siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 309   710   711   755   819   820   873   976   991   1026   1102   1103   1334   1343   1600   1601   1604   1605   1698   1880  
1920   2176   2219   2220   2256   2312   2337   2364   2478   2558   2563   2583   2585   2586   2764   2766   2773   2814   2820   2881  
2902   2907   2929   2966   2967   3030   3032   3033   3069   3070   3076   3096   3146   3163   3165   3175   3177   3220   3221   3223  
3228   3229   3231   3256   3257   3259   3280   3281   3282   3359   3404   3405   3411   3412   3413   3448   3458   3460   3583   3613  
3637   3639   3641   3673   3733   3734   3735   3745   3746   3754   3760   3775   3813   3815   3849   3936   3938  
Biltr, Sidirect 311   325   371   376   511   533   543   548   608   611   622   624   635   644   646   676   734   749   781   872  
1028   1029   1034   1042   1053   1063   1075   1105   1147   1210   1285   1364   1365   1374   1377   1403   1404   1416   1419   1440  
1502   1504   1562   1569   1570   1822   1832   1834   1843   1858   1860   1883   1884   1889   2181   2222   2246   2299   2302   2354  
2441   2451   2482   2520   2530   2547   2609   2636   2674   2754   2757   2810   2824   2861   2872   2874   2878   2903   2910   2927  
2975   2977   2987   3013   3060   3062   3068   3077   3098   3137   3292   3295   3321   3340   3344   3347   3349   3353   3374   3381  
3384   3428   3432   3459   3469   3479   3481   3488   3490   3495   3556   3560   3566   3567   3577   3661   3674   3682   3699   3701  
3708   3725   3765   3784   3787   3788   3825   3835   3839   3842   3858   3881   3882   3885   3891   3895   3897   3902   3911  
Biltr, Ernai 670   1560  
Biltr, Ernai, Rnaxs 1457   2212   3006   3318  
Biltr, Ernai, Rnaxs, Sidirect 1694   2813  
Biltr, Ernai, Sidirect 1092   2544  
Biltr, Rnaxs 122   123   124   125   126   127   128   129   179   180   181   191   302   303   304   305   306   308   322   323  
324   327   328   329   332   369   404   405   410   411   432   509   510   512   517   518   521   630   631   632  
633   704   705   747   756   792   796   813   814   815   816   817   818   865   866   867   868   869   879   881  
892   947   959   960   961   962   965   966   967   968   969   970   971   972   975   990   1015   1017   1018   1019  
1020   1021   1022   1023   1024   1025   1027   1049   1050   1051   1099   1100   1101   1139   1182   1239   1240   1241   1242   1249  
1252   1253   1264   1314   1328   1342   1437   1438   1456   1458   1459   1460   1461   1463   1493   1523   1524   1525   1593   1594  
1595   1597   1599   1603   1637   1638   1692   1693   1697   1699   1700   1707   1708   1739   1758   1759   1760   1878   1879   1905  
1906   1914   1915   1916   1917   1919   1929   1935   1936   1939   1941   1996   2000   2007   2014   2015   2018   2019   2025   2055  
2060   2061   2064   2066   2068   2069   2070   2093   2094   2098   2125   2128   2129   2135   2136   2137   2138   2139   2140   2141  
2142   2143   2165   2171   2172   2173   2174   2175   2179   2180   2183   2184   2206   2207   2208   2211   2213   2214   2217   2218  
2235   2242   2243   2255   2277   2278   2286   2287   2288   2289   2301   2310   2311   2322   2331   2336   2340   2344   2345   2363  
2393   2396   2399   2435   2436   2475   2476   2477   2480   2481   2505   2506   2508   2557   2562   2570   2571   2572   2577   2578  
2581   2582   2584   2611   2632   2633   2634   2664   2665   2666   2669   2761   2762   2763   2765   2772   2812   2818   2819   2821  
2829   2830   2856   2858   2859   2860   2880   2887   2888   2896   2897   2899   2900   2901   2918   2953   2954   2955   2956   2957  
2958   2960   2963   2964   2965   3005   3007   3008   3009   3028   3029   3031   3075   3089   3090   3091   3092   3095   3097   3118  
3119   3120   3125   3126   3143   3144   3145   3150   3151   3162   3164   3174   3176   3218   3219   3222   3227   3230   3258   3267  
3268   3269   3273   3277   3278   3279   3306   3317   3319   3361   3369   3373   3406   3409   3417   3418   3444   3445   3446   3447  
3449   3450   3457   3494   3500   3511   3512   3520   3521   3522   3523   3524   3579   3580   3591   3633   3634   3635   3636   3638  
3640   3645   3689   3697   3723   3724   3726   3731   3732   3744   3752   3753   3759   3774   3783   3797   3798   3803   3810   3812  
3814   3816   3848   3857   3909   3930   3931   3932   3933   3934   3935   3937   3939  


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631UGAACAAAUACAUGGGAUU74.34531841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865649TGAACAAATACATGGGATTAATCCCATGTATTTGTTCA0.109100.047100.715500.750001.000001.00000


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174UCACAUUUUACAUAAAUAA84.3037770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3653192TCACATTTTACATAAATAATTATTTATGTAAAATGTGA0.692600.389800.689700.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102GCUCAAUUUAUGAAUAUUA96.725563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731120GCTCAATTTATGAATATTATAATATTCATAAATTGAGC0.090800.013800.819001.000000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1100-1122CCGCTCAATTTATGAATATTATCUAAUAUUCAUAAAUUGAGCGGGCUCAAUUUAUGAAUAUUAUCU1.812.033


Target Position: 3759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3759AGAUUUCAAUAAUUGAGUA95.798479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633777AGATTTCAATAATTGAGTATACTCAATTATTGAAATCT0.112100.030400.543100.750001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218AGCCACAAUUGCACAAUAU82.2804969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883236AGCCACAATTGCACAATATATATTGTGCAATTGTGGCT0.079500.021500.810300.750001.000001.00000


Target Position: 3699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3699CUCAAAAUACAAUGUUUGA84.0417794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3697-3719TGCTCAAAATACAATGTTTGATTUCAAACAUUGUAUUUUGAGCACUCAAAAUACAAUGUUUGAUUU12.17.422


Target Position: 3521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3521CCAGCUCAAAAGAAAACAA90.5116283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613539CCAGCTCAAAAGAAAACAATTGTTTTCTTTTGAGCTGG0.177900.024300.698301.000000.940200.62500


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858UGGCUACAAUACUGCACAA90.4113289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6092876TGGCTACAATACTGCACAATTGTGCAGTATTGTAGCCA0.339400.056600.698300.750000.956500.87500


Target Position: 3697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697UGCUCAAAAUACAAUGUUU83.3143865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803715TGCTCAAAATACAATGTTTAAACATTGTATTTTGAGCA0.081300.023000.853400.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GAUGAAAGAAUUACCGAAU86.1597625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751068GATGAAAGAATTACCGAATATTCGGTAATTCTTTCATC0.106500.058800.672400.750001.000001.00000


Target Position: 311, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311CAAGAAAAAGAUAAGUUCU85.5881660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
309-331GACAAGAAAAAGATAAGTTCTGAAGAACUUAUCUUUUUCUUGUCCAAGAAAAAGAUAAGUUCUGAU14.65.522


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594CCUCACCCAACGAAAAAUU71.44852210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1121612CCTCACCCAACGAAAAATTAATTTTTCGTTGGGTGAGG0.629900.246600.836201.000001.000001.00000


Target Position: 2173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173ACCGUAUGGAAGACAUUAA85.5202667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752191ACCGTATGGAAGACATTAATTAATGTCTTCCATACGGT0.130900.038100.819000.750001.000001.00000


Target Position: 3165, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165CCUUUUUUUUCACAUUUUA86.6033591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3683183CCTTTTTTTTCACATTTTATAAAATGTGAAAAAAAAGG0.307700.184900.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3163-3185CACCTTTTTTTTCACATTTTACAUAAAAUGUGAAAAAAAAGGUGCCUUUUUUUUCACAUUUUACAU5.3-5.912


Target Position: 3520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3520GCCAGCUCAAAAGAAAACA74.36931837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933538GCCAGCTCAAAAGAAAACATGTTTTCTTTTGAGCTGGC0.177900.022400.793100.750000.940200.62500


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143CCACUGAUGAAUUAAAAAC72.4342078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002161CCACTGATGAATTAAAAACGTTTTTAATTCATCAGTGG0.101700.029000.698300.750001.000001.00000


Target Position: 2975, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2975CUCAGUUUUUUGGUAUUUA85.3527684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2973-2995TTCTCAGTTTTTTGGTATTTAAAUAAAUACCAAAAAACUGAGAACUCAGUUUUUUGGUAUUUAAAU13.919.221


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UCCAAGAAGCCCUAACGUG59.07393346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452354TCCAAGAAGCCCTAACGTGCACGTTAGGGCTTCTTGGA0.248800.097900.577600.500000.978300.62500


Target Position: 1075, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075GAUAUGAGCCAGAAGAACU88.9142395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1073-1095GGGATATGAGCCAGAAGAACTTTAGUUCUUCUGGCUCAUAUCCCGAUAUGAGCCAGAAGAACUUUU21.513.332


Target Position: 3340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3340GGAACAUGACAUUGUUAAU94.695121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3338-3360CTGGAACATGACATTGTTAATCAAUUAACAAUGUCAUGUUCCAGGGAACAUGACAUUGUUAAUCAU7.220.522


Target Position: 2214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214CCUACCCACAUACAUAAAG66.46092738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922232CCTACCCACATACATAAAGCTTTATGTATGTGGGTAGG0.750500.657000.706900.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CUUUUAGGCCGCUCAAUUU79.01041327

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4109219CTTTTAGGCCGCTCAATTT1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62199170..62199188(+)00HIF1A(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1090-1112AACTTTTAGGCCGCTCAATTTATAAAUUGAGCGGCCUAAAAGUUCUUUUAGGCCGCUCAAUUUAUU12.011.033


Target Position: 2888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888UCAAUUUUUGAUCCCCUUU62.15533116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5112906TCAATTTTTGATCCCCTTTAAAGGGGATCAAAAATTGA0.503500.204000.724100.750001.000001.00000


Target Position: 608, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608CAUGAUUUACAUUUCUGAU90.1852302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
606-628GACATGATTTACATTTCTGATAAAUCAGAAAUGUAAAUCAUGUCCAUGAUUUACAUUUCUGAUAAU20.47.222


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303GCGAACGACAAGAAAAAGA79.08591314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
746321GCGAACGACAAGAAAAAGATCTTTTTCTTGTCGTTCGC0.437600.081100.698300.750001.000001.00000


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916AGAAGCAAAGAACCCAUUU72.3142108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551934AGAAGCAAAGAACCCATTTAAATGGGTTCTTTGCTTCT0.452800.072000.724100.750000.983700.75000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018UCAGUUGUCACCAUUAGAA82.3647962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392036TCAGTTGTCACCATTAGAATTCTAATGGTGACAACTGA0.494300.131300.551700.750000.972800.75000


Target Position: 3524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3524GCUCAAAAGAAAACAAUAC74.26691846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6153542GCTCAAAAGAAAACAATACGTATTGTTTTCTTTTGAGC0.406300.041500.672400.750001.000001.00000


Target Position: 2055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055GAAAGCGCAAGUCCUCAAA83.8043815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562073GAAAGCGCAAGTCCTCAAATTTGAGGACTTGCGCTTTC0.199900.014700.672400.750000.994600.62500


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009GUAGCAUCAUUUUAAAAAA96.457567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183027GTAGCATCATTTTAAAAAATTTTTTAAAATGATGCTAC0.120400.039600.681000.750001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364GCUUUGAGUCAAAGAACUA95.377595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722382GCTTTGAGTCAAAGAACTATAGTTCTTTGACTCAAAGC0.123200.018100.681001.000000.940200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2362-2384TCGCTTTGAGTCAAAGAACTACAUAGUUCUUUGACUCAAAGCGAGCUUUGAGUCAAAGAACUACAU17.716.633


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249CUGUCAUAUAUAACACCAA94.358131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6551267CTGTCATATATAACACCAATTGGTGTTATATATGACAG0.748800.311800.637900.750000.923900.62500


Target Position: 2141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141CACCACUGAUGAAUUAAAA93.868148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982159CACCACTGATGAATTAAAATTTTAATTCATCAGTGGTG0.492300.098700.793100.750001.000001.00000


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306GAAAUUUUUUUUGGCCUAU76.11311660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333324GAAATTTTTTTTGGCCTATATAGGCCAAAAAAAATTTC0.094500.021400.629300.750001.000001.00000


Target Position: 3784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3784GAAGCAUUAUUUUAGGAAU91.8284226

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3782-3804TAGAAGCATTATTTTAGGAATATAUUCCUAAAAUAAUGCUUCUAGAAGCAUUAUUUUAGGAAUAUU19.918.512


Target Position: 711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711GAAAUGAGAGAAAUGCUUA97.48350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786729GAAATGAGAGAAATGCTTATAAGCATTTCTCTCATTTC0.128300.031000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
709-731AGGAAATGAGAGAAATGCTTACAUAAGCAUUUCUCUCAUUUCCUGAAAUGAGAGAAAUGCUUACAU18.512.023


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867ACAGGCCACAUUCACGUAU69.37562458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
714885ACAGGCCACATTCACGTATATACGTGAATGTGGCCTGT0.493900.028800.663800.750001.000001.00000


Target Position: 376, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376GUAAAGAAUCUGAAGUUUU84.6486739

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
374-396AAGTAAAGAATCTGAAGTTTTTTAAAACUUCAGAUUCUUUACUUGUAAAGAAUCUGAAGUUUUUUU13.37.122


Target Position: 3075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3075UCGAAUUAUUUUUAAGAAG62.94053053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613093TCGAATTATTTTTAAGAAGCTTCTTAAAAATAATTCGA0.234600.043900.655200.500001.000001.00000


Target Position: 3317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317UGGCCUAUGAAAUUGUUAA83.0386885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4273335TGGCCTATGAAATTGTTAATTAACAATTTCATAGGCCA0.262500.102400.810300.750001.000001.00000


Target Position: 3374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3374CUUAAAUGCUGUAUGGUUU82.1136983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3372-3394TTCTTAAATGCTGTATGGTTTATAAACCAUACAGCAUUUAAGAACUUAAAUGCUGUAUGGUUUAUU20.0-1.422


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632GAACAAAUACAUGGGAUUA94.2865135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890650GAACAAATACATGGGATTATAATCCCATGTATTTGTTC0.103300.059700.637900.750001.000001.00000


Target Position: 3282, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3282GUUUAUAAAACUAGUUUUU79.07391318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053300GTTTATAAAACTAGTTTTTAAAAACTAGTTTTATAAAC0.123400.072800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3280-3302GCGTTTATAAAACTAGTTTTTAAAAAAACUAGUUUUAUAAACGCGUUUAUAAAACUAGUUUUUAAU4.9-7.522


Target Position: 3006, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006GCAGUAGCAUCAUUUUAAA98.5840

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3300619GCAGTAGCATCATTTTAAA1/1/0/0100.00HIF1ANM_181054.2+NM_001530.31+1NANANA14:62214043..62214061(+)00HIF1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1883024GCAGTAGCATCATTTTAAATTTAAAATGATGCTACTGC0.602000.150700.853401.000001.000001.00000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363CGCUUUGAGUCAAAGAACU80.93061105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372381CGCTTTGAGTCAAAGAACTAGTTCTTTGACTCAAAGCG0.121400.015400.715500.750000.940200.75000


Target Position: 1920, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GCAAAGAACCCAUUUUCUA91.1184258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401938GCAAAGAACCCATTTTCTATAGAAAATGGGTTCTTTGC0.232100.026200.681001.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1918-1940AAGCAAAGAACCCATTTTCTACTUAGAAAAUGGGUUCUUUGCUUGCAAAGAACCCAUUUUCUACUU5.312.223


Target Position: 3259, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259GUUACUCAUGGAAUAUAUU86.4964598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343277GTTACTCATGGAATATATTAATATATTCCATGAGTAAC0.515100.468500.637900.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3257-3279CAGTTACTCATGGAATATATTCTAAUAUAUUCCAUGAGUAACUGGUUACUCAUGGAAUAUAUUCUU-8.620.323


Target Position: 1889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889GGUAGAAAAACUUUUUGCU82.5161946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1887-1909TTGGTAGAAAAACTTTTTGCTGAAGCAAAAAGUUUUUCUACCAAGGUAGAAAAACUUUUUGCUGAU14.114.622


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332ACGUCGAAAAGAAAAGUCU72.31382109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923350ACGTCGAAAAGAAAAGTCTAGACTTTTCTTTTCGACGT0.199800.046600.551700.500001.000001.00000


Target Position: 3060, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060GAGUUUAUCCCUUUUUCGA87.1154547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3058-3080GGGAGTTTATCCCTTTTTCGAATUCGAAAAAGGGAUAAACUCCCGAGUUUAUCCCUUUUUCGAAUU7.74.633


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697UCAAGAAGUUGCAUUAAAA91.4029246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951715TCAAGAAGTTGCATTAAAATTTTAATGCAACTTCTTGA0.653000.107200.724100.750001.000001.00000


Target Position: 2861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2861CUACAAUACUGCACAAACU87.0456556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2859-2881GGCTACAATACTGCACAAACTTGAGUUUGUGCAGUAUUGUAGCCCUACAAUACUGCACAAACUUGU19.38.532


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900CCCCUUUCUACUUAAUUUA84.8369725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872918CCCCTTTCTACTTAATTTATAAATTAAGTAGAAAGGGG0.649000.537600.956901.000001.000001.00000


Target Position: 3347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3347GACAUUGUUAAUCAUAUAA94.1878137

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3345-3367ATGACATTGTTAATCATATAATAUUAUAUGAUUAACAAUGUCAUGACAUUGUUAAUCAUAUAAUAU10.219.322


Target Position: 2288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2288ACCAAACAGAGCAGGAAAA78.68631362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6812306ACCAAACAGAGCAGGAAAATTTTCCTGCTCTGTTTGGT0.161100.051500.853400.750001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180GGAAGACAUUAAAAUAUUG86.7914580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952198GGAAGACATTAAAATATTGCAATATTTTAATGTCTTCC0.190500.055400.724100.750001.000001.00000


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219GCCACAAUUGCACAAUAUA92.9578184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093237GCCACAATTGCACAATATATATATTGTGCAATTGTGGC0.409800.021800.956901.000001.000001.00000


Target Position: 3788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3788CAUUAUUUUAGGAAUAUAU92.5296197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3786-3808AGCATTATTTTAGGAATATATAGAUAUAUUCCUAAAAUAAUGCUCAUUAUUUUAGGAAUAUAUAGU3.5-10.331


Target Position: 2211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211UCUCCUACCCACAUACAUA89.064386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3912229TCTCCTACCCACATACATATATGTATGTGGGTAGGAGA0.823100.765500.681000.750001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508GACGAUCAUGCAGCUACUA88.7563406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682526GACGATCATGCAGCTACTATAGTAGCTGCATGATCGTC0.166700.065100.646600.750001.000001.00000


Target Position: 3459, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459GCAUUUAUUUGGAUAAAAU93.0679177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3457-3479TGGCATTTATTTGGATAAAATTCAUUUUAUCCAAAUAAAUGCCAGCAUUUAUUUGGAUAAAAUUCU2.1-1.822


Target Position: 2611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611CUGAUUUAGCAUGUAGACU73.60441927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382629CTGATTTAGCATGTAGACTAGTCTACATGCTAAATCAG0.126400.015300.577600.500001.000001.00000


