siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 176   184   187   222   272   480   515   568   581   587   623   628   640   681   773   795   812   845   846   1001  
1002   1013   1050   1059   1095   1096   1124   1133   1144   1198   1210   1211   1300   1301   1303   1307   1353   1354   1360   1361  
1396   1405   1413   1421   1430   1472   1482   1503   1564   1666   1681   1691   1899   1985   1998   2116   2133   2226   2243   2362  
2363   2370   2371   2379   2461   2505   2552   2561   2587   2598   2599   2626   2628   2629   2634   2640   2643   2649   2786   2791  
2796   2800   2806   2807   2858   2881   2925   2959   2960   2963   2992   2993   3066   3111   3116   3119   3120   3148   3149   3150  
3160   3164   3188   3225   3228   3275   3276   3371   3397   3398   3408   3425   3428   3452   3469   3528   3610   3640   3649   3661  
Biltr, Rnaxs 114   115   116   117   118   125   128   185   190   192   195   196   200   201   213   214   219   220   221   225  
226   228   260   261   262   265   266   267   268   271   304   307   308   309   310   311   312   313   317   318  
319   320   321   327   345   354   355   361   373   374   375   376   377   382   386   387   394   408   421   422  
423   434   442   443   447   448   454   464   482   499   500   501   502   503   504   505   506   507   508   509  
510   512   530   531   536   537   538   544   545   549   550   552   554   558   572   596   602   604   621   622  
625   626   654   655   658   659   660   679   680   706   726   732   736   737   740   741   742   746   770   791  
792   793   798   802   810   811   813   842   921   922   923   974   975   978   1020   1021   1022   1023   1026   1027  
1028   1029   1030   1031   1032   1035   1036   1054   1055   1056   1057   1058   1074   1075   1083   1108   1112   1113   1119   1120  
1121   1168   1169   1201   1216   1220   1231   1232   1235   1242   1243   1246   1255   1256   1257   1258   1271   1272   1277   1284  
1285   1286   1293   1294   1325   1326   1327   1337   1338   1339   1340   1341   1345   1346   1348   1349   1350   1351   1352   1382  
1389   1390   1392   1393   1394   1398   1439   1444   1445   1497   1498   1535   1542   1550   1551   1626   1627   1630   1631   1634  
1637   1638   1639   1667   1672   1673   1675   1676   1679   1699   1700   1734   1735   1737   1738   1741   1742   1743   1746   1747  
1751   1788   1790   1791   1792   1799   1805   1806   1807   1808   1810   1811   1813   1847   1894   1895   1898   1900   1903   1907  
1908   1982   1983   1984   1992   1993   2081   2088   2089   2090   2096   2100   2101   2192   2193   2202   2203   2208   2210   2211  
2214   2215   2216   2217   2218   2219   2223   2224   2225   2252   2304   2305   2307   2349   2377   2378   2381   2398   2401   2402  
2403   2404   2405   2407   2408   2410   2411   2412   2415   2416   2424   2429   2443   2444   2455   2456   2457   2494   2495   2534  
2535   2563   2564   2571   2584   2585   2663   2664   2677   2700   2701   2702   2703   2704   2758   2762   2770   2771   2772   2776  
2777   2780   2798   2825   2826   2827   2832   2836   2837   2838   2854   2855   2857   2866   2868   2871   2872   2883   2894   2902  
2930   2931   2932   2972   3025   3031   3032   3043   3044   3045   3046   3050   3051   3052   3056   3064   3065   3069   3081   3082  
3083   3084   3085   3089   3090   3091   3094   3095   3096   3104   3105   3106   3108   3113   3126   3135   3139   3141   3172   3174  
3178   3185   3186   3187   3197   3201   3207   3208   3212   3213   3214   3215   3246   3250   3260   3265   3266   3270   3293   3294  
3295   3296   3302   3303   3304   3306   3311   3312   3314   3317   3319   3322   3323   3324   3331   3342   3343   3355   3356   3357  
3361   3365   3366   3367   3368   3369   3370   3372   3373   3378   3383   3385   3386   3387   3439   3446   3447   3448   3457   3459  
3467   3507   3508   3509   3566   3568   3569   3574   3578   3579   3580   3581   3587   3588   3591   3594   3595   3596   3598   3620  
3624   3625   3653   3657   3658   3676   3677   3679  
Biltr, Rnaxs, Sidirect 119   120   126   191   193   269   270   322   383   384   388   483   511   595   597   598   603   771   803   1024  
1033   1060   1098   1122   1217   1236   1278   1399   1440   1441   1748   1749   1750   2082   2123   2382   2409   2458   2459   2556  
2557   2665   2761   2799   2828   2829   2839   2865   2867   2869   2873   2884   2893   2895   2968   2969   2973   3054   3055   3057  
3070   3107   3179   3198   3237   3238   3247   3248   3251   3305   3307   3308   3313   3315   3318   3374   3414   3449   3450   3458  
3619   3626   3651   3652   3659  


Target Position: 2217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2217CGACUGUUGGUUCUAUUUU81.1956954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252235CGACTGTTGGTTCTATTTTAAAATAGAACCAACAGTCG0.138000.036700.793101.000001.000001.00000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408GGGAGUUUGCUAAAUUUGA86.8212479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2712426GGGAGTTTGCTAAATTTGATCAAATTTAGCAAACTCCC0.461300.064900.767200.750001.000001.00000


Target Position: 3626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3626GUUUUAACAGUUCACUUUU79.91991072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6533644GTTTTAACAGTTCACTTTTAAAAGTGAACTGTTAAAAC0.203100.129900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3624-3646TAGTTTTAACAGTTCACTTTTTAAAAAGUGAACUGUUAAAACUAGUUUUAACAGUUCACUUUUUAU19.20.021


Target Position: 2827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827GCGAUUGAAAGGGCAAUAG64.25122715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232845GCGATTGAAAGGGCAATAGCTATTGCCCTTTCAATCGC0.073300.011100.750000.750001.000001.00000


Target Position: 3056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056UGUAAAAUACGUUUGAAAU79.21161142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4683074TGTAAAATACGTTTGAAATATTTCAAACGTATTTTACA0.371900.035600.698300.750001.000001.00000


Target Position: 2381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381AGCUUUUAAUGAUAAUUCA89.8322290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322399AGCTTTTAATGATAATTCATGAATTATCATTAAAAGCT0.065600.009300.629300.500001.000001.00000


