCCTTTAGAGAAGTTTCA0.024200.016300.551700.750001.000001.00000


Target Position: 1122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122AGUGUAAAACUGCUUCCAU83.7646531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781140AGTGTAAAACTGCTTCCATATGGAAGCAGTTTTACACT0.045800.004600.551700.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798GGAAUAAAAGUUUUAUGAA99.084518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871816GGAATAAAAGTTTTATGAATTCATAAAACTTTTATTCC0.015600.002000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1796-1818GTGGAATAAAAGTTTTATGAATGUUCAUAAAACUUUUAUUCCACGGAAUAAAAGUUUUAUGAAUGU8.92.102


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310UGUUUUAGCCUUCUGUCUU72.68111438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242328TGTTTTAGCCTTCTGTCTTAAGACAGAAGGCTAAAACA0.339100.181500.569000.750001.000001.00000


Target Position: 2647, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2647GCAGAAAACACCAAACAAA95.717349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1532665GCAGAAAACACCAAACAAATTTGTTTGGTGTTTTCTGC0.508600.207200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2645-2667TTGCAGAAAACACCAAACAAAAAUUUGUUUGGUGUUUUCUGCAAGCAGAAAACACCAAACAAAAAU12.212.202


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093AUGUAGUGUGUUCCAUUUA82.1718644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872111ATGTAGTGTGTTCCATTTATAAATGGAACACACTACAT0.082200.015800.620700.500001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424GCUUGCAUCCCACAGACUA89.2905231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2812442GCTTGCATCCCACAGACTATAGTCTGTGGGATGCAAGC0.376500.126100.681001.000001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872AAACUUCUCUAAAGGAAAU80.3509777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131890AAACTTCTCTAAAGGAAATATTTCCTTTAGAGAAGTTT0.037400.015300.491400.500001.000001.00000


Target Position: 2318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318CCUUCUGUCUUGUCACCAA96.299241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522336CCTTCTGTCTTGTCACCAATTGGTGACAAGACAGAAGG0.049800.020900.698301.000000.989100.62500


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003CCAUGUCCCAUGAUCCCCU74.37421275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902021CCATGTCCCATGATCCCCTAGGGGATCATGGGACATGG0.202800.090800.500000.750000.923900.62500


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027CAUCUUGAGGUGGCCAAUA83.7943529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931045CATCTTGAGGTGGCCAATATATTGGCCACCTCAAGATG0.043500.002900.612100.750001.000001.00000


Target Position: 2544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544UGCCUUUAAAAUCCUUCCU58.61332379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062562TGCCTTTAAAATCCTTCCTAGGAAGGATTTTAAAGGCA0.931700.504700.508600.500001.000001.00000


Target Position: 2418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418UCCUUUGCUUGCAUCCCAC58.8722366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062436TCCTTTGCTTGCATCCCACGTGGGATGCAAGCAAAGGA0.188300.066100.577600.500001.000001.00000


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491CUGUGUUUAUCUCCCUUUA89.2932230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322509CTGTGTTTATCTCCCTTTATAAAGGGAGATAAACACAG0.665500.105800.750000.750001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545GCCUUUAAAAUCCUUCCUC64.20432066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2692563GCCTTTAAAATCCTTCCTCGAGGAAGGATTTTAAAGGC0.900300.572600.689700.750001.000001.00000


Target Position: 936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936CUUCUAUUUGAAUUUCUAU86.347380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575954CTTCTATTTGAATTTCTATATAGAAATTCAAATAGAAG0.134100.075300.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
934-956TACTTCTATTTGAATTTCTATATAUAGAAAUUCAAAUAGAAGUACUUCUAUUUGAAUUUCUAUAUU6.96.911


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595AUGUAUUUAACUUUUUUUU70.1491612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211613ATGTATTTAACTTTTTTTTAAAAAAAAGTTAAATACAT0.570200.465300.655200.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449AAGGAGAUUACUACCGUUA83.6238541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810467AAGGAGATTACTACCGTTATAACGGTAGTAATCTCCTT0.179000.015100.603400.500000.923900.75000


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583AAACAAAAACCCAUGUAUU82.0761653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181601AAACAAAAACCCATGTATTAATACATGGGTTTTTGTTT0.185700.079200.491400.500001.000001.00000


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320CUCAAUGUGUACACCUUUG71.37521527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651338CTCAATGTGTACACCTTTGCAAAGGTGTACACATTGAG0.117700.008700.663800.500001.000001.00000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CUGCAAUGAUGUACUGUCU83.9769523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819381CTGCAATGATGTACTGTCTAGACAGTACATCATTGCAG0.056500.009300.560300.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299GAUUACCUUCCUGUUUUAG69.93441631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422317GATTACCTTCCTGTTTTAGCTAAAACAGGAAGGTAATC0.259400.179600.508600.500001.000001.00000


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945GAAUUUCUAUAUUUCCCAU93.1035101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
785963GAATTTCTATATTTCCCATATGGGAAATATAGAAATTC0.063500.039800.517200.750001.000001.00000


Target Position: 1628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628UGUGAUUUUUUUUUUUUUU69.63271656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741646TGTGATTTTTTTTTTTTTTAAAAAAAAAAAAAATCACA0.612900.395100.706900.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864CAGUAGACCAUUUGUCAUC73.58471350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767882CAGTAGACCATTTGTCATCGATGACAAATGGTCTACTG0.335700.007200.603400.500000.918500.87500


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679AAAAUAGUUAACAGGGAAA83.9036527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281697AAAATAGTTAACAGGGAAATTTCCCTGTTAACTATTTT0.075200.015600.500000.500001.000001.00000


Target Position: 2657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2657CCAAACAAAAAUGCCAUUU65.46091997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142675CCAAACAAAAATGCCATTTAAATGGCATTTTTGTTTGG0.144100.158200.844801.000000.962000.87500


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658GCAAAGACAGCUUUUGAUG72.17441472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971676GCAAAGACAGCTTTTGATGCATCAAAAGCTGTCTTTGC0.047800.001500.698300.750001.000001.00000


Target Position: 549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549CAGCAAAAAGGAAAUGCAA91.5566144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
547-569ATCAGCAAAAAGGAAATGCAACCUUGCAUUUCCUUUUUGCUGAUCAGCAAAAAGGAAAUGCAACCU20.018.602


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210UCACUUUUUGGUUUUUAAG59.70852331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892228TCACTTTTTGGTTTTTAAGCTTAAAAACCAAAAAGTGA0.078800.003100.586200.500001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974CAAAAAUACUACUAAUAUA107.721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611992CAAAAATACTACTAATATATATATTAGTAGTATTTTTG0.670500.604600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1972-1994AACAAAAATACTACTAATATAACUAUAUUAGUAGUAUUUUUGUUCAAAAAUACUACUAAUAUAACU-2.7-9.701


Target Position: 932, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932GUUACUUCUAUUUGAAUUU78.1017967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456950GTTACTTCTATTTGAATTTAAATTCAAATAGAAGTAAC0.312800.126900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
930-952ATGTTACTTCTATTTGAATTTCTAAAUUCAAAUAGAAGUAACAUGUUACUUCUAUUUGAAUUUCUU7.414.612


Target Position: 2192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2192AAGUUUUGUGCUUCCAAAU75.84511147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702210AAGTTTTGTGCTTCCAAATATTTGGAAGCACAAAACTT0.067800.007900.629300.500000.929300.62500


Target Position: 51, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
51CCUUGCUUCUAGGAGAUAA90.1642194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46569CCTTGCTTCTAGGAGATAATTATCTCCTAGAAGCAAGG0.254300.034800.810301.000001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182GAGCUGAAUUAUCCAAUGA92.3821122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980200GAGCTGAATTATCCAATGATCATTGGATAATTCAGCTC0.029400.001200.586200.500001.000001.00000


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298AGAUUACCUUCCUGUUUUA93.662191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3852316AGATTACCTTCCTGTTTTATAAAACAGGAAGGTAATCT0.284300.048300.689700.750001.000001.00000


Target Position: 2138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138CUUAGGAAGCCACAAUGUU78.1697960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2136-2158AACTTAGGAAGCCACAATGTTCTAACAUUGUGGCUUCCUAAGUUCUUAGGAAGCCACAAUGUUCUU19.319.903


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267CGUCUCAAGUAUUGAACAA94.754965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765285CGTCTCAAGTATTGAACAATTGTTCAATACTTGAGACG0.182900.007600.629301.000000.978300.75000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574CUCUAUUCUCUAAAUAAUG74.93971231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142592CTCTATTCTCTAAATAATGCATTATTTAGAGAATAGAG0.227400.190600.655200.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GAUGUGGAAUUUUUAUACA94.588270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441068GATGTGGAATTTTTATACATGTATAAAAATTCCACATC0.088900.004800.474100.500001.000001.00000


Target Position: 835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835CUUUUGUCUGCCUCAUUCU75.84541146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
833-855AACTTTTGTCTGCCTCATTCTAAAGAAUGAGGCAGACAAAAGUUCUUUUGUCUGCCUCAUUCUAAU20.414.911


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793UAAGUGGAAUAAAAGUUUU75.21491201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641811TAAGTGGAATAAAAGTTTTAAAACTTTTATTCCACTTA0.022900.010100.534500.500001.000001.00000


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432CCCACAGACUAUUUCCCUC71.6191511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3412450CCCACAGACTATTTCCCTCGAGGGAAATAGTCTGTGGG0.908800.371100.681000.750000.972800.62500


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635CCUCAGUACUUUGCAGAAA86.6753362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082653CCTCAGTACTTTGCAGAAATTTCTGCAAAGTACTGAGG0.085400.037100.844801.000001.000001.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445UCCCUCAUCCUAUUUACUG57.79572421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662463TCCCTCATCCTATTTACTGCAGTAAATAGGATGAGGGA0.232400.236100.586200.500001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420AGAGAGCAAAGUCUUCUAU81.63701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967438AGAGAGCAAAGTCTTCTATATAGAAGACTTTGCTCTCT0.058200.001500.681000.750001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218CAGUUGCUUAUAAAAAUGU77.34091029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741236CAGTTGCTTATAAAAATGTACATTTTTATAAGCAACTG0.149100.021500.577600.500001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545AAAUCAGCAAAAAGGAAAU76.49471104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929563AAATCAGCAAAAAGGAAATATTTCCTTTTTGCTGATTT0.032200.024100.491400.500001.000001.00000


Target Position: 2119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119GGCAUAUGGCAUUUUCUAA96.862735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2117-2139TTGGCATATGGCATTTTCTAACTUUAGAAAAUGCCAUAUGCCAAGGCAUAUGGCAUUUUCUAACUU7.121.103


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789CGAAGCUGAAGCAGGAGAA88.2852275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822807CGAAGCTGAAGCAGGAGAATTCTCCTGCTTCAGCTTCG0.055500.022600.620701.000001.000001.00000


Target Position: 2425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2425CUUGCAUCCCACAGACUAU86.6798361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772443CTTGCATCCCACAGACTATATAGTCTGTGGGATGCAAG0.388100.139600.594800.750001.000001.00000


Target Position: 2328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2328UGUCACCAACCAUUCUUAC62.69922173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502346TGTCACCAACCATTCTTACGTAAGAATGGTTGGTGACA0.596400.029700.525900.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182CAUUAACUGUAAGUUUUGU80.2955786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2180-2202AGCATTAACTGTAAGTTTTGTGCACAAAACUUACAGUUAAUGCUCAUUAACUGUAAGUUUUGUGCU10.34.602


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694GAAAUAACUUGAGAUGAUG80.1295790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771712GAAATAACTTGAGATGATGCATCATCTCAAGTTATTTC0.129700.028700.517200.500001.000001.00000


Target Position: 1291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291CAUAUUAAACCAUGUAUAU91.226157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1289-1311CACATATTAAACCATGTATATCTAUAUACAUGGUUUAAUAUGUGCAUAUUAAACCAUGUAUAUCUU8.2-8.012


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399GCAGAAACGGUUCACAUUC70.54671583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141417GCAGAAACGGTTCACATTCGAATGTGAACCGTTTCTGC0.098600.005000.681000.750001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681AAGGUGUAUUUUUUCUUUU76.49041105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7732699AAGGTGTATTTTTTCTTTTAAAAGAAAAAATACACCTT0.097500.009000.637900.500001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621UUGCUUUUGUGAUUUUUUU65.52291993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451639TTGCTTTTGTGATTTTTTTAAAAAAATCACAAAAGCAA0.613800.396900.646600.500001.000001.00000


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614AGGAUUUUUGCUUUUGUGA75.16651206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451632AGGATTTTTGCTTTTGTGATCACAAAAGCAAAAATCCT0.473400.053000.620700.500001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862CACAGUAGACCAUUUGUCA94.120179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821880CACAGTAGACCATTTGTCATGACAAATGGTCTACTGTG0.329100.004800.569000.500000.918500.62500


Target Position: 2556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556CCUUCCUCUUUCUUCCUCC63.63972111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512574CCTTCCTCTTTCTTCCTCCGGAGGAAGAAAGAGGAAGG0.509200.492200.474100.500001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627UUGUGAUUUUUUUUUUUUU68.27291778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9241645TTGTGATTTTTTTTTTTTTAAAAAAAAAAAAATCACAA0.659200.392900.646600.500001.000001.00000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913CCUUAUUCCCUCUUGGCAG68.57941759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401931CCTTATTCCCTCTTGGCAGCTGCCAAGAGGGAATAAGG0.029600.007600.560300.750000.940200.75000


Target Position: 1624, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CUUUUGUGAUUUUUUUUUU76.55161097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621642CTTTTGTGATTTTTTTTTTAAAAAAAAAATCACAAAAG0.754200.442200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1622-1644TGCTTTTGTGATTTTTTTTTTTTAAAAAAAAAAUCACAAAAGCACUUUUGUGAUUUUUUUUUUUUU-11.312.210


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325GAAUACAGAGAGAAAAUUG82.8899591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
757343GAATACAGAGAGAAAATTGCAATTTTCTCTCTGTATTC0.330000.327500.525900.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989GAGUAGAGCCAGUUAACAU98.199624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871007GAGTAGAGCCAGTTAACATATGTTAACTGGCTCTACTC0.220100.006200.655200.750001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522AGAUGCAGGAAAAAUGAAU79.3702854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251540AGATGCAGGAAAAATGAATATTCATTTTTCCTGCATCT0.541000.236700.715500.750001.000001.00000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177GCAAGGAGCUGAAUUAUCC75.06151217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997195GCAAGGAGCTGAATTATCCGGATAATTCAGCTCCTTGC0.055000.001800.482800.500000.956500.62500


Target Position: 659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659CAAAGACAGCUUUUGAUGA89.5803216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
657-679TGCAAAGACAGCTTTTGATGAAGUCAUCAAAAGCUGUCUUUGCACAAAGACAGCUUUUGAUGAAGU13.819.202


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720UUGUUUAAUGUCUUAUGAA83.3059568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771738TTGTTTAATGTCTTATGAATTCATAAGACATTAAACAA0.018700.001300.474100.500001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UGAGAGACAACUUGACAUU77.01451056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544764TGAGAGACAACTTGACATTAATGTCAAGTTGTCTCTCA0.253400.022800.715500.750001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155AACUGCCUACAUACUGGUU74.21521289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651173AACTGCCTACATACTGGTTAACCAGTATGTAGGCAGTT0.546800.001500.500000.500000.978300.75000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CGGCCUUCCAACUUUUGUC67.71061826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
820842CGGCCTTCCAACTTTTGTCGACAAAAGTTGGAAGGCCG0.075000.004800.594800.750000.972800.75000


Target Position: 1754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1754CCAAGCAUAAUUGUUAAGA75.35951189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831772CCAAGCATAATTGTTAAGATCTTAACAATTATGCTTGG0.139500.019800.620700.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240AGGUUUGGAGCACUUACAA85.6578425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661258AGGTTTGGAGCACTTACAATTGTAAGTGCTCCAAACCT0.048400.001500.698300.750001.000001.00000


Target Position: 2097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2097AGUGUGUUCCAUUUAAAAU82.5794617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742115AGTGTGTTCCATTTAAAATATTTTAAATGGAACACACT0.787200.020600.698300.750001.000001.00000


Target Position: 2686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2686GUAUUUUUUCUUUUAGAAU83.6536538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4512704GTATTTTTTCTTTTAGAATATTCTAAAAGAAAAAATAC0.175100.048800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2684-2706GTGTATTTTTTCTTTTAGAATGTAUUCUAAAAGAAAAAAUACACGUAUUUUUUCUUUUAGAAUGUU7.1-9.701


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715UACAAAGACAGCACGCUAA81.8998672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
666733TACAAAGACAGCACGCTAATTAGCGTGCTGTCTTTGTA0.096600.025600.646600.500001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708UGAUGGCUAGCUUUGUUUA84.4135495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871726TGATGGCTAGCTTTGTTTATAAACAAAGCTAGCCATCA0.157000.052200.689700.750001.000001.00000


Target Position: 2642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642ACUUUGCAGAAAACACCAA80.0799796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612660ACTTTGCAGAAAACACCAATTGGTGTTTTCTGCAAAGT0.512400.064600.560300.750000.994601.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AGGAGACGAAGCUGAAGCA85.8243415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
903801AGGAGACGAAGCTGAAGCATGCTTCAGCTTCGTCTCCT0.067300.012700.491400.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AAGGCUGUGGUAGAAUCAU73.84851325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631275AAGGCTGTGGTAGAATCATATGATTCTACCACAGCCTT0.054600.001500.482800.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507CAAAUGUAAAAGUAAAGAU88.2624277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831525CAAATGTAAAAGTAAAGATATCTTTACTTTTACATTTG0.411900.232900.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1505-1527AACAAATGTAAAAGTAAAGATGCAUCUUUACUUUUACAUUUGUUCAAAUGUAAAAGUAAAGAUGCU14.66.901


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683UUGCUGAACUUGAUACAUU76.16421125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934701TTGCTGAACTTGATACATTAATGTATCAAGTTCAGCAA0.126300.006600.637900.500001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710AUGGCUAGCUUUGUUUAAU73.20991387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431728ATGGCTAGCTTTGTTTAATATTAAACAAAGCTAGCCAT0.074200.023300.646600.500001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GAAUGGACUUUUCAACUAC82.6704607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041832GAATGGACTTTTCAACTACGTAGTTGAAAAGTCCATTC0.111400.024500.491400.500001.000001.00000


Target Position: 357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
357AGAUAUCUGCAAUGAUGUA95.348359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947375AGATATCTGCAATGATGTATACATCATTGCAGATATCT0.040700.001900.543100.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GCCUACAUACUGGUUUGUC66.44491924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751177GCCTACATACTGGTTTGTCGACAAACCAGTATGTAGGC0.019300.021200.681000.750000.978300.75000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551UCAUUACUUCAUGUAUAUC66.34641933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851569TCATTACTTCATGTATATCGATATACATGAAGTAATGA0.058800.001200.543100.500000.978300.62500


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220GUUGCUUAUAAAAAUGUUG69.07971715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876238GTTGCTTATAAAAATGTTGCAACATTTTTATAAGCAAC0.121300.021900.500000.500001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765UAAAUGCUCAAUAAAUAUU73.84741326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802783TAAATGCTCAATAAATATTAATATTTATTGAGCATTTA0.075100.017000.525900.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590AACCCAUGUAUUUAACUUU78.781904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681608AACCCATGTATTTAACTTTAAAGTTAAATACATGGGTT0.675500.081800.646600.500001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465AGCAAAUCUCUCCUUAGUU79.2379866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852483AGCAAATCTCTCCTTAGTTAACTAAGGAGAGATTTGCT0.191300.031700.706900.750001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137CCAUGUCUAAGCAAAGAAA94.179475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251155CCATGTCTAAGCAAAGAAATTTCTTTGCTTAGACATGG0.138900.058100.844801.000000.989100.75000