Target Position: 3033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033CUUUUUAUUUAUUUAUUUU83.9594801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583051CTTTTTATTTATTTATTTTAAAATAAATAAATAAAAAG0.417900.296000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3031-3053ACCTTTTTATTTATTTATTTTTGAAAAUAAAUAAAUAAAAAGGUCUUUUUAUUUAUUUAUUUUUGU-9.7-9.700


Target Position: 1419, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419GAAUCAGAAGAUACAAGUA103.8745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1417-1439TTGAATCAGAAGATACAAGTAGCUACUUGUAUCUUCUGAUUCAAGAAUCAGAAGAUACAAGUAGCU19.020.422


Target Position: 710, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710GGAAAUGAGAGAAAUGCUU82.7637914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867728GGAAATGAGAGAAATGCTTAAGCATTTCTCTCATTTCC0.108900.028300.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
708-730GAGGAAATGAGAGAAATGCTTACAAGCAUUUCUCUCAUUUCCUCGGAAAUGAGAGAAAUGCUUACU18.516.322


Target Position: 1377, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377GAAUCUUCAGAUAUGAAAA100.6525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1375-1397TTGAATCTTCAGATATGAAAATGUUUUCAUAUCUGAAGAUUCAAGAAUCUUCAGAUAUGAAAAUGU8.914.822


Target Position: 2213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2213UCCUACCCACAUACAUAAA78.00411435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292231TCCTACCCACATACATAAATTTATGTATGTGGGTAGGA0.827100.740000.870700.750001.000001.00000


Target Position: 3645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645ACAAGAAAAAAAAAAUCAU78.74751356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483663ACAAGAAAAAAAAAATCATATGATTTTTTTTTTCTTGT0.484600.288400.551700.750001.000001.00000


Target Position: 2208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208CCAUCUCCUACCCACAUAC72.29992111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5012226CCATCTCCTACCCACATACGTATGTGGGTAGGAGATGG0.830300.402500.663800.750001.000001.00000


Target Position: 3857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3857UCAUUCCUUUUGCUCUUUG57.50573438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8423875TCATTCCTTTTGCTCTTTGCAAAGAGCAAAAGGAATGA0.183700.110900.577600.500001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506CAGACGAUCAUGCAGCUAC75.0181777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812524CAGACGATCATGCAGCTACGTAGCTGCATGATCGTCTG0.120900.053700.603400.500001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707GCAUUAAAAUUAGAACCAA94.979109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221725GCATTAAAATTAGAACCAATTGGTTCTAATTTTAATGC0.438700.425800.706901.000001.000001.00000


Target Position: 371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371GCGAAGUAAAGAAUCUGAA90.3432291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
369-391CGGCGAAGTAAAGAATCTGAAGTUUCAGAUUCUUUACUUCGCCGGCGAAGUAAAGAAUCUGAAGUU20.420.932


Target Position: 2674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674GUUAUGAUUGUGAAGUUAA92.9131186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694CAGTTATGATTGTGAAGTTAATGUUAACUUCACAAUCAUAACUGGUUAUGAUUGUGAAGUUAAUGU14.68.722


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765AGCUUUUUCUUAAUUUCAU79.70241245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932783AGCTTTTTCTTAATTTCATATGAAATTAAGAAAAAGCT0.610900.189500.698300.750001.000001.00000


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966CCUCACCCAUCAAAUAUUG69.73612415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687984CCTCACCCATCAAATATTGCAATATTTGATGGGTGAGG0.158300.058700.698300.750001.000001.00000


Target Position: 3090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3090GAAGAUGCCAAUAUAAUUU86.8113577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923108GAAGATGCCAATATAATTTAAATTATATTGGCATCTTC0.257100.031300.672400.750001.000001.00000


Target Position: 511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GUGAUUUGGAUAUUGAAGA80.92131108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
509-531TGGTGATTTGGATATTGAAGATGUCUUCAAUAUCCAAAUCACCAGUGAUUUGGAUAUUGAAGAUGU12.013.821


Target Position: 1936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1936CUACUCAGGACACAGAUUU75.57331719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321954CTACTCAGGACACAGATTTAAATCTGTGTCCTGAGTAG0.337500.126100.672400.750001.000001.00000


Target Position: 3030, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030CACCUUUUUAUUUAUUUAU81.20511079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7203048CACCTTTTTATTTATTTATATAAATAAATAAAAAGGTG0.719700.514600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3028-3050TGCACCTTTTTATTTATTTATTTAUAAAUAAAUAAAAAGGUGCACACCUUUUUAUUUAUUUAUUUU-7.517.311


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015CGAUCAGUUGUCACCAUUA100.22429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3812033CGATCAGTTGTCACCATTATAATGGTGACAACTGATCG0.292100.141800.758601.000000.972801.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025CCUGGAUAUGAAAUUUUCU82.1628980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611043CCTGGATATGAAATTTTCTAGAAAATTTCATATCCAGG0.105300.014500.620700.750001.000001.00000


Target Position: 3566, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3566GCUAAUAUUGUGUAACUGA92.9445185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3564-3586ATGCTAATATTGTGTAACTGATAUCAGUUACACAAUAUUAGCAUGCUAAUAUUGUGUAACUGAUAU19.0-2.722


Target Position: 3164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3164ACCUUUUUUUUCACAUUUU72.672047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7133182ACCTTTTTTTTCACATTTTAAAATGTGAAAAAAAAGGT0.240100.164900.853400.750001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064AGUCCUCAAAGCACAGUUA88.169447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662082AGTCCTCAAAGCACAGTTATAACTGTGCTTTGAGGACT0.244900.110400.672400.750000.945700.75000


Target Position: 3774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3774AGUAAUUUUAGAAGCAUUA85.5306664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993792AGTAATTTTAGAAGCATTATAATGCTTCTAAAATTACT0.076200.022900.672400.750001.000001.00000


Target Position: 3835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3835CUAUGUACAUUGUACAAAU95.1501103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3833-3855TTCTATGTACATTGTACAAATTTAUUUGUACAAUGUACAUAGAACUAUGUACAUUGUACAAAUUUU14.715.822


Target Position: 2544, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544CGUGUAAAAGGAUGCAAAU86.4566603

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8254419CGTGTAAAAGGATGCAAAT1/1/0/097.75HIF1ANM_001530.3+NM_181054.21+0NANANA14:62212466..62212484(+)00HIF1A(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2542-2564AACGTGTAAAAGGATGCAAATCTAUUUGCAUCCUUUUACACGUUCGUGUAAAAGGAUGCAAAUCUU20.014.732


Target Position: 3412, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3412CCAUUUACAUAAUAUAGAA103.23712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4733430CCATTTACATAATATAGAATTCTATATTATGTAAATGG0.247700.085800.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3410-3432AGCCATTTACATAATATAGAAAGUUCUAUAUUAUGUAAAUGGCUCCAUUUACAUAAUAUAGAAAGU8.26.932


Target Position: 2451, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451GAACAUGAUGGUUCACUUU88.6271418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2449-2471TGGAACATGATGGTTCACTTTTTAAAGUGAACCAUCAUGUUCCAGAACAUGAUGGUUCACUUUUUU19.220.522


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241UCAAGCAACUGUCAUAUAU78.05731421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171259TCAAGCAACTGTCATATATATATATGACAGTTGCTTGA0.310600.108500.681000.750001.000001.00000


Target Position: 3641, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641GUAAACAAGAAAAAAAAAA82.8256908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6833659GTAAACAAGAAAAAAAAAATTTTTTTTTTCTTGTTTAC0.744300.503000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3639-3661CTGTAAACAAGAAAAAAAAAATCUUUUUUUUUUCUUGUUUACAGGUAAACAAGAAAAAAAAAAUCU-11.37.211


Target Position: 3013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3013CAUCAUUUUAAAAAAUGCA83.5659840

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3011-3033AGCATCATTTTAAAAAATGCACCUGCAUUUUUUAAAAUGAUGCUCAUCAUUUUAAAAAAUGCACCU14.07.222


Target Position: 3229, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229CACAAUAUAUUUUCUUAAA95.988476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6433247CACAATATATTTTCTTAAATTTAAGAAAATATATTGTG0.415800.300300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3227-3249TGCACAATATATTTTCTTAAAAAUUUAAGAAAAUAUAUUGUGCACACAAUAUAUUUUCUUAAAAAU7.16.722


Target Position: 2907, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2907CUACUUAAUUUACAUUAAU87.41513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162925CTACTTAATTTACATTAATATTAATGTAAATTAAGTAG0.407000.351100.663800.750000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2905-2927TTCTACTTAATTTACATTAATGCAUUAAUGUAAAUUAAGUAGAACUACUUAAUUUACAUUAAUGCU6.96.622


Target Position: 3935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3935CCAGGAAAAAAAAAAAAAA88.2108442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963953CCAGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCTGG0.999100.022300.844801.000001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971CCCAUCAAAUAUUGAAAUU77.63231480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287989CCCATCAAATATTGAAATTAATTTCAATATTTGATGGG0.364600.101700.982801.000001.000001.00000


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308CGACAAGAAAAAGAUAAGU77.18891532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802326CGACAAGAAAAAGATAAGTACTTATCTTTTTCTTGTCG0.172900.068100.586200.750001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961CCAUUCCUCACCCAUCAAA83.0139890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
723979CCATTCCTCACCCATCAAATTTGATGGGTGAGGAATGG0.147000.058900.844801.000001.000001.00000


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887UUCAAUUUUUGAUCCCCUU62.84853059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892905TTCAATTTTTGATCCCCTTAAGGGGATCAAAAATTGAA0.346000.188900.534500.500001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410UCAGUUGCCACUUCCACAU67.68482617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937428TCAGTTGCCACTTCCACATATGTGGAAGTGGCAACTGA0.093900.054500.569000.750000.956500.75000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817GAGGAAGAACUAUGAACAU91.7247237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665835GAGGAAGAACTATGAACATATGTTCATAGTTCTTCCTC0.615500.065500.655200.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070CAAAGCACAGUUACAGUAU84.202777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242088CAAAGCACAGTTACAGTATATACTGTAACTGTGCTTTG0.204900.016100.603400.750001.000001.00000


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881CGUAUAUGAUACCAACAGU89.7161335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848899CGTATATGATACCAACAGTACTGTTGGTATCATATACG0.151600.068800.569000.750000.983700.62500


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917GAAGCAAAGAACCCAUUUU83.9058805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181935GAAGCAAAGAACCCATTTTAAAATGGGTTCTTTGCTTC0.242600.028300.672400.750000.983700.62500


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970ACCCAUCAAAUAUUGAAAU72.84722025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290988ACCCATCAAATATTGAAATATTTCAATATTTGATGGGT0.378900.099700.844800.750001.000001.00000


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637UCCAUUACCCACCGCUGAA72.35512096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931655TCCATTACCCACCGCTGAATTCAGCGGTGGGTAATGGA0.154500.085000.698300.750001.000001.00000


Target Position: 2957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957UCACAGACAGCUCAUUUUC61.0323203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602975TCACAGACAGCTCATTTTCGAAAATGAGCTGTCTGTGA0.562200.066300.551700.500001.000001.00000


Target Position: 622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622CUGAUAAUGUGAACAAAUA95.42393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
620-642TTCTGATAATGTGAACAAATACAUAUUUGUUCACAUUAUCAGAACUGAUAAUGUGAACAAAUACAU5.38.722


Target Position: 2764, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764GAGCUUUUUCUUAAUUUCA88.6693416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332782GAGCTTTTTCTTAATTTCATGAAATTAAGAAAAAGCTC0.604000.171900.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2762-2784CTGAGCTTTTTCTTAATTTCATTUGAAAUUAAGAAAAAGCUCAGGAGCUUUUUCUUAAUUUCAUUU2.117.022


Target Position: 1440, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440CUCUUUGACAAACUUAAGA78.27761394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1438-1460GCCTCTTTGACAAACTTAAGAAGUCUUAAGUUUGUCAAAGAGGCCUCUUUGACAAACUUAAGAAGU9.820.422


Target Position: 2757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757GUUAACUGAGCUUUUUCUU74.26581847

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2755-2777AAGTTAACTGAGCTTTTTCTTAAAAGAAAAAGCUCAGUUAACUUGUUAACUGAGCUUUUUCUUAAU5.511.822


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240CUCAAGCAACUGUCAUAUA90.8967265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751258CTCAAGCAACTGTCATATATATATGACAGTTGCTTGAG0.289300.090500.767200.750001.000001.00000


Target Position: 3281, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3281CGUUUAUAAAACUAGUUUU87.389514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8223299CGTTTATAAAACTAGTTTTAAAACTAGTTTTATAAACG0.118000.089200.775901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3279-3301TGCGTTTATAAAACTAGTTTTTAAAAACUAGUUUUAUAAACGCACGUUUAUAAAACUAGUUUUUAU9.81.432


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019CAGUUGUCACCAUUAGAAA96.142172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1962037CAGTTGTCACCATTAGAAATTTCTAATGGTGACAACTG0.488200.141100.784500.750000.972800.62500


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812ACCUAAAGCAGUCUAUUUA87.3593517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602830ACCTAAAGCAGTCTATTTATAAATAGACTGCTTTAGGT0.303000.185400.819000.750001.000001.00000


Target Position: 3349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3349CAUUGUUAAUCAUAUAAUA104.9571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3347-3369GACATTGTTAATCATATAATAATUAUUAUAUGAUUAACAAUGUCCAUUGUUAAUCAUAUAAUAAUU-8.66.922


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591ACCUAAAUGUUCUGCCUAC70.87332286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8843609ACCTAAATGTTCTGCCTACGTAGGCAGAACATTTAGGT0.104400.044200.672400.500001.000001.00000


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761ACUGAGCUUUUUCUUAAUU74.2381856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602779ACTGAGCTTTTTCTTAATTAATTAAGAAAAAGCTCAGT0.486800.035800.698300.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049UGAUGAAAGAAUUACCGAA89.8615320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541067TGATGAAAGAATTACCGAATTCGGTAATTCTTTCATCA0.133800.069800.551700.750001.000001.00000


Target Position: 2206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206CUCCAUCUCCUACCCACAU74.88591787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412224CTCCATCTCCTACCCACATATGTGGGTAGGAGATGGAG0.878500.319900.655200.750001.000001.00000


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031ACCUUUUUAUUUAUUUAUU75.56811720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6703049ACCTTTTTATTTATTTATTAATAAATAAATAAAAAGGT0.712900.556000.844800.750001.000001.00000


Target Position: 2520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520GCUACUACAUCACUUUCUU87.64487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2518-2540CAGCTACTACATCACTTTCTTGGAAGAAAGUGAUGUAGUAGCUGGCUACUACAUCACUUUCUUGGU17.718.833


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329UGAACGUCGAAAAGAAAAG60.50363245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875347TGAACGTCGAAAAGAAAAGCTTTTCTTTTCGACGTTCA0.500100.061900.586200.500001.000001.00000


Target Position: 1699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699AAGAAGUUGCAUUAAAAUU77.4971497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911717AAGAAGTTGCATTAAAATTAATTTTAATGCAACTTCTT0.708800.113400.629300.500001.000001.00000


Target Position: 3752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3752UUCAUGUAGAUUUCAAUAA74.63141811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393770TTCATGTAGATTTCAATAATTATTGAAATCTACATGAA0.133300.049900.637900.500001.000001.00000


Target Position: 2181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GAAGACAUUAAAAUAUUGA88.8139401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2179-2201TGGAAGACATTAAAATATTGATTUCAAUAUUUUAAUGUCUUCCAGAAGACAUUAAAAUAUUGAUUU-1.819.222


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GCAGACUCAAAUACAAGAA89.2814370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592111GCAGACTCAAATACAAGAATTCTTGTATTTGAGTCTGC0.407600.035900.681001.000001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146CAGUUGAAAAAUUUUUACA87.7086481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453164CAGTTGAAAAATTTTTACATGTAAAAATTTTTCAACTG0.854000.014900.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3144-3166GGCAGTTGAAAAATTTTTACACCUGUAAAAAUUUUUCAACUGCCCAGUUGAAAAAUUUUUACACCU0.019.232


Target Position: 3228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228GCACAAUAUAUUUUCUUAA96.11374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2403246GCACAATATATTTTCTTAATTAAGAAAATATATTGTGC0.407600.296600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3226-3248TTGCACAATATATTTTCTTAAAAUUAAGAAAAUAUAUUGUGCAAGCACAAUAUAUUUUCUUAAAAU7.113.522


Target Position: 1103, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103CUCAAUUUAUGAAUAUUAU87.4731505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641121CTCAATTTATGAATATTATATAATATTCATAAATTGAG0.187700.018600.767200.750000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1101-1123CGCTCAATTTATGAATATTATCAAUAAUAUUCAUAAAUUGAGCGCUCAAUUUAUGAAUAUUAUCAU-8.07.422


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517UGGAUAUUGAAGAUGACAU78.99341331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755535TGGATATTGAAGATGACATATGTCATCTTCAATATCCA0.136200.114200.689700.750001.000001.00000


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869AGGCCACAUUCACGUAUAU84.0331795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604887AGGCCACATTCACGTATATATATACGTGAATGTGGCCT0.270300.043000.801700.750001.000001.00000


Target Position: 2530, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530CACUUUCUUGGAAACGUGU74.14541868

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2528-2550ATCACTTTCTTGGAAACGTGTAAACACGUUUCCAAGAAAGUGAUCACUUUCUUGGAAACGUGUAAU19.817.722


Target Position: 2025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025UCACCAUUAGAAAGCAGUU73.50481942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422043TCACCATTAGAAAGCAGTTAACTGCTTTCTAATGGTGA0.127700.099700.577600.750001.000001.00000


Target Position: 3708, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3708CAAUGUUUGAUUUUAUGCA86.7429585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3706-3728TACAATGTTTGATTTTATGCACTUGCAUAAAAUCAAACAUUGUACAAUGUUUGAUUUUAUGCACUU15.35.323


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396AGAACUAAAUCCAAAGAUA96.927458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152414AGAACTAAATCCAAAGATATATCTTTGGATTTAGTTCT0.271800.092300.681000.750001.000001.00000


Target Position: 3689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689UGUUAAUUUGCUCAAAAUA83.9591802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103707TGTTAATTTGCTCAAAATATATTTTGAGCAAATTAACA0.099600.027700.663800.750001.000001.00000


Target Position: 304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
304CGAACGACAAGAAAAAGAU86.3026617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
752322CGAACGACAAGAAAAAGATATCTTTTTCTTGTCGTTCG0.445300.073900.612101.000001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GCCGAGGAAGAACUAUGAA88.5402424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665832GCCGAGGAAGAACTATGAATTCATAGTTCTTCCTCGGC0.427400.035200.827601.000001.000001.00000


Target Position: 2881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881GGUUAGUUCAAUUUUUGAU87.2495528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492899GGTTAGTTCAATTTTTGATATCAAAAATTGAACTAACC0.231700.025300.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2879-2901TTGGTTAGTTCAATTTTTGATCCAUCAAAAAUUGAACUAACCAAGGUUAGUUCAAUUUUUGAUCCU7.712.932


Target Position: 2582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582GGAGCAAAAGACAAUUAUU93.9017146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2182600GGAGCAAAAGACAATTATTAATAATTGTCTTTTGCTCC0.426900.184900.862101.000001.000001.00000


Target Position: 1883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883GGAAUUGGUAGAAAAACUU84.1898779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1881-1903TTGGAATTGGTAGAAAAACTTTTAAGUUUUUCUACCAAUUCCAAGGAAUUGGUAGAAAAACUUUUU3.220.122


Target Position: 2856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856CCUGGCUACAAUACUGCAC64.07332950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472874CCTGGCTACAATACTGCACGTGCAGTATTGTAGCCAGG0.344300.029500.551700.750000.956500.62500


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818AGGAAGAACUAUGAACAUA91.7565233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248836AGGAAGAACTATGAACATATATGTTCATAGTTCTTCCT0.616300.117500.801700.750001.000001.00000