Target Position: 3581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3581CCAUCUUGUUUCACACUAG83.1435778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973599CCATCTTGTTTCACACTAGCTAGTGTGAAACAAGATGG0.163100.113700.672400.750001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439AGGAUUCUGACAGCUUUAA78.43821233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131457AGGATTCTGACAGCTTTAATTAAAGCTGTCAGAATCCT0.565400.068100.810300.750001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083UGCUCACCUUGUCCAGAAA84.6155646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521101TGCTCACCTTGTCCAGAAATTTCTGGACAAGGTGAGCA0.223000.023500.853400.750001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031ACCUGGAAAAUAAUAUGUA86.7716482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841049ACCTGGAAAATAATATGTATACATATTATTTTCCAGGT0.550200.361900.672400.750001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459GUGAAAAUCCUAUUUAUAA96.956464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3752477GTGAAAATCCTATTTATAATTATAAATAGGATTTTCAC0.420600.053500.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2457-2479GGGTGAAAATCCTATTTATAAGAUUAUAAAUAGGAUUUUCACCCGUGAAAAUCCUAUUUAUAAGAU-8.07.432


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213GAUAAAAGAACCGAGCAAU83.5163747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3673231GATAAAAGAACCGAGCAATATTGCTCGGTTCTTTTATC0.325900.168600.672400.750001.000001.00000


Target Position: 3387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3387GUAUUUGUUUGCAAUUUUG75.00841612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723405GTATTTGTTTGCAATTTTGCAAAATTGCAAACAAATAC0.076300.026600.534500.500001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278GGAAAACGGCAAAUUGUCA89.8545288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951296GGAAAACGGCAAATTGTCATGACAATTTGCCGTTTTCC0.051800.004700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1276-1298TTGGAAAACGGCAAATTGTCAGAUGACAAUUUGCCGUUUUCCAAGGAAAACGGCAAAUUGUCAGAU14.815.323


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746GCACAAGUGAACAGAACUG76.66391428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767764GCACAAGTGAACAGAACTGCAGTTCTGTTCACTTGTGC0.088300.029300.569000.750001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675AGGAAAGAAAACAGUUCAG69.00182289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821693AGGAAAGAAAACAGTTCAGCTGAACTGTTTTCTTTCCT0.270400.211800.560300.500001.000001.00000


Target Position: 1124, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124CAAUUUUUGCAGUUACUGA91.783199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1122-1144GACAATTTTTGCAGTTACTGAAGUCAGUAACUGCAAAAAUUGUCCAAUUUUUGCAGUUACUGAAGU19.0-12.022


Target Position: 3107, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107GAGAGUUAGGAAGGAAAAA88.7082349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103125GAGAGTTAGGAAGGAAAAATTTTTCCTTCCTAACTCTC0.232100.026600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3105-3127CAGAGAGTTAGGAAGGAAAAACCUUUUUCCUUCCUAACUCUCUGGAGAGUUAGGAAGGAAAAACCU18.718.922


Target Position: 3148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148GCCAUUUUAAGAGUUACUU72.68131892

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3146-3168GTGCCATTTTAAGAGTTACTTAAAAGUAACUCUUAAAAUGGCACGCCAUUUUAAGAGUUACUUAAU17.611.323


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219ACUGUUGGUUCUAUUUUAC68.71332318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252237ACTGTTGGTTCTATTTTACGTAAAATAGAACCAACAGT0.089700.024300.525900.500001.000001.00000


Target Position: 3566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3566CACCAUUUGAGUUGCCCAU76.3221472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5703584CACCATTTGAGTTGCCCATATGGGCAACTCAAATGGTG0.451700.110100.637900.750000.967400.62500


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294UCAGAAGGAGUAACAAUAA85.8974549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441312TCAGAAGGAGTAACAATAATTATTGTTACTCCTTCTGA0.060300.021300.689700.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258CUUUCCUCAGAAGUCAUUU71.97831968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641276CTTTCCTCAGAAGTCATTTAAATGACTTCTGAGGAAAG0.166900.011500.637900.750001.000001.00000


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355CCAGAUGACAUAGAAAAUC67.56582424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434373CCAGATGACATAGAAAATCGATTTTCTATGTCATCTGG0.190300.106900.663800.750000.978300.62500


Target Position: 3094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094UGGGAAAAAUUCAGAGAGU72.57781908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583112TGGGAAAAATTCAGAGAGTACTCTCTGAATTTTTCCCA0.057400.056700.637900.500001.000001.00000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791UGAUAAUUUCAACUGUGAU82.3964848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531809TGATAATTTCAACTGTGATATCACAGTTGAAATTATCA0.345600.023400.543100.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508CCACAGACAUUUACAUUAA97.163860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109526CCACAGACATTTACATTAATTAATGTAAATGTCTGTGG0.686900.378800.810301.000001.000001.00000


Target Position: 3619, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3619GCCUUUAGUUUUAACAGUU84.6124648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2183637GCCTTTAGTTTTAACAGTTAACTGTTAAAACTAAAGGC0.354700.263300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3617-3639GTGCCTTTAGTTTTAACAGTTCAAACUGUUAAAACUAAAGGCACGCCUUUAGUUUUAACAGUUCAU19.015.823


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898ACUGUUCUUUGGAUACUAG75.54221562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741916ACTGTTCTTTGGATACTAGCTAGTATCCAAAGAACAGT0.065600.004600.534500.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812GAGAAGUAUUUAAUGAACU86.8234478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
810-832AGGAGAAGTATTTAATGAACTTGAGUUCAUUAAAUACUUCUCCUGAGAAGUAUUUAAUGAACUUGU14.818.923


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788GUGUGAUAAUUUCAACUGU84.0694700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021806GTGTGATAATTTCAACTGTACAGTTGAAATTATCACAC0.066400.006200.586200.500001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GAAACUGAGUGAAAAUAAU93.7802135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901116GAAACTGAGTGAAAATAATATTATTTTCACTCAGTTTC0.180200.004300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118CAGAAACTGAGTGAAAATAATATAUUAUUUUCACUCAGUUUCUGGAAACUGAGUGAAAAUAAUAUU-9.719.212


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327AGAAGCCUUAAAAAAGAAG64.00142736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947345AGAAGCCTTAAAAAAGAAGCTTCTTTTTTAAGGCTTCT0.059600.008900.586200.500001.000001.00000


Target Position: 2992, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2992GCUAUUUGCCUGUUAGACA90.3006258