Target Position: 1666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666UGCAUGUGCUGUAAAAAUA85.9635405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061684TGCATGTGCTGTAAAAATATATTTTTACAGCACATGCA0.054700.002600.810300.750000.956500.75000


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463GCAGCAAAUCUCUCCUUAG81.9575667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372481GCAGCAAATCTCTCCTTAGCTAAGGAGAGATTTGCTGC0.106700.030800.681000.750001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567AUCAAGCACAGCAGUAAAA79.2167870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791585ATCAAGCACAGCAGTAAAATTTTACTGCTGTGCTTGAT0.473900.100000.681000.500001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850AUGUAAAUUAGUCUUGGUU74.06571304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491868ATGTAAATTAGTCTTGGTTAACCAAGACTAATTTACAT0.247600.015700.508600.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926GUUUAUGUUACUUCUAUUU81.4769713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410944GTTTATGTTACTTCTATTTAAATAGAAGTAACATAAAC0.280800.079300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
924-946AGGTTTATGTTACTTCTATTTGAAAAUAGAAGUAACAUAAACCUGUUUAUGUUACUUCUAUUUGAU6.96.903


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516AAGUAAAGAUGCAGGAAAA94.714367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631534AAGTAAAGATGCAGGAAAATTTTCCTGCATCTTTACTT0.318200.216000.637900.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382CUUUUGGAAAAGUUCUUGA79.4686847

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
380-402CTCTTTTGGAAAAGTTCTTGATCUCAAGAACUUUUCCAAAAGAGCUUUUGGAAAAGUUCUUGAUCU19.220.102


Target Position: 2813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813AAGGGUGAGAAACUGAAAU74.78271244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162831AAGGGTGAGAAACTGAAATATTTCAGTTTCTCACCCTT0.290600.057100.629300.500001.000001.00000


Target Position: 1547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547GUAUUCAUUACUUCAUGUA90.2775189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1545-1567TGGTATTCATTACTTCATGTATAUACAUGAAGUAAUGAAUACCAGUAUUCAUUACUUCAUGUAUAU20.58.712


Target Position: 1593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CCAUGUAUUUAACUUUUUU87.1274337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801611CCATGTATTTAACTTTTTTAAAAAAGTTAAATACATGG0.657600.479300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613ACCCATGTATTTAACTTTTTTTTAAAAAAGUUAAAUACAUGGGUCCAUGUAUUUAACUUUUUUUUU3.213.302


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729AUGUUUUCUGUAUGUUCUA81.2275723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552747ATGTTTTCTGTATGTTCTATAGAACATACAGAAAACAT0.050000.014100.482800.500001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738GCAAUUACUGAGAGACAAC77.7873991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329756GCAATTACTGAGAGACAACGTTGTCTCTCAGTAATTGC0.262200.107600.706900.750001.000001.00000


Target Position: 1843, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843GCUUUUCAUGUAAAUUAGU77.59661009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381861GCTTTTCATGTAAATTAGTACTAATTTACATGAAAAGC0.052900.016300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1841-1863CAGCTTTTCATGTAAATTAGTCTACUAAUUUACAUGAAAAGCUGGCUUUUCAUGUAAAUUAGUCUU-4.312.202


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GGGUCGUCUCAAGUAUUGA89.2207233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969281GGGTCGTCTCAAGTATTGATCAATACTTGAGACGACCC0.126600.001500.767200.750001.000001.00000


Target Position: 2441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441UAUUUCCCUCAUCCUAUUU67.2691859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302459TATTTCCCTCATCCTATTTAAATAGGATGAGGGAAATA0.786000.721800.543100.500001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CGGGGAAUAAAAGGGAUCA79.2679862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861200CGGGGAATAAAAGGGATCATGATCCCTTTTATTCCCCG0.157100.076100.689700.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414UGCUUCCUUUGCUUGCAUC59.11122359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672432TGCTTCCTTTGCTTGCATCGATGCAAGCAAAGGAAGCA0.114200.035400.672400.500000.978300.75000


Target Position: 2493, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493GUGUUUAUCUCCCUUUAAA93.913982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952511GTGTTTATCTCCCTTTAAATTTAAAGGGAGATAAACAC0.676500.352700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2491-2513CTGTGTTTATCTCCCTTTAAAACUUUAAAGGGAGAUAAACACAGGUGUUUAUCUCCCUUUAAAACU11.06.902


Target Position: 1546, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546GGUAUUCAUUACUUCAUGU89.1239238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1544-1566TTGGTATTCATTACTTCATGTATACAUGAAGUAAUGAAUACCAAGGUAUUCAUUACUUCAUGUAUU18.116.112


Target Position: 605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605UCUCUGUGUUCUAUUAUGA81.6699698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
990623TCTCTGTGTTCTATTATGATCATAATAGAACACAGAGA0.459100.004900.500000.500001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GUCCCAUGAUCCCCUCUCU78.4461932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002025GTCCCATGATCCCCTCTCTAGAGAGGGGATCATGGGAC0.815400.148800.594800.500001.000001.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490ACUGUGUUUAUCUCCCUUU72.86131424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912508ACTGTGTTTATCTCCCTTTAAAGGGAGATAAACACAGT0.593700.075800.706900.750001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148CAAAGAAAACUGCCUACAU88.7579251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141166CAAAGAAAACTGCCTACATATGTAGGCAGTTTTCTTTG0.048700.039800.491400.750001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953AUAUUUCCCAUGUGGUUUU68.01251804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799971ATATTTCCCATGTGGTTTTAAAACCACATGGGAAATAT0.063200.005600.543100.500000.956501.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877UCUCUAAAGGAAAUUGUAC64.19232067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881895TCTCTAAAGGAAATTGTACGTACAATTTCCTTTAGAGA0.144200.014000.543100.500001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439CUGUUAGCUUUCAUUAUUU85.8258414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961457CTGTTAGCTTTCATTATTTAAATAATGAAAGCTAACAG0.612700.002900.784500.750001.000001.00000


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706GAUGAUGGCUAGCUUUGUU89.368226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321724GATGATGGCTAGCTTTGTTAACAAAGCTAGCCATCATC0.156500.043900.534500.750001.000001.00000


Target Position: 2220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220GUUUUUAAGAAUUUCUUGA81.6866697

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2218-2240TGGTTTTTAAGAATTTCTTGATAUCAAGAAAUUCUUAAAAACCAGUUUUUAAGAAUUUCUUGAUAU12.2-9.101


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375GCAUGAUCUUUCUGGCUCC74.36761276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302393GCATGATCTTTCTGGCTCCGGAGCCAGAAAGATCATGC0.046900.023700.482800.500001.000001.00000


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355AGAGAUAUCUGCAAUGAUG81.5541706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947373AGAGATATCTGCAATGATGCATCATTGCAGATATCTCT0.028300.002300.569000.500001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GCUUUUGUGAUUUUUUUUU74.0161308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651641GCTTTTGTGATTTTTTTTTAAAAAAAAATCACAAAAGC0.754500.442800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1621-1643TTGCTTTTGTGATTTTTTTTTTTAAAAAAAAAUCACAAAAGCAAGCUUUUGUGAUUUUUUUUUUUU-11.310.301


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CCAAGAAGCUUUUGAAAUC74.45781269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
607549CCAAGAAGCTTTTGAAATCGATTTCAAAAGCTTCTTGG0.372800.018500.663800.750001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231GGUACUUUAAGGUUUGGAG76.15321126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941249GGTACTTTAAGGTTTGGAGCTCCAAACCTTAAAGTACC0.012800.005500.543100.750001.000001.00000


Target Position: 2658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658CAAACAAAAAUGCCAUUUU79.9755801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432676CAAACAAAAATGCCATTTTAAAATGGCATTTTTGTTTG0.132200.145900.646600.750000.962000.75000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992UAGAGCCAGUUAACAUUUA80.6553754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691010TAGAGCCAGTTAACATTTATAAATGTTAACTGGCTCTA0.177200.074800.637900.500001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255ACAAGGCUGUGGUAGAAUC69.9321632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681273ACAAGGCTGTGGTAGAATCGATTCTACCACAGCCTTGT0.021800.001700.525900.500001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831CCAACUUUUGUCUGCCUCA84.367500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540849CCAACTTTTGTCTGCCTCATGAGGCAGACAAAAGTTGG0.370600.045700.620700.750001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775ACGUGUAUUAAAUUCAUGU75.57271170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751793ACGTGTATTAAATTCATGTACATGAATTTAATACACGT0.147100.038000.569000.500001.000001.00000


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194GGGAUCAUUGGUUCCAGUC67.8211823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971212GGGATCATTGGTTCCAGTCGACTGGAACCAATGATCCC0.050300.002900.672400.750000.929300.62500


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835UCUCUACAGCUUUUCAUGU68.98691721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271853TCTCTACAGCTTTTCATGTACATGAAAAGCTGTAGAGA0.100900.036600.517200.500001.000001.00000


Target Position: 2245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2245UAUAGCCUGCCUUCAAUUU67.47961842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612263TATAGCCTGCCTTCAATTTAAATTGAAGGCAGGCTATA0.326300.144000.543100.500001.000001.00000


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602UAACUUUUUUUUAGGAUUU69.95471626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161620TAACTTTTTTTTAGGATTTAAATCCTAAAAAAAAGTTA0.121600.075900.534500.500001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GAGAUUACUACCGUUACUU81.8267684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589470GAGATTACTACCGTTACTTAAGTAACGGTAGTAATCTC0.119900.020600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
450-472AGGAGATTACTACCGTTACTTGGAAGUAACGGUAGUAAUCUCCUGAGAUUACUACCGUUACUUGGU19.614.503


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GCUAAGAGAUAUCUGCAAU90.9197169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858369GCTAAGAGATATCTGCAATATTGCAGATATCTCTTAGC0.049100.035800.844801.000001.000001.00000


Target Position: 2760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2760CACUGUAAAUGCUCAAUAA104.6424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2758-2780TACACTGTAAATGCTCAATAAATUUAUUGAGCAUUUACAGUGUACACUGUAAAUGCUCAAUAAAUU13.419.001


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454AUUUUUGCUACACUCAUUU68.68081746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031472ATTTTTGCTACACTCATTTAAATGAGTGTAGCAAAAAT0.392100.171100.508600.500001.000001.00000


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154GCCUGCAUGAAGUCUGUAA90.4233187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886172GCCTGCATGAAGTCTGTAATTACAGACTTCATGCAGGC0.161800.003200.965501.000001.000001.00000


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181GGAGCUGAAUUAUCCAAUG80.8992739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995199GGAGCTGAATTATCCAATGCATTGGATAATTCAGCTCC0.033300.001000.715500.750001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100GUGUUCCAUUUAAAAUUUU77.12381046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072118GTGTTCCATTTAAAATTTTAAAATTTTAAATGGAACAC0.358600.046300.793100.750001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773ACACGUGUAUUAAAUUCAU83.4836555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901791ACACGTGTATTAAATTCATATGAATTTAATACACGTGT0.138000.013500.551700.750001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CUCUUUUGGAAAAGUUCUU70.83111559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454398CTCTTTTGGAAAAGTTCTTAAGAACTTTTCCAAAAGAG0.196000.036500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
378-400GTCTCTTTTGGAAAAGTTCTTGAAAGAACUUUUCCAAAAGAGACCUCUUUUGGAAAAGUUCUUGAU17.712.202


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919UCCCUCUUGGCAGCUAAUG43.87192772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911937TCCCTCTTGGCAGCTAATGCATTAGCTGCCAAGAGGGA0.012900.003600.715500.500000.967400.75000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048GGGAUGUGGAAUUUUUAUA91.4938149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071066GGGATGTGGAATTTTTATATATAAAAATTCCACATCCC0.106900.002600.948301.000001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630UGAUUUUUUUUUUUUUUUU69.34341687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211648TGATTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAATCA0.597400.503900.724100.750001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940UAUUUGAAUUUCUAUAUUU83.1752575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816958TATTTGAATTTCTATATTTAAATATAGAAATTCAAATA0.115800.041200.543100.500001.000001.00000


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329GUCACCAACCAUUCUUACU74.89261234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372347GTCACCAACCATTCTTACTAGTAAGAATGGTTGGTGAC0.432200.028000.612100.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885UGCUGUCCCACAAAUAGUU72.4631453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828903TGCTGTCCCACAAATAGTTAACTATTTGTGGGACAGCA0.066500.004600.706900.750001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503CCCUUUAAAACCCUACCUA83.4901553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
932521CCCTTTAAAACCCTACCTATAGGTAGGGTTTTAAAGGG0.617900.447600.819001.000001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675UUAAAAAAGGUGUAUUUUU69.50861666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942693TTAAAAAAGGTGTATTTTTAAAAATACACCTTTTTTAA0.165300.002900.534500.500001.000001.00000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423GAGCAAAGUCUUCUAUUUG80.8573743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909441GAGCAAAGTCTTCTATTTGCAAATAGAAGACTTTGCTC0.040300.002500.663800.500001.000001.00000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996GCCAGUUAACAUUUAGGGA83.9599524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181014GCCAGTTAACATTTAGGGATCCCTAAATGTTAACTGGC0.436500.043700.629300.750001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602ACUUCUCUGUGUUCUAUUA91.6384141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593620ACTTCTCTGTGTTCTATTATAATAGAACACAGAGAAGT0.143700.019000.672400.750001.000001.00000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727ACGCUAAUAAUGCAAUUAC67.10531870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925745ACGCTAATAATGCAATTACGTAATTGCATTATTAGCGT0.033000.024000.594800.500000.978300.75000


Target Position: 2802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802GUCUUGAUGAUAAGGGUGA78.1019966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8532820GTCTTGATGATAAGGGTGATCACCCTTATCATCAAGAC0.126000.027800.594800.500001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563CUUUCUUCCUCCUCUAUUC72.86721423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842581CTTTCTTCCTCCTCTATTCGAATAGAGGAGGAAGAAAG0.420900.394500.465500.500001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311UGUGGAAUACUCAAUGUGU78.2374952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791329TGTGGAATACTCAATGTGTACACATTGAGTATTCCACA0.085100.001300.500000.500001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676UAAAAAAGGUGUAUUUUUU77.13561044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772694TAAAAAAGGTGTATTTTTTAAAAAATACACCTTTTTTA0.068300.003400.534500.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685GCUGAACUUGAUACAUUAA96.960733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864703GCTGAACTTGATACATTAATTAATGTATCAAGTTCAGC0.048100.018000.819001.000001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969CAUAACAAAAAUACUACUA89.7825207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401987CATAACAAAAATACTACTATAGTAGTATTTTTGTTATG0.849200.763100.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1967-1989ATCATAACAAAAATACTACTAATUAGUAGUAUUUUUGUUAUGAUCAUAACAAAAAUACUACUAAUU18.86.922


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CUUCACAAGCAGAGAGCAA86.638367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915428CTTCACAAGCAGAGAGCAATTGCTCTCTGCTTGTGAAG0.096900.012400.491400.750000.945700.75000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672UGCUGUAAAAAUAGUUAAC64.74832037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031690TGCTGTAAAAATAGTTAACGTTAACTATTTTTACAGCA0.078300.005400.706900.500001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620UUUGCUUUUGUGAUUUUUU64.13172071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601638TTTGCTTTTGTGATTTTTTAAAAAATCACAAAAGCAAA0.556900.099000.500000.500001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GGAUGUGGAAUUUUUAUAC79.9482806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711067GGATGTGGAATTTTTATACGTATAAAAATTCCACATCC0.100900.003600.689700.750001.000001.00000


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500UCUCCCUUUAAAACCCUAC51.68312636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862518TCTCCCTTTAAAACCCTACGTAGGGTTTTAAAGGGAGA0.577000.421700.543100.500001.000001.00000


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086GAAAAAAAUGUAGUGUGUU82.6189614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442104GAAAAAAATGTAGTGTGTTAACACACTACATTTTTTTC0.051300.033200.525900.750001.000001.00000


Target Position: 2638, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638CAGUACUUUGCAGAAAACA82.103650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922656CAGTACTTTGCAGAAAACATGTTTTCTGCAAAGTACTG0.210600.043500.577600.500000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2636-2658CTCAGTACTTTGCAGAAAACACCUGUUUUCUGCAAAGUACUGAGCAGUACUUUGCAGAAAACACCU13.317.603


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GUUUAAUAUUAGGGGAGUA91.5032148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985993GTTTAATATTAGGGGAGTATACTCCCCTAATATTAAAC0.092900.044600.465500.750001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758GCAUAAUUGUUAAGAACAC78.7997902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931776GCATAATTGTTAAGAACACGTGTTCTTAACAATTATGC0.089100.016100.560300.750001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300UGAGAAAAAACAGCAGAUG61.32222250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953318TGAGAAAAAACAGCAGATGCATCTGCTGTTTTTTCTCA0.026800.004500.569000.500001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744CAUGAACAAUCCAAGCAUA99.566417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901762CATGAACAATCCAAGCATATATGCTTGGATTGTTCATG0.177600.006200.612100.750001.000001.00000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AAGGAAAUUGUACAUUUUU76.83891066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361901AAGGAAATTGTACATTTTTAAAAATGTACAATTTCCTT0.321700.037500.637900.500001.000001.00000


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243CUUAUAGCCUGCCUUCAAU82.6998606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142261CTTATAGCCTGCCTTCAATATTGAAGGCAGGCTATAAG0.324900.124800.629300.750001.000001.00000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574ACAGCAGUAAAACAAAAAC65.88411963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781592ACAGCAGTAAAACAAAAACGTTTTTGTTTTACTGCTGT0.218800.186800.560300.500001.000001.00000


Target Position: 1942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942CUUACCAAGUUUAAACACA83.4469559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1940-1962CTCTTACCAAGTTTAAACACAAAUGUGUUUAAACUUGGUAAGAGCUUACCAAGUUUAAACACAAAU14.720.013


Target Position: 1552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1552CAUUACUUCAUGUAUAUCA92.6005113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1550-1572TTCATTACTTCATGTATATCAAGUGAUAUACAUGAAGUAAUGAACAUUACUUCAUGUAUAUCAAGU11.24.612


Target Position: 2212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212ACUUUUUGGUUUUUAAGAA84.5218486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612230ACTTTTTGGTTTTTAAGAATTCTTAAAAACCAAAAAGT0.078700.001600.534500.750001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685UGUAUUUUUUCUUUUAGAA84.5163487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282703TGTATTTTTTCTTTTAGAATTCTAAAAGAAAAAATACA0.178400.048800.534500.750001.000001.00000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702AAGUGAAGAGUCAUACAAA99.974714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939720AAGTGAAGAGTCATACAAATTTGTATGACTCTTCACTT0.115400.002100.637900.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730UGUUUUCUGUAUGUUCUAU77.60941007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232748TGTTTTCTGTATGTTCTATATAGAACATACAGAAAACA0.055100.012100.663800.750001.000001.00000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724GGACAAUGUUUUCUGUAUG82.2162637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892742GGACAATGTTTTCTGTATGCATACAGAAAACATTGTCC0.260600.006200.715500.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GGAGACGAAGCUGAAGCAG67.46521843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790802GGAGACGAAGCTGAAGCAGCTGCTTCAGCTTCGTCTCC0.062000.011100.586200.750001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077GUGUUUGGCAUAGUACUUU76.29621120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941095GTGTTTGGCATAGTACTTTAAAGTACTATGCCAAACAC0.150700.006000.793100.750001.000001.00000