Target Position: 2918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2918ACAUUAAUGCUCUUUUUUA90.5696277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782936ACATTAATGCTCTTTTTTATAAAAAAGAGCATTAATGT0.105500.046700.672400.750001.000001.00000


Target Position: 126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126GCCCGCUUCUCUCUAGUCU74.21661860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226144GCCCGCTTCTCTCTAGTCTAGACTAGAGAGAAGCGGGC0.666900.157600.775900.750001.000001.00000


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664CAGCUGACCAGUUAUGAUU84.288772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522682CAGCTGACCAGTTATGATTAATCATAACTGGTCAGCTG0.211500.048700.775900.750001.000001.00000


Target Position: 3812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812UCACAGUAAAUAUCUUGUU72.03082144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243830TCACAGTAAATATCTTGTTAACAAGATATTTACTGTGA0.195900.086800.577600.750001.000001.00000


Target Position: 2584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584AGCAAAAGACAAUUAUUUU83.2064872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2392602AGCAAAAGACAATTATTTTAAAATAATTGTCTTTTGCT0.433500.279200.853400.750001.000001.00000


Target Position: 3089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3089AGAAGAUGCCAAUAUAAUU89.2856369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6843107AGAAGATGCCAATATAATTAATTATATTGGCATCTTCT0.227400.032400.715500.750001.000001.00000


Target Position: 2477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2477AGUAGGAAUUGGAACAUUA96.832761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6642495AGTAGGAATTGGAACATTATAATGTTCCAATTCCTACT0.283100.068300.672400.750001.000001.00000


Target Position: 2322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322ACAGAAAAAUCUCAUCCAA90.8521267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952340ACAGAAAAATCTCATCCAATTGGATGAGATTTTTCTGT0.107300.060300.560300.750000.956500.75000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975UCAAAUAUUGAAAUUCCUU71.93352152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799993TCAAATATTGAAATTCCTTAAGGAATTTCAATATTTGA0.359900.213700.586200.750001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027UGGAUAUGAAAUUUUCUUA84.92718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591045TGGATATGAAATTTTCTTATAAGAAAATTTCATATCCA0.089200.049700.810300.750001.000001.00000


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968UCACCCAUCAAAUAUUGAA79.79461230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917986TCACCCATCAAATATTGAATTCAATATTTGATGGGTGA0.393500.066800.551700.750001.000001.00000


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CCCGCUUCUCUCUAGUCUC68.52712552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413145CCCGCTTCTCTCTAGTCTCGAGACTAGAGAGAAGCGGG0.677500.181000.681000.750001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CUCAAAGCACAGUUACAGU79.55451261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882086CTCAAAGCACAGTTACAGTACTGTAACTGTGCTTTGAG0.209100.013200.603400.500001.000001.00000


Target Position: 3937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3937AGGAAAAAAAAAAAAAAAA82.4645953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4113955AGGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCCT0.999300.151700.844800.750001.000001.00000


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816CGAGGAAGAACUAUGAACA95.316397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803834CGAGGAAGAACTATGAACATGTTCATAGTTCTTCCTCG0.428600.052700.586200.750001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939CUCAGGACACAGAUUUAGA88.143448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931957CTCAGGACACAGATTTAGATCTAAATCTGTGTCCTGAG0.311700.153600.586200.500001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322UAAGUUCUGAACGUCGAAA75.43021734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994340TAAGTTCTGAACGTCGAAATTTCGACGTTCAGAACTTA0.201700.017700.534500.500000.983700.62500


Target Position: 1560, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1560GAGGAAGUACCAUUAUAUA103.3810

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5156019GAGGAAGTACCATTATATA1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62204831..62204849(+)00HIF1A(0.002)


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327UCUGAACGUCGAAAAGAAA82.641931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543345TCTGAACGTCGAAAAGAAATTTCTTTTCGACGTTCAGA0.478700.050700.724100.750001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CCAACAGUAACCAACCUCA88.2887436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716910CCAACAGTAACCAACCTCATGAGGTTGGTTACTGTTGG0.289700.083900.620700.750001.000001.00000


Target Position: 1105, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105CAAUUUAUGAAUAUUAUCA94.4182128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1103-1125CTCAATTTATGAATATTATCATGUGAUAAUAUUCAUAAAUUGAGCAAUUUAUGAAUAUUAUCAUGU3.5-10.322


Target Position: 1858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858GUGAUAUGGUCAAUGAAUU86.5569593

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1856-1878TAGTGATATGGTCAATGAATTCAAAUUCAUUGACCAUAUCACUAGUGAUAUGGUCAAUGAAUUCAU7.214.922


Target Position: 3813, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813CACAGUAAAUAUCUUGUUU87.7901472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7073831CACAGTAAATATCTTGTTTAAACAAGATATTTACTGTG0.206000.095000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3811-3833GTCACAGTAAATATCTTGTTTTTAAACAAGAUAUUUACUGUGACCACAGUAAAUAUCUUGUUUUUU19.219.022


Target Position: 3934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3934ACCAGGAAAAAAAAAAAAA77.86671451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123952ACCAGGAAAAAAAAAAAAATTTTTTTTTTTTTCCTGGT0.998800.021700.853400.750001.000001.00000


Target Position: 3842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3842CAUUGUACAAAUUUUUCAU87.3349523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3840-3862TACATTGTACAAATTTTTCATTCAUGAAAAAUUUGUACAAUGUACAUUGUACAAAUUUUUCAUUCU7.714.621


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021ACAGCCUGGAUAUGAAAUU70.20712363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201039ACAGCCTGGATATGAAATTAATTTCATATCCAGGCTGT0.578100.075100.698300.750001.000001.00000


Target Position: 3353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3353GUUAAUCAUAUAAUAAUGA87.1401545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3351-3373TTGTTAATCATATAATAATGATTUCAUUAUUAUAUGAUUAACAAGUUAAUCAUAUAAUAAUGAUUU-1.88.922


Target Position: 2814, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2814CUAAAGCAGUCUAUUUAUA93.2885169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792832CTAAAGCAGTCTATTTATATATAAATAGACTGCTTTAG0.385900.204400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2812-2834ACCTAAAGCAGTCTATTTATATTUAUAAAUAGACUGCUUUAGGUCUAAAGCAGUCUAUUUAUAUUU-8.019.731


Target Position: 309, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309GACAAGAAAAAGAUAAGUU87.0666554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924327GACAAGAAAAAGATAAGTTAACTTATCTTTTTCTTGTC0.095600.059600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
307-329ACGACAAGAAAAAGATAAGTTCTAACUUAUCUUUUUCUUGUCGUGACAAGAAAAAGAUAAGUUCUU14.519.222


Target Position: 180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
180GACUUGCCUUUCCUUCUCU80.77141132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796198GACTTGCCTTTCCTTCTCTAGAGAAGGAAAGGCAAGTC0.249400.107700.594800.500001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404UGCUCAUCAGUUGCCACUU68.59592546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897422TGCTCATCAGTTGCCACTTAAGTGGCAACTGATGAGCA0.102100.039100.715500.750000.956500.62500


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954GGAUCACAGACAGCUCAUU86.2901618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4212972GGATCACAGACAGCTCATTAATGAGCTGTCTGTGATCC0.267300.077800.862101.000001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026CUGGAUAUGAAAUUUUCUU78.18021409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281044CTGGATATGAAATTTTCTTAAGAAAATTTCATATCCAG0.095300.024400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1024-1046GCCTGGATATGAAATTTTCTTATAAGAAAAUUUCAUAUCCAGGCCUGGAUAUGAAAUUUUCUUAUU5.321.222


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638CCAUUACCCACCGCUGAAA80.07671200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211656CCATTACCCACCGCTGAAATTTCAGCGGTGGGTAATGG0.147100.084300.844801.000001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GCUGAAGACACAGAAGCAA88.3139434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101923GCTGAAGACACAGAAGCAATTGCTTCTGTGTCTTCAGC0.122100.022600.706901.000000.951100.62500


Target Position: 2581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581UGGAGCAAAAGACAAUUAU71.83562162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782599TGGAGCAAAAGACAATTATATAATTGTCTTTTGCTCCA0.406300.169800.801700.750001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432GUGAGUUCGCAUCUUGAUA89.0804384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
778450GTGAGTTCGCATCTTGATATATCAAGATGCGAACTCAC0.147100.023200.750000.750001.000001.00000


Target Position: 302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
302CGCGAACGACAAGAAAAAG70.95332274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550320CGCGAACGACAAGAAAAAGCTTTTTCTTGTCGTTCGCG0.438900.088700.784500.750001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337CCAAGAAGCCCUAACGUGU77.2591520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6502355CCAAGAAGCCCTAACGTGTACACGTTAGGGCTTCTTGG0.255800.090700.637900.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2335-2357ATCCAAGAAGCCCTAACGTGTTAACACGUUAGGGCUUCUUGGAUCCAAGAAGCCCUAACGUGUUAU21.016.623


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411CAGUUGCCACUUCCACAUA89.8014329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943429CAGTTGCCACTTCCACATATATGTGGAAGTGGCAACTG0.092100.052800.741400.750000.956500.62500


Target Position: 3176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3176ACAUUUUACAUAAAUAAUA87.3845515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023194ACATTTTACATAAATAATATATTATTTATGTAAAATGT0.692400.499400.663800.750001.000001.00000


Target Position: 3384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3384GUAUGGUUUAUUAUUUAAA92.7799189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3382-3404CTGTATGGTTTATTATTTAAATGUUUAAAUAAUAAACCAUACAGGUAUGGUUUAUUAUUUAAAUGU-7.520.022


Target Position: 3902, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902GUUUUGUUACAUCAAAUAA92.1908212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3900-3922TTGTTTTGTTACATCAAATAAACUUAUUUGAUGUAACAAAACAAGUUUUGUUACAUCAAAUAAACU8.95.631


Target Position: 2207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2207UCCAUCUCCUACCCACAUA75.16031759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552225TCCATCTCCTACCCACATATATGTGGGTAGGAGATGGA0.879000.361500.827600.750001.000001.00000


Target Position: 3449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3449AAGGUAUGUGGCAUUUAUU81.63341036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993467AAGGTATGTGGCATTTATTAATAAATGCCACATACCTT0.081700.026500.629300.500001.000001.00000


Target Position: 3633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3633AGCAGACUGUAAACAAGAA94.1057140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3973651AGCAGACTGTAAACAAGAATTCTTGTTTACAGTCTGCT0.662800.113500.681000.750001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GCUGAUUUGUGAACCCAUU82.762915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916965GCTGATTTGTGAACCCATTAATGGGTTCACAAATCAGC0.126600.016300.844801.000001.000001.00000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061GCAAGUCCUCAAAGCACAG74.43521830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522079GCAAGTCCTCAAAGCACAGCTGTGCTTTGAGGACTTGC0.203000.065900.569000.750000.945700.75000


Target Position: 2813, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813CCUAAAGCAGUCUAUUUAU87.4451510

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9281319CCTAAAGCAGTCTATTTAT1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62213851..62213869(+)00HIF1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3462831CCTAAAGCAGTCTATTTATATAAATAGACTGCTTTAGG0.333400.193800.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2811-2833TACCTAAAGCAGTCTATTTATATAUAAAUAGACUGCUUUAGGUACCUAAAGCAGUCUAUUUAUAUU-2.318.332


Target Position: 3143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143AGGCAGUUGAAAAAUUUUU72.33882101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9363161AGGCAGTTGAAAAATTTTTAAAAATTTTTCAACTGCCT0.117200.015400.844800.750001.000001.00000


Target Position: 3223, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223CAAUUGCACAAUAUAUUUU85.2821687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073241CAATTGCACAATATATTTTAAAATATATTGTGCAATTG0.410400.042500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3221-3243CACAATTGCACAATATATTTTCTAAAAUAUAUUGUGCAAUUGUGCAAUUGCACAAUAUAUUUUCUU-8.020.022


Target Position: 1504, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504CAAUCAUAUCUUUAGAUUU93.6105156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1502-1524CACAATCATATCTTTAGATTTTGAAAUCUAAAGAUAUGAUUGUGCAAUCAUAUCUUUAGAUUUUGU6.98.732


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880UGGUUAGUUCAAUUUUUGA80.41581169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992898TGGTTAGTTCAATTTTTGATCAAAAATTGAACTAACCA0.217900.016900.620700.500001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796UGAAGUGUACCCUAACUAG75.17581756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994814TGAAGTGTACCCTAACTAGCTAGTTAGGGTACACTTCA0.124800.027600.551700.500001.000001.00000


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969CACCCAUCAAAUAUUGAAA91.7142238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691987CACCCATCAAATATTGAAATTTCAATATTTGATGGGTG0.385200.088900.793100.750001.000001.00000


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181ACUUGCCUUUCCUUCUCUU74.35061839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850199ACTTGCCTTTCCTTCTCTTAAGAGAAGGAAAGGCAAGT0.224000.100500.569000.750001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758CCCCAGAUUCAGGAUCAGA81.21831077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351776CCCCAGATTCAGGATCAGATCTGATCCTGAATCTGGGG0.180900.043600.767200.750000.902200.62500


Target Position: 2965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2965AGCUCAUUUUCUCAGUUUU81.04531091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052983AGCTCATTTTCTCAGTTTTAAAACTGAGAAAATGAGCT0.346300.290900.853400.750001.000001.00000


Target Position: 3417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3417UACAUAAUAUAGAAAGAUA95.791980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923435TACATAATATAGAAAGATATATCTTTCTATATTATGTA0.214700.035700.637900.500001.000001.00000


Target Position: 3119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119GCAGUAACCUUUCAUCAUG78.73481358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183137GCAGTAACCTTTCATCATGCATGATGAAAGGTTACTGC0.213500.076500.698300.750001.000001.00000


Target Position: 2899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899UCCCCUUUCUACUUAAUUU74.97131780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242917TCCCCTTTCTACTTAATTTAAATTAAGTAGAAAGGGGA0.665800.540200.870700.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GAAAGAAUUACCGAAUUGA87.9894460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1051-1073ATGAAAGAATTACCGAATTGATGUCAAUUCGGUAAUUCUUUCAUGAAAGAAUUACCGAAUUGAUGU14.15.333


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435GAGAAAGCGAAAAAUGGAA88.4919429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072453GAGAAAGCGAAAAATGGAATTCCATTTTTCGCTTTCTC0.167900.029400.637900.750001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815CCGAGGAAGAACUAUGAAC72.18372123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632833CCGAGGAAGAACTATGAACGTTCATAGTTCTTCCTCGG0.414300.039300.767200.750001.000001.00000


Target Position: 972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
972CCAUCAAAUAUUGAAAUUC70.66192307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452990CCATCAAATATTGAAATTCGAATTTCAATATTTGATGG0.348100.097700.672400.750001.000001.00000


Target Position: 3731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731GUCGCUAUUAACAUCCUUU81.85871008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163749GTCGCTATTAACATCCTTTAAAGGATGTTAATAGCGAC0.474600.214300.819000.750001.000001.00000


Target Position: 1063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063CCGAAUUGAUGGGAUAUGA83.7892818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1061-1083TACCGAATTGATGGGATATGAGCUCAUAUCCCAUCAAUUCGGUACCGAAUUGAUGGGAUAUGAGCU21.214.133


Target Position: 1028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GGAUAUGAAAUUUUCUUAU90.4017290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1026-1048CTGGATATGAAATTTTCTTATTGAUAAGAAAAUUUCAUAUCCAGGGAUAUGAAAUUUUCUUAUUGU7.117.422


Target Position: 3359, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3359CAUAUAAUAAUGAUUCUUA100.63526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903377CATATAATAATGATTCTTATAAGAATCATTATTATATG0.337400.017300.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3357-3379ATCATATAATAATGATTCTTAAAUAAGAAUCAUUAUUAUAUGAUCAUAUAAUAAUGAUUCUUAAAU14.8-8.622


Target Position: 2958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2958CACAGACAGCUCAUUUUCU85.1955690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462976CACAGACAGCTCATTTTCTAGAAAATGAGCTGTCTGTG0.735900.069300.569000.500001.000001.00000


Target Position: 3734, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3734GCUAUUAACAUCCUUUUUU79.07921316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1133752GCTATTAACATCCTTTTTTAAAAAAGGATGTTAATAGC0.678200.245500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3732-3754TCGCTATTAACATCCTTTTTTTCAAAAAAGGAUGUUAAUAGCGAGCUAUUAACAUCCUUUUUUUCU9.5-2.322


Target Position: 3032, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032CCUUUUUAUUUAUUUAUUU83.6301836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2003050CCTTTTTATTTATTTATTTAAATAAATAAATAAAAAGG0.446300.379600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3030-3052CACCTTTTTATTTATTTATTTTTAAAUAAAUAAAUAAAAAGGUGCCUUUUUAUUUAUUUAUUUUUU-10.3-3.810


Target Position: 3939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3939GAAAAAAAAAAAAAAAAAA89.0835383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4463957GAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTC0.999700.966400.672400.750001.000001.00000


Target Position: 1832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832CAGUGAAUAUUGUUUUUAU98.460642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1830-1852CCCAGTGAATATTGTTTTTATGTAUAAAAACAAUAUUCACUGGGCAGUGAAUAUUGUUUUUAUGUU0.019.222


Target Position: 2140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140CCACCACUGAUGAAUUAAA93.7511151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702158CCACCACTGATGAATTAAATTTAATTCATCAGTGGTGG0.923500.107600.844801.000000.940200.62500


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521UAUUGAAGAUGACAUGAAA94.6064123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956539TATTGAAGATGACATGAAATTTCATGTCATCTTCAATA0.100800.084000.543100.500001.000001.00000


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344GCCCUAACGUGUUAUCUGU81.68611028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4712362GCCCTAACGTGTTATCTGTACAGATAACACGTTAGGGC0.242700.095100.793100.750001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693UCAAUCAAGAAGUUGCAUU67.84162609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131711TCAATCAAGAAGTTGCATTAATGCAACTTCTTGATTGA0.184000.081000.715500.750001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759CCCAGAUUCAGGAUCAGAC73.11661993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631777CCCAGATTCAGGATCAGACGTCTGATCCTGAATCTGGG0.211100.047000.672400.750000.951100.75000


Target Position: 872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872CCACAUUCACGUAUAUGAU89.345363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
870-892GGCCACATTCACGTATATGATACAUCAUAUACGUGAAUGUGGCCCCACAUUCACGUAUAUGAUACU10.220.533


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191CCUUCUCUUCUCCGCGUGU70.14562374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969209CCTTCTCTTCTCCGCGTGTACACGCGGAGAAGAGAAGG0.102100.014000.637900.750001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231CAAUAUAUUUUCUUAAAAA103.5677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5863249CAATATATTTTCTTAAAAATTTTTAAGAAAATATATTG0.404200.334100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3229-3251CACAATATATTTTCTTAAAAAATUUUUUAAGAAAAUAUAUUGUGCAAUAUAUUUUCUUAAAAAAUU-3.8-8.621


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179UGGAAGACAUUAAAAUAUU79.12121310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752197TGGAAGACATTAAAATATTAATATTTTAATGTCTTCCA0.245600.060300.836200.750001.000001.00000


Target Position: 2142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142ACCACUGAUGAAUUAAAAA85.8078646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502160ACCACTGATGAATTAAAAATTTTTAATTCATCAGTGGT0.400800.090300.853400.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GAAGAACUAUGAACAUAAA104.7133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457838GAAGAACTATGAACATAAATTTATGTTCATAGTTCTTC0.639300.152000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
818-840AGGAAGAACTATGAACATAAAGTUUUAUGUUCAUAGUUCUUCCUGAAGAACUAUGAACAUAAAGUU6.917.722