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2990-3012TTGCTATTTGCCTGTTAGACATGUGUCUAACAGGCAAAUAGCAAGCUAUUUGCCUGUUAGACAUGU21.43.533


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265UGGUGCACAAAUUCAACAU73.41151809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960283TGGTGCACAAATTCAACATATGTTGAATTTGTGCACCA0.303400.005000.689700.750001.000001.00000


Target Position: 272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272CAAAUUCAACAUUUUUACA89.0716321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
270-292CACAAATTCAACATTTTTACAGGUGUAAAAAUGUUGAAUUUGUGCAAAUUCAACAUUUUUACAGGU0.07.421


Target Position: 3081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081UCUACAAAGGCCAUGGGAA77.83071311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033099TCTACAAAGGCCATGGGAATTCCCATGGCCTTTGTAGA0.394100.103600.551700.750001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373CCCAGAGGCUCCAAAGAUA92.3183183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112391CCCAGAGGCTCCAAAGATATATCTTTGGAGCCTCTGGG0.630800.164500.948301.000001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352GGGAAAAUGGAAGAAAAUG71.22582050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341370GGGAAAATGGAAGAAAATGCATTTTCTTCCATTTTCCC0.061300.030200.836200.750001.000001.00000


Target Position: 3528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528GAGUUAGUGCCAUAACAGA95.3173101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3526-3548TTGAGTTAGTGCCATAACAGACCUCUGUUAUGGCACUAACUCAAGAGUUAGUGCCAUAACAGACCU11.617.633


Target Position: 2969, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2969GAUUGUUUUAAAUCUGUUA94.6507118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462987GATTGTTTTAAATCTGTTATAACAGATTTAAAACAATC0.060000.020700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2967-2989AGGATTGTTTTAAATCTGTTATTUAACAGAUUUAAAACAAUCCUGAUUGUUUUAAAUCUGUUAUUU19.25.322


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CCUUUUCUUCCUGGACUAU76.08011495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2612789CCTTTTCTTCCTGGACTATATAGTCCAGGAAGAAAAGG0.312700.077800.801701.000001.000001.00000


Target Position: 3276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276CAUACUUUACAAAGUAUUU86.6607489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3274-3296GCCATACTTTACAAAGTATTTGCAAAUACUUUGUAAAGUAUGGCCAUACUUUACAAAGUAUUUGCU4.64.622


Target Position: 1472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GCUUUACGGAGGAAGUAGA86.2597517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1470-1492GGGCTTTACGGAGGAAGTAGAGGUCUACUUCCUCCGUAAAGCCCGCUUUACGGAGGAAGUAGAGGU18.912.033


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810AGAUCCAAUGGCUUAAUUU81.9985884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551828AGATCCAATGGCTTAATTTAAATTAAGCCATTGGATCT0.085000.015200.724100.750001.000001.00000


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029UCACCUGGAAAAUAAUAUG65.42522612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521047TCACCTGGAAAATAATATGCATATTATTTTCCAGGTGA0.519000.127700.569000.500001.000001.00000


Target Position: 3119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119GGAAAAACCAAUAGCUUUA92.1955187

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3117-3139AAGGAAAAACCAATAGCTTTAAAUAAAGCUAUUGGUUUUUCCUUGGAAAAACCAAUAGCUUUAAAU18.38.722


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GAAAAUAAUAUUCAGACAA93.8892131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261126GAAAATAATATTCAGACAATTGTCTGAATATTATTTTC0.089900.049800.525900.750001.000001.00000


Target Position: 507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
507GCCACAGACAUUUACAUUA92.2582184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66525GCCACAGACATTTACATTATAATGTAAATGTCTGTGGC0.658600.271700.965501.000001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023ACAAUGUCACCUGGAAAAU70.07852175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911041ACAATGTCACCTGGAAAATATTTTCCAGGTGACATTGT0.490600.039100.698300.750001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277UGGAAAACGGCAAAUUGUC58.17913129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961295TGGAAAACGGCAAATTGTCGACAATTTGCCGTTTTCCA0.051200.004200.525900.500001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191CAGAUGAAAAUAGAUGUUU78.2391261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608209CAGATGAAAATAGATGTTTAAACATCTATTTTCATCTG0.113300.053200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
189-211AACAGATGAAAATAGATGTTTAAAAACAUCUAUUUUCAUCUGUUCAGAUGAAAAUAGAUGUUUAAU19.220.402


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457GGGUGAAAAUCCUAUUUAU99.778419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192475GGGTGAAAATCCTATTTATATAAATAGGATTTTCACCC0.110900.030400.948301.000001.000001.00000


Target Position: 1985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985GUACAGAUCCGAAGUUUCA89.4376306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1983-2005GTGTACAGATCCGAAGTTTCAAGUGAAACUUCGGAUCUGUACACGUACAGAUCCGAAGUUUCAAGU13.320.332


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214GCAAAUGCCAAAUCAUGUG70.02692182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799232GCAAATGCCAAATCATGTGCACATGATTTGGCATTTGC0.077900.010800.560300.750001.000001.00000


Target Position: 3187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187CCUUCACUUUACAAAUUCA96.153783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6403205CCTTCACTTTACAAATTCATGAATTTGTAAAGTGAAGG0.707400.605700.620700.750001.000001.00000


Target Position: 2193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2193CCAUUGUAAGGAGAAGGAU78.93651169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692211CCATTGTAAGGAGAAGGATATCCTTCTCCTTACAATGG0.068200.008900.663801.000001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020UGGACAAUGUCACCUGGAA84.758634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461038TGGACAATGTCACCTGGAATTCCAGGTGACATTGTCCA0.169800.017600.672400.750000.994600.62500


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654UACUUCGGACUUCAGAAUU66.52182524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998672TACTTCGGACTTCAGAATTAATTCTGAAGTCCGAAGTA0.050900.011500.672400.500001.000001.00000


Target Position: 1749, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1749GGAUAAUACAAAUGAAAUU91.7445204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151767GGATAATACAAATGAAATTAATTTCATTTGTATTATCC0.092500.053700.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1747-1769AGGGATAATACAAATGAAATTTAAAUUUCAUUUGUAUUAUCCCUGGAUAAUACAAAUGAAAUUUAU7.23.522


Target Position: 3113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3113UAGGAAGGAAAAACCAAUA79.60891100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793131TAGGAAGGAAAAACCAATATATTGGTTTTTCCTTCCTA0.094800.011500.629300.500000.978301.00000