Target Position: 2330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330UCACCAACCAUUCUUACUU70.57091582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152348TCACCAACCATTCTTACTTAAGTAAGAATGGTTGGTGA0.083900.028200.586200.750001.000001.00000


Target Position: 2758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758UACACUGUAAAUGCUCAAU68.70881745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572776TACACTGTAAATGCTCAATATTGAGCATTTACAGTGTA0.071600.058200.672400.500000.934800.62500


Target Position: 322, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CGAGAAUACAGAGAGAAAA93.688190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128340CGAGAATACAGAGAGAAAATTTTCTCTCTGTATTCTCG0.790900.477500.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342CTCGAGAATACAGAGAGAAAATTUUUUCUCUCUGUAUUCUCGAGCGAGAAUACAGAGAGAAAAUUU19.116.012


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671GUGCUGUAAAAAUAGUUAA89.8647203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7071689GTGCTGTAAAAATAGTTAATTAACTATTTTTACAGCAC0.101700.012200.758600.750001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GGAUCAUUGGUUCCAGUCA91.3431153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331213GGATCATTGGTTCCAGTCATGACTGGAACCAATGATCC0.054000.004600.646600.750000.972800.62500


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CGGAUACCCAAGGAGACGA77.19951041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529791CGGATACCCAAGGAGACGATCGTCTCCTTGGGTATCCG0.228900.032800.620700.750000.962000.75000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557AGGAAAUGCAACCAACACA84.365501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911575AGGAAATGCAACCAACACATGTGTTGGTTGCATTTCCT0.341300.037100.637900.500000.934800.62500


Target Position: 2039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039GAAAAAAAUGAGUUCCUAU94.167776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452057GAAAAAAATGAGTTCCTATATAGGAACTCATTTTTTTC0.028900.012500.629300.750001.000001.00000


Target Position: 1785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1785AAUUCAUGUAAGUGGAAUA92.3504123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671803AATTCATGTAAGTGGAATATATTCCACTTACATGAATT0.060500.001600.465500.500001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465ACUCAUUUUAUUUGUAUUU72.66181441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161483ACTCATTTTATTTGTATTTAAATACAAATAAAATGAGT0.275600.141900.706900.750001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UCCCAUGUGGUUUUUAUGU60.18452301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989976TCCCATGTGGTTTTTATGTACATAAAAACCACATGGGA0.399400.003700.663800.500000.956500.75000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068AGAGGGGGGGAUUGAUUAG66.61131913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562086AGAGGGGGGGATTGATTAGCTAATCAATCCCCCCCTCT0.141400.057500.551700.500001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911UACGAUUUAUGACAGGUUU72.11831479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908929TACGATTTATGACAGGTTTAAACCTGTCATAAATCGTA0.037500.021200.681000.500001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901UUGAAAUUUAUUCCUUAUU62.30552193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281919TTGAAATTTATTCCTTATTAATAAGGAATAAATTTCAA0.293300.197300.637900.500000.989100.75000


Target Position: 1714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714CUAGCUUUGUUUAAUGUCU78.8142900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1712-1734GGCTAGCTTTGTTTAATGTCTTAAGACAUUAAACAAAGCUAGCCCUAGCUUUGUUUAAUGUCUUAU16.118.303


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309CUGUUUUAGCCUUCUGUCU73.73381335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862327CTGTTTTAGCCTTCTGTCTAGACAGAAGGCTAAAACAG0.256300.169500.560300.500001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608CUGUGUUCUAUUAUGAGAU84.3063505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836626CTGTGTTCTATTATGAGATATCTCATAATAGAACACAG0.463100.004400.603400.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CCUUUAAAACCCUACCUAU88.6966254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1142522CCTTTAAAACCCTACCTATATAGGTAGGGTTTTAAAGG0.627400.447700.801701.000001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834ACUUUUGUCUGCCUCAUUC66.97711881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729852ACTTTTGTCTGCCTCATTCGAATGAGGCAGACAAAAGT0.382500.060100.534500.500001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833AACUUUUGUCUGCCUCAUU75.52131173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988851AACTTTTGTCTGCCTCATTAATGAGGCAGACAAAAGTT0.370000.054900.637900.500001.000001.00000


Target Position: 1755, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755CAAGCAUAAUUGUUAAGAA103.8125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631773CAAGCATAATTGTTAAGAATTCTTAACAATTATGCTTG0.145500.022100.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1753-1775TCCAAGCATAATTGTTAAGAACAUUCUUAACAAUUAUGCUUGGACAAGCAUAAUUGUUAAGAACAU14.619.703


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411CCCUGCUUCCUUUGCUUGC51.50262641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002429CCCTGCTTCCTTTGCTTGCGCAAGCAAAGGAAGCAGGG0.087400.014900.637900.500000.978301.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434ACCUGCUGUUAGCUUUCAU77.27671032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841452ACCTGCTGTTAGCTTTCATATGAAAGCTAACAGCAGGT0.017400.001200.698300.750000.940201.00000


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449UCAUUAUUUUUGCUACACU75.71581156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801467TCATTATTTTTGCTACACTAGTGTAGCAAAAATAATGA0.251300.191300.517200.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318GGCUCGAGAAUACAGAGAG78.0725970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651336GGCTCGAGAATACAGAGAGCTCTCTGTATTCTCGAGCC0.522100.015300.689700.750001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962AUGUGGUUUUUAUGUUUAA85.3328440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576980ATGTGGTTTTTATGTTTAATTAAACATAAAAACCACAT0.192700.069000.620700.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664CAUGCAUGUGCUGUAAAAA93.0012104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421682CATGCATGTGCTGTAAAAATTTTTACAGCACATGCATG0.061000.002000.655200.750000.956500.87500


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183GGGGAAUAAAAGGGAUCAU79.7551824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481201GGGGAATAAAAGGGATCATATGATCCCTTTTATTCCCC0.102200.069900.836201.000001.000001.00000


Target Position: 1578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578CAGUAAAACAAAAACCCAU86.1609393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021596CAGTAAAACAAAAACCCATATGGGTTTTTGTTTTACTG0.163700.126600.629300.750001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805AAGUUUUAUGAAUGGACUU76.02921134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001823AAGTTTTATGAATGGACTTAAGTCCATTCATAAAACTT0.039500.003900.500000.500001.000001.00000


Target Position: 1817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817UGGACUUUUCAACUACUUU75.12411209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031835TGGACTTTTCAACTACTTTAAAGTAGTTGAAAAGTCCA0.203100.045600.844800.750001.000001.00000


Target Position: 40, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
40CGUCCCUCAAACCUUGCUU72.00691486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92858CGTCCCTCAAACCTTGCTTAAGCAAGGTTTGAGGGACG0.126400.002200.637901.000001.000001.00000


Target Position: 2175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175UGGGUAGCAUUAACUGUAA85.8054416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622193TGGGTAGCATTAACTGTAATTACAGTTAATGCTACCCA0.082200.001600.810300.750000.989101.00000


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541GUCUGCCUUUAAAAUCCUU77.8828983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212559GTCTGCCTTTAAAATCCTTAAGGATTTTAAAGGCAGAC0.916900.460900.681000.750001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920UGACAGGUUUAUGUUACUU75.30391194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732938TGACAGGTTTATGTTACTTAAGTAACATAAACCTGTCA0.129200.010500.586200.750001.000001.00000


Target Position: 2649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649AGAAAACACCAAACAAAAA89.1945235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4482667AGAAAACACCAAACAAAAATTTTTGTTTGGTGTTTTCT0.544400.299400.724100.750001.000001.00000


Target Position: 2269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269CUUUAUUCUUUCUAUUUGU79.6587832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2267-2289TCCTTTATTCTTTCTATTTGTCAACAAAUAGAAAGAAUAAAGGACUUUAUUCUUUCUAUUUGUCAU3.52.102


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076AGUGUUUGGCAUAGUACUU78.8419898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981094AGTGTTTGGCATAGTACTTAAGTACTATGCCAAACACT0.073100.005600.569000.750001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047GGGGAUGUGGAAUUUUUAU84.69478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131065GGGGATGTGGAATTTTTATATAAAAATTCCACATCCCC0.104000.002400.948301.000001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888AAUUGUACAUUUUUUGAAA90.7792175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391906AATTGTACATTTTTTGAAATTTCAAAAAATGTACAATT0.246000.164900.508600.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680AAAUAGUUAACAGGGAAAU71.57891515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071698AAATAGTTAACAGGGAAATATTTCCCTGTTAACTATTT0.062700.027600.491400.500001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577GCAGUAAAACAAAAACCCA90.5253183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201595GCAGTAAAACAAAAACCCATGGGTTTTTGTTTTACTGC0.411400.173500.508600.750001.000001.00000


Target Position: 1537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537GAAUUGCUUGGUAUUCAUU86.8666348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1535-1557ATGAATTGCTTGGTATTCATTACAAUGAAUACCAAGCAAUUCAUGAAUUGCUUGGUAUUCAUUACU8.718.513


Target Position: 324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
324AGAAUACAGAGAGAAAAUU78.1294964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178342AGAATACAGAGAGAAAATTAATTTTCTCTCTGTATTCT0.529700.416900.715500.750001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610GUGUUCUAUUAUGAGAUUC68.45971765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773628GTGTTCTATTATGAGATTCGAATCTCATAATAGAACAC0.453200.006900.620700.500001.000001.00000


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095GUAGUGUGUUCCAUUUAAA96.963732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362113GTAGTGTGTTCCATTTAAATTTAAATGGAACACACTAC0.153400.016300.681000.750001.000001.00000


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918UUCCCUCUUGGCAGCUAAU64.43192050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321936TTCCCTCTTGGCAGCTAATATTAGCTGCCAAGAGGGAA0.031000.007100.663800.500000.940200.75000


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079GUUUGGCAUAGUACUUUUG70.08251622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301097GTTTGGCATAGTACTTTTGCAAAAGTACTATGCCAAAC0.120400.006400.500000.500001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UGUCAUUGUCUGCCUUUAA84.4959489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3302552TGTCATTGTCTGCCTTTAATTAAAGGCAGACAATGACA0.490800.279700.672400.750001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378GUCUCUUUUGGAAAAGUUC67.92921810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971396GTCTCTTTTGGAAAAGTTCGAACTTTTCCAAAAGAGAC0.189900.004700.646600.500000.967400.62500


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304CCUUCCUGUUUUAGCCUUC64.17592068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4342322CCTTCCTGTTTTAGCCTTCGAAGGCTAAAACAGGAAGG0.328700.237300.672400.750001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592CUGGCCCUUAACUUCUCUG62.05212211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832610CTGGCCCTTAACTTCTCTGCAGAGAAGTTAAGGGCCAG0.079600.032100.500000.500001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682AUAGUUAACAGGGAAAUAA82.8058597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7991700ATAGTTAACAGGGAAATAATTATTTCCCTGTTAACTAT0.180500.020500.508600.500001.000001.00000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174UUGGGUAGCAUUAACUGUA77.58271010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822192TTGGGTAGCATTAACTGTATACAGTTAATGCTACCCAA0.071700.001800.465500.500000.989100.87500


Target Position: 966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966GGUUUUUAUGUUUAAUAUU87.5527315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454984GGTTTTTATGTTTAATATTAATATTAAACATAAAAACC0.173400.071600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
964-986GTGGTTTTTATGTTTAATATTAGAAUAUUAAACAUAAAAACCACGGUUUUUAUGUUUAAUAUUAGU-8.00.022


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998UGUUUCCAUGUCCCAUGAU69.74041644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522016TGTTTCCATGTCCCATGATATCATGGGACATGGAAACA0.159700.055300.525900.750000.923900.75000


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890UUGUACAUUUUUUGAAAUU65.95721955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221908TTGTACATTTTTTGAAATTAATTTCAAAAAATGTACAA0.259200.182100.637900.500001.000001.00000


Target Position: 2419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419CCUUUGCUUGCAUCCCACA80.4188771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4472437CCTTTGCTTGCATCCCACATGTGGGATGCAAGCAAAGG0.233700.069300.637900.750001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008UUAGGGAGUUAUCUGUUUU73.45831367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981026TTAGGGAGTTATCTGTTTTAAAACAGATAACTCCCTAA0.054800.002800.534500.500001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569UCCUCCUCUAUUCUCUAAA73.49321362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622587TCCTCCTCTATTCTCTAAATTTAGAGAATAGAGGAGGA0.501800.290600.870700.750001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069GAGGGGGGGAUUGAUUAGA75.6811159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052087GAGGGGGGGATTGATTAGATCTAATCAATCCCCCCCTC0.162900.059900.586200.500001.000001.00000


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140UGUCUAAGCAAAGAAAACU70.38441595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8501158TGTCTAAGCAAAGAAAACTAGTTTTCTTTGCTTAGACA0.197200.008400.500000.500000.989100.75000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890UCCCACAAAUAGUUUUUUG60.21452300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860908TCCCACAAATAGTTTTTTGCAAAAAACTATTTGTGGGA0.072200.016400.724100.500001.000001.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912ACGAUUUAUGACAGGUUUA82.1951640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
920930ACGATTTATGACAGGTTTATAAACCTGTCATAAATCGT0.034400.018300.741400.750001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60UAGGAGAUAAAAAGAACAU75.38191184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77878TAGGAGATAAAAAGAACATATGTTCTTTTTATCTCCTA0.197500.029900.517200.500001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613AAGCUCACUUUACAAAAUA84.8767468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722631AAGCTCACTTTACAAAATATATTTTGTAAAGTGAGCTT0.644300.257900.594800.500001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CACAGCAGUAAAACAAAAA88.3532272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221591CACAGCAGTAAAACAAAAATTTTTGTTTTACTGCTGTG0.232200.186800.793100.750001.000001.00000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434CACAGACUAUUUCCCUCAU85.9895400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4572452CACAGACTATTTCCCTCATATGAGGGAAATAGTCTGTG0.889000.396100.637900.750000.972800.62500


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850UUCUAAAAUUUACACAGUA82.6694608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910868TTCTAAAATTTACACAGTATACTGTGTAAATTTTAGAA0.045800.047000.491400.500001.000001.00000


Target Position: 1408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1408GUUCACAUUCCAUUAUUUG71.61541513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511426GTTCACATTCCATTATTTGCAAATAATGGAATGTGAAC0.302700.035200.500000.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CCAUUAUUUGUAAAGUUAC74.491264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881435CCATTATTTGTAAAGTTACGTAACTTTACAAATAATGG0.090900.066100.663800.750000.994600.62500


Target Position: 1878, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878CUCUAAAGGAAAUUGUACA87.0652340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881896CTCTAAAGGAAATTGTACATGTACAATTTCCTTTAGAG0.232800.013600.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1876-1898TTCTCTAAAGGAAATTGTACATTUGUACAAUUUCCUUUAGAGAACUCUAAAGGAAAUUGUACAUUU14.611.702


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446CCCUCAUCCUAUUUACUGC70.67991575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962464CCCTCATCCTATTTACTGCGCAGTAAATAGGATGAGGG0.193900.185900.637900.500001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GUGGUUUUUAUGUUUAAUA87.9088299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491982GTGGTTTTTATGTTTAATATATTAAACATAAAAACCAC0.155500.069100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
962-984ATGTGGTTTTTATGTTTAATATTUAUUAAACAUAAAAACCACAUGUGGUUUUUAUGUUUAAUAUUU-0.318.822


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GAGCCCGUAGGUCAUCUUG68.89731725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986260GAGCCCGTAGGTCATCTTGCAAGATGACCTACGGGCTC0.018800.001200.663800.500000.913000.87500


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517AGUAAAGAUGCAGGAAAAA82.7104604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411535AGTAAAGATGCAGGAAAAATTTTTCCTGCATCTTTACT0.475900.220800.706900.750001.000001.00000


Target Position: 2324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2324GUCUUGUCACCAACCAUUC67.69731828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892342GTCTTGTCACCAACCATTCGAATGGTTGGTGACAAGAC0.116400.032300.646600.500000.989100.87500


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863ACAGUAGACCAUUUGUCAU82.983587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797881ACAGTAGACCATTTGTCATATGACAAATGGTCTACTGT0.336100.005800.551700.750000.918500.75000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667GCAUGUGCUGUAAAAAUAG79.7615823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351685GCATGTGCTGTAAAAATAGCTATTTTTACAGCACATGC0.107900.002100.681000.750001.000001.00000


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724UUAAUGUCUUAUGAAAUUU68.12871792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951742TTAATGTCTTATGAAATTTAAATTTCATAAGACATTAA0.065100.002900.534500.500001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GAAAUCAGCAAAAAGGAAA86.5308374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772562GAAATCAGCAAAAAGGAAATTTCCTTTTTGCTGATTTC0.066900.034100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
542-564TTGAAATCAGCAAAAAGGAAATGUUUCCUUUUUGCUGAUUUCAAGAAAUCAGCAAAAAGGAAAUGU18.712.001


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973ACAAAAAUACUACUAAUAU85.9593406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541991ACAAAAATACTACTAATATATATTAGTAGTATTTTTGT0.862200.788600.663800.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779CCCAAGGAGACGAAGCUGA75.61811165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451797CCCAAGGAGACGAAGCTGATCAGCTTCGTCTCCTTGGG0.209400.094300.767200.750001.000001.00000


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741UGUUCUAUUGUGCCUAGUA86.7008358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7732759TGTTCTATTGTGCCTAGTATACTAGGCACAATAGAACA0.146900.054700.525900.750001.000001.00000


Target Position: 1716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1716AGCUUUGUUUAAUGUCUUA89.5131220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901734AGCTTTGTTTAATGTCTTATAAGACATTAAACAAAGCT0.013000.001600.819000.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327UUGUCACCAACCAUUCUUA79.7021827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312345TTGTCACCAACCATTCTTATAAGAATGGTTGGTGACAA0.596400.027400.612100.500001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214CUCUCAGUUGCUUAUAAAA92.8005106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551232CTCTCAGTTGCTTATAAAATTTTATAAGCAACTGAGAG0.166900.022300.810300.750001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891UGUACAUUUUUUGAAAUUU72.84481426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3261909TGTACATTTTTTGAAATTTAAATTTCAAAAAATGTACA0.264300.181200.706900.750001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081GAUUAGAAAAAAAUGUAGU82.0657654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9532099GATTAGAAAAAAATGTAGTACTACATTTTTTTCTAATC0.110700.048200.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2079-2101TTGATTAGAAAAAAATGTAGTGTACUACAUUUUUUUCUAAUCAAGAUUAGAAAAAAAUGUAGUGUU11.66.911


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GUGUUCCUUUAGACAAAGU76.25581121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741372GTGTTCCTTTAGACAAAGTACTTTGTCTAAAGGAACAC0.124000.030500.586200.500000.972800.62500


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726CACGCUAAUAAUGCAAUUA86.6117369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677744CACGCTAATAATGCAATTATAATTGCATTATTAGCGTG0.093800.034800.758600.750000.978300.87500


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673UUUUAAAAAAGGUGUAUUU69.01641718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172691TTTTAAAAAAGGTGTATTTAAATACACCTTTTTTAAAA0.084600.002300.500000.500001.000001.00000


Target Position: 1937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937GGGCUCUUACCAAGUUUAA87.898300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281955GGGCTCTTACCAAGTTTAATTAAACTTGGTAAGAGCCC0.109200.020800.956901.000000.918500.62500