Target Position: 2176, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176GUAUGGAAGACAUUAAAAU88.5324425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922194GTATGGAAGACATTAAAATATTTTAATGTCTTCCATAC0.154600.032000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2174-2196CCGTATGGAAGACATTAAAATATAUUUUAAUGUCUUCCAUACGGGUAUGGAAGACAUUAAAAUAUU-9.721.222


Target Position: 3092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092AGAUGCCAAUAUAAUUUUU82.4857950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6673110AGATGCCAATATAATTTTTAAAAATTATATTGGCATCT0.167200.047900.724100.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571CAGAAUGGAAUGGAGCAAA85.3729679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672589CAGAATGGAATGGAGCAAATTTGCTCCATTCCATTCTG0.194300.085900.784500.750001.000001.00000


Target Position: 3405, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3405GGUAAAGCCAUUUACAUAA95.1614102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443423GGTAAAGCCATTTACATAATTATGTAAATGGCTTTACC0.151800.025600.819001.000000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3403-3425TGGGTAAAGCCATTTACATAATAUUAUGUAAAUGGCUUUACCCAGGUAAAGCCAUUUACAUAAUAU8.520.932


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792AGAAUGAAGUGUACCCUAA93.3852164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901810AGAATGAAGTGTACCCTAATTAGGGTACACTTCATTCT0.101600.025100.689700.750001.000001.00000


Target Position: 2476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2476CAGUAGGAAUUGGAACAUU85.5323663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452494CAGTAGGAATTGGAACATTAATGTTCCAATTCCTACTG0.207900.060200.775900.750001.000001.00000


Target Position: 123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
123GCCGCCCGCUUCUCUCUAG66.67132716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521141GCCGCCCGCTTCTCTCTAGCTAGAGAGAAGCGGGCGGC0.349700.057400.827600.750000.983700.75000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599CCCAACGAAAAAUUACAGA74.36271838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161617CCCAACGAAAAATTACAGATCTGTAATTTTTCGTTGGG0.594200.486800.767200.750001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578GAAUGGAGCAAAAGACAAU90.7485271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592596GAATGGAGCAAAAGACAATATTGTCTTTTGCTCCATTC0.428000.128500.663800.750001.000001.00000


Target Position: 325, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325GUUCUGAACGUCGAAAAGA79.90961220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
323-345AAGTTCTGAACGTCGAAAAGAAAUCUUUUCGACGUUCAGAACUUGUUCUGAACGUCGAAAAGAAAU12.420.432


Target Position: 2340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2340AGAAGCCCUAACGUGUUAU71.0632262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582358AGAAGCCCTAACGTGTTATATAACACGTTAGGGCTTCT0.248500.092100.681000.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051AUGAAAGAAUUACCGAAUU71.28762231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481069ATGAAAGAATTACCGAATTAATTCGGTAATTCTTTCAT0.092800.053200.646600.500001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CGCUGGAGACACAAUCAUA102.90616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971511CGCTGGAGACACAATCATATATGATTGTGTCTCCAGCG0.601300.017000.879301.000001.000001.00000


Target Position: 324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
324AGUUCUGAACGUCGAAAAG69.95352394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946342AGTTCTGAACGTCGAAAAGCTTTTCGACGTTCAGAACT0.091100.018800.569000.500000.983700.62500


Target Position: 3280, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280GCGUUUAUAAAACUAGUUU80.68851139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273298GCGTTTATAAAACTAGTTTAAACTAGTTTTATAAACGC0.146500.093200.922401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3278-3300CTGCGTTTATAAAACTAGTTTTTAAACUAGUUUUAUAAACGCAGGCGUUUAUAAAACUAGUUUUUU17.66.932


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456AGAAGGAACCUGAUGCUUU82.4328958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761474AGAAGGAACCTGATGCTTTAAAGCATCAGGTTCCTTCT0.230000.023300.724100.750001.000001.00000


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129CACUACCACUGCCACCACU79.48091266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322147CACTACCACTGCCACCACTAGTGGTGGCAGTGGTAGTG0.208500.165300.586200.500001.000001.00000


Target Position: 3448, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448GAAGGUAUGUGGCAUUUAU94.7294120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863466GAAGGTATGTGGCATTTATATAAATGCCACATACCTTC0.158600.042700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3446-3468TAGAAGGTATGTGGCATTTATTTAUAAAUGCCACAUACCUUCUAGAAGGUAUGUGGCAUUUAUUUU15.318.522


Target Position: 3849, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3849CAAAUUUUUCAUUCCUUUU79.11711311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623867CAAATTTTTCATTCCTTTTAAAAGGAATGAAAAATTTG0.298100.242700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3847-3869TACAAATTTTTCATTCCTTTTGCAAAAGGAAUGAAAAAUUUGUACAAAUUUUUCAUUCCUUUUGCU18.7-12.021


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100CCGCUCAAUUUAUGAAUAU82.009993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391118CCGCTCAATTTATGAATATATATTCATAAATTGAGCGG0.093300.017400.870701.000000.962000.75000


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183AGACAUUAAAAUAUUGAUU80.94041103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472201AGACATTAAAATATTGATTAATCAATATTTTAATGTCT0.140900.071200.715500.750001.000001.00000


Target Position: 3798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3798GGAAUAUAUAGUUGUCACA96.265570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903816GGAATATATAGTTGTCACATGTGACAACTATATATTCC0.156500.046100.663800.750001.000001.00000


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019ACACAGCCUGGAUAUGAAA86.3578611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031037ACACAGCCTGGATATGAAATTTCATATCCAGGCTGTGT0.277100.056500.706900.750001.000001.00000


Target Position: 3735, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3735CUAUUAACAUCCUUUUUUU87.6741485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5393753CTATTAACATCCTTTTTTTAAAAAAAGGATGTTAATAG0.589300.194800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3733-3755CGCTATTAACATCCTTTTTTTCAAAAAAAAGGAUGUUAAUAGCGCUAUUAACAUCCUUUUUUUCAU-5.91.422


Target Position: 548, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548GAAUUGCUUUUAUUUGAAA95.562387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
546-568ATGAATTGCTTTTATTTGAAAGCUUUCAAAUAAAAGCAAUUCAUGAAUUGCUUUUAUUUGAAAGCU7.418.531


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868CAGGCCACAUUCACGUAUA91.7366236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708886CAGGCCACATTCACGTATATATACGTGAATGTGGCCTG0.250000.036500.741400.750001.000001.00000


Target Position: 1457, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1457GAAGGAACCUGAUGCUUUA100.78523

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2145719GAAGGAACCTGATGCTTTA1/1/0/0100.00HIF1ANM_181054.2+NM_001530.31+1NANANA14:62203751..62203769(+)00HIF1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451475GAAGGAACCTGATGCTTTATAAAGCATCAGGTTCCTTC0.285600.025600.637900.750001.000001.00000


Target Position: 3636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3636AGACUGUAAACAAGAAAAA87.0077560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2473654AGACTGTAAACAAGAAAAATTTTTCTTGTTTACAGTCT0.669400.351800.724100.750001.000001.00000


Target Position: 734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CAGAAAUGGCCUUGUGAAA89.8326323

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
732-754CACAGAAATGGCCTTGTGAAAAAUUUCACAAGGCCAUUUCUGUGCAGAAAUGGCCUUGUGAAAAAU20.512.022


Target Position: 1822, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822CUAAUAGUCCCAGUGAAUA87.5063501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1820-1842GCCTAATAGTCCCAGTGAATATTUAUUCACUGGGACUAUUAGGCCUAAUAGUCCCAGUGAAUAUUU19.26.323


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018GACACAGCCUGGAUAUGAA103.06514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481036GACACAGCCTGGATATGAATTCATATCCAGGCTGTGTC0.172800.047200.646600.750001.000001.00000


Target Position: 3775, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3775GUAAUUUUAGAAGCAUUAU78.83661348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073793GTAATTTTAGAAGCATTATATAATGCTTCTAAAATTAC0.137000.021900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3773-3795GAGTAATTTTAGAAGCATTATTTAUAAUGCUUCUAAAAUUACUCGUAAUUUUAGAAGCAUUAUUUU19.7-9.722


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965UCCUCACCCAUCAAAUAUU72.40852086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758983TCCTCACCCATCAAATATTAATATTTGATGGGTGAGGA0.135300.067500.862100.750001.000001.00000


Target Position: 3444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3444UCUAGAAGGUAUGUGGCAU74.26051849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9113462TCTAGAAGGTATGTGGCATATGCCACATACCTTCTAGA0.102700.016500.569000.750001.000001.00000


Target Position: 2354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354GUUAUCUGUCGCUUUGAGU73.8881893

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2352-2374GTGTTATCTGTCGCTTTGAGTCAACUCAAAGCGACAGAUAACACGUUAUCUGUCGCUUUGAGUCAU16.613.432


Target Position: 1416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416GUUGAAUCAGAAGAUACAA90.5228282

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1414-1436AAGTTGAATCAGAAGATACAAGTUUGUAUCUUCUGAUUCAACUUGUUGAAUCAGAAGAUACAAGUU20.316.332


Target Position: 3373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373UCUUAAAUGCUGUAUGGUU77.01491554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393391TCTTAAATGCTGTATGGTTAACCATACAGCATTTAAGA0.237700.133700.577600.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GGGUAAAGAACAAAACACA95.321696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246773GGGTAAAGAACAAAACACATGTGTTTTGTTCTTTACCC0.733800.231200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
753-775AAGGGTAAAGAACAAAACACACAUGUGUUUUGUUCUUUACCCUUGGGUAAAGAACAAAACACACAU13.318.622


Target Position: 3097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3097CCAAUAUAAUUUUUGUAAG77.25671521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603115CCAATATAATTTTTGTAAGCTTACAAAAATTATATTGG0.089200.093100.706900.750001.000001.00000


Target Position: 2246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246CACAUCAUCACCAUAUAGA87.2101535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2244-2266GCCACATCATCACCATATAGAGAUCUAUAUGGUGAUGAUGUGGCCACAUCAUCACCAUAUAGAGAU4.920.532


Target Position: 3344, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3344CAUGACAUUGUUAAUCAUA93.2651170

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3342-3364AACATGACATTGTTAATCATATAUAUGAUUAACAAUGUCAUGUUCAUGACAUUGUUAAUCAUAUAU8.720.523


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243UGCCACAUCAUCACCAUAU73.12141992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172261TGCCACATCATCACCATATATATGGTGATGATGTGGCA0.361100.226000.810300.750000.994600.75000


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273AUAUUCUGCGUUUAUAAAA80.6711142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573291ATATTCTGCGTTTATAAAATTTTATAAACGCAGAATAT0.349500.052400.543100.500001.000001.00000


Target Position: 3848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3848ACAAAUUUUUCAUUCCUUU75.72621700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4493866ACAAATTTTTCATTCCTTTAAAGGAATGAAAAATTTGT0.326300.263500.706900.750001.000001.00000


Target Position: 976, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976CAAAUAUUGAAAUUCCUUU82.8476904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655994CAAATATTGAAATTCCTTTAAAGGAATTTCAATATTTG0.335800.229100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
974-996ATCAAATATTGAAATTCCTTTAGAAAGGAAUUUCAAUAUUUGAUCAAAUAUUGAAAUUCCUUUAGU18.7-10.322


Target Position: 3447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3447AGAAGGUAUGUGGCAUUUA85.1688694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023465AGAAGGTATGTGGCATTTATAAATGCCACATACCTTCT0.124500.038200.689700.750001.000001.00000


Target Position: 646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646GAUUAACUCAGUUUGAACU85.7559648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
644-666GGGATTAACTCAGTTTGAACTAAAGUUCAAACUGAGUUAAUCCCGAUUAACUCAGUUUGAACUAAU14.94.633


Target Position: 3256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256GCAGUUACUCAUGGAAUAU85.0897702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643274GCAGTTACTCATGGAATATATATTCCATGAGTAACTGC0.467800.014300.810301.000000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3254-3276CAGCAGTTACTCATGGAATATATAUAUUCCAUGAGUAACUGCUGGCAGUUACUCAUGGAAUAUAUU21.219.032


Target Position: 3511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511AGUCACUUUGCCAGCUCAA82.2705972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933529AGTCACTTTGCCAGCTCAATTGAGCTGGCAAAGTGACT0.143100.106000.560300.750000.978301.00000


Target Position: 2903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903CUUUCUACUUAAUUUACAU90.2667295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2901-2923CCCTTTCTACTTAATTTACATTAAUGUAAAUUAAGUAGAAAGGGCUUUCUACUUAAUUUACAUUAU6.914.632


Target Position: 1334, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334GAUUUUCUCCCUUCAACAA93.3588167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991352GATTTTCTCCCTTCAACAATTGTTGAAGGGAGAAAATC0.362500.090100.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1332-1354TTGATTTTCTCCCTTCAACAAACUUGUUGAAGGGAGAAAAUCAAGAUUUUCUCCCUUCAACAAACU20.55.322


Target Position: 3745, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3745CCUUUUUUUCAUGUAGAUU76.81579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073763CCTTTTTTTCATGTAGATTAATCTACATGAAAAAAAGG0.186900.131000.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3743-3765ATCCTTTTTTTCATGTAGATTTCAAUCUACAUGAAAAAAAGGAUCCUUUUUUUCAUGUAGAUUUCU20.3-5.922


Target Position: 328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328CUGAACGUCGAAAAGAAAA79.90171221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494346CTGAACGTCGAAAAGAAAATTTTCTTTTCGACGTTCAG0.527300.057700.784500.750001.000001.00000


Target Position: 3321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3321CUAUGAAAUUGUUAAACCU85.5275665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3319-3341GCCTATGAAATTGTTAAACCTGGAGGUUUAACAAUUUCAUAGGCCUAUGAAAUUGUUAAACCUGGU14.08.912


Target Position: 3765, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3765CAAUAAUUGAGUAAUUUUA96.423368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3763-3785TTCAATAATTGAGTAATTTTAGAUAAAAUUACUCAAUUAUUGAACAAUAAUUGAGUAAUUUUAGAU-9.7-10.322


Target Position: 1604, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604CGAAAAAUUACAGAAUAUA93.048179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2261622CGAAAAATTACAGAATATATATATTCTGTAATTTTTCG0.655800.541700.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1602-1624AACGAAAAATTACAGAATATAAAUAUAUUCUGUAAUUUUUCGUUCGAAAAAUUACAGAAUAUAAAU6.60.422


Target Position: 2966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2966GCUCAUUUUCUCAGUUUUU81.85641009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3082984GCTCATTTTCTCAGTTTTTAAAAACTGAGAAAATGAGC0.352700.290400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2964-2986CAGCTCATTTTCTCAGTTTTTTGAAAAACUGAGAAAAUGAGCUGGCUCAUUUUCUCAGUUUUUUGU10.312.022


Target Position: 3523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3523AGCUCAAAAGAAAACAAUA92.0817214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7023541AGCTCAAAAGAAAACAATATATTGTTTTCTTTTGAGCT0.410400.030100.810300.750000.940200.62500


Target Position: 3488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3488GAGAAAUCAUCUGAUGUUU86.3099616

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3486-3508CAGAGAAATCATCTGATGTTTCTAAACAUCAGAUGAUUUCUCUGGAGAAAUCAUCUGAUGUUUCUU20.514.832


Target Position: 1843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843GUUUUUAUGUGGAUAGUGA91.3647248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1841-1863TTGTTTTTATGTGGATAGTGATAUCACUAUCCACAUAAAAACAAGUUUUUAUGUGGAUAGUGAUAU20.3-9.722


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024GCCUGGAUAUGAAAUUUUC76.46461613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481042GCCTGGATATGAAATTTTCGAAAATTTCATATCCAGGC0.112400.014900.827600.750001.000001.00000


Target Position: 3931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3931UGGACCAGGAAAAAAAAAA74.74941801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413949TGGACCAGGAAAAAAAAAATTTTTTTTTTCCTGGTCCA0.967300.015200.844800.750001.000001.00000


Target Position: 3682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3682CCUAGUAUGUUAAUUUGCU83.1577876

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3680-3702TGCCTAGTATGTTAATTTGCTCAAGCAAAUUAACAUACUAGGCACCUAGUAUGUUAAUUUGCUCAU14.011.233


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174CCGUAUGGAAGACAUUAAA89.3075366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592192CCGTATGGAAGACATTAAATTTAATGTCTTCCATACGG0.135300.034900.913801.000001.000001.00000


Target Position: 1694, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694CAAUCAAGAAGUUGCAUUA97.988644

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6169419CAATCAAGAAGTTGCATTA1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62204965..62204983(+)00HIF1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601712CAATCAAGAAGTTGCATTATAATGCAACTTCTTGATTG0.262500.089500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1692-1714CTCAATCAAGAAGTTGCATTAAAUAAUGCAACUUCUUGAUUGAGCAAUCAAGAAGUUGCAUUAAAU20.012.022


Target Position: 3269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GAAUAUAUUCUGCGUUUAU91.7919229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113287GAATATATTCTGCGTTTATATAAACGCAGAATATATTC0.150000.047300.629300.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GGAAGAACUAUGAACAUAA104.4944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207837GGAAGAACTATGAACATAATTATGTTCATAGTTCTTCC0.623300.135400.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
817-839GAGGAAGAACTATGAACATAAAGUUAUGUUCAUAGUUCUUCCUCGGAAGAACUAUGAACAUAAAGU16.121.522


Target Position: 2217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2217ACCCACAUACAUAAAGAAA83.6537833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632235ACCCACATACATAAAGAAATTTCTTTATGTATGTGGGT0.705800.592400.853400.750001.000001.00000


Target Position: 865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865GCACAGGCCACAUUCACGU74.21291861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818883GCACAGGCCACATTCACGTACGTGAATGTGGCCTGTGC0.233700.022000.577600.750001.000001.00000


Target Position: 3930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3930GUGGACCAGGAAAAAAAAA80.85351118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813948GTGGACCAGGAAAAAAAAATTTTTTTTTCCTGGTCCAC0.886200.013600.793100.750001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563CUAGUGAACAGAAUGGAAU81.58861040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022581CTAGTGAACAGAATGGAATATTCCATTCTGTTCACTAG0.187700.045600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2561-2583ATCTAGTGAACAGAATGGAATGGAUUCCAUUCUGUUCACUAGAUCUAGUGAACAGAAUGGAAUGGU20.120.322


Target Position: 2963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963ACAGCUCAUUUUCUCAGUU78.03141428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9032981ACAGCTCATTTTCTCAGTTAACTGAGAAAATGAGCTGT0.348900.192000.560300.750001.000001.00000


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286UCACCAAACAGAGCAGGAA77.27431517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492304TCACCAAACAGAGCAGGAATTCCTGCTCTGTTTGGTGA0.094700.045400.551700.750001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150UGAAAAAUUUUUACACCUU76.14361654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003168TGAAAAATTTTTACACCTTAAGGTGTAAAAATTTTTCA0.853200.048200.586200.750001.000001.00000


Target Position: 3635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635CAGACUGUAAACAAGAAAA94.2167136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2243653CAGACTGTAAACAAGAAAATTTTCTTGTTTACAGTCTG0.671100.257100.784500.750001.000001.00000


Target Position: 3361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3361UAUAAUAAUGAUUCUUAAA87.7518477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583379TATAATAATGATTCTTAAATTTAAGAATCATTATTATA0.301900.036400.543100.500001.000001.00000


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956AUCACAGACAGCUCAUUUU76.22881640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302974ATCACAGACAGCTCATTTTAAAATGAGCTGTCTGTGAT0.393300.079800.681000.500001.000001.00000


Target Position: 3726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3726ACUUUGUCGCUAUUAACAU78.24681396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223744ACTTTGTCGCTATTAACATATGTTAATAGCGACAAAGT0.356800.131100.551700.750000.956500.62500


Target Position: 3933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3933GACCAGGAAAAAAAAAAAA87.1782538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133951GACCAGGAAAAAAAAAAAATTTTTTTTTTTTCCTGGTC0.997200.021500.819000.750001.000001.00000