Target Position: 1341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341GAAUGGAACAGGGGAAAAU82.5898824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6551359GAATGGAACAGGGGAAAATATTTTCCCCTGTTCCATTC0.414500.101500.663800.750001.000001.00000


Target Position: 3054, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3054GGUGUAAAAUACGUUUGAA98.559340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6323072GGTGTAAAATACGTTTGAATTCAAACGTATTTTACACC0.106900.035400.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3052-3074CTGGTGTAAAATACGTTTGAAATUUCAAACGUAUUUUACACCAGGGUGUAAAAUACGUUUGAAAUU21.114.723


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679AAGAAAACAGUUCAGAAAU77.87121303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931697AAGAAAACAGTTCAGAAATATTTCTGAACTGTTTTCTT0.123100.109500.629300.500001.000001.00000


Target Position: 3108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3108AGAGUUAGGAAGGAAAAAC66.31052544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713126AGAGTTAGGAAGGAAAAACGTTTTTCCTTCCTAACTCT0.103600.013700.577600.500001.000001.00000


Target Position: 1339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339GUGAAUGGAACAGGGGAAA75.05431610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061357GTGAATGGAACAGGGGAAATTTCCCCTGTTCCATTCAC0.163700.083900.793100.750001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121AGACAAUUUUUGCAGUUAC73.65991779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921139AGACAATTTTTGCAGTTACGTAACTGCAAAAATTGTCT0.106100.062200.543100.500001.000001.00000


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983GUGUACAGAUCCGAAGUUU80.6531007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532001GTGTACAGATCCGAAGTTTAAACTTCGGATCTGTACAC0.174300.063000.793100.750001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805GUGAUAGAUCCAAUGGCUU80.33831041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821823GTGATAGATCCAATGGCTTAAGCCATTGGATCTATCAC0.099100.038700.655200.750001.000001.00000


Target Position: 549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549UCCCAUUGACCUCUACUAC61.60262892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
977567TCCCATTGACCTCTACTACGTAGTAGAGGTCAATGGGA0.294200.010500.689700.500001.000001.00000


Target Position: 2640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640GUACAAUAUGUAUAAUUUU89.8093293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2638-2660ATGTACAATATGTATAATTTTTAAAAAUUAUACAUAUUGUACAUGUACAAUAUGUAUAAUUUUUAU-10.38.522


Target Position: 2665, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665GUUUUAUUAUUUUGAAAAU84.5625651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892683GTTTTATTATTTTGAAAATATTTTCAAAATAATAAAAC0.118500.026800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2663-2685ATGTTTTATTATTTTGAAAATAAAUUUUCAAAAUAAUAAAACAUGUUUUAUUAUUUUGAAAAUAAU7.7-9.721


Target Position: 3657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657UACUGAAGUUAUUUAUUAA97.441554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273675TACTGAAGTTATTTATTAATTAATAAATAACTTCAGTA0.110800.005600.646600.500001.000001.00000


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250UGAUUUAGCACUAUUUACA84.1331694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9513268TGATTTAGCACTATTTACATGTAAATAGTGCTAAATCA0.318800.023400.517200.500001.000001.00000


Target Position: 2208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208GGAUGUUGACGACUGUUGG74.88691630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322226GGATGTTGACGACTGTTGGCCAACAGTCGTCAACATCC0.101200.005500.525900.500001.000001.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261UGGGUGGUGCACAAAUUCA79.23571138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845279TGGGTGGTGCACAAATTCATGAATTTGTGCACCACCCA0.554100.012900.620700.500001.000001.00000


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445CUGACAGCUUUAAAAUUAG76.10491491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871463CTGACAGCTTTAAAATTAGCTAATTTTAAAGCTGTCAG0.302200.207900.612100.500001.000001.00000


Target Position: 2973, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2973GUUUUAAAUCUGUUAUUUU87.7444406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122991GTTTTAAATCTGTTATTTTAAAATAACAGATTTAAAAC0.156200.019500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2971-2993TTGTTTTAAATCTGTTATTTTGCAAAAUAACAGAUUUAAAACAAGUUUUAAAUCUGUUAUUUUGCU-0.3-9.122


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510ACAGACAUUUACAUUAAAA90.9989235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619528ACAGACATTTACATTAAAATTTTAATGTAAATGTCTGT0.740100.488200.706900.750001.000001.00000


Target Position: 1564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564GGAAAUGGGACAUUUGAGU76.66091429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1562-1584AAGGAAATGGGACATTTGAGTGTACUCAAAUGUCCCAUUUCCUUGGAAAUGGGACAUUUGAGUGUU12.020.122


Target Position: 603, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603GGAGAAUGUAAAAAGUCUU88.6453353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865621GGAGAATGTAAAAAGTCTTAAGACTTTTTACATTCTCC0.068300.036900.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
601-623TTGGAGAATGTAAAAAGTCTTGGAAGACUUUUUACAUUCUCCAAGGAGAAUGUAAAAAGUCUUGGU17.720.423


Target Position: 3091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3091CCAUGGGAAAAAUUCAGAG72.88951867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893109CCATGGGAAAAATTCAGAGCTCTGAATTTTTCCCATGG0.089400.076600.534500.750001.000001.00000


Target Position: 2226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2226GUUCUAUUUUACGUAUUCA90.3961253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2224-2246TGGTTCTATTTTACGTATTCAGTUGAAUACGUAAAAUAGAACCAGUUCUAUUUUACGUAUUCAGUU16.56.923


Target Position: 3322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3322UUAUUUUAUUAUUUUUAUU78.03171285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203340TTATTTTATTATTTTTATTAATAAAAATAATAAAATAA0.511800.346600.525900.500001.000001.00000


Target Position: 2416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416GCUAAAUUUGAAAAGGAGA83.2813766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902434GCTAAATTTGAAAAGGAGATCTCCTTTTCAAATTTAGC0.502300.277400.629300.750001.000001.00000


Target Position: 3178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178ACUUUUAUGCCUUCACUUU75.78851532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5293196ACTTTTATGCCTTCACTTTAAAGTGAAGGCATAAAAGT0.762200.089400.706900.750001.000001.00000


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319AAUUUAUUUUAUUAUUUUU87.1964445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9953337AATTTATTTTATTATTTTTAAAAATAATAAAATAAATT0.484400.294000.508600.500001.000001.00000