Target Position: 717, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CAAAGACAGCACGCUAAUA93.0927102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567735CAAAGACAGCACGCTAATATATTAGCGTGCTGTCTTTG0.197300.022700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
715-737TACAAAGACAGCACGCTAATAATUAUUAGCGUGCUGUCUUUGUACAAAGACAGCACGCUAAUAAUU20.419.213


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463ACACUCAUUUUAUUUGUAU79.7352825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501481ACACTCATTTTATTTGTATATACAAATAAAATGAGTGT0.293400.141200.663800.750001.000001.00000


Target Position: 32, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
32GACUACGACGUCCCUCAAA87.7938305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89650GACTACGACGTCCCTCAAATTTGAGGGACGTCGTAGTC0.040500.007600.819000.750000.918500.62500


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212UUCUCUCAGUUGCUUAUAA82.4566622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833230TTCTCTCAGTTGCTTATAATTATAAGCAACTGAGAGAA0.121100.004500.637900.500001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571AGCACAGCAGUAAAACAAA88.9503246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381589AGCACAGCAGTAAAACAAATTTGTTTTACTGCTGTGCT0.273000.059200.853400.750001.000001.00000


Target Position: 2218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218UGGUUUUUAAGAAUUUCUU69.77011639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312236TGGTTTTTAAGAATTTCTTAAGAAATTCTTAAAAACCA0.054200.012300.706900.750001.000001.00000


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985CUAAUAUAACUACUGUUUC72.12431477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912003CTAATATAACTACTGTTTCGAAACAGTAGTTATATTAG0.479200.433400.500000.500001.000001.00000


Target Position: 2637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637UCAGUACUUUGCAGAAAAC67.50061836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782655TCAGTACTTTGCAGAAAACGTTTTCTGCAAAGTACTGA0.186900.038200.577600.500001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395UCUUGAUCCCCAAUGCUUC61.12242255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989413TCTTGATCCCCAATGCTTCGAAGCATTGGGGATCAAGA0.013800.004000.551700.500001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503AGAACAAAUGUAAAAGUAA94.158177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001521AGAACAAATGTAAAAGTAATTACTTTTACATTTGTTCT0.513200.180600.689700.750001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972AACAAAAAUACUACUAAUA88.1006288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551990AACAAAAATACTACTAATATATTAGTAGTATTTTTGTT0.855800.754500.603400.500001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705AGAUGAUGGCUAGCUUUGU74.65921253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811723AGATGATGGCTAGCTTTGTACAAAGCTAGCCATCATCT0.114700.037300.517200.500001.000001.00000


Target Position: 2190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2190GUAAGUUUUGUGCUUCCAA88.5809261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302208GTAAGTTTTGTGCTTCCAATTGGAAGCACAAAACTTAC0.031300.003600.534500.750000.978300.62500


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063CUGGGAGAGGGGGGGAUUG53.28812591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502081CTGGGAGAGGGGGGGATTGCAATCCCCCCCTCTCCCAG0.138200.032700.637900.500001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GAUACCCAAGGAGACGAAG66.0771948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922793GATACCCAAGGAGACGAAGCTTCGTCTCCTTGGGTATC0.205400.044700.543100.500001.000001.00000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091AAAUGUAGUGUGUUCCAUU87.1841335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112109AAATGTAGTGTGTTCCATTAATGGAACACACTACATTT0.038900.014200.491400.500001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064UGGGAGAGGGGGGGAUUGA62.10042206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752082TGGGAGAGGGGGGGATTGATCAATCCCCCCCTCTCCCA0.119800.043800.620700.500001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130GCUGAGCGAUAUGAUGACA89.4779222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681148GCTGAGCGATATGATGACATGTCATCATATCGCTCAGC0.117300.014000.646600.750001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437UGCUGUUAGCUUUCAUUAU77.9705976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341455TGCTGTTAGCTTTCATTATATAATGAAAGCTAACAGCA0.495000.002100.810300.750000.940200.62500


Target Position: 42, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
42UCCCUCAAACCUUGCUUCU57.67292426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77660TCCCTCAAACCTTGCTTCTAGAAGCAAGGTTTGAGGGA0.116700.006700.646600.500001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193UCCAAUGAGGAGAGGAAUC54.90222539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998211TCCAATGAGGAGAGGAATCGATTCCTCTCCTCATTGGA0.012200.001200.689700.500000.907600.62500


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584AACAAAAACCCAUGUAUUU76.74341078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711602AACAAAAACCCATGTATTTAAATACATGGGTTTTTGTT0.454100.080100.646600.500001.000001.00000


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268CCUUUAUUCUUUCUAUUUG75.03231218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2892286CCTTTATTCTTTCTATTTGCAAATAGAAAGAATAAAGG0.309400.240500.698300.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GAAAUUUUCAUGAACAAUC72.98121406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961754GAAATTTTCATGAACAATCGATTGTTCATGAAAATTTC0.062100.016600.491400.500001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246CCGUAGGUCAUCUUGGAGG60.74962273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997264CCGTAGGTCATCTTGGAGGCCTCCAAGATGACCTACGG0.029200.001000.569000.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057AAUUUUUAUACAAGUUAUA85.7277420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771075AATTTTTATACAAGTTATATATAACTTGTATAAAAATT0.092400.032200.465500.500001.000001.00000


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498ACCUAAGAACAAAUGUAAA88.643256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131516ACCTAAGAACAAATGTAAATTTACATTTGTTCTTAGGT0.474800.086000.853400.750001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776CGUGUAUUAAAUUCAUGUA95.382856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421794CGTGTATTAAATTCATGTATACATGAATTTAATACACG0.051800.020200.594801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1774-1796CACGTGTATTAAATTCATGTAAGUACAUGAAUUUAAUACACGUGCGUGUAUUAAAUUCAUGUAAGU20.514.602


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085AGAAAAAAAUGUAGUGUGU78.7003909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772103AGAAAAAAATGTAGTGTGTACACACTACATTTTTTTCT0.061700.045200.517200.500001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UUUAAAAUCCUUCCUCUUU64.87732031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402566TTTAAAATCCTTCCTCTTTAAAGAGGAAGGATTTTAAA0.891100.651400.500000.500001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101UGUUCCAUUUAAAAUUUUG64.69672038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452119TGTTCCATTTAAAATTTTGCAAAATTTTAAATGGAACA0.227900.052900.560300.500001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990AGUAGAGCCAGUUAACAUU83.5768546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371008AGTAGAGCCAGTTAACATTAATGTTAACTGGCTCTACT0.215900.016300.698300.750001.000001.00000


Target Position: 426, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
426CAAAGUCUUCUAUUUGAAA95.431855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581444CAAAGTCTTCTATTTGAAATTTCAAATAGAAGACTTTG0.178400.020000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
424-446AGCAAAGTCTTCTATTTGAAAATUUUCAAAUAGAAGACUUUGCUCAAAGUCUUCUAUUUGAAAAUU7.417.702


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571CUCCUCUAUUCUCUAAAUA87.6922309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022589CTCCTCTATTCTCTAAATATATTTAGAGAATAGAGGAG0.557400.270800.767200.750001.000001.00000


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439ACUAUUUCCCUCAUCCUAU79.1218879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3592457ACTATTTCCCTCATCCTATATAGGATGAGGGAAATAGT0.781700.728300.663800.750001.000001.00000


Target Position: 2636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636CUCAGUACUUUGCAGAAAA90.9126170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242654CTCAGTACTTTGCAGAAAATTTTCTGCAAAGTACTGAG0.082100.035100.810300.750001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435ACAGACUAUUUCCCUCAUC63.82942094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562453ACAGACTATTTCCCTCATCGATGAGGGAAATAGTCTGT0.887800.411900.525900.500001.000001.00000


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017CCCCUCUCUUCCUCCCCAC57.60032433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162035CCCCTCTCTTCCTCCCCACGTGGGGAGGAAGAGAGGGG0.560600.450400.698300.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046UGGGGAUGUGGAAUUUUUA83.4129564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481064TGGGGATGTGGAATTTTTATAAAAATTCCACATCCCCA0.085600.001900.810300.750001.000001.00000


Target Position: 2440, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440CUAUUUCCCUCAUCCUAUU82.3384629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662458CTATTTCCCTCATCCTATTAATAGGATGAGGGAAATAG0.789300.729600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2438-2460GACTATTTCCCTCATCCTATTTAAAUAGGAUGAGGGAAAUAGUCCUAUUUCCCUCAUCCUAUUUAU19.915.503


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984ACUAAUAUAACUACUGUUU76.73881079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2802002ACTAATATAACTACTGTTTAAACAGTAGTTATATTAGT0.473400.432100.706900.750001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680CCAUUGCUGAACUUGAUAC73.15231392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774698CCATTGCTGAACTTGATACGTATCAAGTTCAGCAATGG0.129000.006900.663800.750001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949AGUUUAAACACAAAAUUUA89.67213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151967AGTTTAAACACAAAATTTATAAATTTTGTGTTTAAACT0.839600.691000.672400.750001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493AGGCAACCUAAGAACAAAU81.2302722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041511AGGCAACCTAAGAACAAATATTTGTTCTTAGGTTGCCT0.161900.018600.836200.750001.000001.00000


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467UCAUUUUAUUUGUAUUUAA87.8931301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041485TCATTTTATTTGTATTTAATTAAATACAAATAAAATGA0.165800.137100.689700.750001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718AAAGACAGCACGCUAAUAA85.6706424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991736AAAGACAGCACGCTAATAATTATTAGCGTGCTGTCTTT0.200200.021800.465500.500001.000001.00000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067GAGAGGGGGGGAUUGAUUA89.0274244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802085GAGAGGGGGGGATTGATTATAATCAATCCCCCCCTCTC0.122400.057600.775900.750001.000001.00000


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601UUAACUUUUUUUUAGGAUU66.52221921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7581619TTAACTTTTTTTTAGGATTAATCCTAAAAAAAAGTTAA0.126700.076900.525900.500001.000001.00000


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444AGCUUUCAUUAUUUUUGCU75.9541137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461462AGCTTTCATTATTTTTGCTAGCAAAAATAATGAAAGCT0.255800.032200.500000.500001.000001.00000


Target Position: 1497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497AACCUAAGAACAAAUGUAA88.1315284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471515AACCTAAGAACAAATGTAATTACATTTGTTCTTAGGTT0.310200.074800.612100.500001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071GGGGGGGAUUGAUUAGAAA94.813964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3792089GGGGGGGATTGATTAGAAATTTCTAATCAATCCCCCCC0.219400.092800.991401.000001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922ACAGGUUUAUGUUACUUCU80.5669761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934940ACAGGTTTATGTTACTTCTAGAAGTAACATAAACCTGT0.139600.015200.482800.500001.000001.00000


Target Position: 2738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2738GUAUGUUCUAUUGUGCCUA86.3579376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172756GTATGTTCTATTGTGCCTATAGGCACAATAGAACATAC0.093600.032700.508600.750001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731GUUUUCUGUAUGUUCUAUU80.1244791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192749GTTTTCTGTATGTTCTATTAATAGAACATACAGAAAAC0.087500.011200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2729-2751ATGTTTTCTGTATGTTCTATTGTAAUAGAACAUACAGAAAACAUGUUUUCUGUAUGUUCUAUUGUU14.512.202


Target Position: 2616, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616CUCACUUUACAAAAUAUUU80.7704749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4052634CTCACTTTACAAAATATTTAAATATTTTGTAAAGTGAG0.315700.197900.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2614-2636AGCTCACTTTACAAAATATTTCCAAAUAUUUUGUAAAGUGAGCUCUCACUUUACAAAAUAUUUCCU-10.319.202


Target Position: 1138, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CAUGUCUAAGCAAAGAAAA87.7722306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881156CATGTCTAAGCAAAGAAAATTTTCTTTGCTTAGACATG0.272600.062600.655200.750000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1136-1158TCCATGTCTAAGCAAAGAAAACTUUUUCUUUGCUUAGACAUGGACAUGUCUAAGCAAAGAAAACUU5.520.302


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458UUGCUACACUCAUUUUAUU74.43781271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341476TTGCTACACTCATTTTATTAATAAAATGAGTGTAGCAA0.355200.089400.637900.500001.000001.00000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492UGUGUUUAUCUCCCUUUAA82.2102638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212510TGTGTTTATCTCCCTTTAATTAAAGGGAGATAAACACA0.627000.254600.672400.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GCAUUAACUGUAAGUUUUG75.63261163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482199GCATTAACTGTAAGTTTTGCAAAACTTACAGTTAATGC0.028200.006500.706900.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925GGUUUAUGUUACUUCUAUU98.871321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286943GGTTTATGTTACTTCTATTAATAGAAGTAACATAAACC0.372500.077400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945CAGGTTTATGTTACTTCTATTTGAAUAGAAGUAACAUAAACCUGGGUUUAUGUUACUUCUAUUUGU11.66.903


Target Position: 1673, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GCUGUAAAAAUAGUUAACA85.148450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321691GCTGTAAAAATAGTTAACATGTTAACTATTTTTACAGC0.061800.004500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1671-1693GTGCTGTAAAAATAGTTAACAGGUGUUAACUAUUUUUACAGCACGCUGUAAAAAUAGUUAACAGGU12.911.802


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CUAUAUUUCCCAUGUGGUU79.2619864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779969CTATATTTCCCATGTGGTTAACCACATGGGAAATATAG0.065100.006600.525900.750000.956500.75000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780CCAAGGAGACGAAGCUGAA91.6926140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352798CCAAGGAGACGAAGCTGAATTCAGCTTCGTCTCCTTGG0.245700.105100.672401.000001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826GCCUUCCAACUUUUGUCUG63.6142114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812844GCCTTCCAACTTTTGTCTGCAGACAAAAGTTGGAAGGC0.057500.009700.715500.750001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433CCACAGACUAUUUCCCUCA85.1049454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392451CCACAGACTATTTCCCTCATGAGGGAAATAGTCTGTGG0.911300.382800.620700.750000.972800.75000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368AAAGUUGUGACCCAUUUUA81.1397729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901386AAAGTTGTGACCCATTTTATAAAATGGGTCACAACTTT0.056100.001300.465500.500001.000001.00000


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565AUAUCAAGCACAGCAGUAA85.1077453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141583ATATCAAGCACAGCAGTAATTACTGCTGTGCTTGATAT0.491300.078500.508600.500001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533CUGUCAUUGUCUGCCUUUA87.2452332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1712551CTGTCATTGTCTGCCTTTATAAAGGCAGACAATGACAG0.479700.252600.750000.750001.000001.00000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721UGUUUAAUGUCUUAUGAAA91.3143154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741739TGTTTAATGTCTTATGAAATTTCATAAGACATTAAACA0.020800.001400.706900.750001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299CUGAGAAAAAACAGCAGAU83.4836554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777317CTGAGAAAAAACAGCAGATATCTGCTGTTTTTTCTCAG0.065800.008300.603400.750000.972800.62500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512AUCAGUCACAACAAGCAUA83.938526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847530ATCAGTCACAACAAGCATATATGCTTGTTGTGACTGAT0.182200.013000.637900.500001.000001.00000


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029UCCCCACCCUGAAAAAAAU69.97171624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982047TCCCCACCCTGAAAAAAATATTTTTTTCAGGGTGGGGA0.152000.132100.862100.750001.000001.00000


Target Position: 2187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187ACUGUAAGUUUUGUGCUUC64.32562058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722205ACTGTAAGTTTTGTGCTTCGAAGCACAAAACTTACAGT0.019900.002100.534500.500001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691AGGGAAAUAACUUGAGAUG69.1281712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971709AGGGAAATAACTTGAGATGCATCTCAAGTTATTTCCCT0.073300.014900.689700.500001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206UCCAGUCACAGGUGUAGUA80.3823776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661224TCCAGTCACAGGTGTAGTATACTACACCTGTGACTGGA0.471600.151900.689700.750000.972800.75000


Target Position: 2290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2290GGUGCACAAGAUUACCUUC78.9271892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042308GGTGCACAAGATTACCTTCGAAGGTAATCTTGTGCACC0.086800.023200.681000.750001.000001.00000


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763UGUAAAUGCUCAAUAAAUA91.4925150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872781TGTAAATGCTCAATAAATATATTTATTGAGCATTTACA0.063200.031100.663800.750001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670UGUGCUGUAAAAAUAGUUA83.6882535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041688TGTGCTGTAAAAATAGTTATAACTATTTTTACAGCACA0.111500.005400.672400.750001.000001.00000


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597GGCUAAGUUAUACCCAAAG73.5021361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4802615GGCTAAGTTATACCCAAAGCTTTGGGTATAACTTAGCC0.159900.054200.862100.750000.918500.62500


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838UUGUCUGCCUCAUUCUAAA82.7588599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537856TTGTCTGCCTCATTCTAAATTTAGAATGAGGCAGACAA0.928800.279100.646600.500001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307UAUCUGUGGAAUACUCAAU76.12921129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641325TATCTGTGGAATACTCAATATTGAGTATTCCACAGATA0.108100.001500.534500.500001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466CUCAUUUUAUUUGUAUUUA83.6279540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551484CTCATTTTATTTGTATTTATAAATACAAATAAAATGAG0.173400.136000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1464-1486CACTCATTTTATTTGTATTTAAAUAAAUACAAAUAAAAUGAGUGCUCAUUUUAUUUGUAUUUAAAU6.97.402


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603AACUUUUUUUUAGGAUUUU68.2381782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091621AACTTTTTTTTAGGATTTTAAAATCCTAAAAAAAAGTT0.070700.048000.646600.500001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615GGAUUUUUGCUUUUGUGAU85.2567444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301633GGATTTTTGCTTTTGTGATATCACAAAAGCAAAAATCC0.491100.062100.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1613-1635TAGGATTTTTGCTTTTGTGATTTAUCACAAAAGCAAAAAUCCUAGGAUUUUUGCUUUUGUGAUUUU20.50.412


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885GGAAAUUGUACAUUUUUUG74.76671245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241903GGAAATTGTACATTTTTTGCAAAAAATGTACAATTTCC0.313500.075000.724100.750001.000001.00000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794AAGUGGAAUAAAAGUUUUA86.3496379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811812AAGTGGAATAAAAGTTTTATAAAACTTTTATTCCACTT0.016700.006500.603400.500001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186AACUGUAAGUUUUGUGCUU77.8892982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042204AACTGTAAGTTTTGTGCTTAAGCACAAAACTTACAGTT0.038700.004200.508600.500001.000001.00000


Target Position: 2518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518CCUAUCCUGAAUGGUCUGU61.20742251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662536CCTATCCTGAATGGTCTGTACAGACCATTCAGGATAGG0.021900.016300.637900.750000.989101.00000


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326CUUGUCACCAACCAUUCUU71.58821514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712344CTTGTCACCAACCATTCTTAAGAATGGTTGGTGACAAG0.600500.029100.500000.750000.989100.62500


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268GUCUCAAGUAUUGAACAAA91.1443160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623286GTCTCAAGTATTGAACAAATTTGTTCAATACTTGAGAC0.200100.016800.819000.750000.978300.75000


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521AUCCUGAAUGGUCUGUCAU72.48821450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822539ATCCTGAATGGTCTGTCATATGACAGACCATTCAGGAT0.141900.014900.525900.500000.989100.75000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610UUUUAGGAUUUUUGCUUUU63.87092088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981628TTTTAGGATTTTTGCTTTTAAAAGCAAAAATCCTAAAA0.090600.033200.500000.500001.000001.00000