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310GUCAUAGAACAGACAGAAA95.498889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482328GTCATAGAACAGACAGAAATTTCTGTCTGTTCTATGAC0.140800.083100.819000.750000.934800.62500


Target Position: 3428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428GAAAGAUAUGCAUAUAUCU93.9915144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3426-3448TAGAAAGATATGCATATATCTAGAGAUAUAUGCAUAUCUUUCUAGAAAGAUAUGCAUAUAUCUAGU3.26.922


Target Position: 2754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2754CAAGUUAACUGAGCUUUUU81.9353998

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2752-2774ATCAAGTTAACTGAGCTTTTTCTAAAAAGCUCAGUUAACUUGAUCAAGUUAACUGAGCUUUUUCUU17.04.922


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GUGAACAAAUACAUGGGAU83.1679874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843648GTGAACAAATACATGGGATATCCCATGTATTTGTTCAC0.112900.020700.612100.750001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GCUCAUCAGUUGCCACUUC73.1121994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860423GCTCATCAGTTGCCACTTCGAAGTGGCAACTGATGAGC0.109900.038400.681000.750000.956500.75000


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277UCUGCGUUUAUAAAACUAG62.52843086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9693295TCTGCGTTTATAAAACTAGCTAGTTTTATAAACGCAGA0.177900.044400.551700.500001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915CAGAAGCAAAGAACCCAUU77.38331505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191933CAGAAGCAAAGAACCCATTAATGGGTTCTTTGCTTCTG0.216900.075800.775900.750000.983700.75000


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953UGGAUCACAGACAGCUCAU74.0741871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322971TGGATCACAGACAGCTCATATGAGCTGTCTGTGATCCA0.219200.026800.689700.750001.000001.00000


Target Position: 2929, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929CUUUUUUAGUAUGUUCUUU77.29111515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292947CTTTTTTAGTATGTTCTTTAAAGAACATACTAAAAAAG0.095100.017300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2927-2949CTCTTTTTTAGTATGTTCTTTAAAAAGAACAUACUAAAAAAGAGCUUUUUUAGUAUGUUCUUUAAU19.2-9.111


Target Position: 3070, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070CUUUUUCGAAUUAUUUUUA81.66551031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743088CTTTTTCGAATTATTTTTATAAAAATAATTCGAAAAAG0.351500.025500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090CCCTTTTTCGAATTATTTTTAAGUAAAAAUAAUUCGAAAAAGGGCUUUUUCGAAUUAUUUUUAAGU-9.77.722


Target Position: 2818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2818AGCAGUCUAUUUAUAUUUU84.1509781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832836AGCAGTCTATTTATATTTTAAAATATAAATAGACTGCT0.509100.127700.853400.750001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570ACAGAAUGGAAUGGAGCAA77.93531445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8812588ACAGAATGGAATGGAGCAATTGCTCCATTCCATTCTGT0.178600.088900.560300.750001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GGAACCUGAUGCUUUAACU86.4379604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591478GGAACCTGATGCTTTAACTAGTTAAAGCATCAGGTTCC0.202400.089200.663800.750001.000001.00000


Target Position: 3932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932GGACCAGGAAAAAAAAAAA94.2938134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183950GGACCAGGAAAAAAAAAAATTTTTTTTTTTCCTGGTCC0.992700.021300.870701.000001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135CACUGCCACCACUGAUGAA93.8997147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272153CACTGCCACCACTGATGAATTCATCAGTGGTGGCAGTG0.147900.094400.620700.750000.913000.62500


Target Position: 2585, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585GCAAAAGACAAUUAUUUUA92.0684215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2052603GCAAAAGACAATTATTTTATAAAATAATTGTCTTTTGC0.440900.325500.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2583-2605GAGCAAAAGACAATTATTTTAATUAAAAUAAUUGUCUUUUGCUCGCAAAAGACAAUUAUUUUAAUU-9.712.212


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124CCGCCCGCUUCUCUCUAGU65.80482797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
724142CCGCCCGCTTCTCTCTAGTACTAGAGAGAAGCGGGCGG0.581600.084600.706900.750001.000001.00000


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319GCCUAUGAAAUUGUUAAAC64.46342916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4263337GCCTATGAAATTGTTAAACGTTTAACAATTTCATAGGC0.262900.162900.853400.750001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458AAGGAACCUGAUGCUUUAA80.61951148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201476AAGGAACCTGATGCTTTAATTAAAGCATCAGGTTCCTT0.288000.051900.603400.500001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177CAUUUUACAUAAAUAAUAA103.27111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343195CATTTTACATAAATAATAATTATTATTTATGTAAAATG0.596200.509000.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3175-3197CACATTTTACATAAATAATAATGUUAUUAUUUAUGUAAAAUGUGCAUUUUACAUAAAUAAUAAUGU-8.0-0.322


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603ACGAAAAAUUACAGAAUAU85.5369662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301621ACGAAAAATTACAGAATATATATTCTGTAATTTTTCGT0.623800.523600.732800.750001.000001.00000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007CAGUAGCAUCAUUUUAAAA97.616848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1653025CAGTAGCATCATTTTAAAATTTTAAAATGATGCTACTG0.585800.166500.784500.750001.000001.00000


Target Position: 3803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3803AUAUAGUUGUCACAGUAAA89.0487390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613821ATATAGTTGTCACAGTAAATTTACTGTGACAACTATAT0.164800.086500.543100.500001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461GAACCUGAUGCUUUAACUU87.3367522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981479GAACCTGATGCTTTAACTTAAGTTAAAGCATCAGGTTC0.305300.091000.534500.750001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCUUUAGAUAGCAAGACUU84.2473776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091008CCTTTAGATAGCAAGACTTAAGTCTTGCTATCTAAAGG0.099900.051300.706901.000000.972800.62500


Target Position: 2766, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2766GCUUUUUCUUAAUUUCAUU85.0991700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2342784GCTTTTTCTTAATTTCATTAATGAAATTAAGAAAAAGC0.412200.129500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2764-2786GAGCTTTTTCTTAATTTCATTCCAAUGAAAUUAAGAAAAAGCUCGCUUUUUCUUAAUUUCAUUCCU7.25.522


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459AGGAACCUGAUGCUUUAAC58.71763368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351477AGGAACCTGATGCTTTAACGTTAAAGCATCAGGTTCCT0.200700.081500.698300.500001.000001.00000


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914ACAGAAGCAAAGAACCCAU77.7051473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341932ACAGAAGCAAAGAACCCATATGGGTTCTTTGCTTCTGT0.178100.066100.551700.750000.983700.75000


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438GCCUCUUUGACAAACUUAA89.1756379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751456GCCTCTTTGACAAACTTAATTAAGTTTGTCAAAGAGGC0.188000.013700.965501.000001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221CACAAUUGCACAAUAUAUU83.6847829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6733239CACAATTGCACAATATATTAATATATTGTGCAATTGTG0.349900.034000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3219-3241GCCACAATTGCACAATATATTTTAAUAUAUUGUGCAAUUGUGGCCACAAUUGCACAAUAUAUUUUU-8.612.131


Target Position: 2222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2222CAUACAUAAAGAAACUACU86.3692608

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2220-2242CACATACATAAAGAAACTACTAGAGUAGUUUCUUUAUGUAUGUGCAUACAUAAAGAAACUACUAGU12.98.222


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128CCACUACCACUGCCACCAC70.49022329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522146CCACTACCACTGCCACCACGTGGTGGCAGTGGTAGTGG0.173900.184400.551700.750001.000001.00000


Target Position: 3891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3891CUAACUGUAUUGUUUUGUU84.9514714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3889-3911CACTAACTGTATTGTTTTGTTACAACAAAACAAUACAGUUAGUGCUAACUGUAUUGUUUUGUUACU13.319.022


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331UCUCAUCCAAGAAGCCCUA73.03032004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352349TCTCATCCAAGAAGCCCTATAGGGCTTCTTGGATGAGA0.217800.069900.551700.750000.989100.62500


Target Position: 1404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404CUAUUCACCAAAGUUGAAU72.4092085

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1402-1424AGCTATTCACCAAAGTTGAATCAAUUCAACUUUGGUGAAUAGCUCUAUUCACCAAAGUUGAAUCAU19.216.122


Target Position: 1210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CCAAAAGAGGUGGAUAUGU72.75872037

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1208-1230TGCCAAAAGAGGTGGATATGTCTACAUAUCCACCUCUUUUGGCACCAAAAGAGGUGGAUAUGUCUU21.212.223


Target Position: 3137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137GAUCAUAGGCAGUUGAAAA101.45318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3135-3157ATGATCATAGGCAGTTGAAAAATUUUUCAACUGCCUAUGAUCAUGAUCAUAGGCAGUUGAAAAAUU14.913.322


Target Position: 670, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670GACACAGUGUGUUUGAUUU90.6728273

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_167019GACACAGTGTGTTTGATTT1/1/0/0100.00HIF1ANM_181054.2+NM_001530.31+1NANANA14:62188470..62188488(+)00HIF1A(0.002)


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772UCUUAAUUUCAUUCCUUUU72.94652012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952790TCTTAATTTCATTCCTTTTAAAAGGAATGAAATTAAGA0.450300.288400.724100.750001.000001.00000


Target Position: 749, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GAAAAAGGGUAAAGAACAA96.467166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
747-769GTGAAAAAGGGTAAAGAACAAAAUUGUUCUUUACCCUUUUUCACGAAAAAGGGUAAAGAACAAAAU19.29.522


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632UGGGGCAAUCAAUGGAUGA72.12042130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682650TGGGGCAATCAATGGATGATCATCCATTGATTGCCCCA0.108500.019100.620700.500000.994600.62500


Target Position: 1502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502CACAAUCAUAUCUUUAGAU87.9678461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1500-1522GACACAATCATATCTTTAGATTTAUCUAAAGAUAUGAUUGUGUCCACAAUCAUAUCUUUAGAUUUU11.720.532


Target Position: 3725, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CACUUUGUCGCUAUUAACA87.5267499

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3723-3745TGCACTTTGTCGCTATTAACATCUGUUAAUAGCGACAAAGUGCACACUUUGUCGCUAUUAACAUCU1.417.832


Target Position: 3895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3895CUGUAUUGUUUUGUUACAU80.95591101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3893-3915AACTGTATTGTTTTGTTACATCAAUGUAACAAAACAAUACAGUUCUGUAUUGUUUUGUUACAUCAU20.413.523


Target Position: 3810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3810UGUCACAGUAAAUAUCUUG67.72842614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283828TGTCACAGTAAATATCTTGCAAGATATTTACTGTGACA0.168700.082500.560300.500001.000001.00000


Target Position: 3162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3162ACACCUUUUUUUUCACAUU76.6081600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5083180ACACCTTTTTTTTCACATTAATGTGAAAAAAAAGGTGT0.222500.147900.698300.750001.000001.00000


Target Position: 3098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098CAAUAUAAUUUUUGUAAGA93.0699176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3096-3118GCCAATATAATTTTTGTAAGAAGUCUUACAAAAAUUAUAUUGGCCAAUAUAAUUUUUGUAAGAAGU11.8-8.032


Target Position: 2810, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810CUACCUAAAGCAGUCUAUU79.98581211

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2808-2830CACTACCTAAAGCAGTCTATTTAAAUAGACUGCUUUAGGUAGUGCUACCUAAAGCAGUCUAUUUAU18.919.812


Target Position: 3674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CAAAAUUGCCUAGUAUGUU80.99931093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3672-3694AGCAAAATTGCCTAGTATGTTAAAACAUACUAGGCAAUUUUGCUCAAAAUUGCCUAGUAUGUUAAU19.0-3.322


Target Position: 2820, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820CAGUCUAUUUAUAUUUUCU92.0521216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952838CAGTCTATTTATATTTTCTAGAAAATATAAATAGACTG0.504500.140400.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2818-2840AGCAGTCTATTTATATTTTCTACAGAAAAUAUAAAUAGACUGCUCAGUCUAUUUAUAUUUUCUACU2.118.922


Target Position: 1570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570CAUUAUAUAAUGAUGUAAU93.7392153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1568-1590ACCATTATATAATGATGTAATGCAUUACAUCAUUAUAUAAUGGUCAUUAUAUAAUGAUGUAAUGCU16.1-8.623


Target Position: 2960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960CAGACAGCUCAUUUUCUCA95.0173107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842978CAGACAGCTCATTTTCTCATGAGAAAATGAGCTGTCTG0.460400.092100.560300.500001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184GACAUUAAAAUAUUGAUUG74.44351828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932202GACATTAAAATATTGATTGCAATCAATATTTTAATGTC0.137800.073200.672400.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CUUUAGAUAGCAAGACUUU82.0498986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9581009CTTTAGATAGCAAGACTTTAAAGTCTTGCTATCTAAAG0.089500.046200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
989-1011TCCTTTAGATAGCAAGACTTTCCAAAGUCUUGCUAUCUAAAGGACUUUAGAUAGCAAGACUUUCCU17.76.932


Target Position: 2235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2235ACUACUAGUGCCACAUCAU83.555842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212253ACTACTAGTGCCACATCATATGATGTGGCACTAGTAGT0.497100.171600.551700.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860GAUAUGGUCAAUGAAUUCA86.6349590

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1858-1880GTGATATGGTCAATGAATTCAAGUGAAUUCAUUGACCAUAUCACGAUAUGGUCAAUGAAUUCAAGU16.320.022


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GCCGCUCAAUUUAUGAAUA90.1477304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531117GCCGCTCAATTTATGAATATATTCATAAATTGAGCGGC0.095500.014800.956901.000000.962000.75000


Target Position: 2475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475GCAGUAGGAAUUGGAACAU78.13831416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542493GCAGTAGGAATTGGAACATATGTTCCAATTCCTACTGC0.205000.053500.698301.000001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242CAAGCAACUGUCAUAUAUA103.7646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771260CAAGCAACTGTCATATATATATATATGACAGTTGCTTG0.457800.122000.603400.750001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762CUGAGCUUUUUCUUAAUUU79.04331323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782780CTGAGCTTTTTCTTAATTTAAATTAAGAAAAAGCTCAG0.480700.051000.784500.750001.000001.00000


Target Position: 3495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495CAUCUGAUGUUUCUAUAGU84.4413757

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3493-3515ATCATCTGATGTTTCTATAGTCAACUAUAGAAACAUCAGAUGAUCAUCUGAUGUUUCUAUAGUCAU13.020.422


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007CGUUCCUUCGAUCAGUUGU73.26661973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672025CGTTCCTTCGATCAGTTGTACAACTGATCGAAGGAACG0.181100.029200.569000.750001.000001.00000


Target Position: 2967, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2967CUCAUUUUCUCAGUUUUUU72.13612128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172985CTCATTTTCTCAGTTTTTTAAAAAACTGAGAAAATGAG0.120500.105300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2965-2987AGCTCATTTTCTCAGTTTTTTGGAAAAAACUGAGAAAAUGAGCUCUCAUUUUCUCAGUUUUUUGGU3.27.422


Target Position: 2212, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212CUCCUACCCACAUACAUAA89.5579345

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7221219CTCCTACCCACATACATAA1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62207741..62207759(+)00HIF1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792230CTCCTACCCACATACATAATTATGTATGTGGGTAGGAG0.887100.786000.775900.750001.000001.00000


Target Position: 3522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522CAGCUCAAAAGAAAACAAU80.92861106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423540CAGCTCAAAAGAAAACAATATTGTTTTCTTTTGAGCTG0.402000.025700.775900.750000.940200.62500


Target Position: 3723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3723UGCACUUUGUCGCUAUUAA84.7347731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4533741TGCACTTTGTCGCTATTAATTAATAGCGACAAAGTGCA0.278900.069900.819000.750000.934800.62500


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CAUAUAUAACACCAAGAAU92.2744207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681271CATATATAACACCAAGAATATTCTTGGTGTTATATATG0.599500.430300.646600.750001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873CACAUUCACGUAUAUGAUA93.3797165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830891CACATTCACGTATATGATATATCATATACGTGAATGTG0.116000.069500.750000.750000.951100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
871-893GCCACATTCACGTATATGATACCUAUCAUAUACGUGAAUGUGGCCACAUUCACGUAUAUGAUACCU8.520.533


Target Position: 2897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2897GAUCCCCUUUCUACUUAAU84.8527723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982915GATCCCCTTTCTACTTAATATTAAGTAGAAAGGGGATC0.670100.356300.672400.750001.000001.00000


Target Position: 3125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125ACCUUUCAUCAUGAUCAUA83.772820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083143ACCTTTCATCATGATCATATATGATCATGATGAAAGGT0.337200.061700.810300.750001.000001.00000


Target Position: 1374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374GUUGAAUCUUCAGAUAUGA87.6159490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1372-1394CGGTTGAATCTTCAGATATGAAAUCAUAUCUGAAGAUUCAACCGGUUGAAUCUUCAGAUAUGAAAU13.316.322


Target Position: 2436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436AGAAAGCGAAAAAUGGAAC62.16823112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162454AGAAAGCGAAAAATGGAACGTTCCATTTTTCGCTTTCT0.165800.026800.577600.500001.000001.00000


Target Position: 1029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029GAUAUGAAAUUUUCUUAUU88.9693392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1027-1049TGGATATGAAATTTTCTTATTGTAAUAAGAAAAUUUCAUAUCCAGAUAUGAAAUUUUCUUAUUGUU6.98.722


Target Position: 3118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3118GGCAGUAACCUUUCAUCAU88.6073419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7563136GGCAGTAACCTTTCATCATATGATGAAAGGTTACTGCC0.196500.024700.844801.000000.929300.62500


Target Position: 2000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000CCAGUUACGUUCCUUCGAU82.9122896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882018CCAGTTACGTTCCTTCGATATCGAAGGAACGTAACTGG0.103900.063000.663801.000001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583GAGCAAAAGACAAUUAUUU86.7799582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382601GAGCAAAAGACAATTATTTAAATAATTGTCTTTTGCTC0.422300.229700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2581-2603TGGAGCAAAAGACAATTATTTTAAAAUAAUUGUCUUUUGCUCCAGAGCAAAAGACAAUUAUUUUAU-10.318.621


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901CCCUUUCUACUUAAUUUAC70.3472344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442919CCCTTTCTACTTAATTTACGTAAATTAAGTAGAAAGGG0.613000.545800.810300.750001.000001.00000


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816AGUAAAUAUCUUGUUUUUU76.33781629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4683834AGTAAATATCTTGTTTTTTAAAAAACAAGATATTTACT0.244300.118600.706900.750001.000001.00000


Target Position: 2482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482GAAUUGGAACAUUAUUACA96.124873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2480-2502AGGAATTGGAACATTATTACAGCUGUAAUAAUGUUCCAAUUCCUGAAUUGGAACAUUAUUACAGCU1.420.122


Target Position: 3512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3512GUCACUUUGCCAGCUCAAA81.35661065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403530GTCACTTTGCCAGCTCAAATTTGAGCTGGCAAAGTGAC0.142900.105500.819000.750000.978300.87500


Target Position: 2987, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987GUAUUUAAACCAUUGCAUU84.0771786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2985-3007TGGTATTTAAACCATTGCATTGCAAUGCAAUGGUUUAAAUACCAGUAUUUAAACCAUUGCAUUGCU19.9-7.522


Target Position: 781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GCUUUUUUCUCAGAAUGAA90.4318287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801AAGCTTTTTTCTCAGAATGAAGTUUCAUUCUGAGAAAAAAGCUUGCUUUUUUCUCAGAAUGAAGUU20.4-5.922


Target Position: 3479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3479CUCAAUUCAGAGAAAUCAU82.8733902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3477-3499TTCTCAATTCAGAGAAATCATCTAUGAUUUCUCUGAAUUGAGAACUCAAUUCAGAGAAAUCAUCUU16.316.323