Target Position: 2857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2857AGCAUGAUGAGAGUUUCUG63.07932801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742875AGCATGATGAGAGTTTCTGCAGAAACTCTCATCATGCT0.081100.006800.569000.500001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398CAUGACAGAAGGGAGUUUG66.90952497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942416CATGACAGAAGGGAGTTTGCAAACTCCCTTCTGTCATG0.139600.020300.508600.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771CCCAUUUAGCUACAAAAAU76.63071435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
600789CCCATTTAGCTACAAAAATATTTTTGTAGCTAAATGGG0.115400.026400.982801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
769-791AGCCCATTTAGCTACAAAAATGTAUUUUUGUAGCUAAAUGGGCUCCCAUUUAGCUACAAAAAUGUU5.612.822


Target Position: 388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388GAUAUAAAGAAAAAUAAAA97.406155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644406GATATAAAGAAAAATAAAATTTTATTTTTCTTTATATC0.924100.868300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
386-408AAGATATAAAGAAAAATAAAAATUUUUAUUUUUCUUUAUAUCUUGAUAUAAAGAAAAAUAAAAAUU-9.7-8.011


Target Position: 2216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2216ACGACUGUUGGUUCUAUUU74.54671682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782234ACGACTGTTGGTTCTATTTAAATAGAACCAACAGTCGT0.067000.041100.775900.750001.000001.00000


Target Position: 2895, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895GAUUUUUAGCUUUACAAAU87.0079462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3712913GATTTTTAGCTTTACAAATATTTGTAAAGCTAAAAATC0.504700.397400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2893-2915CTGATTTTTAGCTTTACAAATATAUUUGUAAAGCUAAAAAUCAGGAUUUUUAGCUUUACAAAUAUU7.2-9.722


Target Position: 3064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3064ACGUUUGAAAUAGUUGAUC56.22733244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7583082ACGTTTGAAATAGTTGATCGATCAACTATTTCAAACGT0.096200.060500.594800.500001.000001.00000


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808AUAGAUCCAAUGGCUUAAU68.68462322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831826ATAGATCCAATGGCTTAATATTAAGCCATTGGATCTAT0.104100.023900.534500.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CAGUUGAUCAUUGAUGCAU81.1193962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6991249CAGTTGATCATTGATGCATATGCATCAATGATCAACTG0.096700.020200.629300.750001.000001.00000


Target Position: 628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628GAUCUGAUGAAUGAAAUGA87.3572431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
626-648CAGATCTGATGAATGAAATGAGGUCAUUUCAUUCAUCAGAUCUGGAUCUGAUGAAUGAAAUGAGGU13.820.422


Target Position: 2796, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2796CAAGCUUAUUGGAUUAAGU85.8604556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2794-2816ATCAAGCTTATTGGATTAAGTGAACUUAAUCCAAUAAGCUUGAUCAAGCUUAUUGGAUUAAGUGAU6.918.333


Target Position: 2556, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556GCAAAGUAGCAAUUUCCAU84.5117659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6972574GCAAAGTAGCAATTTCCATATGGAAATTGCTACTTTGC0.206800.015100.698301.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2554-2576ATGCAAAGTAGCAATTTCCATAGAUGGAAAUUGCUACUUUGCAUGCAAAGUAGCAAUUUCCAUAGU20.111.822


Target Position: 126, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126GAUGAAUUUACAACCAAUU84.6129647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741144GATGAATTTACAACCAATTAATTGGTTGTAAATTCATC0.087900.071400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
124-146AAGATGAATTTACAACCAATTTTAAUUGGUUGUAAAUUCAUCUUGAUGAAUUUACAACCAAUUUUU18.87.203


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216UCUAGCAAUGUAAUUCAGU65.96982571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551234TCTAGCAATGTAATTCAGTACTGAATTACATTGCTAGA0.063800.007800.517200.500001.000001.00000


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664UGUUUUAUUAUUUUGAAAA80.8359985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422682TGTTTTATTATTTTGAAAATTTTCAAAATAATAAAACA0.087500.030400.706900.750001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120CAGACAAUUUUUGCAGUUA90.7321243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671138CAGACAATTTTTGCAGTTATAACTGCAAAAATTGTCTG0.166600.139200.750000.750001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424UGAAAAGGAGAAAAUGAAU77.58621332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2152442TGAAAAGGAGAAAATGAATATTCATTTTCTCCTTTTCA0.382700.222600.715500.750001.000001.00000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706CCUUACAUUAGCACAACAC70.46692127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924724CCTTACATTAGCACAACACGTGTTGTGCTAATGTAAGG0.062200.034000.551700.750000.983700.87500


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978UGCUGGAGAUGGGAAACUU75.80571529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565996TGCTGGAGATGGGAAACTTAAGTTTCCCATCTCCAGCA0.125700.035900.715500.750001.000001.00000


Target Position: 3120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120GAAAAACCAAUAGCUUUAA86.0442537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3118-3140AGGAAAAACCAATAGCTTTAAAAUUAAAGCUAUUGGUUUUUCCUGAAAAACCAAUAGCUUUAAAAU18.312.622


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571CCAUAGUCACAGUUAGGUA98.512941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6502589CCATAGTCACAGTTAGGTATACCTAACTGTGACTATGG0.103900.040500.663801.000001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680GCUCAUUUGUGGAAAAGAC77.39621355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899698GCTCATTTGTGGAAAAGACGTCTTTTCCACAAATGAGC0.124000.006300.534500.750001.000001.00000


Target Position: 2628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628GGUUUUGAAAAUGUACAAU82.4379844

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2626-2648CAGGTTTTGAAAATGTACAATATAUUGUACAUUUUCAAAACCUGGGUUUUGAAAAUGUACAAUAUU20.414.922


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032CCUGGAAAAUAAUAUGUAC82.1848867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251050CCTGGAAAATAATATGTACGTACATATTATTTTCCAGG0.480700.307700.663800.750001.000001.00000


Target Position: 2786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2786CUAUUGAAAUCAAGCUUAU86.6564490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2784-2806GACTATTGAAATCAAGCTTATTGAUAAGCUUGAUUUCAAUAGUCCUAUUGAAAUCAAGCUUAUUGU18.38.922


Target Position: 3238, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3238CUAAAAAGUCCUUGAUUUA91.7787200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7583256CTAAAAAGTCCTTGATTTATAAATCAAGGACTTTTTAG0.084700.018000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3236-3258TGCTAAAAAGTCCTTGATTTAGCUAAAUCAAGGACUUUUUAGCACUAAAAAGUCCUUGAUUUAGCU7.4-3.822