Target Position: 1504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504GAACAAAUGUAAAAGUAAA102.5356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331522GAACAAATGTAAAAGTAAATTTACTTTTACATTTGTTC0.621900.183600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1502-1524AAGAACAAATGTAAAAGTAAAGAUUUACUUUUACAUUUGUUCUUGAACAAAUGUAAAAGUAAAGAU4.95.302


Target Position: 2754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2754CUAGUACACUGUAAAUGCU83.468556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2752-2774GCCTAGTACACTGTAAATGCTCAAGCAUUUACAGUGUACUAGGCCUAGUACACUGUAAAUGCUCAU15.320.202


Target Position: 2762, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762CUGUAAAUGCUCAAUAAAU88.7277252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812780CTGTAAATGCTCAATAAATATTTATTGAGCATTTACAG0.065000.037600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2760-2782CACTGTAAATGCTCAATAAATATAUUUAUUGAGCAUUUACAGUGCUGUAAAUGCUCAAUAAAUAUU-1.46.901


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GGGCAGAAACGGUUCACAU89.5401219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121415GGGCAGAAACGGTTCACATATGTGAACCGTTTCTGCCC0.036400.004100.836201.000001.000001.00000


Target Position: 2009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2009CCCAUGAUCCCCUCUCUUC66.1291944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3752027CCCATGATCCCCTCTCTTCGAAGAGAGGGGATCATGGG0.812600.168000.819000.750001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984UAGGGGAGUAGAGCCAGUU66.91761887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201002TAGGGGAGTAGAGCCAGTTAACTGGCTCTACTCCCCTA0.164400.002300.525900.500001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGGAUUGUCGAUCAGUCAC72.60741447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973520GGGATTGTCGATCAGTCACGTGACTGATCGACAATCCC0.065800.001400.698300.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GUACAUUGUGGCUUCAAAA94.559571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118TGGTACATTGTGGCTTCAAAAGGUUUUGAAGCCACAAUGUACCAGUACAUUGUGGCUUCAAAAGGU12.213.512


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029UCUUGAGGUGGCCAAUAUG65.89661961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9511047TCTTGAGGTGGCCAATATGCATATTGGCCACCTCAAGA0.033000.004200.569000.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CAAAAACCCAUGUAUUUAA93.292797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451604CAAAAACCCATGTATTTAATTAAATACATGGGTTTTTG0.490100.080100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606AACAAAAACCCATGTATTTAACTUUAAAUACAUGGGUUUUUGUUCAAAAACCCAUGUAUUUAACUU1.412.602


Target Position: 2228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228GAAUUUCUUGAUACUCUUA97.871927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942246GAATTTCTTGATACTCTTATAAGAGTATCAAGAAATTC0.338600.053300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2226-2248AAGAATTTCTTGATACTCTTATAUAAGAGUAUCAAGAAAUUCUUGAAUUUCUUGAUACUCUUAUAU18.95.302


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664AAAAUGCCAUUUUAAAAAA83.4181562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8482682AAAATGCCATTTTAAAAAATTTTTTAAAATGGCATTTT0.110900.080600.500000.500001.000001.00000


Target Position: 1819, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819GACUUUUCAACUACUUUCU78.3162943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251837GACTTTTCAACTACTTTCTAGAAAGTAGTTGAAAAGTC0.219200.060900.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1817-1839TGGACTTTTCAACTACTTTCTCTAGAAAGUAGUUGAAAAGUCCAGACUUUUCAACUACUUUCUCUU14.613.302


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219GGUUUUUAAGAAUUUCUUG76.38961114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922237GGTTTTTAAGAATTTCTTGCAAGAAATTCTTAAAAACC0.211900.006100.706900.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051AUGUGGAAUUUUUAUACAA89.7654208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691069ATGTGGAATTTTTATACAATTGTATAAAAATTCCACAT0.082500.018900.508600.500001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961CAUGUGGUUUUUAUGUUUA91.8349134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538979CATGTGGTTTTTATGTTTATAAACATAAAAACCACATG0.376500.056900.620700.750001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882AAAGGAAAUUGUACAUUUU85.1796447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8741900AAAGGAAATTGTACATTTTAAAATGTACAATTTCCTTT0.294500.033000.500000.500001.000001.00000


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271UCAAGUAUUGAACAAAAGA77.27211033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839289TCAAGTATTGAACAAAAGATCTTTTGTTCAATACTTGA0.225700.039400.500000.500001.000001.00000


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893UACAUUUUUUGAAAUUUAU74.62241259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381911TACATTTTTTGAAATTTATATAAATTTCAAAAAATGTA0.272900.134900.637900.500001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462UACACUCAUUUUAUUUGUA84.4902490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571480TACACTCATTTTATTTGTATACAAATAAAATGAGTGTA0.314800.126800.500000.500001.000001.00000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960AAAAUUUAUCAUAACAAAA88.612258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551978AAAATTTATCATAACAAAATTTTGTTATGATAAATTTT0.852900.749800.500000.500001.000001.00000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248AGCCUGCCUUCAAUUUUGA77.09731049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602266AGCCTGCCTTCAATTTTGATCAAAATTGAAGGCAGGCT0.205700.103400.629300.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615GCUCACUUUACAAAAUAUU78.9614891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2502633GCTCACTTTACAAAATATTAATATTTTGTAAAGTGAGC0.345800.178800.844801.000001.000001.00000


Target Position: 2806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2806UGAUGAUAAGGGUGAGAAA92.0951126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472824TGATGATAAGGGTGAGAAATTTCTCACCCTTATCATCA0.207200.022400.724100.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864UGGUUCUGAAACUUCUCUA81.4351715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631882TGGTTCTGAAACTTCTCTATAGAGAAGTTTCAGAACCA0.284800.089300.672400.750001.000001.00000


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319CUUCUGUCUUGUCACCAAC70.5111587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012337CTTCTGTCTTGTCACCAACGTTGGTGACAAGACAGAAG0.057700.018100.491400.500000.967400.62500


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970AUAACAAAAAUACUACUAA88.3389274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061988ATAACAAAAATACTACTAATTAGTAGTATTTTTGTTAT0.844000.746500.508600.500001.000001.00000


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609UGUGUUCUAUUAUGAGAUU78.6371913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
842627TGTGTTCTATTATGAGATTAATCTCATAATAGAACACA0.450300.004300.698300.750001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210UCUUCUCUCAGUUGCUUAU73.44591369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874228TCTTCTCTCAGTTGCTTATATAAGCAACTGAGAGAAGA0.046200.004000.681000.750001.000001.00000


Target Position: 2797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2797AGUGAGUCUUGAUGAUAAG78.1704959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882815AGTGAGTCTTGATGATAAGCTTATCATCAAGACTCACT0.105600.006200.569000.500001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889AUUGUACAUUUUUUGAAAU76.50421103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541907ATTGTACATTTTTTGAAATATTTCAAAAAATGTACAAT0.252300.172500.500000.500001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513UCAGUCACAACAAGCAUAC57.57132436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885531TCAGTCACAACAAGCATACGTATGCTTGTTGTGACTGA0.167500.014500.543100.500001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GUUCUGAAACUUCUCUAAA90.7708176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371884GTTCTGAAACTTCTCTAAATTTAGAGAAGTTTCAGAAC0.053100.018600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1864-1886TGGTTCTGAAACTTCTCTAAAGGUUUAGAGAAGUUUCAGAACCAGUUCUGAAACUUCUCUAAAGGU20.220.401


Target Position: 2807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GAUGAUAAGGGUGAGAAAC72.1291476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662825GATGATAAGGGTGAGAAACGTTTCTCACCCTTATCATC0.183100.020500.534500.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CCUCAUUCUAAAAUUUACA85.6474427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443863CCTCATTCTAAAATTTACATGTAAATTTTAGAATGAGG0.547300.569300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
843-865TGCCTCATTCTAAAATTTACACAUGUAAAUUUUAGAAUGAGGCACCUCAUUCUAAAAUUUACACAU-0.320.402


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879UCUAAAGGAAAUUGUACAU72.44661455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931897TCTAAAGGAAATTGTACATATGTACAATTTCCTTTAGA0.236200.013000.569000.750001.000001.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522UCCUGAAUGGUCUGUCAUU75.51931174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722540TCCTGAATGGTCTGTCATTAATGACAGACCATTCAGGA0.345100.014500.862100.750000.989100.75000


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764UUGUUAAGAACACGUGUAU69.42961679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191782TTGTTAAGAACACGTGTATATACACGTGTTCTTAACAA0.112200.015300.603400.500001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422AGAGCAAAGUCUUCUAUUU87.4745318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910440AGAGCAAAGTCTTCTATTTAAATAGAAGACTTTGCTCT0.053700.002500.724100.750001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900AGUUUUUUGUUUACGAUUU75.11031210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340918AGTTTTTTGTTTACGATTTAAATCGTAAACAAAAAACT0.509100.058400.706900.750001.000001.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700AGAAUGUAAGCUCCUCAAG68.07731798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682718AGAATGTAAGCTCCTCAAGCTTGAGGAGCTTACATTCT0.054800.007300.586200.500001.000001.00000


Target Position: 1818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818GGACUUUUCAACUACUUUC76.80021071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861836GGACTTTTCAACTACTTTCGAAAGTAGTTGAAAAGTCC0.214700.054100.698300.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539CUUUUGAAAUCAGCAAAAA84.3901497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604557CTTTTGAAATCAGCAAAAATTTTTGCTGATTTCAAAAG0.116400.026500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
537-559AGCTTTTGAAATCAGCAAAAAGGUUUUUGCUGAUUUCAAAAGCUCUUUUGAAAUCAGCAAAAAGGU18.67.702


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617UCACUUUACAAAAUAUUUC60.5042292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672635TCACTTTACAAAATATTTCGAAATATTTTGTAAAGTGA0.304500.204500.551700.500001.000001.00000


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215UCUCAGUUGCUUAUAAAAA81.4769712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524233TCTCAGTTGCTTATAAAAATTTTTATAAGCAACTGAGA0.159800.025600.724100.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719AAGACAGCACGCUAAUAAU86.6435366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767737AAGACAGCACGCTAATAATATTATTAGCGTGCTGTCTT0.090300.018800.629300.500001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519ACAACAAGCAUACCAAGAA86.202391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726537ACAACAAGCATACCAAGAATTCTTGGTATGCTTGTTGT0.570700.078900.534500.750001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CCUACAUACUGGUUUGUCC73.96691311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921178CCTACATACTGGTTTGTCCGGACAAACCAGTATGTAGG0.019700.021100.474100.500000.978300.75000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UGAAAUUUUCAUGAACAAU73.92071317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461753TGAAATTTTCATGAACAATATTGTTCATGAAAATTTCA0.050300.015000.715500.750001.000001.00000


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193AGGGAUCAUUGGUUCCAGU76.6531090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681211AGGGATCATTGGTTCCAGTACTGGAACCAATGATCCCT0.047700.001500.637900.500000.929300.62500


Target Position: 728, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CGCUAAUAAUGCAAUUACU89.8069206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
678746CGCTAATAATGCAATTACTAGTAATTGCATTATTAGCG0.093800.019800.715500.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
726-748CACGCTAATAATGCAATTACTGAAGUAAUUGCAUUAUUAGCGUGCGCUAAUAAUGCAAUUACUGAU6.914.912


Target Position: 57, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
57UUCUAGGAGAUAAAAAGAA76.38971113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86575TTCTAGGAGATAAAAAGAATTCTTTTTATCTCCTAGAA0.628700.147100.500000.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515AAAGUAAAGAUGCAGGAAA84.9125466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461533AAAGTAAAGATGCAGGAAATTTCCTGCATCTTTACTTT0.327300.225400.500000.500001.000001.00000


Target Position: 1940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940CUCUUACCAAGUUUAAACA84.1087517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811958CTCTTACCAAGTTTAAACATGTTTAAACTTGGTAAGAG0.714900.053800.603400.500001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628AAUAUUUCCUCAGUACUUU76.98851058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972646AATATTTCCTCAGTACTTTAAAGTACTGAGGAAATATT0.101800.052300.508600.500001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617AUUUUUGCUUUUGUGAUUU64.87742030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021635ATTTTTGCTTTTGTGATTTAAATCACAAAAGCAAAAAT0.494900.071100.508600.500001.000001.00000


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406AGGCACCCUGCUUCCUUUG55.54512511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772424AGGCACCCTGCTTCCTTTGCAAAGGAAGCAGGGTGCCT0.313200.003700.698300.500000.967400.75000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415UUCCAUUAUUUGUAAAGUU71.99891487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551433TTCCATTATTTGTAAAGTTAACTTTACAAATAATGGAA0.084100.082200.525900.500001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770GCUCAAUAAAUAUUGAUGA88.9453247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692788GCTCAATAAATATTGATGATCATCAATATTTATTGAGC0.046900.004800.629300.750000.918500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2768-2790ATGCTCAATAAATATTGATGATGUCAUCAAUAUUUAUUGAGCAUGCUCAAUAAAUAUUGAUGAUGU13.613.402


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407GGCACCCUGCUUCCUUUGC50.93722662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742425GGCACCCTGCTTCCTTTGCGCAAAGGAAGCAGGGTGCC0.344200.006300.646600.500000.967400.75000


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888UGUCCCACAAAUAGUUUUU66.93051886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800906TGTCCCACAAATAGTTTTTAAAAACTATTTGTGGGACA0.060700.022400.706900.750001.000001.00000


Target Position: 1830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830UACUUUCUCUACAGCUUUU76.54551098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391848TACTTTCTCTACAGCTTTTAAAAGCTGTAGAGAAAGTA0.115500.019300.681000.500000.940200.62500


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622UGCUUUUGUGAUUUUUUUU69.76631640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491640TGCTTTTGTGATTTTTTTTAAAAAAAATCACAAAAGCA0.761300.425400.853400.750001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469AUUUUAUUUGUAUUUAAAU77.31791030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431487ATTTTATTTGTATTTAAATATTTAAATACAAATAAAAT0.276400.046700.500000.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744ACUGAGAGACAACUUGACA85.3673437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849762ACTGAGAGACAACTTGACATGTCAAGTTGTCTCTCAGT0.134800.031300.500000.500001.000001.00000


Target Position: 2246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246AUAGCCUGCCUUCAAUUUU66.87981890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912264ATAGCCTGCCTTCAATTTTAAAATTGAAGGCAGGCTAT0.308000.135800.543100.500001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UCAUUGUCUGCCUUUAAAA81.7623691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1632554TCATTGTCTGCCTTTAAAATTTTAAAGGCAGACAATGA0.515700.303800.724100.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813UGAAUGGACUUUUCAACUA84.3039507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6711831TGAATGGACTTTTCAACTATAGTTGAAAAGTCCATTCA0.100600.019200.551700.750001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200UGCUUCCAAAUCACUUUUU63.66052108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782218TGCTTCCAAATCACTTTTTAAAAAGTGATTTGGAAGCA0.379100.049800.853400.750001.000001.00000


Target Position: 1957, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957CACAAAAUUUAUCAUAACA93.768287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331975CACAAAATTTATCATAACATGTTATGATAAATTTTGTG0.887300.763200.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1955-1977AACACAAAATTTATCATAACAAAUGUUAUGAUAAAUUUUGUGUUCACAAAAUUUAUCAUAACAAAU16.15.312


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250CCUGCCUUCAAUUUUGAUC60.92992264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562268CCTGCCTTCAATTTTGATCGATCAAAATTGAAGGCAGG0.254800.180600.663800.750001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UGCCUCAUUCUAAAAUUUA79.1579876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249861TGCCTCATTCTAAAATTTATAAATTTTAGAATGAGGCA0.917100.673400.819000.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861UCUUGGUUCUGAAACUUCU73.57771352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531879TCTTGGTTCTGAAACTTCTAGAAGTTTCAGAACCAAGA0.217400.058300.500000.500001.000001.00000


Target Position: 2261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261UUUUGAUCCUUUAUUCUUU73.18111389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602279TTTTGATCCTTTATTCTTTAAAGAATAAAGGATCAAAA0.457200.212700.500000.500001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GACUAUUUCCCUCAUCCUA93.394295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242456GACTATTTCCCTCATCCTATAGGATGAGGGAAATAGTC0.779100.730500.646600.750001.000001.00000


Target Position: 2722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722AGGGACAAUGUUUUCUGUA83.5433549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722740AGGGACAATGTTTTCTGTATACAGAAAACATTGTCCCT0.316500.006900.663800.750001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424AGCAAAGUCUUCUAUUUGA87.0935338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836442AGCAAAGTCTTCTATTTGATCAAATAGAAGACTTTGCT0.053200.025400.629300.500001.000001.00000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721CAGGGACAAUGUUUUCUGU84.7419475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412739CAGGGACAATGTTTTCTGTACAGAAAACATTGTCCCTG0.315500.007000.577600.500001.000001.00000


Target Position: 1842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842AGCUUUUCAUGUAAAUUAG74.63251257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981860AGCTTTTCATGTAAATTAGCTAATTTACATGAAAAGCT0.040100.015300.681000.500001.000001.00000


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680AAAGGUGUAUUUUUUCUUU80.0996794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682698AAAGGTGTATTTTTTCTTTAAAGAAAAAATACACCTTT0.086000.006600.500000.500001.000001.00000


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CCCUUAACUUCUCUGUGUU82.1754643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876614CCCTTAACTTCTCTGTGTTAACACAGAGAAGTTAAGGG0.046000.046700.844801.000001.000001.00000


Target Position: 2387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387UGGCUCCACUCAGUGUCUA75.90181140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612405TGGCTCCACTCAGTGTCTATAGACACTGAGTGGAGCCA0.023700.004700.672400.750000.972801.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GCCUUCUGUCUUGUCACCA78.1277965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022335GCCTTCTGTCTTGTCACCATGGTGACAAGACAGAAGGC0.060500.010100.655200.750001.000001.00000


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958ACAAAAUUUAUCAUAACAA88.0505290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521976ACAAAATTTATCATAACAATTGTTATGATAAATTTTGT0.887500.761700.560300.750001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615CUAUUAUGAGAUUCUGAAC76.67451087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788633CTATTATGAGATTCTGAACGTTCAGAATCTCATAATAG0.113700.013700.525900.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573CCUCUAUUCUCUAAAUAAU92.6501110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1272591CCTCTATTCTCTAAATAATATTATTTAGAGAATAGAGG0.557800.226100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2571-2593CTCCTCTATTCTCTAAATAATGAAUUAUUUAGAGAAUAGAGGAGCCUCUAUUCUCUAAAUAAUGAU-7.511.603


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87GGAUAAAAAUGAGCUGGUU87.3009328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881105GGATAAAAATGAGCTGGTTAACCAGCTCATTTTTATCC0.045500.016600.724101.000001.000001.00000


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948AAGUUUAAACACAAAAUUU82.0302660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6151966AAGTTTAAACACAAAATTTAAATTTTGTGTTTAAACTT0.826700.657400.637900.500001.000001.00000


Target Position: 2648, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648CAGAAAACACCAAACAAAA94.340773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2322666CAGAAAACACCAAACAAAATTTTGTTTGGTGTTTTCTG0.550900.249400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2646-2668TGCAGAAAACACCAAACAAAAATUUUUGUUUGGUGUUUUCUGCACAGAAAACACCAAACAAAAAUU5.613.301


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073GGGGGAUUGAUUAGAAAAA90.9075172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3352091GGGGGATTGATTAGAAAAATTTTTCTAATCAATCCCCC0.256700.090200.991401.000001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346CUGCAGAAGUGUUCCUUUA90.2433191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631364CTGCAGAAGTGTTCCTTTATAAAGGAACACTTCTGCAG0.048100.011900.750000.750000.978300.87500