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724GCACUUUGUCGCUAUUAAC78.23351399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373742GCACTTTGTCGCTATTAACGTTAATAGCGACAAAGTGC0.273300.132800.706900.750000.994600.62500


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634GCAGACUGUAAACAAGAAA88.4217431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1743652GCAGACTGTAAACAAGAAATTTCTTGTTTACAGTCTGC0.665200.161400.853401.000001.000001.00000


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222ACAAUUGCACAAUAUAUUU79.04271324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6543240ACAATTGCACAATATATTTAAATATATTGTGCAATTGT0.362600.036500.706900.750001.000001.00000


Target Position: 3406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406GUAAAGCCAUUUACAUAAU84.2742774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373424GTAAAGCCATTTACATAATATTATGTAAATGGCTTTAC0.178100.038700.672400.750001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GUUGGAAUUGGUAGAAAAA91.7839230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371898GTTGGAATTGGTAGAAAAATTTTTCTACCAATTCCAAC0.175300.042900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1878-1900AAGTTGGAATTGGTAGAAAAACTUUUUUCUACCAAUUCCAACUUGUUGGAAUUGGUAGAAAAACUU7.120.122


Target Position: 1365, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365CUUAAACCGGUUGAAUCUU68.64612539

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1363-1385TCCTTAAACCGGTTGAATCTTCAAAGAUUCAACCGGUUUAAGGACUUAAACCGGUUGAAUCUUCAU20.414.033


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692CUCAAUCAAGAAGUUGCAU72.76282034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631710CTCAATCAAGAAGTTGCATATGCAACTTCTTGATTGAG0.168700.071500.655200.750001.000001.00000


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705CAUGAGGAAAUGAGAGAAA91.6537240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992723CATGAGGAAATGAGAGAAATTTCTCTCATTTCCTCATG0.090500.012700.655200.750001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264CCAAGAAUUCUCAACCACA93.6628155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931282CCAAGAATTCTCAACCACATGTGGTTGAGAATTCTTGG0.127000.121400.637900.750001.000001.00000


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255ACCAUAUAGAGAUACUCAA88.693415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392273ACCATATAGAGATACTCAATTGAGTATCTCTATATGGT0.174800.089400.706900.750000.983700.75000


Target Position: 2125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2125CCACCACUACCACUGCCAC70.92572279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512143CCACCACTACCACTGCCACGTGGCAGTGGTAGTGGTGG0.667000.650400.551700.750001.000001.00000


Target Position: 611, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611GAUUUACAUUUCUGAUAAU96.731362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
609-631ATGATTTACATTTCTGATAATGTAUUAUCAGAAAUGUAAAUCAUGAUUUACAUUUCUGAUAAUGUU13.46.912


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919AGCAAAGAACCCAUUUUCU74.64371810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241937AGCAAAGAACCCATTTTCTAGAAAATGGGTTCTTTGCT0.206600.023400.629300.500001.000001.00000


Target Position: 3069, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069CCUUUUUCGAAUUAUUUUU73.94221884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7683087CCTTTTTCGAATTATTTTTAAAAATAATTCGAAAAAGG0.357700.023800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3067-3089TCCCTTTTTCGAATTATTTTTAAAAAAAUAAUUCGAAAAAGGGACCUUUUUCGAAUUAUUUUUAAU-9.75.522


Target Position: 2060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2060CGCAAGUCCUCAAAGCACA87.3577518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442078CGCAAGTCCTCAAAGCACATGTGCTTTGAGGACTTGCG0.173400.060200.715500.750000.945700.75000


Target Position: 3445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3445CUAGAAGGUAUGUGGCAUU80.84191123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8443463CTAGAAGGTATGTGGCATTAATGCCACATACCTTCTAG0.112800.023100.663800.750001.000001.00000


Target Position: 3227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227UGCACAAUAUAUUUUCUUA91.7615232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393245TGCACAATATATTTTCTTATAAGAAAATATATTGTGCA0.405800.297700.819000.750001.000001.00000


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369CGGCGAAGUAAAGAAUCUG72.84292027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861387CGGCGAAGTAAAGAATCTGCAGATTCTTTACTTCGCCG0.109800.043700.629300.750001.000001.00000


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GUCGACACAGCCUGGAUAU77.57871485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281033GTCGACACAGCCTGGATATATATCCAGGCTGTGTCGAC0.116700.038000.775900.750001.000001.00000


Target Position: 1929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1929CCAUUUUCUACUCAGGACA81.74331023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6711947CCATTTTCTACTCAGGACATGTCCTGAGTAGAAAATGG0.237600.072000.637900.750001.000001.00000


Target Position: 3814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3814ACAGUAAAUAUCUUGUUUU80.29881181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5073832ACAGTAAATATCTTGTTTTAAAACAAGATATTTACTGT0.223100.101800.706900.750001.000001.00000


Target Position: 2824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2824CUAUUUAUAUUUUCUACAU89.6541337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2822-2844GTCTATTTATATTTTCTACATCTAUGUAGAAAAUAUAAAUAGACCUAUUUAUAUUUUCUACAUCUU20.3-8.022


Target Position: 2586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586CAAAAGACAAUUAUUUUAA91.2193253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562604CAAAAGACAATTATTTTAATTAAAATAATTGTCTTTTG0.448700.332500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2584-2606AGCAAAAGACAATTATTTTAATAUUAAAAUAAUUGUCUUUUGCUCAAAAGACAAUUAUUUUAAUAU-7.513.311


Target Position: 3381, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3381GCUGUAUGGUUUAUUAUUU88.0496455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3379-3401ATGCTGTATGGTTTATTATTTAAAAAUAAUAAACCAUACAGCAUGCUGUAUGGUUUAUUAUUUAAU-8.017.932


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139UCAUCUGACCAAAACUCAU78.74341357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711157TCATCTGACCAAAACTCATATGAGTTTTGGTCAGATGA0.209800.055200.569000.750001.000001.00000


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739GGAACUUUCUUUUACCAUG79.38711281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651757GGAACTTTCTTTTACCATGCATGGTAAAAGAAAGTTCC0.576600.297700.715500.750001.000001.00000


Target Position: 3432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3432GAUAUGCAUAUAUCUAGAA98.639439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3430-3452AAGATATGCATATATCTAGAAGGUUCUAGAUAUAUGCAUAUCUUGAUAUGCAUAUAUCUAGAAGGU20.221.123


Target Position: 543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543CAGAUGAAUUGCUUUUAUU89.8118326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
541-563CACAGATGAATTGCTTTTATTTGAAUAAAAGCAAUUCAUCUGUGCAGAUGAAUUGCUUUUAUUUGU-4.320.422


Target Position: 3882, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3882GAUCUAACACUAACUGUAU94.418129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3880-3902TGGATCTAACACTAACTGTATTGAUACAGUUAGUGUUAGAUCCAGAUCUAACACUAACUGUAUUGU19.014.522


Target Position: 3825, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3825CUUGUUUUUUCUAUGUACA85.3562683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3823-3845ATCTTGTTTTTTCTATGTACATTUGUACAUAGAAAAAACAAGAUCUUGUUUUUUCUAUGUACAUUU15.85.622


Target Position: 3446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3446UAGAAGGUAUGUGGCAUUU68.83092514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003464TAGAAGGTATGTGGCATTTAAATGCCACATACCTTCTA0.113300.029900.672400.500001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256CCAUAUAGAGAUACUCAAA100.77124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872274CCATATAGAGATACTCAAATTTGAGTATCTCTATATGG0.194800.089800.844801.000000.983700.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2254-2276CACCATATAGAGATACTCAAAGTUUUGAGUAUCUCUAUAUGGUGCCAUAUAGAGAUACUCAAAGUU20.34.932


Target Position: 3661, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661CAUGCAUUCUUAGCAAAAU84.9668712

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3659-3681ATCATGCATTCTTAGCAAAATTGAUUUUGCUAAGAAUGCAUGAUCAUGCAUUCUUAGCAAAAUUGU18.619.923


Target Position: 1834, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834GUGAAUAUUGUUUUUAUGU76.66281592

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1832-1854CAGTGAATATTGTTTTTATGTGGACAUAAAAACAAUAUUCACUGGUGAAUAUUGUUUUUAUGUGGU-1.48.722


Target Position: 3095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095UGCCAAUAUAAUUUUUGUA82.3731961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003113TGCCAATATAATTTTTGTATACAAAAATTATATTGGCA0.153000.045900.672400.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CUGAAGACACAGAAGCAAA92.9767183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751924CTGAAGACACAGAAGCAAATTTGCTTCTGTGTCTTCAG0.083100.023600.784500.750000.972800.62500


Target Position: 3897, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897GUAUUGUUUUGUUACAUCA93.4746159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3895-3917CTGTATTGTTTTGTTACATCAAAUGAUGUAACAAAACAAUACAGGUAUUGUUUUGUUACAUCAAAU16.16.922


Target Position: 2172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172GACCGUAUGGAAGACAUUA92.2209210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802190GACCGTATGGAAGACATTATAATGTCTTCCATACGGTC0.129600.041500.784500.750001.000001.00000


Target Position: 3318, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318GGCCUAUGAAAUUGUUAAA92.6974191

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10331819GGCCTATGAAATTGTTAAA1/1/0/097.75HIF1ANM_181054.2+NM_001530.31+1NANANA14:62214355..62214373(+)00HIF1A(0.002)&MTMR12(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4163336GGCCTATGAAATTGTTAAATTTAACAATTTCATAGGCC0.271700.127201.000001.000001.000001.00000


Target Position: 1884, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884GAAUUGGUAGAAAAACUUU87.1483542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1882-1904TGGAATTGGTAGAAAAACTTTTTAAAGUUUUUCUACCAAUUCCAGAAUUGGUAGAAAAACUUUUUU3.218.822


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879AGUUGGAAUUGGUAGAAAA97.06955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321897AGTTGGAATTGGTAGAAAATTTTCTACCAATTCCAACT0.144500.032100.706900.750001.000001.00000


Target Position: 3583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3583GAUAUUAAACCUAAAUGUU89.0606387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853601GATATTAAACCTAAATGTTAACATTTAGGTTTAATATC0.146800.094700.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3581-3603CTGATATTAAACCTAAATGTTCTAACAUUUAGGUUUAAUAUCAGGAUAUUAAACCUAAAUGUUCUU6.9-8.022


Target Position: 3787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787GCAUUAUUUUAGGAAUAUA99.491733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3785-3807AAGCATTATTTTAGGAATATATAUAUAUUCCUAAAAUAAUGCUUGCAUUAUUUUAGGAAUAUAUAU15.4-1.832


Target Position: 1605, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605GAAAAAUUACAGAAUAUAA104.7652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261623GAAAAATTACAGAATATAATTATATTCTGTAATTTTTC0.698300.544200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1603-1625ACGAAAAATTACAGAATATAAATUUAUAUUCUGUAAUUUUUCGUGAAAAAUUACAGAAUAUAAAUU3.5-12.022


Target Position: 3673, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3673GCAAAAUUGCCUAGUAUGU77.55521487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403691GCAAAATTGCCTAGTATGTACATACTAGGCAATTTTGC0.104700.015300.646600.750000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3671-3693TAGCAAAATTGCCTAGTATGTTAACAUACUAGGCAAUUUUGCUAGCAAAAUUGCCUAGUAUGUUAU13.1-3.322


Target Position: 2175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175CGUAUGGAAGACAUUAAAA95.600186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162193CGTATGGAAGACATTAAAATTTTAATGTCTTCCATACG0.148300.034900.775901.000001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866CACAGGCCACAUUCACGUA91.8046228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750884CACAGGCCACATTCACGTATACGTGAATGTGGCCTGTG0.240300.025500.612100.750001.000001.00000


Target Position: 3292, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3292CUAGUUUUUAAGAAGAAAU81.20641078

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3290-3312AACTAGTTTTTAAGAAGAAATTTAUUUCUUCUUAAAAACUAGUUCUAGUUUUUAAGAAGAAAUUUU14.84.912


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137CUGCCACCACUGAUGAAUU82.4493957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882155CTGCCACCACTGATGAATTAATTCATCAGTGGTGGCAG0.157800.135300.775900.750000.929300.75000


Target Position: 2977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2977CAGUUUUUUGGUAUUUAAA91.1109259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2975-2997CTCAGTTTTTTGGTATTTAAACCUUUAAAUACCAAAAAACUGAGCAGUUUUUUGGUAUUUAAACCU-7.53.212


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512UGAUUUGGAUAUUGAAGAU83.4478851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982530TGATTTGGATATTGAAGATATCTTCAATATCCAAATCA0.334700.183800.543100.750001.000001.00000


Target Position: 3490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3490GAAAUCAUCUGAUGUUUCU84.6251742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3488-3510GAGAAATCATCTGATGTTTCTATAGAAACAUCAGAUGAUUUCUCGAAAUCAUCUGAUGUUUCUAUU14.87.232


Target Position: 1034, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034GAAAUUUUCUUAUUGUGAU89.0274391

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1032-1054ATGAAATTTTCTTATTGTGATGAAUCACAAUAAGAAAAUUUCAUGAAAUUUUCUUAUUGUGAUGAU20.5-12.022


Target Position: 3839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3839GUACAUUGUACAAAUUUUU81.61311038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3837-3859ATGTACATTGTACAAATTTTTCAAAAAAUUUGUACAAUGUACAUGUACAUUGUACAAAUUUUUCAU-12.013.522


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494UCAUCUGAUGUUUCUAUAG69.81722410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293512TCATCTGATGTTTCTATAGCTATAGAAACATCAGATGA0.280600.022600.551700.500001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595CUCACCCAACGAAAAAUUA80.94511102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341613CTCACCCAACGAAAAATTATAATTTTTCGTTGGGTGAG0.640800.328500.775900.750001.000001.00000


Target Position: 2819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2819GCAGUCUAUUUAUAUUUUC74.0041880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572837GCAGTCTATTTATATTTTCGAAAATATAAATAGACTGC0.485100.126700.681000.750001.000001.00000


Target Position: 3120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120CAGUAACCUUUCAUCAUGA95.692684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803138CAGTAACCTTTCATCATGATCATGATGAAAGGTTACTG0.320800.073400.560300.500001.000001.00000


Target Position: 3096, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096GCCAAUAUAAUUUUUGUAA87.9651462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6993114GCCAATATAATTTTTGTAATTACAAAAATTATATTGGC0.153100.132000.965501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3094-3116ATGCCAATATAATTTTTGTAAGAUUACAAAAAUUAUAUUGGCAUGCCAAUAUAAUUUUUGUAAGAU7.212.612


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763UGAGCUUUUUCUUAAUUUC66.71892707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192781TGAGCTTTTTCTTAATTTCGAAATTAAGAAAAAGCTCA0.577400.068600.551700.500001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220CACAUACAUAAAGAAACUA89.8956319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7182238CACATACATAAAGAAACTATAGTTTCTTTATGTATGTG0.633600.575800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2218-2240CCCACATACATAAAGAAACTACTUAGUUUCUUUAUGUAUGUGGGCACAUACAUAAAGAAACUACUU17.720.422


Target Position: 3579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3579AACUGAUAUUAAACCUAAA95.552288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003597AACTGATATTAAACCTAAATTTAGGTTTAATATCAGTT0.373700.102300.646600.500001.000001.00000


Target Position: 3911, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3911CAUCAAAUAAACAUCUUCU87.5051502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3909-3931TACATCAAATAAACATCTTCTGTAGAAGAUGUUUAUUUGAUGUACAUCAAAUAAACAUCUUCUGUU20.47.213


Target Position: 2902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902CCUUUCUACUUAAUUUACA86.5119597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622920CCTTTCTACTTAATTTACATGTAAATTAAGTAGAAAGG0.598500.530000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2900-2922CCCCTTTCTACTTAATTTACATTUGUAAAUUAAGUAGAAAGGGGCCUUUCUACUUAAUUUACAUUU-0.311.722


Target Position: 676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GUGUGUUUGAUUUUACUCA87.8648467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
674-696CAGTGTGTTTGATTTTACTCATCUGAGUAAAAUCAAACACACUGGUGUGUUUGAUUUUACUCAUCU14.619.332


Target Position: 3469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469GGAUAAAAUUCUCAAUUCA100.44728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3467-3489TTGGATAAAATTCTCAATTCAGAUGAAUUGAGAAUUUUAUCCAAGGAUAAAAUUCUCAAUUCAGAU16.32.122


Target Position: 3029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3029GCACCUUUUUAUUUAUUUA96.514765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993047GCACCTTTTTATTTATTTATAAATAAATAAAAAGGTGC0.723900.480800.819001.000001.000001.00000


Target Position: 3091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3091AAGAUGCCAAUAUAAUUUU74.55661815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903109AAGATGCCAATATAATTTTAAAATTATATTGGCATCTT0.211700.054200.637900.500001.000001.00000


Target Position: 2138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138UGCCACCACUGAUGAAUUA81.35381066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512156TGCCACCACTGATGAATTATAATTCATCAGTGGTGGCA0.415000.126100.819000.750000.929300.75000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597CACCCAACGAAAAAUUACA86.1816623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921615CACCCAACGAAAAATTACATGTAATTTTTCGTTGGGTG0.612800.500500.586200.500001.000001.00000


Target Position: 3577, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3577GUAACUGAUAUUAAACCUA91.8841224

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3575-3597GTGTAACTGATATTAAACCTAAAUAGGUUUAAUAUCAGUUACACGUAACUGAUAUUAAACCUAAAU18.620.322


Target Position: 1601, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601CAACGAAAAAUUACAGAAU86.3846607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171619CAACGAAAAATTACAGAATATTCTGTAATTTTTCGTTG0.603700.516900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1599-1621CCCAACGAAAAATTACAGAATATAUUCUGUAAUUUUUCGUUGGGCAACGAAAAAUUACAGAAUAUU20.315.322


Target Position: 533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533CAUGAAAGCACAGAUGAAU84.5105750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
531-553GACATGAAAGCACAGATGAATTGAUUCAUCUGUGCUUUCAUGUCCAUGAAAGCACAGAUGAAUUGU20.412.022


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708CAUUAAAAUUAGAACCAAA103.4888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351726CATTAAAATTAGAACCAAATTTGGTTCTAATTTTAATG0.436600.417200.655200.750001.000001.00000


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524GGCAGCAACGACACAGAAA92.305206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441542GGCAGCAACGACACAGAAATTTCTGTGTCGTTGCTGCC0.263700.050701.000001.000001.000001.00000


Target Position: 3556, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3556GGAAGUUUAUGCUAAUAUU97.221354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3554-3576GTGGAAGTTTATGCTAATATTGTAAUAUUAGCAUAAACUUCCACGGAAGUUUAUGCUAAUAUUGUU-2.713.322


Target Position: 3144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GGCAGUUGAAAAAUUUUUA89.8265324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273162GGCAGTTGAAAAATTTTTATAAAAATTTTTCAACTGCC0.217000.016000.965501.000001.000001.00000


Target Position: 3815, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3815CAGUAAAUAUCUUGUUUUU90.7755270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973833CAGTAAATATCTTGTTTTTAAAAACAAGATATTTACTG0.229500.109400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3813-3835CACAGTAAATATCTTGTTTTTTCAAAAACAAGAUAUUUACUGUGCAGUAAAUAUCUUGUUUUUUCU5.64.621


Target Position: 3126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126CCUUUCAUCAUGAUCAUAG74.50931821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5293144CCTTTCATCATGATCATAGCTATGATCATGATGAAAGG0.316800.067400.672400.750001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480AGGAAUUGGAACAUUAUUA88.1864444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112498AGGAATTGGAACATTATTATAATAATGTTCCAATTCCT0.298500.090800.810300.750001.000001.00000