Target Position: 1133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133CAGUUACUGAAGAAUUUCA93.0937152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1131-1153TGCAGTTACTGAAGAATTTCAGCUGAAAUUCUUCAGUAACUGCACAGUUACUGAAGAAUUUCAGCU10.417.621


Target Position: 3587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3587UGUUUCACACUAGUCACAU72.6831891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073605TGTTTCACACTAGTCACATATGTGACTAGTGTGAAACA0.155200.094100.551700.750001.000001.00000


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215UAAAAGAACCGAGCAAUUU67.73032410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813233TAAAAGAACCGAGCAATTTAAATTGCTCGGTTCTTTTA0.286400.165900.534500.500001.000001.00000


Target Position: 2839, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2839GCAAUAGUUAAAGUAAUGA84.763633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232857GCAATAGTTAAAGTAATGATCATTACTTTAACTATTGC0.360700.099100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2837-2859GGGCAATAGTTAAAGTAATGAGCUCAUUACUUUAACUAUUGCCCGCAAUAGUUAAAGUAAUGAGCU11.611.622


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810AGGAGAAGUAUUUAAUGAA94.8024114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460828AGGAGAAGTATTTAATGAATTCATTAAATACTTCTCCT0.416600.171000.672400.750001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257CCUUUCCUCAGAAGUCAUU73.61241787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751275CCTTTCCTCAGAAGTCATTAATGACTTCTGAGGAAAGG0.176600.016100.836201.000001.000001.00000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734UGUUUGUAGGAAGAGGGAU68.08672377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981752TGTTTGTAGGAAGAGGGATATCCCTCTTCCTACAAACA0.478600.004100.525900.750001.000001.00000


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653UAUUUACUGAAGUUAUUUA88.5008365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853671TATTTACTGAAGTTATTTATAAATAACTTCAGTAAATA0.136700.007500.508600.500001.000001.00000


Target Position: 2461, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461GAAAAUCCUAUUUAUAAGA88.4019367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2459-2481GTGAAAATCCTATTTATAAGAGTUCUUAUAAAUAGGAUUUUCACGAAAAUCCUAUUUAUAAGAGUU-2.314.222


Target Position: 1361, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361GAAGAAAAUGUUCCAAUAU89.2814313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1359-1381TGGAAGAAAATGTTCCAATATTTAUAUUGGAACAUUUUCUUCCAGAAGAAAAUGUUCCAAUAUUUU21.25.521


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625ACAGAUCUGAUGAAUGAAA87.1899447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554643ACAGATCTGATGAATGAAATTTCATTCATCAGATCTGT0.190900.023500.706900.750001.000001.00000


Target Position: 2883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2883UGUAUUAAAACUGAUUUUU67.37632450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502901TGTATTAAAACTGATTTTTAAAAATCAGTTTTAATACA0.086000.050900.706900.750001.000001.00000


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031AGACAAGUAUGUUGAGAGU82.5889826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593049AGACAAGTATGTTGAGAGTACTCTCAACATACTTGTCT0.108400.024000.517200.500000.994600.75000


Target Position: 3247, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3247CCUUGAUUUAGCACUAUUU85.838557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3973265CCTTGATTTAGCACTATTTAAATAGTGCTAAATCAAGG0.212600.081800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3245-3267GTCCTTGATTTAGCACTATTTACAAAUAGUGCUAAAUCAAGGACCCUUGAUUUAGCACUAUUUACU11.612.023


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260GUGGGUGGUGCACAAAUUC67.37662449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975278GTGGGTGGTGCACAAATTCGAATTTGTGCACCACCCAC0.429800.008300.620700.500001.000001.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659CGGACUUCAGAAUUGGAUU81.4414934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528677CGGACTTCAGAATTGGATTAATCCAATTCTGAAGTCCG0.323500.025400.905201.000001.000001.00000


Target Position: 1095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095CCAGAAACUGAGUGAAAAU88.9416332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1093-1115GTCCAGAAACTGAGTGAAAATAAAUUUUCACUCAGUUUCUGGACCCAGAAACUGAGUGAAAAUAAU14.919.221


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631GCAGCACAGAUGAAGUUAA96.227981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001649GCAGCACAGATGAAGTTAATTAACTTCATCTGTGCTGC0.254700.009900.819001.000001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975CUUUGCUGGAGAUGGGAAA78.06241280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699993CTTTGCTGGAGATGGGAAATTTCCCATCTCCAGCAAAG0.109300.014900.637900.750001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CUGAAAAACUUGAUCCCUA92.7693164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811186CTGAAAAACTTGATCCCTATAGGGATCAAGTTTTTCAG0.103300.006700.612100.750001.000001.00000


Target Position: 2867, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2867GAGUUUCUGUUAAUCAUGU84.8066630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242885GAGTTTCTGTTAATCATGTACATGATTAACAGAAACTC0.083200.020300.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2865-2887GAGAGTTTCTGTTAATCATGTATACAUGAUUAACAGAAACUCUCGAGUUUCUGUUAAUCAUGUAUU13.617.723


Target Position: 568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568CUUAUGGACCUGUCUUACU77.31621361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
566-588ACCTTATGGACCTGTCTTACTCAAGUAAGACAGGUCCAUAAGGUCUUAUGGACCUGUCUUACUCAU21.421.223


Target Position: 2758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758UGUGCCUUUUUGACCUUUU68.23752363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602776TGTGCCTTTTTGACCTTTTAAAAGGTCAAAAAGGCACA0.068700.015200.706900.750000.934800.87500


Target Position: 2363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363CAUUACUGCUGAUAUGGAA97.600950

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2361-2383TGCATTACTGCTGATATGGAAGCUUCCAUAUCAGCAGUAAUGCACAUUACUGCUGAUAUGGAAGCU21.211.622


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320AUGAUUUAGAAGCCUUAAA77.2371367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
743338ATGATTTAGAAGCCTTAAATTTAAGGCTTCTAAATCAT0.088100.080700.655200.500001.000001.00000


Target Position: 3458, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3458GCCUUUUUAAUGAACAUGU74.27931714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4643476GCCTTTTTAATGAACATGTACATGTTCATTAAAAAGGC0.168900.137100.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3456-3478TTGCCTTTTTAATGAACATGTGAACAUGUUCAUUAAAAAGGCAAGCCUUUUUAAUGAACAUGUGAU20.59.522