Target Position: 2815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815GGGUGAGAAACUGAAAUCC68.85471727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242833GGGTGAGAAACTGAAATCCGGATTTCAGTTTCTCACCC0.091400.030800.620700.500001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GAGAAGGAGGGGAAAAUUA91.7179139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806821GAGAAGGAGGGGAAAATTATAATTTTCCCCTCCTTCTC0.872500.005300.775900.750001.000001.00000


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998CAGUUAACAUUUAGGGAGU80.0891795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501016CAGTTAACATTTAGGGAGTACTCCCTAAATGTTAACTG0.043700.028300.577600.500001.000001.00000


Target Position: 1280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280CAUGGAUACCACAUAUUAA105.7363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1278-1300CCCATGGATACCACATATTAAACUUAAUAUGUGGUAUCCAUGGGCAUGGAUACCACAUAUUAAACU0.021.213


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411UUCACAAGCAGAGAGCAAA74.44941270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949429TTCACAAGCAGAGAGCAAATTTGCTCTCTGCTTGTGAA0.027600.003500.672400.500000.945700.87500


Target Position: 1869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869CUGAAACUUCUCUAAAGGA86.3436381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1867-1889TTCTGAAACTTCTCTAAAGGAAAUCCUUUAGAGAAGUUUCAGAACUGAAACUUCUCUAAAGGAAAU15.819.202


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737UGCAAUUACUGAGAGACAA82.3477628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313755TGCAATTACTGAGAGACAATTGTCTCTCAGTAATTGCA0.277200.093600.706900.750001.000001.00000


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856AUUAGUCUUGGUUCUGAAA81.5742704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041874ATTAGTCTTGGTTCTGAAATTTCAGAACCAAGACTAAT0.179400.032700.508600.500001.000001.00000


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489GACUGUGUUUAUCUCCCUU88.4182267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3172507GACTGTGTTTATCTCCCTTAAGGGAGATAAACACAGTC0.785100.066100.681000.750001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521AAGAUGCAGGAAAAAUGAA84.2552510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811539AAGATGCAGGAAAAATGAATTCATTTTTCCTGCATCTT0.615600.242700.465500.500001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567CUUCCUCCUCUAUUCUCUA90.1705193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862585CTTCCTCCTCTATTCTCTATAGAGAATAGAGGAGGAAG0.494300.308200.465500.750001.000001.00000


Target Position: 2022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2022CUCUUCCUCCCCACCCUGA69.73481645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612040CTCTTCCTCCCCACCCTGATCAGGGTGGGGAGGAAGAG0.394600.422000.586200.500001.000001.00000


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069AGUUAUAAGUGUUUGGCAU84.6049481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691087AGTTATAAGTGTTTGGCATATGCCAAACACTTATAACT0.020900.003700.551700.750001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812UAAGGGUGAGAAACUGAAA83.4157563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172830TAAGGGTGAGAAACTGAAATTTCAGTTTCTCACCCTTA0.356500.057400.534500.500001.000001.00000


Target Position: 1935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1935AUGGGCUCUUACCAAGUUU69.5821660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561953ATGGGCTCTTACCAAGTTTAAACTTGGTAAGAGCCCAT0.075000.004000.655200.500000.918500.87500


Target Position: 2560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560CCUCUUUCUUCCUCCUCUA89.9832198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372578CCTCTTTCTTCCTCCTCTATAGAGGAGGAAGAAAGAGG0.447500.432200.672401.000001.000001.00000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791UGUAAGUGGAAUAAAAGUU73.34691378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8941809TGTAAGTGGAATAAAAGTTAACTTTTATTCCACTTACA0.040700.021700.560300.750001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550UUCAUUACUUCAUGUAUAU75.20791202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881568TTCATTACTTCATGTATATATATACATGAAGTAATGAA0.050400.001100.629300.500000.978300.75000


Target Position: 2240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2240ACUCUUAUAGCCUGCCUUC64.3872053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932258ACTCTTATAGCCTGCCTTCGAAGGCAGGCTATAAGAGT0.187700.125900.534500.500001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GGAGAAGGAGGGGAAAAUU82.3107632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885820GGAGAAGGAGGGGAAAATTAATTTTCCCCTCCTTCTCC0.044500.005400.862101.000001.000001.00000


Target Position: 2660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660AACAAAAAUGCCAUUUUAA85.8829410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752678AACAAAAATGCCATTTTAATTAAAATGGCATTTTTGTT0.125100.125300.612100.500000.978300.62500


Target Position: 53, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
53UUGCUUCUAGGAGAUAAAA73.23761385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72271TTGCTTCTAGGAGATAAAATTTTATCTCCTAGAAGCAA0.530600.047300.646600.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767UUAAGAACACGUGUAUUAA81.8027689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341785TTAAGAACACGTGTATTAATTAATACACGTGTTCTTAA0.130600.048400.500000.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440UGAAAAUGAAAGGAGAUUA81.7572692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927458TGAAAATGAAAGGAGATTATAATCTCCTTTCATTTTCA0.032600.013800.689700.750001.000001.00000


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311AGCAGAUGGCUCGAGAAUA85.9819401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890329AGCAGATGGCTCGAGAATATATTCTCGAGCCATCTGCT0.056100.003100.810300.750000.972800.62500


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839UGUCUGCCUCAUUCUAAAA84.1869513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461857TGTCTGCCTCATTCTAAAATTTTAGAATGAGGCAGACA0.935800.285900.706900.750001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303ACCUUCCUGUUUUAGCCUU65.84011968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022321ACCTTCCTGTTTTAGCCTTAAGGCTAAAACAGGAAGGT0.320100.222300.715500.750001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GUUUUUUGUUUACGAUUUA86.3284384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
548919GTTTTTTGTTTACGATTTATAAATCGTAAACAAAAAAC0.538700.067800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
899-921TAGTTTTTTGTTTACGATTTATGUAAAUCGUAAACAAAAAACUAGUUUUUUGUUUACGAUUUAUGU15.2-2.912


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352CUAAGAGAUAUCUGCAAUG75.58241168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875370CTAAGAGATATCTGCAATGCATTGCAGATATCTCTTAG0.046100.042300.517200.500001.000001.00000


Target Position: 606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
606CUCUGUGUUCUAUUAUGAG78.4102937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923624CTCTGTGTTCTATTATGAGCTCATAATAGAACACAGAG0.453100.002300.500000.500001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886GCUGUCCCACAAAUAGUUU77.7562994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815904GCTGTCCCACAAATAGTTTAAACTATTTGTGGGACAGC0.064700.004900.853401.000001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572GCACAGCAGUAAAACAAAA95.998445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311590GCACAGCAGTAAAACAAAATTTTGTTTTACTGCTGTGC0.261500.200700.853401.000001.000001.00000


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016UCCCCUCUCUUCCUCCCCA66.17671940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542034TCCCCTCTCTTCCTCCCCATGGGGAGGAAGAGAGGGGA0.627200.530200.525900.500001.000001.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438GCUGUUAGCUUUCAUUAUU85.2742443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151456GCTGTTAGCTTTCATTATTAATAATGAAAGCTAACAGC0.532700.002400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1436-1458CTGCTGTTAGCTTTCATTATTTTAAUAAUGAAAGCUAACAGCAGGCUGUUAGCUUUCAUUAUUUUU8.716.412


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249GCCUGCCUUCAAUUUUGAU79.236867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3882267GCCTGCCTTCAATTTTGATATCAAAATTGAAGGCAGGC0.212000.187900.819001.000001.000001.00000


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502UCCCUUUAAAACCCUACCU56.4422483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662520TCCCTTTAAAACCCTACCTAGGTAGGGTTTTAAAGGGA0.581800.454500.525900.500001.000001.00000


Target Position: 2266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2266AUCCUUUAUUCUUUCUAUU75.62931164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352284ATCCTTTATTCTTTCTATTAATAGAAAGAATAAAGGAT0.490700.297600.672400.500001.000001.00000


Target Position: 1455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1455UUUUUGCUACACUCAUUUU70.18771608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521473TTTTTGCTACACTCATTTTAAAATGAGTGTAGCAAAAA0.419900.116000.500000.500001.000001.00000


Target Position: 1936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1936UGGGCUCUUACCAAGUUUA79.1807873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251954TGGGCTCTTACCAAGTTTATAAACTTGGTAAGAGCCCA0.081600.010900.810300.750000.918500.75000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CUCAAGUAUUGAACAAAAG72.70961436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797288CTCAAGTATTGAACAAAAGCTTTTGTTCAATACTTGAG0.192000.031600.672400.500001.000001.00000


Target Position: 425, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
425GCAAAGUCUUCUAUUUGAA94.946462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750443GCAAAGTCTTCTATTTGAATTCAAATAGAAGACTTTGC0.072500.022300.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
423-445GAGCAAAGTCTTCTATTTGAAAAUUCAAAUAGAAGACUUUGCUCGCAAAGUCUUCUAUUUGAAAAU8.919.202


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058AUUUUUAUACAAGUUAUAA84.9565463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611076ATTTTTATACAAGTTATAATTATAACTTGTATAAAAAT0.095200.030600.474100.500001.000001.00000


Target Position: 1886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886GAAAUUGUACAUUUUUUGA88.6086259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1884-1906AGGAAATTGTACATTTTTTGAAAUCAAAAAAUGUACAAUUUCCUGAAAUUGUACAUUUUUUGAAAU-2.95.312


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902UGAAAUUUAUUCCUUAUUC65.71581976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8151920TGAAATTTATTCCTTATTCGAATAAGGAATAAATTTCA0.303700.210100.551700.500000.989100.62500


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199GUGCUUCCAAAUCACUUUU73.62471344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582217GTGCTTCCAAATCACTTTTAAAAGTGATTTGGAAGCAC0.378400.036000.793100.750001.000001.00000


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955AACACAAAAUUUAUCAUAA93.495492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731973AACACAAAATTTATCATAATTATGATAAATTTTGTGTT0.816700.752500.612100.500001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324AUGUGUACACCUUUGACUA87.9479295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291342ATGTGTACACCTTTGACTATAGTCAAAGGTGTACACAT0.064300.005000.482800.500001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042AAAAAUGAGUUCCUAUUUU78.6052918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792060AAAAATGAGTTCCTATTTTAAAATAGGAACTCATTTTT0.017100.003900.500000.500001.000001.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997CCAGUUAACAUUUAGGGAG69.28861693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541015CCAGTTAACATTTAGGGAGCTCCCTAAATGTTAACTGG0.049500.033300.534500.750001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367AAUGAUGUACUGUCUCUUU83.2896569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807385AATGATGTACTGTCTCTTTAAAGAGACAGTACATCATT0.091300.018600.508600.500001.000001.00000


Target Position: 2661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2661ACAAAAAUGCCAUUUUAAA85.141452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582679ACAAAAATGCCATTTTAAATTTAAAATGGCATTTTTGT0.128600.114700.706900.750000.994600.62500


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605CUUUUUUUUAGGAUUUUUG64.50362047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981623CTTTTTTTTAGGATTTTTGCAAAAATCCTAAAAAAAAG0.051300.028700.491400.500001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312GCAGAUGGCUCGAGAAUAC79.1971872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711330GCAGATGGCTCGAGAATACGTATTCTCGAGCCATCTGC0.535600.012000.672400.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070AGGGGGGGAUUGAUUAGAA88.4155268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022088AGGGGGGGATTGATTAGAATTCTAATCAATCCCCCCCT0.204000.094200.672400.750001.000001.00000


Target Position: 2726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726ACAAUGUUUUCUGUAUGUU74.38551274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362744ACAATGTTTTCTGTATGTTAACATACAGAAAACATTGT0.263900.010300.560300.750001.000001.00000


Target Position: 2065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065GGGAGAGGGGGGGAUUGAU76.78031074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322083GGGAGAGGGGGGGATTGATATCAATCCCCCCCTCTCCC0.107900.055900.810301.000001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895CAUUUUUUGAAAUUUAUUC68.81271732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331913CATTTTTTGAAATTTATTCGAATAAATTTCAAAAAATG0.247800.134000.482800.500000.972800.62500


Target Position: 1518, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518GUAAAGAUGCAGGAAAAAU81.7505693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581536GTAAAGATGCAGGAAAAATATTTTTCCTGCATCTTTAC0.519200.218400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1516-1538AAGTAAAGATGCAGGAAAAATGAAUUUUUCCUGCAUCUUUACUUGUAAAGAUGCAGGAAAAAUGAU14.36.912


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347UGCAGAAGUGUUCCUUUAG65.43961998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911365TGCAGAAGTGTTCCTTTAGCTAAAGGAACACTTCTGCA0.116500.013100.681000.500000.978300.87500


Target Position: 43, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
43CCCUCAAACCUUGCUUCUA83.336566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71661CCCTCAAACCTTGCTTCTATAGAAGCAAGGTTTGAGGG0.083800.016400.819001.000001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GACGAAGCUGAAGCAGGAG69.42961678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812805GACGAAGCTGAAGCAGGAGCTCCTGCTTCAGCTTCGTC0.069700.009900.508600.500001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348GCAGAAGUGUUCCUUUAGA89.8367205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741366GCAGAAGTGTTCCTTTAGATCTAAAGGAACACTTCTGC0.096200.014500.629300.750000.978300.75000


Target Position: 2205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205CCAAAUCACUUUUUGGUUU77.23161039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2203-2225TTCCAAATCACTTTTTGGTTTTTAAACCAAAAAGUGAUUUGGAACCAAAUCACUUUUUGGUUUUUU18.813.802


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347CGGAGCUAAGAGAUAUCUG76.63331091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
990365CGGAGCTAAGAGATATCTGCAGATATCTCTTAGCTCCG0.054300.001100.629300.750001.000001.00000


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672AUUUUAAAAAAGGUGUAUU69.6381654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762690ATTTTAAAAAAGGTGTATTAATACACCTTTTTTAAAAT0.042000.001300.500000.500001.000001.00000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264UGAUCCUUUAUUCUUUCUA78.0324971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682282TGATCCTTTATTCTTTCTATAGAAAGAATAAAGGATCA0.471100.302600.551700.750001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GUACAUUUUUUGAAAUUUA94.04881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051910GTACATTTTTTGAAATTTATAAATTTCAAAAAATGTAC0.283100.180600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1890-1912TTGTACATTTTTTGAAATTTATTUAAAUUUCAAAAAAUGUACAAGUACAUUUUUUGAAAUUUAUUU0.46.921


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GUCUAAGCAAAGAAAACUG72.97061408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861159GTCTAAGCAAAGAAAACTGCAGTTTTCTTTGCTTAGAC0.099900.003000.534500.500000.989100.62500


Target Position: 2720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720GCAGGGACAAUGUUUUCUG73.64371342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562738GCAGGGACAATGTTTTCTGCAGAAAACATTGTCCCTGC0.113500.008300.569000.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601AACUUCUCUGUGUUCUAUU76.3161119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641619AACTTCTCTGTGTTCTATTAATAGAACACAGAGAAGTT0.130000.023200.637900.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GCUUUUGAAAUCAGCAAAA86.5975371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392556GCTTTTGAAATCAGCAAAATTTTGCTGATTTCAAAAGC0.358500.047000.853401.000000.967400.62500


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88GAUAAAAAUGAGCUGGUUC75.07991214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816106GATAAAAATGAGCTGGTTCGAACCAGCTCATTTTTATC0.056600.019700.508600.500001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CCGGCCUUCCAACUUUUGU62.79692167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884841CCGGCCTTCCAACTTTTGTACAAAAGTTGGAAGGCCGG0.071500.003200.706900.750000.951100.62500


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830UCCAACUUUUGUCUGCCUC49.93692682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
871848TCCAACTTTTGTCTGCCTCGAGGCAGACAAAAGTTGGA0.365500.040400.560300.500001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352GGCCAUGUACUUGGAAAAA85.4865429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182370GGCCATGTACTTGGAAAAATTTTTCCAAGTACATGGCC0.228200.017401.000001.000000.956500.75000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760ACAUUGUGGACAUCGGAUA81.9149671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
903778ACATTGTGGACATCGGATATATCCGATGTCCACAATGT0.050100.002600.663800.750001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703UGAGAUGAUGGCUAGCUUU78.6078917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651721TGAGATGATGGCTAGCTTTAAAGCTAGCCATCATCTCA0.096700.039000.724100.750001.000001.00000


Target Position: 2531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531GUCUGUCAUUGUCUGCCUU82.9973586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2862549GTCTGTCATTGTCTGCCTTAAGGCAGACAATGACAGAC0.474300.196700.681000.750001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793GCUGAAGCAGGAGAAGGAG69.15291707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
689811GCTGAAGCAGGAGAAGGAGCTCCTTCTCCTGCTTCAGC0.135300.020100.543100.750001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985AGGGGAGUAGAGCCAGUUA87.2529331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301003AGGGGAGTAGAGCCAGTTATAACTGGCTCTACTCCCCT0.153300.002200.810300.750001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GGAAUCUUCUCUCAGUUGC65.34812003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942224GGAATCTTCTCTCAGTTGCGCAACTGAGAGAAGATTCC0.029400.003600.517200.500001.000001.00000


Target Position: 1832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832CUUUCUCUACAGCUUUUCA87.6621311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1830-1852TACTTTCTCTACAGCTTTTCATGUGAAAAGCUGUAGAGAAAGUACUUUCUCUACAGCUUUUCAUGU21.019.101


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096UAGUGUGUUCCAUUUAAAA87.414320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822114TAGTGTGTTCCATTTAAAATTTTAAATGGAACACACTA0.304800.015600.672400.500001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806AGUUUUAUGAAUGGACUUU73.00711404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551824AGTTTTATGAATGGACTTTAAAGTCCATTCATAAAACT0.049400.005800.706900.750001.000001.00000


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663AAAAAUGCCAUUUUAAAAA79.2917860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352681AAAAATGCCATTTTAAAAATTTTTAAAATGGCATTTTT0.126100.093700.500000.500001.000001.00000


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917AUUCCCUCUUGGCAGCUAA77.9706975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711935ATTCCCTCTTGGCAGCTAATTAGCTGCCAAGAGGGAAT0.020000.010900.474100.500000.940200.87500


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CUGCCUCAUUCUAAAAUUU82.125648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153860CTGCCTCATTCTAAAATTTAAATTTTAGAATGAGGCAG0.926400.293900.784500.750001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570CCUCCUCUAUUCUCUAAAU89.5618218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1102588CCTCCTCTATTCTCTAAATATTTAGAGAATAGAGGAGG0.676700.279400.836201.000001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UGUAAAGUUACCUGCUGUU73.56021355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741443TGTAAAGTTACCTGCTGTTAACAGCAGGTAACTTTACA0.019500.010300.560300.750001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010AGGGAGUUAUCUGUUUUCA81.5186710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621028AGGGAGTTATCTGTTTTCATGAAAACAGATAACTCCCT0.023500.002200.620700.500001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564GCAACCAACACAUCCUAUC68.10831795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736582GCAACCAACACATCCTATCGATAGGATGTGTTGGTTGC0.078600.059400.672400.750001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816AUGGACUUUUCAACUACUU70.09471620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591834ATGGACTTTTCAACTACTTAAGTAGTTGAAAAGTCCAT0.157000.035900.517200.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881UAAAGGAAAUUGUACAUUU81.4264716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181899TAAAGGAAATTGTACATTTAAATGTACAATTTCCTTTA0.286500.036800.534500.500001.000001.00000