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634GGGCAAUCAAUGGAUGAAA88.7288409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492652GGGCAATCAATGGATGAAATTTCATCCATTGATTGCCC0.272200.036900.991401.000000.983700.75000


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171AGACCGUAUGGAAGACAUU81.56441046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872189AGACCGTATGGAAGACATTAATGTCTTCCATACGGTCT0.128100.044900.715500.750001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252UCAUAUAUAACACCAAGAA84.0783785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201270TCATATATAACACCAAGAATTCTTGGTGTTATATATGA0.562600.408800.551700.750001.000001.00000


Target Position: 3295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295GUUUUUAAGAAGAAAUUUU80.21791193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3293-3315TAGTTTTTAAGAAGAAATTTTTTAAAAUUUCUUCUUAAAAACUAGUUUUUAAGAAGAAAUUUUUUU0.4-9.121


Target Position: 2289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289CCAAACAGAGCAGGAAAAG61.97233132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692307CCAAACAGAGCAGGAAAAGCTTTTCCTGCTCTGTTTGG0.187400.023600.706900.750001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020CACAGCCUGGAUAUGAAAU79.3351288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351038CACAGCCTGGATATGAAATATTTCATATCCAGGCTGTG0.601700.068500.784500.750001.000001.00000


Target Position: 3457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3457UGGCAUUUAUUUGGAUAAA77.81041459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893475TGGCATTTATTTGGATAAATTTATCCAAATAAATGCCA0.079200.013700.844800.750001.000001.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151GAAAAAUUUUUACACCUUU85.0989701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293169GAAAAATTTTTACACCTTTAAAGGTGTAAAAATTTTTC0.832100.075800.672400.750001.000001.00000


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760CCAGAUUCAGGAUCAGACA88.2223441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361778CCAGATTCAGGATCAGACATGTCTGATCCTGAATCTGG0.417300.051200.637900.750001.000001.00000


Target Position: 3638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3638ACUGUAAACAAGAAAAAAA88.1828445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443656ACTGTAAACAAGAAAAAAATTTTTTTCTTGTTTACAGT0.698900.438700.706900.750001.000001.00000


Target Position: 2964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964CAGCUCAUUUUCUCAGUUU83.7134825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632982CAGCTCATTTTCTCAGTTTAAACTGAGAAAATGAGCTG0.344500.194400.784500.750001.000001.00000


Target Position: 2896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896UGAUCCCCUUUCUACUUAA86.5476595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152914TGATCCCCTTTCTACTTAATTAAGTAGAAAGGGGATCA0.650700.343600.689700.750001.000001.00000


Target Position: 3885, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885CUAACACUAACUGUAUUGU73.87071896

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3883-3905ATCTAACACTAACTGTATTGTTTACAAUACAGUUAGUGUUAGAUCUAACACUAACUGUAUUGUUUU13.519.023


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125CGCCCGCUUCUCUCUAGUC70.03592383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779143CGCCCGCTTCTCTCTAGTCGACTAGAGAGAAGCGGGCG0.614800.102600.603400.750001.000001.00000


Target Position: 635, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635CAAAUACAUGGGAUUAACU85.6675652

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
633-655AACAAATACATGGGATTAACTCAAGUUAAUCCCAUGUAUUUGUUCAAAUACAUGGGAUUAACUCAU10.06.933


Target Position: 2299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299CAGGAAAAGGAGUCAUAGA92.2493209

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2297-2319AGCAGGAAAAGGAGTCATAGAACUCUAUGACUCCUUUUCCUGCUCAGGAAAAGGAGUCAUAGAACU20.318.722


Target Position: 3450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3450AGGUAUGUGGCAUUUAUUU79.47281267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933468AGGTATGTGGCATTTATTTAAATAAATGCCACATACCT0.077500.025200.844800.750001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962CAUUCCUCACCCAUCAAAU84.341766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745980CATTCCTCACCCATCAAATATTTGATGGGTGAGGAATG0.159000.061800.646600.750001.000001.00000


Target Position: 3458, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3458GGCAUUUAUUUGGAUAAAA90.4814285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013476GGCATTTATTTGGATAAAATTTTATCCAAATAAATGCC0.186800.016901.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3456-3478GTGGCATTTATTTGGATAAAATTUUUUAUCCAAAUAAAUGCCACGGCAUUUAUUUGGAUAAAAUUU15.515.322


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CCCUCACCCAACGAAAAAU74.54721817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161611CCCTCACCCAACGAAAAATATTTTTCGTTGGGTGAGGG0.632100.231300.982801.000001.000001.00000


Target Position: 2547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547GUAAAAGGAUGCAAAUCUA97.979245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2545-2567GTGTAAAAGGATGCAAATCTAGTUAGAUUUGCAUCCUUUUACACGUAAAAGGAUGCAAAUCUAGUU12.011.022


Target Position: 2609, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2609CUCUGAUUUAGCAUGUAGA88.2479440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2607-2629CCCTCTGATTTAGCATGTAGACTUCUACAUGCUAAAUCAGAGGGCUCUGAUUUAGCAUGUAGACUU17.920.432


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239ACUCAAGCAACUGUCAUAU75.2861750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251257ACTCAAGCAACTGTCATATATATGACAGTTGCTTGAGT0.241100.076700.663800.750001.000001.00000


Target Position: 2666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2666GCUGACCAGUUAUGAUUGU76.05851668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792684GCTGACCAGTTATGATTGTACAATCATAACTGGTCAGC0.205100.047400.646600.750001.000001.00000


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278GGACAGCCUCACCAAACAG79.06841320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052296GGACAGCCTCACCAAACAGCTGTTTGGTGAGGCTGTCC0.133000.016700.586200.750000.962000.75000


Target Position: 633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633AACAAAUACAUGGGAUUAA81.14131087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894651AACAAATACATGGGATTAATTAATCCCATGTATTTGTT0.133500.061300.612100.500001.000001.00000


Target Position: 2399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399ACUAAAUCCAAAGAUACUA81.9121001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872417ACTAAATCCAAAGATACTATAGTATCTTTGGATTTAGT0.160100.096200.534500.750001.000001.00000


Target Position: 3567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3567CUAAUAUUGUGUAACUGAU89.4158359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3565-3587TGCTAATATTGTGTAACTGATATAUCAGUUACACAAUAUUAGCACUAAUAUUGUGUAACUGAUAUU20.3-8.032


Target Position: 3613, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613GUUGGUAUAAAGAUAUUUU86.9025568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8323631GTTGGTATAAAGATATTTTAAAATATCTTTATACCAAC0.153200.020500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3611-3633CTGTTGGTATAAAGATATTTTGAAAAAUAUCUUUAUACCAACAGGUUGGUAUAAAGAUAUUUUGAU1.820.023


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463ACCUGAUGCUUUAACUUUG71.18742244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7561481ACCTGATGCTTTAACTTTGCAAAGTTAAAGCATCAGGT0.149600.061100.706900.500001.000001.00000


Target Position: 3481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3481CAAUUCAGAGAAAUCAUCU84.4312758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3479-3501CTCAATTCAGAGAAATCATCTGAAGAUGAUUUCUCUGAAUUGAGCAAUUCAGAGAAAUCAUCUGAU16.212.022


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859GGCUACAAUACUGCACAAA87.1132548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612877GGCTACAATACTGCACAAATTTGTGCAGTATTGTAGCC0.340400.064201.000001.000000.956500.87500


Target Position: 3797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3797AGGAAUAUAUAGUUGUCAC79.23881301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573815AGGAATATATAGTTGTCACGTGACAACTATATATTCCT0.154200.014600.551700.500001.000001.00000


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959ACCCAUUCCUCACCCAUCA74.76861799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911977ACCCATTCCTCACCCATCATGATGGGTGAGGAATGGGT0.098700.045400.629300.500001.000001.00000


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955GAUCACAGACAGCUCAUUU89.6006343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412973GATCACAGACAGCTCATTTAAATGAGCTGTCTGTGATC0.390900.080800.681000.750001.000001.00000


Target Position: 2557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2557GCAAAUCUAGUGAACAGAA95.713882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802575GCAAATCTAGTGAACAGAATTCTGTTCACTAGATTTGC0.277700.032800.681001.000000.978300.62500


Target Position: 2301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301GGAAAAGGAGUCAUAGAAC80.97571096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912319GGAAAAGGAGTCATAGAACGTTCTATGACTCCTTTTCC0.078200.020100.724100.750001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830AUAUUUUCUACAUCUAAUU76.24941639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972848ATATTTTCTACATCTAATTAATTAGATGTAGAAAATAT0.368000.166900.534500.500001.000001.00000


Target Position: 3418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3418ACAUAAUAUAGAAAGAUAU88.393432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643436ACATAATATAGAAAGATATATATCTTTCTATATTATGT0.170100.024100.663800.750001.000001.00000


Target Position: 3733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3733CGCUAUUAACAUCCUUUUU80.8691115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1473751CGCTATTAACATCCTTTTTAAAAAGGATGTTAATAGCG0.553400.283300.922401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3731-3753GTCGCTATTAACATCCTTTTTTTAAAAAGGAUGUUAAUAGCGACCGCUAUUAACAUCCUUUUUUUU18.714.922


Target Position: 1042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042CUUAUUGUGAUGAAAGAAU79.07491317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1040-1062TTCTTATTGTGATGAAAGAATTAAUUCUUUCAUCACAAUAAGAACUUAUUGUGAUGAAAGAAUUAU14.86.922


Target Position: 3409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3409AAGCCAUUUACAUAAUAUA92.324205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843427AAGCCATTTACATAATATATATATTATGTAAATGGCTT0.338800.078600.594800.500001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069UCAAAGCACAGUUACAGUA80.7951127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642087TCAAAGCACAGTTACAGTATACTGTAACTGTGCTTTGA0.207100.016700.543100.750001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277CGGACAGCCUCACCAAACA88.5301427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082295CGGACAGCCTCACCAAACATGTTTGGTGAGGCTGTCCG0.612700.021900.706900.750000.962000.62500


Target Position: 3754, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3754CAUGUAGAUUUCAAUAAUU92.9923181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8623772CATGTAGATTTCAATAATTAATTATTGAAATCTACATG0.109700.042400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3752-3774TTCATGTAGATTTCAATAATTGAAAUUAUUGAAAUCUACAUGAACAUGUAGAUUUCAAUAAUUGAU-1.820.322


Target Position: 3268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268GGAAUAUAUUCUGCGUUUA93.1582173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393286GGAATATATTCTGCGTTTATAAACGCAGAATATATTCC0.114000.052900.836201.000001.000001.00000


Target Position: 3062, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3062GUUUAUCCCUUUUUCGAAU79.7731236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3060-3082GAGTTTATCCCTTTTTCGAATTAAUUCGAAAAAGGGAUAAACUCGUUUAUCCCUUUUUCGAAUUAU16.815.532


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577GGAAUGGAGCAAAAGACAA93.4466162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2482595GGAATGGAGCAAAAGACAATTGTCTTTTGCTCCATTCC0.472600.127000.724101.000001.000001.00000


Target Position: 1285, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GCAUUGUAUGUGUGAAUUA96.955657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1283-1305GTGCATTGTATGTGTGAATTACGUAAUUCACACAUACAAUGCACGCAUUGUAUGUGUGAAUUACGU14.813.523


Target Position: 2242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2242GUGCCACAUCAUCACCAUA94.8611115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2862260GTGCCACATCATCACCATATATGGTGATGATGTGGCAC0.364900.243500.750000.750000.994600.75000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017CGACACAGCCUGGAUAUGA85.9387639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771035CGACACAGCCTGGATATGATCATATCCAGGCTGTGTCG0.132000.036900.569000.750001.000001.00000


Target Position: 2636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GCAAUCAAUGGAUGAAAGU74.57191813

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2634-2656GGGCAATCAATGGATGAAAGTGGACUUUCAUCCAUUGAUUGCCCGCAAUCAAUGGAUGAAAGUGGU12.013.832


Target Position: 3077, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3077GAAUUAUUUUUAAGAAGAU93.3951163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3075-3097TCGAATTATTTTTAAGAAGATGCAUCUUCUUAAAAAUAAUUCGAGAAUUAUUUUUAAGAAGAUGCU19.1-10.322


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094CAGACUCAAAUACAAGAAC71.85752160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862112CAGACTCAAATACAAGAACGTTCTTGTATTTGAGTCTG0.418700.355000.637900.500001.000001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306AACGACAAGAAAAAGAUAA80.39531172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776324AACGACAAGAAAAAGATAATTATCTTTTTCTTGTCGTT0.677800.366300.612100.500001.000001.00000


Target Position: 3279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3279UGCGUUUAUAAAACUAGUU69.29992465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063297TGCGTTTATAAAACTAGTTAACTAGTTTTATAAACGCA0.156000.087500.706900.750001.000001.00000


Target Position: 3746, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3746CUUUUUUUCAUGUAGAUUU77.71541471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7573764CTTTTTTTCATGTAGATTTAAATCTACATGAAAAAAAG0.135800.089500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3744-3766TCCTTTTTTTCATGTAGATTTCAAAAUCUACAUGAAAAAAAGGACUUUUUUUCAUGUAGAUUUCAU14.5-11.321


Target Position: 3753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3753UCAUGUAGAUUUCAAUAAU83.8817809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003771TCATGTAGATTTCAATAATATTATTGAAATCTACATGA0.125100.063000.715500.750001.000001.00000


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278CUGCGUUUAUAAAACUAGU78.84751345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793296CTGCGTTTATAAAACTAGTACTAGTTTTATAAACGCAG0.168200.050000.577600.500001.000001.00000


Target Position: 1147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147CCAAAACUCAUCAUGAUAU86.8045578

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1145-1167GACCAAAACTCATCATGATATGTAUAUCAUGAUGAGUUUUGGUCCCAAAACUCAUCAUGAUAUGUU14.910.322


Target Position: 3637, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3637GACUGUAAACAAGAAAAAA95.94877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6693655GACTGTAAACAAGAAAAAATTTTTTCTTGTTTACAGTC0.689700.408000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3635-3657CAGACTGTAAACAAGAAAAAAAAUUUUUUCUUGUUUACAGUCUGGACUGUAAACAAGAAAAAAAAU5.519.021


Target Position: 2302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302GAAAAGGAGUCAUAGAACA94.8806113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2300-2322AGGAAAAGGAGTCATAGAACAGAUGUUCUAUGACUCCUUUUCCUGAAAAGGAGUCAUAGAACAGAU14.518.721


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523UGGCAGCAACGACACAGAA83.4116854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741541TGGCAGCAACGACACAGAATTCTGTGTCGTTGCTGCCA0.261900.023400.672400.750001.000001.00000


Target Position: 2910, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2910CUUAAUUUACAUUAAUGCU76.16271649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2908-2930TACTTAATTTACATTAATGCTCTAGCAUUAAUGUAAAUUAAGUACUUAAUUUACAUUAAUGCUCUU15.3-9.722


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878AAGUUGGAAUUGGUAGAAA85.1279697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431896AAGTTGGAATTGGTAGAAATTTCTACCAATTCCAACTT0.134000.026900.637900.500001.000001.00000


Target Position: 3257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257CAGUUACUCAUGGAAUAUA94.7696118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583275CAGTTACTCATGGAATATATATATTCCATGAGTAACTG0.454700.426100.741400.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3255-3277AGCAGTTACTCATGGAATATATTUAUAUUCCAUGAGUAACUGCUCAGUUACUCAUGGAAUAUAUUU15.417.632


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023AGCCUGGAUAUGAAAUUUU75.70071705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391041AGCCTGGATATGAAATTTTAAAATTTCATATCCAGGCT0.151100.026400.853400.750001.000001.00000


Target Position: 2872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872CACAAACUUGGUUAGUUCA88.1795446

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2870-2892TGCACAAACTTGGTTAGTTCAATUGAACUAACCAAGUUUGUGCACACAAACUUGGUUAGUUCAAUU14.617.832


Target Position: 179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
179GGACUUGCCUUUCCUUCUC68.98722502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883197GGACTTGCCTTTCCTTCTCGAGAAGGAAAGGCAAGTCC0.265000.108600.560300.750000.962000.62500


Target Position: 122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122UGCCGCCCGCUUCUCUCUA66.90272691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622140TGCCGCCCGCTTCTCTCTATAGAGAGAAGCGGGCGGCA0.348900.040900.681000.750000.913000.75000


Target Position: 1600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600CCAACGAAAAAUUACAGAA90.0816309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391618CCAACGAAAAATTACAGAATTCTGTAATTTTTCGTTGG0.593600.493100.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1598-1620ACCCAACGAAAAATTACAGAATAUUCUGUAAUUUUUCGUUGGGUCCAACGAAAAAUUACAGAAUAU20.321.122


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129CGCUUCUCUCUAGUCUCAC66.83362695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719147CGCTTCTCTCTAGTCTCACGTGAGACTAGAGAGAAGCG0.352400.099400.629300.750001.000001.00000


Target Position: 2311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311UCAUAGAACAGACAGAAAA83.9752800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7262329TCATAGAACAGACAGAAAATTTTCTGTCTGTTCTATGA0.146500.085800.724100.750001.000001.00000


Target Position: 1935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1935UCUACUCAGGACACAGAUU74.051876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581953TCTACTCAGGACACAGATTAATCTGTGTCCTGAGTAGA0.355900.129800.715500.750001.000001.00000


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305GAACGACAAGAAAAAGAUA99.434236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710323GAACGACAAGAAAAAGATATATCTTTTTCTTGTCGTTC0.485700.067400.629300.750001.000001.00000


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287CACCAAACAGAGCAGGAAA91.6542239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8922305CACCAAACAGAGCAGGAAATTTCCTGCTCTGTTTGGTG0.102900.051600.793100.750001.000001.00000


Target Position: 1343, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343CCUUCAACAAACAGAAUGU80.20381194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431361CCTTCAACAAACAGAATGTACATTCTGTTTGTTGAAGG0.192000.087100.637900.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1341-1363TCCCTTCAACAAACAGAATGTGTACAUUCUGUUUGUUGAAGGGACCUUCAACAAACAGAAUGUGUU18.119.231


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128CCGCUUCUCUCUAGUCUCA87.3569519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399146CCGCTTCTCTCTAGTCTCATGAGACTAGAGAGAAGCGG0.754700.262100.689700.750001.000001.00000


Target Position: 3701, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3701CAAAAUACAAUGUUUGAUU83.8407813

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3699-3721CTCAAAATACAATGTTTGATTTTAAUCAAACAUUGUAUUUUGAGCAAAAUACAAUGUUUGAUUUUU14.8-0.321


Target Position: 3760, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760GAUUUCAAUAAUUGAGUAA92.7954188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383778GATTTCAATAATTGAGTAATTACTCAATTATTGAAATC0.114000.033400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3758-3780TAGATTTCAATAATTGAGTAATTUUACUCAAUUAUUGAAAUCUAGAUUUCAAUAAUUGAGUAAUUU20.37.422


Target Position: 3732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732UCGCUAUUAACAUCCUUUU68.05942592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3193750TCGCTATTAACATCCTTTTAAAAGGATGTTAATAGCGA0.486600.215600.793100.750001.000001.00000


Target Position: 1562, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GGAAGUACCAUUAUAUAAU94.1296139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1560-1582GAGGAAGTACCATTATATAATGAAUUAUAUAAUGGUACUUCCUCGGAAGUACCAUUAUAUAAUGAU-5.921.423


Target Position: 1698, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1698CAAGAAGUUGCAUUAAAAU88.5581423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281716CAAGAAGTTGCATTAAAATATTTTAATGCAACTTCTTG0.681200.115900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1696-1718ATCAAGAAGTTGCATTAAAATTAAUUUUAAUGCAACUUCUUGAUCAAGAAGUUGCAUUAAAAUUAU-9.717.722