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798UCUUACUAAUAAAGGAGAA81.2982944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831816TCTTACTAATAAAGGAGAATTCTCCTTTATTAGTAAGA0.101900.059600.551700.750001.000001.00000


Target Position: 1666, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666GCUUACUGCAGGAAAGAAA89.2809314

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1664-1686ATGCTTACTGCAGGAAAGAAAACUUUCUUUCCUGCAGUAAGCAUGCUUACUGCAGGAAAGAAAACU14.816.422


Target Position: 3225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225GAGCAAUUUUCUGCUAAAA92.0282190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3223-3245CCGAGCAATTTTCTGCTAAAAAGUUUUAGCAGAAAAUUGCUCGGGAGCAAUUUUCUGCUAAAAAGU19.718.522


Target Position: 2116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116GAAUGUUCCUAUUUUAACA98.910234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2114-2136AGGAATGTTCCTATTTTAACATTUGUUAAAAUAGGAACAUUCCUGAAUGUUCCUAUUUUAACAUUU0.014.821


Target Position: 2584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584UAGGUAGCUUUAGGGCAAU67.94042391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772602TAGGTAGCTTTAGGGCAATATTGCCCTAAAGCTACCTA0.069600.004500.663800.500000.989100.87500


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262GGGUGGUGCACAAAUUCAA94.1837126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940280GGGTGGTGCACAAATTCAATTGAATTTGTGCACCACCC0.346800.005400.844801.000001.000001.00000


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210AUGUUGACGACUGUUGGUU64.71732677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982228ATGTTGACGACTGTTGGTTAACCAACAGTCGTCAACAT0.068500.012600.508600.500001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271UCAUUUUGGAAAACGGCAA70.00022186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761289TCATTTTGGAAAACGGCAATTGCCGTTTTCCAAAATGA0.102600.006800.577600.750000.962000.62500


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GAUGCAUACAAUUCCCUUU85.8902550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6341261GATGCATACAATTCCCTTTAAAGGGAATTGTATGCATC0.306900.084700.681000.750001.000001.00000


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751AUAAUACAAAUGAAAUUUA85.3413593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861769ATAATACAAATGAAATTTATAAATTTCATTTGTATTAT0.052700.036200.508600.500001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726AGCUAAGCUCAGGAACCCU72.99411855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996744AGCTAAGCTCAGGAACCCTAGGGTTCCTGAGCTTAGCT0.056600.004900.508600.500000.956500.62500


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407AGGGAGUUUGCUAAAUUUG66.00442568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252425AGGGAGTTTGCTAAATTTGCAAATTTAGCAAACTCCCT0.361100.065800.698300.500001.000001.00000


Target Position: 2777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2777CUUCCUGGACUAUUGAAAU82.7273817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912795CTTCCTGGACTATTGAAATATTTCAATAGTCCAGGAAG0.130000.080800.629300.750001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CCUUCUAUUGCUCACCUUG71.81291980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431093CCTTCTATTGCTCACCTTGCAAGGTGAGCAATAGAAGG0.132900.080900.698300.750001.000001.00000


Target Position: 3448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448CGGUCAAUUUGCCUUUUUA96.157382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5803466CGGTCAATTTGCCTTTTTATAAAAAGGCAAATTGACCG0.122800.029400.879301.000000.972800.75000


Target Position: 2780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780CCUGGACUAUUGAAAUCAA98.806936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452798CCTGGACTATTGAAATCAATTGATTTCAATAGTCCAGG0.087100.053300.698301.000000.978300.75000


Target Position: 3374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3374CUAAUCUUUUAAUGUAUUU79.28741132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173392CTAATCTTTTAATGTATTTAAATACATTAAAAGATTAG0.092200.082700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3372-3394TTCTAATCTTTTAATGTATTTGTAAAUACAUUAAAAGAUUAGAACUAAUCUUUUAAUGUAUUUGUU6.76.922


Target Position: 3373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373UCUAAUCUUUUAAUGUAUU74.24961720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6843391TCTAATCTTTTAATGTATTAATACATTAAAAGATTAGA0.098900.094800.715500.750001.000001.00000


Target Position: 2932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932GCAGAAUCCAAAGUAAAUG70.7792096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472950GCAGAATCCAAAGTAAATGCATTTACTTTGGATTCTGC0.442100.071600.698300.750001.000001.00000


Target Position: 3260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3260CUAUUUACAUACAGGCCAU87.0715457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623278CTATTTACATACAGGCCATATGGCCTGTATGTAAATAG0.105100.097700.517200.750001.000001.00000


Target Position: 3311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3311UUGAGUUGAAUUUAUUUUA75.70961540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6703329TTGAGTTGAATTTATTTTATAAAATAAATTCAACTCAA0.376800.079600.612100.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013CAAAUGAUGGACAAUGUCA92.4284176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1011-1033ACCAAATGATGGACAATGTCACCUGACAUUGUCCAUCAUUUGGUCAAAUGAUGGACAAUGUCACCU20.57.222


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921UGGCUGGAGGAAUGUUACA75.46821570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997939TGGCTGGAGGAATGTTACATGTAACATTCCTCCAGCCA0.223400.004700.637900.500001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803CUAAUAAAGGAGAAGUAUU86.0543536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510821CTAATAAAGGAGAAGTATTAATACTTCTCCTTTATTAG0.240300.064700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
801-823TACTAATAAAGGAGAAGTATTTAAAUACUUCUCCUUUAUUAGUACUAAUAAAGGAGAAGUAUUUAU14.5-7.521


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UCCAAAGAUAUAAAGAAAA77.73421317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156400TCCAAAGATATAAAGAAAATTTTCTTTATATCTTTGGA0.961800.801900.870700.750001.000001.00000


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306ACCUUUUGAGUUGAAUUUA77.04641392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4443324ACCTTTTGAGTTGAATTTATAAATTCAACTCAAAAGGT0.178600.094100.819000.750001.000001.00000


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703GGGACUGACAAAAGACUUG74.59621671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142721GGGACTGACAAAAGACTTGCAAGTCTTTTGTCAGTCCC0.134300.025000.844800.750001.000001.00000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376AGAGGCUCCAAAGAUAUAA82.5404830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522394AGAGGCTCCAAAGATATAATTATATCTTTGGAGCCTCT0.848000.199700.689700.750001.000001.00000