Target Position: 54, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
54UGCUUCUAGGAGAUAAAAA82.2009639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31472TGCTTCTAGGAGATAAAAATTTTTATCTCCTAGAAGCA0.553300.067000.853400.750001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077GAUUGAUUAGAAAAAAAUG82.4263623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222095GATTGATTAGAAAAAAATGCATTTTTTTCTAATCAATC0.255200.044100.525900.500001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955AUUUCCCAUGUGGUUUUUA71.11811545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954973ATTTCCCATGTGGTTTTTATAAAAACCACATGGGAAAT0.251900.004300.474100.500000.956501.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UCUUUCUUCCUCCUCUAUU67.21681863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852580TCTTTCTTCCTCCTCTATTAATAGAGGAGGAAGAAAGA0.430400.409600.715500.750001.000001.00000


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213UCUCUCAGUUGCUUAUAAA87.3559327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808231TCTCTCAGTTGCTTATAAATTTATAAGCAACTGAGAGA0.160500.005300.724100.750001.000001.00000


Target Position: 2206, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206CAAAUCACUUUUUGGUUUU75.60171166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2204-2226TCCAAATCACTTTTTGGTTTTTAAAAACCAAAAAGUGAUUUGGACAAAUCACUUUUUGGUUUUUAU18.814.802


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500CUAAGAACAAAUGUAAAAG71.11931544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9191518CTAAGAACAAATGTAAAAGCTTTTACATTTGTTCTTAG0.349700.097200.534500.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CCACAAAUAGUUUUUUGUU82.5195618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
890-912TCCCACAAATAGTTTTTTGTTTAAACAAAAAACUAUUUGUGGGACCACAAAUAGUUUUUUGUUUAU5.612.102


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415GCUUCCUUUGCUUGCAUCC58.81072369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352433GCTTCCTTTGCTTGCATCCGGATGCAAGCAAAGGAAGC0.163200.046500.482800.500001.000001.00000


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239UACUCUUAUAGCCUGCCUU71.35131528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642257TACTCTTATAGCCTGCCTTAAGGCAGGCTATAAGAGTA0.208500.132300.543100.500001.000001.00000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450AGGAGAUUACUACCGUUAC70.13951614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
902468AGGAGATTACTACCGTTACGTAACGGTAGTAATCTCCT0.172300.016600.663800.500000.923900.62500


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495GCAACCUAAGAACAAAUGU73.81191327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721513GCAACCTAAGAACAAATGTACATTTGTTCTTAGGTTGC0.232700.041000.646600.750001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672UGAUGAAGCCAUUGCUGAA91.9119131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919690TGATGAAGCCATTGCTGAATTCAGCAATGGCTTCATCA0.035000.003300.551700.750000.923900.87500


Target Position: 913, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913CGAUUUAUGACAGGUUUAU81.0674730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803931CGATTTATGACAGGTTTATATAAACCTGTCATAAATCG0.060500.014700.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
911-933TACGATTTATGACAGGTTTATGTAUAAACCUGUCAUAAAUCGUACGAUUUAUGACAGGUUUAUGUU18.61.813


Target Position: 2211, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211CACUUUUUGGUUUUUAAGA80.051798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192229CACTTTTTGGTTTTTAAGATCTTAAAAACCAAAAAGTG0.079200.002300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2209-2231ATCACTTTTTGGTTTTTAAGAATUCUUAAAAACCAAAAAGUGAUCACUUUUUGGUUUUUAAGAAUU-3.83.202


Target Position: 1013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013GAGUUAUCUGUUUUCAUCU87.4093321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1011-1033GGGAGTTATCTGTTTTCATCTTGAGAUGAAAACAGAUAACUCCCGAGUUAUCUGUUUUCAUCUUGU16.314.512


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203GGUUCCAGUCACAGGUGUA96.427440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841221GGTTCCAGTCACAGGTGTATACACCTGTGACTGGAACC0.385500.048400.672401.000000.972801.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461CUGCAGCAAAUCUCUCCUU75.50061176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172479CTGCAGCAAATCTCTCCTTAAGGAGAGATTTGCTGCAG0.112800.037400.646600.750000.983700.75000


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982CUACUAAUAUAACUACUGU88.3645270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732000CTACTAATATAACTACTGTACAGTAGTTATATTAGTAG0.474300.440900.465500.500001.000001.00000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751UGCCUAGUACACUGUAAAU81.4784711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122769TGCCTAGTACACTGTAAATATTTACAGTGTACTAGGCA0.204200.002400.844800.750001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UCCAUUAUUUGUAAAGUUA81.818687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021434TCCATTATTTGTAAAGTTATAACTTTACAAATAATGGA0.087000.074500.836200.750001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179UAGCAUUAACUGUAAGUUU78.316944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832197TAGCATTAACTGTAAGTTTAAACTTACAGTTAATGCTA0.052300.012600.672400.500000.989100.62500


Target Position: 2062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062UCUGGGAGAGGGGGGGAUU54.97842535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562080TCTGGGAGAGGGGGGGATTAATCCCCCCCTCTCCCAGA0.148000.021900.715500.750001.000001.00000


Target Position: 2655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CACCAAACAAAAAUGCCAU80.8148747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832673CACCAAACAAAAATGCCATATGGCATTTTTGTTTGGTG0.173900.130200.637900.750000.962000.75000


Target Position: 2008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2008UCCCAUGAUCCCCUCUCUU64.99262024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1842026TCCCATGATCCCCTCTCTTAAGAGAGGGGATCATGGGA0.810900.157900.732800.750001.000001.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398GGCAGAAACGGUUCACAUU87.055341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411416GGCAGAAACGGTTCACATTAATGTGAACCGTTTCTGCC0.189600.004300.991401.000001.000001.00000


Target Position: 840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
840GUCUGCCUCAUUCUAAAAU75.79621150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350858GTCTGCCTCATTCTAAAATATTTTAGAATGAGGCAGAC0.936400.283600.810300.750001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411CACAUUCCAUUAUUUGUAA93.127298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101429CACATTCCATTATTTGTAATTACAAATAATGGAATGTG0.198200.198100.758600.750001.000001.00000


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GAUUUAUGACAGGUUUAUG80.67753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917932GATTTATGACAGGTTTATGCATAAACCTGTCATAAATC0.035300.011100.525900.500001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UCAGUUGCUUAUAAAAAUG65.58111988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701235TCAGTTGCTTATAAAAATGCATTTTTATAAGCAACTGA0.166600.043500.569000.500001.000001.00000


Target Position: 269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
269UCUCAAGUAUUGAACAAAA88.1823280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525287TCTCAAGTATTGAACAAAATTTTGTTCAATACTTGAGA0.181100.025400.724100.750000.978300.62500


Target Position: 2442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442AUUUCCCUCAUCCUAUUUA76.60741094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622460ATTTCCCTCATCCTATTTATAAATAGGATGAGGGAAAT0.714000.661900.474100.500001.000001.00000


Target Position: 2388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388GGCUCCACUCAGUGUCUAA98.083525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932406GGCTCCACTCAGTGTCTAATTAGACACTGAGTGGAGCC0.012800.003700.965501.000000.972801.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265GAUCCUUUAUUCUUUCUAU96.023843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532283GATCCTTTATTCTTTCTATATAGAAAGAATAAAGGATC0.474600.337500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2263-2285TTGATCCTTTATTCTTTCTATTTAUAGAAAGAAUAAAGGAUCAAGAUCCUUUAUUCUUUCUAUUUU11.718.701


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719AGCAGGGACAAUGUUUUCU66.52571920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472737AGCAGGGACAATGTTTTCTAGAAAACATTGTCCCTGCT0.117600.009400.629300.500001.000001.00000


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559UCCUCUUUCUUCCUCCUCU68.15061790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372577TCCTCTTTCTTCCTCCTCTAGAGGAGGAAGAAAGAGGA0.456700.444100.646600.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681AAUAGUUAACAGGGAAAUA85.981402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781699AATAGTTAACAGGGAAATATATTTCCCTGTTAACTATT0.120300.023800.465500.500001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076GGAUUGAUUAGAAAAAAAU90.5184185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292094GGATTGATTAGAAAAAAATATTTTTTTCTAATCAATCC0.285600.041000.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2074-2096GGGGATTGATTAGAAAAAAATGTAUUUUUUUCUAAUCAAUCCCCGGAUUGAUUAGAAAAAAAUGUU-11.316.212


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CCAUGUGGUUUUUAUGUUU85.3782435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357978CCATGTGGTTTTTATGTTTAAACATAAAAACCACATGG0.478000.055700.844801.000001.000001.00000


Target Position: 2267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2267UCCUUUAUUCUUUCUAUUU71.23151536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3852285TCCTTTATTCTTTCTATTTAAATAGAAAGAATAAAGGA0.468200.301000.870700.750001.000001.00000


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UCUGUGUUCUAUUAUGAGA80.3994773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916625TCTGTGTTCTATTATGAGATCTCATAATAGAACACAGA0.465100.002300.500000.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UAUUUCCCAUGUGGUUUUU61.34462247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948972TATTTCCCATGTGGTTTTTAAAAACCACATGGGAAATA0.071600.004700.543100.500000.956501.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373GUACUGUCUCUUUUGGAAA89.48221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
403391GTACTGTCTCTTTTGGAAATTTCCAAAAGAGACAGTAC0.272000.065600.681000.750001.000001.00000


Target Position: 1876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1876UUCUCUAAAGGAAAUUGUA79.5371843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721894TTCTCTAAAGGAAATTGTATACAATTTCCTTTAGAGAA0.097200.015800.491400.500001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529UACCAAGAAGCUUUUGAAA79.8242818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814547TACCAAGAAGCTTTTGAAATTTCAAAAGCTTCTTGGTA0.057100.013600.681000.500000.978300.62500


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770AGAACACGUGUAUUAAAUU85.1582448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211788AGAACACGTGTATTAAATTAATTTAATACACGTGTTCT0.567800.026200.715500.750001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720AGACAGCACGCUAAUAAUG71.82261499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882738AGACAGCACGCTAATAATGCATTATTAGCGTGCTGTCT0.045400.008400.569000.500001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858UUUACACAGUAGACCAUUU75.57431169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831876TTTACACAGTAGACCATTTAAATGGTCTACTGTGTAAA0.094000.004500.500000.500001.000001.00000


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336GAAAAUUGAGACGGAGCUA88.1542283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980354GAAAATTGAGACGGAGCTATAGCTCCGTCTCAATTTTC0.017100.005300.500000.750001.000001.00000


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610CCAAAGCUCACUUUACAAA88.3643271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1542628CCAAAGCTCACTTTACAAATTTGTAAAGTGAGCTTTGG0.505300.237800.844801.000000.962000.62500


Target Position: 923, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923CAGGUUUAUGUUACUUCUA90.6318181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553941CAGGTTTATGTTACTTCTATAGAAGTAACATAAACCTG0.153300.064300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
921-943GACAGGTTTATGTTACTTCTATTUAGAAGUAACAUAAACCUGUCCAGGUUUAUGUUACUUCUAUUU18.918.612


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080UGAUUAGAAAAAAAUGUAG69.46931673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402098TGATTAGAAAAAAATGTAGCTACATTTTTTTCTAATCA0.135800.044400.551700.500001.000001.00000


Target Position: 939, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939CUAUUUGAAUUUCUAUAUU85.0682457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529957CTATTTGAATTTCTATATTAATATAGAAATTCAAATAG0.137600.050700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
937-959TTCTATTTGAATTTCTATATTTCAAUAUAGAAAUUCAAAUAGAACUAUUUGAAUUUCUAUAUUUCU8.28.912


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UGGAAUUUUUAUACAAGUU75.8981141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591072TGGAATTTTTATACAAGTTAACTTGTATAAAAATTCCA0.071500.021500.698300.750001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GGAUUGUCGAUCAGUCACA92.452119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905521GGATTGTCGATCAGTCACATGTGACTGATCGACAATCC0.071300.002600.663800.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894ACAUUUUUUGAAAUUUAUU74.75871248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131912ACATTTTTTGAAATTTATTAATAAATTTCAAAAAATGT0.242900.127800.698300.750001.000001.00000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023UCUUCCUCCCCACCCUGAA67.28631858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822041TCTTCCTCCCCACCCTGAATTCAGGGTGGGGAGGAAGA0.372200.399500.551700.750001.000001.00000


Target Position: 2241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2241CUCUUAUAGCCUGCCUUCA77.8633985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472259CTCTTATAGCCTGCCTTCATGAAGGCAGGCTATAAGAG0.341200.126400.586200.500001.000001.00000


Target Position: 2656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656ACCAAACAAAAAUGCCAUU67.84021822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762674ACCAAACAAAAATGCCATTAATGGCATTTTTGTTTGGT0.160900.171300.844800.750000.962000.87500


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771GAACACGUGUAUUAAAUUC76.61161093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751789GAACACGTGTATTAAATTCGAATTTAATACACGTGTTC0.135200.019000.500000.500001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624ACAAAAUAUUUCCUCAGUA89.8811201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762642ACAAAATATTTCCTCAGTATACTGAGGAAATATTTTGT0.126600.111500.525900.750001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458ACUACCGUUACUUGGCUGA68.12681793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992476ACTACCGTTACTTGGCTGATCAGCCAAGTAACGGTAGT0.012800.003800.482800.500000.902200.75000


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499AUCUCCCUUUAAAACCCUA77.34841028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132517ATCTCCCTTTAAAACCCTATAGGGTTTTAAAGGGAGAT0.565200.435400.508600.500001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937UUCUAUUUGAAUUUCUAUA77.45321019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958955TTCTATTTGAATTTCTATATATAGAAATTCAAATAGAA0.151100.065100.629300.500001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319ACUCAAUGUGUACACCUUU78.483927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451337ACTCAATGTGTACACCTTTAAAGGTGTACACATTGAGT0.120500.009700.706900.750001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CCAUGCUGUCCCACAAAUA91.1895159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847900CCATGCTGTCCCACAAATATATTTGTGGGACAGCATGG0.103700.004200.801701.000000.967400.75000


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390AAAGUUCUUGAUCCCCAAU73.26461382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912408AAAGTTCTTGATCCCCAATATTGGGGATCAAGAACTTT0.049300.008500.491400.500001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CAGCAAAUCUCUCCUUAGU82.0888652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132482CAGCAAATCTCTCCTTAGTACTAAGGAGAGATTTGCTG0.197800.043100.577600.500001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178GUAGCAUUAACUGUAAGUU80.8292744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072196GTAGCATTAACTGTAAGTTAACTTACAGTTAATGCTAC0.059000.014700.534500.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2176-2198GGGTAGCATTAACTGTAAGTTTTAACUUACAGUUAAUGCUACCCGUAGCAUUAACUGUAAGUUUUU19.019.703


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828ACUACUUUCUCUACAGCUU78.4477931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651846ACTACTTTCTCTACAGCTTAAGCTGTAGAGAAAGTAGT0.136100.015000.569000.750000.940200.62500


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466GCAAAUCUCUCCUUAGUUG78.5197923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762484GCAAATCTCTCCTTAGTTGCAACTAAGGAGAGATTTGC0.126400.014300.706900.750001.000001.00000


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788ACGAAGCUGAAGCAGGAGA70.80151562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
784806ACGAAGCTGAAGCAGGAGATCTCCTGCTTCAGCTTCGT0.063700.011500.551700.500001.000001.00000


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674UUUAAAAAAGGUGUAUUUU63.47522125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102692TTTAAAAAAGGTGTATTTTAAAATACACCTTTTTTAAA0.183900.003300.500000.500001.000001.00000


Target Position: 49, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
49AACCUUGCUUCUAGGAGAU75.75781152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96967AACCTTGCTTCTAGGAGATATCTCCTAGAAGCAAGGTT0.165100.024100.465500.500000.967400.75000


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308CCUGUUUUAGCCUUCUGUC67.92451811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452326CCTGTTTTAGCCTTCTGTCGACAGAAGGCTAAAACAGG0.236900.156600.525900.750001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693GGAAAUAACUUGAGAUGAU95.547852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441711GGAAATAACTTGAGATGATATCATCTCAAGTTATTTCC0.103900.030100.689701.000001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917UUAUGACAGGUUUAUGUUA82.6256612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856935TTATGACAGGTTTATGTTATAACATAAACCTGTCATAA0.158600.006100.500000.500001.000001.00000


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222UGCUUAUAAAAAUGUUGUA82.1524645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655240TGCTTATAAAAATGTTGTATACAACATTTTTATAAGCA0.100100.021800.672400.750001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995UACUGUUUCCAUGUCCCAU71.97121488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512013TACTGTTTCCATGTCCCATATGGGACATGGAAACAGTA0.117600.052900.525900.500000.994600.62500


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394UUCUUGAUCCCCAAUGCUU65.36622002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985412TTCTTGATCCCCAATGCTTAAGCATTGGGGATCAAGAA0.015700.003600.534500.500001.000001.00000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061UUCUGGGAGAGGGGGGGAU48.53962709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992079TTCTGGGAGAGGGGGGGATATCCCCCCCTCTCCCAGAA0.072500.010700.491400.500001.000001.00000


Target Position: 2662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662CAAAAAUGCCAUUUUAAAA93.484393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732680CAAAAATGCCATTTTAAAATTTTAAAATGGCATTTTTG0.125900.104100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2660-2682AACAAAAATGCCATTTTAAAAAAUUUUAAAAUGGCAUUUUUGUUCAAAAAUGCCAUUUUAAAAAAU-9.1-3.301


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703AGUGAAGAGUCAUACAAAG79.7863822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754721AGTGAAGAGTCATACAAAGCTTTGTATGACTCTTCACT0.127600.011500.569000.500001.000001.00000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851UGUAAAUUAGUCUUGGUUC64.47162048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251869TGTAAATTAGTCTTGGTTCGAACCAAGACTAATTTACA0.117300.018800.534500.500001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939GCUCUUACCAAGUUUAAAC74.03761307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301957GCTCTTACCAAGTTTAAACGTTTAAACTTGGTAAGAGC0.186000.044800.706900.750001.000001.00000


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258CAAUUUUGAUCCUUUAUUC79.3032859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552276CAATTTTGATCCTTTATTCGAATAAAGGATCAAAATTG0.670100.212900.474100.500001.000001.00000


Target Position: 1445, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GCUUUCAUUAUUUUUGCUA83.2142571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171463GCTTTCATTATTTTTGCTATAGCAAAAATAATGAAAGC0.251400.043500.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1443-1465TAGCTTTCATTATTTTTGCTACAUAGCAAAAAUAAUGAAAGCUAGCUUUCAUUAUUUUUGCUACAU18.612.012


Target Position: 2253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2253GCCUUCAAUUUUGAUCCUU72.79661432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3432271GCCTTCAATTTTGATCCTTAAGGATCAAAATTGAAGGC0.252500.173500.862101.000001.000001.00000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183AGCUGAAUUAUCCAAUGAG75.35291190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931201AGCTGAATTATCCAATGAGCTCATTGGATAATTCAGCT0.038300.002100.543100.500001.000001.00000


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038UGAAAAAAAUGAGUUCCUA84.2611509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332056TGAAAAAAATGAGTTCCTATAGGAACTCATTTTTTTCA0.078800.015100.551700.750001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219AGUUGCUUAUAAAAAUGUU81.8527679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661237AGTTGCTTATAAAAATGTTAACATTTTTATAAGCAACT0.136000.015200.560300.750001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074GGGGAUUGAUUAGAAAAAA92.555115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452092GGGGATTGATTAGAAAAAATTTTTTCTAATCAATCCCC0.345400.057700.991401.000001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055GGAAUUUUUAUACAAGUUA90.9852166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481073GGAATTTTTATACAAGTTATAACTTGTATAAAAATTCC0.072900.030900.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1053-1075GTGGAATTTTTATACAAGTTATAUAACUUGUAUAAAAAUUCCACGGAAUUUUUAUACAAGUUAUAU17.80.412