Target Position: 3881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3881GGAUCUAACACUAACUGUA102.10817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3879-3901TTGGATCTAACACTAACTGTATTUACAGUUAGUGUUAGAUCCAAGGAUCUAACACUAACUGUAUUU19.016.023


Target Position: 2829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829UAUAUUUUCUACAUCUAAU84.8362726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952847TATATTTTCTACATCTAATATTAGATGTAGAAAATATA0.380700.182000.534500.500001.000001.00000


Target Position: 2669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669GACCAGUUAUGAUUGUGAA99.64731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182687GACCAGTTATGATTGTGAATTCACAATCATAACTGGTC0.212900.041400.646600.750001.000001.00000


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700AGAAGUUGCAUUAAAAUUA88.5907420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031718AGAAGTTGCATTAAAATTATAATTTTAATGCAACTTCT0.555100.065500.689700.750001.000001.00000


Target Position: 3580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580ACUGAUAUUAAACCUAAAU77.31951512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853598ACTGATATTAAACCTAAATATTTAGGTTTAATATCAGT0.355300.186300.698300.750001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518GGAUAUUGAAGAUGACAUG83.1636875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782536GGATATTGAAGATGACATGCATGTCATCTTCAATATCC0.128800.104500.715500.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066UCCUCAAAGCACAGUUACA81.66671029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142084TCCTCAAAGCACAGTTACATGTAACTGTGCTTTGAGGA0.681800.138100.663800.500001.000001.00000


Target Position: 2665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665AGCUGACCAGUUAUGAUUG72.32982102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9742683AGCTGACCAGTTATGATTGCAATCATAACTGGTCAGCT0.169400.044600.706900.500001.000001.00000


Target Position: 1328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328CGACUUGAUUUUCUCCCUU81.88521004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941346CGACTTGATTTTCTCCCTTAAGGGAGAAAATCAAGTCG0.419900.022400.655201.000001.000001.00000


Target Position: 3220, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220CCACAAUUGCACAAUAUAU91.7615231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993238CCACAATTGCACAATATATATATATTGTGCAATTGTGG0.359400.022200.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3218-3240AGCCACAATTGCACAATATATTTAUAUAUUGUGCAAUUGUGGCUCCACAAUUGCACAAUAUAUUUU0.012.122


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813AGCCGAGGAAGAACUAUGA81.65981032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989831AGCCGAGGAAGAACTATGATCATAGTTCTTCCTCGGCT0.219500.031900.629300.500001.000001.00000


Target Position: 2139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139GCCACCACUGAUGAAUUAA84.5101751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2502157GCCACCACTGATGAATTAATTAATTCATCAGTGGTGGC0.417000.116800.965501.000000.929300.62500


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996ACUUCCAGUUACGUUCCUU73.86121897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652014ACTTCCAGTTACGTTCCTTAAGGAACGTAACTGGAAGT0.199400.055800.569000.750001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UCUAGUGAACAGAAUGGAA85.995638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372580TCTAGTGAACAGAATGGAATTCCATTCTGTTCACTAGA0.388600.045700.551700.750001.000001.00000


Target Position: 3909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3909UACAUCAAAUAAACAUCUU73.18251984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623927TACATCAAATAAACATCTTAAGATGTTTATTTGATGTA0.187800.056000.543100.500001.000001.00000


Target Position: 3500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3500GAUGUUUCUAUAGUCACUU80.93631104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603518GATGTTTCTATAGTCACTTAAGTGACTATAGAAACATC0.341800.136500.543100.750001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747GUGAAAAAGGGUAAAGAAC69.8252408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793765GTGAAAAAGGGTAAAGAACGTTCTTTACCCTTTTTCAC0.259400.055400.646600.500001.000001.00000


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165GACAAAAGACCGUAUGGAA98.539441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852183GACAAAAGACCGTATGGAATTCCATACGGTCTTTTGTC0.079900.060600.646600.750001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230ACAAUAUAUUUUCUUAAAA88.8567399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2973248ACAATATATTTTCTTAAAATTTTAAGAAAATATATTGT0.411000.308500.706900.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704CCAUGAGGAAAUGAGAGAA91.2068256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
955722CCATGAGGAAATGAGAGAATTCTCTCATTTCCTCATGG0.141200.014800.672401.000001.000001.00000


Target Position: 3640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3640UGUAAACAAGAAAAAAAAA83.2967866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2933658TGTAAACAAGAAAAAAAAATTTTTTTTTCTTGTTTACA0.726900.408300.706900.750001.000001.00000


Target Position: 2860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860GCUACAAUACUGCACAAAC79.24241300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3422878GCTACAATACTGCACAAACGTTTGTGCAGTATTGTAGC0.335300.099900.706900.750000.956500.75000


Target Position: 3938, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3938GGAAAAAAAAAAAAAAAAA90.1922300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1123956GGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCC0.999600.885600.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3936-3958CAGGAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUCCUGGGAAAAAAAAAAAAAAAAAAAU-11.30.700


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CACGUAUAUGAUACCAACA91.8143227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993897CACGTATATGATACCAACATGTTGGTATCATATACGTG0.151300.057400.586200.500000.983700.87500


Target Position: 2821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821AGUCUAUUUAUAUUUUCUA92.0427217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912839AGTCTATTTATATTTTCTATAGAAAATATAAATAGACT0.496600.152300.534500.750001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437AGCCUCUUUGACAAACUUA84.0594791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931455AGCCTCTTTGACAAACTTATAAGTTTGTCAAAGAGGCT0.198100.012700.819000.750000.945700.62500


Target Position: 2478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2478GUAGGAAUUGGAACAUUAU89.8086328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082496GTAGGAATTGGAACATTATATAATGTTCCAATTCCTAC0.254700.081400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2476-2498CAGTAGGAATTGGAACATTATTAAUAAUGUUCCAAUUCCUACUGGUAGGAAUUGGAACAUUAUUAU6.919.932


Target Position: 2558, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558CAAAUCUAGUGAACAGAAU85.3636680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282576CAAATCTAGTGAACAGAATATTCTGTTCACTAGATTTG0.194900.027100.637900.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2556-2578TGCAAATCTAGTGAACAGAATGGAUUCUGUUCACUAGAUUUGCACAAAUCUAGUGAACAGAAUGGU19.26.922


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CCAGACGAUCAUGCAGCUA81.74641022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242523CCAGACGATCATGCAGCTATAGCTGCATGATCGTCTGG0.117600.045100.672401.000001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182GUCACCACAGGACAGUACA81.86361007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951200GTCACCACAGGACAGTACATGTACTGTCCTGTGGTGAC0.198000.012600.612100.500000.989100.75000


Target Position: 3258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3258AGUUACUCAUGGAAUAUAU89.2473372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003276AGTTACTCATGGAATATATATATATTCCATGAGTAACT0.474300.435700.663800.750000.967400.75000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572AGAAUGGAAUGGAGCAAAA89.3199364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3642590AGAATGGAATGGAGCAAAATTTTGCTCCATTCCATTCT0.359500.084700.724100.750001.000001.00000


Target Position: 3076, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3076CGAAUUAUUUUUAAGAAGA88.9218393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473094CGAATTATTTTTAAGAAGATCTTCTTAAAAATAATTCG0.233700.077800.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3074-3096TTCGAATTATTTTTAAGAAGATGUCUUCUUAAAAAUAAUUCGAACGAAUUAUUUUUAAGAAGAUGU11.71.833


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633GGGGCAAUCAAUGGAUGAA88.6995413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542651GGGGCAATCAATGGATGAATTCATCCATTGATTGCCCC0.111600.027600.819001.000000.983700.62500


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967CUCACCCAUCAAAUAUUGA79.57521256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809985CTCACCCATCAAATATTGATCAATATTTGATGGGTGAG0.333200.062700.586200.500001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101CGCUCAAUUUAUGAAUAUU89.1958376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471119CGCTCAATTTATGAATATTAATATTCATAAATTGAGCG0.091100.015800.913801.000000.962000.75000


Target Position: 2312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312CAUAGAACAGACAGAAAAA100.87921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802330CATAGAACAGACAGAAAAATTTTTCTGTCTGTTCTATG0.267700.088400.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2310-2332GTCATAGAACAGACAGAAAAATCUUUUUCUGUCUGUUCUAUGACCAUAGAACAGACAGAAAAAUCU12.214.512


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005UGCAGUAGCAUCAUUUUAA86.3235614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2273023TGCAGTAGCATCATTTTAATTAAAATGATGCTACTGCA0.611300.136900.819000.750000.902200.62500


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CCCAUUCCUCACCCAUCAA82.7008925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846978CCCATTCCTCACCCATCAATTGATGGGTGAGGAATGGG0.112600.051600.844801.000001.000001.00000


Target Position: 3404, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3404GGGUAAAGCCAUUUACAUA103.16613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9963422GGGTAAAGCCATTTACATATATGTAAATGGCTTTACCC0.126700.012600.948301.000000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3402-3424ATGGGTAAAGCCATTTACATAATUAUGUAAAUGGCUUUACCCAUGGGUAAAGCCAUUUACAUAAUU6.918.622


Target Position: 2393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2393GGAAGAACUAAAUCCAAAG80.85041120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722411GGAAGAACTAAATCCAAAGCTTTGGATTTAGTTCTTCC0.245500.046500.732800.750000.972800.62500


Target Position: 3744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3744UCCUUUUUUUCAUGUAGAU72.41212082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233762TCCTTTTTTTCATGTAGATATCTACATGAAAAAAAGGA0.225900.161000.689700.750001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098CUCAAAUACAAGAACCUAC72.0822133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622116CTCAAATACAAGAACCTACGTAGGTTCTTGTATTTGAG0.191300.092600.629300.500001.000001.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481GGAAUUGGAACAUUAUUAC77.11981541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282499GGAATTGGAACATTATTACGTAATAATGTTCCAATTCC0.363500.097700.689700.750001.000001.00000


Target Position: 3783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3783AGAAGCAUUAUUUUAGGAA84.9406716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413801AGAAGCATTATTTTAGGAATTCCTAAAATAATGCTTCT0.105700.034900.551700.750001.000001.00000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008AGUAGCAUCAUUUUAAAAA85.6372656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5833026AGTAGCATCATTTTAAAAATTTTTAAAATGATGCTACT0.426300.045600.706900.750001.000001.00000


Target Position: 3858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3858CAUUCCUUUUGCUCUUUGU77.63771479

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3856-3878TTCATTCCTTTTGCTCTTTGTGGACAAAGAGCAAAAGGAAUGAACAUUCCUUUUGCUCUUUGUGGU16.618.722


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509UGGUGAUUUGGAUAUUGAA90.2968292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
855527TGGTGATTTGGATATTGAATTCAATATCCAAATCACCA0.334200.019000.672400.750001.000001.00000


Target Position: 3028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3028UGCACCUUUUUAUUUAUUU69.22332476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103046TGCACCTTTTTATTTATTTAAATAAATAAAAAGGTGCA0.691700.357500.853400.750001.000001.00000


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369UGAUUCUUAAAUGCUGUAU67.40752642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753387TGATTCTTAAATGCTGTATATACAGCATTTAAGAATCA0.241100.117100.681000.750001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323AAGUUCUGAACGUCGAAAA80.77261131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954341AAGTTCTGAACGTCGAAAATTTTCGACGTTCAGAACTT0.090000.016800.637900.500000.983700.62500


Target Position: 2441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441GCGAAAAAUGGAACAUGAU84.8689722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2439-2461AAGCGAAAAATGGAACATGATGGAUCAUGUUCCAUUUUUCGCUUGCGAAAAAUGGAACAUGAUGGU20.57.723


Target Position: 624, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624GAUAAUGUGAACAAAUACA93.8434150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
622-644CTGATAATGTGAACAAATACATGUGUAUUUGUUCACAUUAUCAGGAUAAUGUGAACAAAUACAUGU6.96.722


Target Position: 3460, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460CAUUUAUUUGGAUAAAAUU87.8279470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443478CATTTATTTGGATAAAATTAATTTTATCCAAATAAATG0.091800.016300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3458-3480GGCATTTATTTGGATAAAATTCTAAUUUUAUCCAAAUAAAUGCCCAUUUAUUUGGAUAAAAUUCUU-10.3-10.322


Target Position: 3411, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3411GCCAUUUACAUAAUAUAGA85.3945678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5223429GCCATTTACATAATATAGATCTATATTATGTAAATGGC0.242600.081200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3409-3431AAGCCATTTACATAATATAGAAAUCUAUAUUAUGUAAAUGGCUUGCCAUUUACAUAAUAUAGAAAU-2.712.832


Target Position: 1364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364CCUUAAACCGGUUGAAUCU77.70731472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1362-1384GTCCTTAAACCGGTTGAATCTTCAGAUUCAACCGGUUUAAGGACCCUUAAACCGGUUGAAUCUUCU16.34.933


Target Position: 2878, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878CUUGGUUAGUUCAAUUUUU81.20461080

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2876-2898AACTTGGTTAGTTCAATTTTTGAAAAAAUUGAACUAACCAAGUUCUUGGUUAGUUCAAUUUUUGAU-3.320.031


Target Position: 2773, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2773CUUAAUUUCAUUCCUUUUU68.80322515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272791CTTAATTTCATTCCTTTTTAAAAAGGAATGAAATTAAG0.446800.291300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2771-2793TTCTTAATTTCATTCCTTTTTTTAAAAAGGAAUGAAAUUAAGAACUUAAUUUCAUUCCUUUUUUUU18.7-9.711


Target Position: 3936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936CAGGAAAAAAAAAAAAAAA88.5309426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5473954CAGGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCCTG0.999200.061800.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3934-3956ACCAGGAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUCCUGGUCAGGAAAAAAAAAAAAAAAAAU-11.318.700


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510GGUGAUUUGGAUAUUGAAG77.14081537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657528GGTGATTTGGATATTGAAGCTTCAATATCCAAATCACC0.344600.036400.715500.750001.000001.00000


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345CCCUAACGUGUUAUCUGUC71.03932266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872363CCCTAACGTGTTATCTGTCGACAGATAACACGTTAGGG0.104200.094300.672400.750001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GGUAUUAUUCAGCACGACU85.6335657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921332GGTATTATTCAGCACGACTAGTCGTGCTGAATAATACC0.077900.012800.646600.750001.000001.00000


Target Position: 3267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3267UGGAAUAUAUUCUGCGUUU76.10461661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9153285TGGAATATATTCTGCGTTTAAACGCAGAATATATTCCA0.096900.046900.844800.750001.000001.00000


Target Position: 2219, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219CCACAUACAUAAAGAAACU85.6774651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102237CCACATACATAAAGAAACTAGTTTCTTTATGTATGTGG0.654100.525000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2217-2239ACCCACATACATAAAGAAACTACAGUUUCUUUAUGUAUGUGGGUCCACAUACAUAAAGAAACUACU13.320.422


Target Position: 644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644GGGAUUAACUCAGUUUGAA93.8485149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
642-664ATGGGATTAACTCAGTTTGAACTUUCAAACUGAGUUAAUCCCAUGGGAUUAACUCAGUUUGAACUU19.215.533


Target Position: 1941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941CAGGACACAGAUUUAGACU80.731137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491959CAGGACACAGATTTAGACTAGTCTAAATCTGTGTCCTG0.138500.076400.577600.500001.000001.00000


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145GCAGUUGAAAAAUUUUUAC69.66822423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303163GCAGTTGAAAAATTTTTACGTAAAAATTTTTCAACTGC0.256300.015500.672400.750001.000001.00000


Target Position: 2874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2874CAAACUUGGUUAGUUCAAU83.801816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2872-2894CACAAACTTGGTTAGTTCAATTTAUUGAACUAACCAAGUUUGUGCAAACUUGGUUAGUUCAAUUUU19.210.332


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022CAGCCUGGAUAUGAAAUUU84.3434765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701040CAGCCTGGATATGAAATTTAAATTTCATATCCAGGCTG0.463900.083800.784500.750001.000001.00000


Target Position: 3163, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3163CACCUUUUUUUUCACAUUU77.88731449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5133181CACCTTTTTTTTCACATTTAAATGTGAAAAAAAAGGTG0.231400.154900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3161-3183TACACCTTTTTTTTCACATTTTAAAAUGUGAAAAAAAAGGUGUACACCUUUUUUUUCACAUUUUAU20.517.321


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136ACUGCCACCACUGAUGAAU67.01122681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032154ACTGCCACCACTGATGAATATTCATCAGTGGTGGCAGT0.151800.085800.698300.750000.929300.75000


Target Position: 3560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3560GUUUAUGCUAAUAUUGUGU75.82161690

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3558-3580AAGTTTATGCTAATATTGTGTAAACACAAUAUUAGCAUAAACUUGUUUAUGCUAAUAUUGUGUAAU13.515.323


Target Position: 2927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927CUCUUUUUUAGUAUGUUCU73.75881909

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2925-2947TGCTCTTTTTTAGTATGTTCTTTAGAACAUACUAAAAAAGAGCACUCUUUUUUAGUAUGUUCUUUU16.15.521


Target Position: 3413, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413CAUUUACAUAAUAUAGAAA99.611432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6353431CATTTACATAATATAGAAATTTCTATATTATGTAAATG0.177000.066300.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3411-3433GCCATTTACATAATATAGAAAGAUUUCUAUAUUAUGUAAAUGGCCAUUUACAUAAUAUAGAAAGAU8.46.922


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525GCAGCAACGACACAGAAAC72.81592030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171543GCAGCAACGACACAGAAACGTTTCTGTGTCGTTGCTGC0.148100.040200.706900.750001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GGUAAAGAACAAAACACAC79.28671294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897774GGTAAAGAACAAAACACACGTGTGTTTTGTTCTTTACC0.729100.471600.560300.750001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342CCCUUCAACAAACAGAAUG62.69943075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511360CCCTTCAACAAACAGAATGCATTCTGTTTGTTGAAGGG0.201000.093400.836200.750000.989100.62500


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014UCGAUCAGUUGUCACCAUU70.66752306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522032TCGATCAGTTGTCACCATTAATGGTGACAACTGATCGA0.253600.137800.784500.750000.972800.87500


Target Position: 1569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CCAUUAUAUAAUGAUGUAA93.7126154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1567-1589TACCATTATATAATGATGTAATGUUACAUCAUUAUAUAAUGGUACCAUUAUAUAAUGAUGUAAUGU21.50.022


Target Position: 3639, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3639CUGUAAACAAGAAAAAAAA90.1071306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1643657CTGTAAACAAGAAAAAAAATTTTTTTTCTTGTTTACAG0.689100.411400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3637-3659GACTGTAAACAAGAAAAAAAAAAUUUUUUUUCUUGUUUACAGUCCUGUAAACAAGAAAAAAAAAAU-11.314.721


Target Position: 3175, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175CACAUUUUACAUAAAUAAU87.6045492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4203193CACATTTTACATAAATAATATTATTTATGTAAAATGTG0.667500.501900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3173-3195TTCACATTTTACATAAATAATAAAUUAUUUAUGUAAAAUGUGAACACAUUUUACAUAAAUAAUAAU-7.55.321


Target Position: 2218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218CCCACAUACAUAAAGAAAC69.96162391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232236CCCACATACATAAAGAAACGTTTCTTTATGTATGTGGG0.658700.531800.844800.750001.000001.00000


Target Position: 3068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068CCCUUUUUCGAAUUAUUUU75.91421680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3066-3088ATCCCTTTTTCGAATTATTTTTAAAAAUAAUUCGAAAAAGGGAUCCCUUUUUCGAAUUAUUUUUAU-10.39.532


Target Position: 1403, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403GCUAUUCACCAAAGUUGAA90.2382298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1401-1423CAGCTATTCACCAAAGTTGAATCUUCAACUUUGGUGAAUAGCUGGCUAUUCACCAAAGUUGAAUCU19.213.422