Target Position: 1956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956ACACAAAAUUUAUCAUAAC74.79311241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981974ACACAAAATTTATCATAACGTTATGATAAATTTTGTGT0.882600.750900.560300.500001.000001.00000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561CUCUUUCUUCCUCCUCUAU77.7759993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782579CTCTTTCTTCCTCCTCTATATAGAGGAGGAAGAAAGAG0.443600.427100.767200.750001.000001.00000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205AGGAAUCUUCUCUCAGUUG71.15911540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956223AGGAATCTTCTCTCAGTTGCAACTGAGAGAAGATTCCT0.098000.015900.698300.500001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792GUAAGUGGAAUAAAAGUUU80.3928774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9241810GTAAGTGGAATAAAAGTTTAAACTTTTATTCCACTTAC0.033000.016900.681000.750001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669AUGUGCUGUAAAAAUAGUU72.73931434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881687ATGTGCTGTAAAAATAGTTAACTATTTTTACAGCACAT0.118200.003100.508600.500001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CAGCUUUUCAUGUAAAUUA93.1054100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141859CAGCTTTTCATGTAAATTATAATTTACATGAAAAGCTG0.035900.015500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1839-1861TACAGCTTTTCATGTAAATTAGTUAAUUUACAUGAAAAGCUGUACAGCUUUUCAUGUAAAUUAGUU-0.317.002


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944UACCAAGUUUAAACACAAA86.252387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201962TACCAAGTTTAAACACAAATTTGTGTTTAAACTTGGTA0.806400.089400.681000.500001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441GAAAAUGAAAGGAGAUUAC75.6951158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922459GAAAATGAAAGGAGATTACGTAATCTCCTTTCATTTTC0.043600.015300.491400.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546CCUUUAAAAUCCUUCCUCU84.6065480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352564CCTTTAAAATCCTTCCTCTAGAGGAAGGATTTTAAAGG0.895300.577400.620700.750001.000001.00000


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983UACUAAUAUAACUACUGUU83.0376584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102001TACTAATATAACTACTGTTAACAGTAGTTATATTAGTA0.476600.437400.534500.500001.000001.00000


Target Position: 526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
526GCAUACCAAGAAGCUUUUG63.6662107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963544GCATACCAAGAAGCTTTTGCAAAAGCTTCTTGGTATGC0.023000.010100.706900.750000.978301.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568UCAAGCACAGCAGUAAAAC55.38882519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631586TCAAGCACAGCAGTAAAACGTTTTACTGCTGTGCTTGA0.271700.009100.577600.500001.000001.00000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CCAGUCAUGGAUAAAAAUG69.86841635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99897CCAGTCATGGATAAAAATGCATTTTTATCCATGACTGG0.073900.001000.689700.750000.989100.62500


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572UCCUCUAUUCUCUAAAUAA90.7971174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392590TCCTCTATTCTCTAAATAATTATTTAGAGAATAGAGGA0.543700.277600.836200.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CAUUUAGGGAGUUAUCUGU81.8646677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1003-1025AACATTTAGGGAGTTATCTGTTTACAGAUAACUCCCUAAAUGUUCAUUUAGGGAGUUAUCUGUUUU13.410.912


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177GGUAGCAUUAACUGUAAGU80.9521735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452195GGTAGCATTAACTGTAAGTACTTACAGTTAATGCTACC0.073800.019100.646600.750000.989100.87500


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GGGAAUAAAAGGGAUCAUU80.484768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061202GGGAATAAAAGGGATCATTAATGATCCCTTTTATTCCC0.085900.059100.982801.000001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991GUAGAGCCAGUUAACAUUU80.9286736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121009GTAGAGCCAGTTAACATTTAAATGTTAACTGGCTCTAC0.197700.088900.681000.750001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759GACAUUGUGGACAUCGGAU84.7647474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921777GACATTGTGGACATCGGATATCCGATGTCCACAATGTC0.050100.002300.637900.750001.000001.00000


Target Position: 527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527CAUACCAAGAAGCUUUUGA80.8239746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
525-547AGCATACCAAGAAGCTTTTGAAAUCAAAAGCUUCUUGGUAUGCUCAUACCAAGAAGCUUUUGAAAU18.620.003


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GGAAAUGCAACCAACACAU85.6502426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390576GGAAATGCAACCAACACATATGTGTTGGTTGCATTTCC0.275800.047800.715501.000000.934800.75000


Target Position: 1056, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056GAAUUUUUAUACAAGUUAU95.766347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281074GAATTTTTATACAAGTTATATAACTTGTATAAAAATTC0.079700.031600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1054-1076TGGAATTTTTATACAAGTTATAAAUAACUUGUAUAAAAAUUCCAGAAUUUUUAUACAAGUUAUAAU11.8-12.012


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962AAUUUAUCAUAACAAAAAU85.3383439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811980AATTTATCATAACAAAAATATTTTTGTTATGATAAATT0.845500.744800.500000.500001.000001.00000


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555UCCUUCCUCUUUCUUCCUC50.25622676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262573TCCTTCCTCTTTCTTCCTCGAGGAAGAAAGAGGAAGGA0.558200.540500.560300.500001.000001.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575UCUAUUCUCUAAAUAAUGA81.698695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692593TCTATTCTCTAAATAATGATCATTATTTAGAGAATAGA0.225000.184200.500000.500001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871CCAUUUGUCAUCCAUGCUG68.03221801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763889CCATTTGTCATCCATGCTGCAGCATGGATGACAAATGG0.071100.038200.560300.750001.000001.00000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523CCUGAAUGGUCUGUCAUUG72.40871457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772541CCTGAATGGTCTGTCATTGCAATGACAGACCATTCAGG0.376700.014300.698300.750000.983700.62500


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524CUGAAUGGUCUGUCAUUGU77.65851001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832542CTGAATGGTCTGTCATTGTACAATGACAGACCATTCAG0.387900.015400.577600.500000.983700.62500


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551GCAAAAAGGAAAUGCAACC63.55732118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836569GCAAAAAGGAAATGCAACCGGTTGCATTTCCTTTTTGC0.128500.007000.500000.500000.967400.75000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614UCUAUUAUGAGAUUCUGAA83.7681530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701632TCTATTATGAGATTCTGAATTCAGAATCTCATAATAGA0.151800.012500.551700.750001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436CUGCUGUUAGCUUUCAUUA87.194333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811454CTGCTGTTAGCTTTCATTATAATGAAAGCTAACAGCAG0.474200.001200.750000.750000.940200.75000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092AAUGUAGUGUGUUCCAUUU82.1444646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8532110AATGTAGTGTGTTCCATTTAAATGGAACACACTACATT0.049700.015700.508600.500001.000001.00000


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GAAGGAGGGGAAAAUUAAC76.08021131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862823GAAGGAGGGGAAAATTAACGTTAATTTTCCCCTCCTTC0.675300.003800.525900.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711UGGCUAGCUUUGUUUAAUG68.83011730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621729TGGCTAGCTTTGTTTAATGCATTAAACAAAGCTAGCCA0.029900.011800.689700.500001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124UGUAAAACUGCUUCCAUGU69.69451649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731142TGTAAAACTGCTTCCATGTACATGGAAGCAGTTTTACA0.046300.006800.500000.500001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344AGCUGCAGAAGUGUUCCUU70.64731578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651362AGCTGCAGAAGTGTTCCTTAAGGAACACTTCTGCAGCT0.022700.003400.715500.750000.978300.62500


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024CUUCCUCCCCACCCUGAAA79.0917884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692042CTTCCTCCCCACCCTGAAATTTCAGGGTGGGGAGGAAG0.354400.383300.637900.750001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625CAAAAUAUUUCCUCAGUAC80.5532763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682643CAAAATATTTCCTCAGTACGTACTGAGGAAATATTTTG0.116300.094900.465500.500001.000001.00000


Target Position: 2123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123UAUGGCAUUUUCUAACUUA87.0894339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962141TATGGCATTTTCTAACTTATAAGTTAGAAAATGCCATA0.101300.001000.508600.500001.000001.00000


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33ACUACGACGUCCCUCAAAC66.76581904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95051ACTACGACGTCCCTCAAACGTTTGAGGGACGTCGTAGT0.027300.004200.560300.500001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407GGUUCACAUUCCAUUAUUU95.562951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221425GGTTCACATTCCATTATTTAAATAATGGAATGTGAACC0.374900.043000.853401.000001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230GGGUACUUUAAGGUUUGGA77.8698984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831248GGGTACTTTAAGGTTTGGATCCAAACCTTAAAGTACCC0.016100.005500.620700.750001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665AUGCAUGUGCUGUAAAAAU77.8996980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361683ATGCATGTGCTGTAAAAATATTTTTACAGCACATGCAT0.056600.002100.646600.500000.956500.75000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857AUUUACACAGUAGACCAUU68.5851758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996875ATTTACACAGTAGACCATTAATGGTCTACTGTGTAAAT0.012700.004700.500000.500001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GCAUGAAGUCUGUAACUGA102.047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776176GCATGAAGTCTGTAACTGATCAGTTACAGACTTCATGC0.065800.046400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
156-178CTGCATGAAGTCTGTAACTGAGCUCAGUUACAGACUUCAUGCAGGCAUGAAGUCUGUAACUGAGCU19.018.112


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256UUCAAUUUUGAUCCUUUAU63.32852138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462274TTCAATTTTGATCCTTTATATAAAGGATCAAAATTGAA0.836600.165200.629300.500001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692GGGAAAUAACUUGAGAUGA86.3302383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461710GGGAAATAACTTGAGATGATCATCTCAAGTTATTTCCC0.103600.030800.767200.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CAAGGAGACGAAGCUGAAG72.11781480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808799CAAGGAGACGAAGCTGAAGCTTCAGCTTCGTCTCCTTG0.334600.116400.508600.500001.000001.00000


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482UUGAUGAGACUGUGUUUAU75.00041222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702500TTGATGAGACTGTGTTTATATAAACACAGTCTCATCAA0.082700.001500.603400.500001.000001.00000


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530GGUCUGUCAUUGUCUGCCU84.5268485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152548GGTCTGTCATTGTCTGCCTAGGCAGACAATGACAGACC0.445500.187700.508600.750001.000001.00000


Target Position: 1496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496CAACCUAAGAACAAAUGUA97.388731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651514CAACCTAAGAACAAATGTATACATTTGTTCTTAGGTTG0.240700.064200.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1494-1516GGCAACCTAAGAACAAATGTAAAUACAUUUGUUCUUAGGUUGCCCAACCUAAGAACAAAUGUAAAU12.118.602


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157CUGCCUACAUACUGGUUUG74.52711262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591175CTGCCTACATACTGGTTTGCAAACCAGTATGTAGGCAG0.037900.001600.637900.500000.978300.87500


Target Position: 2040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2040AAAAAAAUGAGUUCCUAUU76.84261065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052058AAAAAAATGAGTTCCTATTAATAGGAACTCATTTTTTT0.045500.009900.491400.500001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993AGAGCCAGUUAACAUUUAG74.30271280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891011AGAGCCAGTTAACATTTAGCTAAATGTTAACTGGCTCT0.141100.061900.551700.500001.000001.00000


Target Position: 1999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1999GUUUCCAUGUCCCAUGAUC68.87221726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952017GTTTCCATGTCCCATGATCGATCATGGGACATGGAAAC0.169600.076400.465500.500000.923900.87500


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413CAUUCCAUUAUUUGUAAAG71.47461519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821431CATTCCATTATTTGTAAAGCTTTACAAATAATGGAATG0.103900.105400.517200.500001.000001.00000


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409CACCCUGCUUCCUUUGCUU79.5336844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082427CACCCTGCTTCCTTTGCTTAAGCAAAGGAAGCAGGGTG0.313400.018400.655200.750000.978300.75000


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761ACUGUAAAUGCUCAAUAAA87.9545294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972779ACTGTAAATGCTCAATAAATTTATTGAGCATTTACAGT0.061000.043800.706900.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860GUCUUGGUUCUGAAACUUC71.17111538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401878GTCTTGGTTCTGAAACTTCGAAGTTTCAGAACCAAGAC0.198500.056100.646600.500001.000001.00000


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731CUUAUGAAAUUUUCAUGAA90.6742180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711749CTTATGAAATTTTCATGAATTCATGAAAATTTCATAAG0.035700.002500.465500.750000.951100.75000


Target Position: 1499, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499CCUAAGAACAAAUGUAAAA89.2088234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281517CCTAAGAACAAATGTAAAATTTTACATTTGTTCTTAGG0.476100.116000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1497-1519AACCTAAGAACAAATGTAAAAGTUUUUACAUUUGUUCUUAGGUUCCUAAGAACAAAUGUAAAAGUU6.911.702


Target Position: 366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366CAAUGAUGUACUGUCUCUU87.1276336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811384CAATGATGTACTGTCTCTTAAGAGACAGTACATCATTG0.092900.019400.508600.750001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829CUACUUUCUCUACAGCUUU79.4398848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851847CTACTTTCTCTACAGCTTTAAAGCTGTAGAGAAAGTAG0.123100.013900.672400.750000.940200.62500


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AACUUGACAUUGUGGACAU82.3257631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995772AACTTGACATTGTGGACATATGTCCACAATGTCAAGTT0.012700.003900.491400.500001.000001.00000


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580GUAAAACAAAAACCCAUGU70.11931616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471598GTAAAACAAAAACCCATGTACATGGGTTTTTGTTTTAC0.130300.098100.474100.500001.000001.00000


Target Position: 2428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428GCAUCCCACAGACUAUUUC68.98051722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982446GCATCCCACAGACTATTTCGAAATAGTCTGTGGGATGC0.582400.346900.681000.750001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841UCUGCCUCAUUCUAAAAUU72.11741481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215859TCTGCCTCATTCTAAAATTAATTTTAGAATGAGGCAGA0.933000.282500.715500.750001.000001.00000


Target Position: 50, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
50ACCUUGCUUCUAGGAGAUA76.68911085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50468ACCTTGCTTCTAGGAGATATATCTCCTAGAAGCAAGGT0.244100.029700.810300.750000.967400.62500


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427UGCAUCCCACAGACUAUUU69.74411642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3552445TGCATCCCACAGACTATTTAAATAGTCTGTGGGATGCA0.418900.210800.853400.750001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938GGCUCUUACCAAGUUUAAA92.0851127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001956GGCTCTTACCAAGTTTAAATTTAAACTTGGTAAGAGCC0.157800.030001.000001.000000.962000.62500


Target Position: 2725, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725GACAAUGUUUUCUGUAUGU82.9099589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312743GACAATGTTTTCTGTATGTACATACAGAAAACATTGTC0.262300.007800.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2723-2745GGGACAATGTTTTCTGTATGTTCACAUACAGAAAACAUUGUCCCGACAAUGUUUUCUGUAUGUUCU17.919.303


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566UAUCAAGCACAGCAGUAAA87.5188316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441584TATCAAGCACAGCAGTAAATTTACTGCTGTGCTTGATA0.516300.086800.543100.500001.000001.00000


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CUCAAUAAAUAUUGAUGAU86.8702347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552789CTCAATAAATATTGATGATATCATCAATATTTATTGAG0.025200.010500.629300.750000.918500.62500


Target Position: 593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
593UGGCCCUUAACUUCUCUGU59.91832318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973611TGGCCCTTAACTTCTCTGTACAGAGAAGTTAAGGGCCA0.109300.060700.637900.500001.000001.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36ACGACGUCCCUCAAACCUU72.66931440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95054ACGACGTCCCTCAAACCTTAAGGTTTGAGGGACGTCGT0.126800.001800.637900.750001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410ACCCUGCUUCCUUUGCUUG57.5782434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592428ACCCTGCTTCCTTTGCTTGCAAGCAAAGGAAGCAGGGT0.085100.015500.706900.500000.978300.87500


Target Position: 1053, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GUGGAAUUUUUAUACAAGU80.5579762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651071GTGGAATTTTTATACAAGTACTTGTATAAAAATTCCAC0.069700.015300.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1051-1073ATGTGGAATTTTTATACAAGTTAACUUGUAUAAAAAUUCCACAUGUGGAAUUUUUAUACAAGUUAU11.620.122


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715UAGCUUUGUUUAAUGUCUU74.52021263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821733TAGCTTTGTTTAATGTCTTAAGACATTAAACAAAGCTA0.016400.002300.534500.500001.000001.00000


Target Position: 2020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020CUCUCUUCCUCCCCACCCU69.21341701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882038CTCTCTTCCTCCCCACCCTAGGGTGGGGAGGAAGAGAG0.564800.457300.465500.500001.000001.00000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CUGUCUCUUUUGGAAAAGU73.59551349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904394CTGTCTCTTTTGGAAAAGTACTTTTCCAAAAGAGACAG0.094500.004100.577600.500000.967400.62500


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618UUUUUGCUUUUGUGAUUUU66.13321943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521636TTTTTGCTTTTGTGATTTTAAAATCACAAAAGCAAAAA0.496900.075700.500000.500001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GUAUUUAACUUUUUUUUAG77.22531040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301615GTATTTAACTTTTTTTTAGCTAAAAAAAAGTTAAATAC0.165900.082500.508600.500001.000001.00000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426UUGCAUCCCACAGACUAUU61.05762258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722444TTGCATCCCACAGACTATTAATAGTCTGTGGGATGCAA0.403900.157500.637900.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591ACCCAUGUAUUUAACUUUU75.07981215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781609ACCCATGTATTTAACTTTTAAAAGTTAAATACATGGGT0.669600.141700.853400.750001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GUUAGCUUUCAUUAUUUUU78.2969947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801459GTTAGCTTTCATTATTTTTAAAAATAATGAAAGCTAAC0.743100.006500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1439-1461CTGTTAGCTTTCATTATTTTTGCAAAAAUAAUGAAAGCUAACAGGUUAGCUUUCAUUAUUUUUGCU-9.718.312


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746UGAACAAUCCAAGCAUAAU77.9533978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081764TGAACAATCCAAGCATAATATTATGCTTGGATTGTTCA0.058900.018300.715500.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609UUUUUAGGAUUUUUGCUUU67.69841827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731627TTTTTAGGATTTTTGCTTTAAAGCAAAAATCCTAAAAA0.086900.032300.500000.500001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774CACGUGUAUUAAAUUCAUG77.8898981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951792CACGTGTATTAAATTCATGCATGAATTTAATACACGTG0.137200.024900.637900.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GAUCAGUCACAACAAGCAU89.3487227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
775529GATCAGTCACAACAAGCATATGCTTGTTGTGACTGATC0.192300.010800.525900.750001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028AUCUUGAGGUGGCCAAUAU77.01651055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801046ATCTTGAGGTGGCCAATATATATTGGCCACCTCAAGAT0.028600.003500.637900.500001.000001.00000


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935ACUUCUAUUUGAAUUUCUA92.4577118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740953ACTTCTATTTGAATTTCTATAGAAATTCAAATAGAAGT0.309400.181700.534500.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GGAGAGGGGGGGAUUGAUU79.3837853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242084GGAGAGGGGGGGATTGATTAATCAATCCCCCCCTCTCC0.110500.0