Target Position: 3197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197ACAAAUUCAAGCCUUAGAU74.77451643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473215ACAAATTCAAGCCTTAGATATCTAAGGCTTGAATTTGT0.439200.382400.525900.750001.000001.00000


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658ACUGAAGUUAUUUAUUAAA86.8559477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623676ACTGAAGTTATTTATTAAATTTAATAAATAACTTCAGT0.083400.004900.706900.750001.000001.00000


Target Position: 1440, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440GGAUUCUGACAGCUUUAAA96.424976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101458GGATTCTGACAGCTTTAAATTTAAAGCTGTCAGAATCC0.558600.086500.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1438-1460AAGGATTCTGACAGCTTTAAAATUUUAAAGCUGUCAGAAUCCUUGGAUUCUGACAGCUUUAAAAUU13.720.422


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506AGCCACAGACAUUUACAUU80.7775994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452524AGCCACAGACATTTACATTAATGTAAATGTCTGTGGCT0.654900.062800.844800.750001.000001.00000


Target Position: 3467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467AUGAACAUGUGAAGUUAUA82.9118796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803485ATGAACATGTGAAGTTATATATAACTTCACATGTTCAT0.122000.057800.612100.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399CAAUUUGAAAUUAGCAUAA90.3973252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7681417CAATTTGAAATTAGCATAATTATGCTAATTTCAAATTG0.228500.011400.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1397-1419TTCAATTTGAAATTAGCATAACTUUAUGCUAAUUUCAAAUUGAACAAUUUGAAAUUAGCAUAACUU20.97.422


Target Position: 2960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960CUAGUUAAGGAUUGUUUUA88.1053386

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2958-2980AGCTAGTTAAGGATTGTTTTAAAUAAAACAAUCCUUAACUAGCUCUAGUUAAGGAUUGUUUUAAAU5.66.622


Target Position: 2378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378GGAAGCUUUUAAUGAUAAU89.3624307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782396GGAAGCTTTTAATGATAATATTATCATTAAAAGCTTCC0.054300.019200.862101.000001.000001.00000


Target Position: 3085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3085CAAAGGCCAUGGGAAAAAU80.11081050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733103CAAAGGCCATGGGAAAAATATTTTTCCCATGGCCTTTG0.336600.101000.637900.750001.000001.00000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638AGAUGAAGUUAACAGUGAA101.2413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451656AGATGAAGTTAACAGTGAATTCACTGTTAACTTCATCT0.060300.018600.551700.750001.000001.00000


Target Position: 2444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2444CCAAAUGGGACACGGGUGA69.50232235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302462CCAAATGGGACACGGGTGATCACCCGTGTCCCATTTGG0.231400.012800.620700.750001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504GGAGCCACAGACAUUUACA93.4014145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423522GGAGCCACAGACATTTACATGTAAATGTCTGTGGCTCC0.589700.035500.663800.750001.000001.00000


Target Position: 1303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303GUAACAAUAAGUUACAAAU88.7116348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1301-1323GAGTAACAATAAGTTACAAATCTAUUUGUAACUUAUUGUUACUCGUAACAAUAAGUUACAAAUCUU7.26.91


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267GUGCACAAAUUCAACAUUU82.0742877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916285GTGCACAAATTCAACATTTAAATGTTGAATTTGTGCAC0.282500.005900.793100.750001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGGGAGCCACAGACAUUUA94.2075125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545520GGGGAGCCACAGACATTTATAAATGTCTGTGGCTCCCC0.534200.024000.956901.000001.000001.00000


Target Position: 3237, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3237GCUAAAAAGUCCUUGAUUU87.5936414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403255GCTAAAAAGTCCTTGATTTAAATCAAGGACTTTTTAGC0.070900.020400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3235-3257CTGCTAAAAAGTCCTTGATTTAGAAAUCAAGGACUUUUUAGCAGGCUAAAAAGUCCUUGAUUUAGU12.0-3.822


Target Position: 2202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2202GGAGAAGGAUGUUGACGAC83.3957758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142220GGAGAAGGATGTTGACGACGTCGTCAACATCCTTCTCC0.303900.069100.551700.750001.000001.00000


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304UCCAGACAUCAUUCCAAUU73.59421790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632322TCCAGACATCATTCCAATTAATTGGAATGATGTCTGGA0.100800.004900.862100.750001.000001.00000


Target Position: 2362, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362GCAUUACUGCUGAUAUGGA93.555140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2360-2382TTGCATTACTGCTGATATGGAAGUCCAUAUCAGCAGUAAUGCAAGCAUUACUGCUGAUAUGGAAGU21.211.623


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630UGCAGCACAGAUGAAGUUA76.46961454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171648TGCAGCACAGATGAAGTTATAACTTCATCTGTGCTGCA0.262100.013800.819000.750001.000001.00000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GGCAAAUUGUCAGAAGGAG73.13791838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271303GGCAAATTGTCAGAAGGAGCTCCTTCTGACAATTTGCC0.095600.013100.689700.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026AUGUCACCUGGAAAAUAAU79.64441095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201044ATGTCACCTGGAAAATAATATTATTTTCCAGGTGACAT0.573900.056100.646600.500001.000001.00000


Target Position: 309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309UGCACGAUGUGAUGAUUUA87.5055421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574327TGCACGATGTGATGATTTATAAATCATCACATCGTGCA0.561400.055200.819000.750001.000001.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398UCAAUUUGAAAUUAGCAUA78.7981187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071416TCAATTTGAAATTAGCATATATGCTAATTTCAAATTGA0.247900.026700.681000.750001.000001.00000


Target Position: 1396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396GUUCAAUUUGAAAUUAGCA84.6862639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1394-1416AGGTTCAATTTGAAATTAGCATAUGCUAAUUUCAAAUUGAACCUGUUCAAUUUGAAAUUAGCAUAU13.67.432


Target Position: 1001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001GCAUUGUUUUACCAAAUGA90.1394266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
999-1021TGGCATTGTTTTACCAAATGATGUCAUUUGGUAAAACAAUGCCAGCAUUGUUUUACCAAAUGAUGU17.712.133


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268UGCACAAAUUCAACAUUUU77.48421344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371286TGCACAAATTCAACATTTTAAAATGTTGAATTTGTGCA0.281800.108200.853400.750001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CCAUUGGAGAUGAGGUUCA82.6367821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491400CCATTGGAGATGAGGTTCATGAACCTCATCTCCAATGG0.111600.005200.620700.750001.000001.00000


Target Position: 2868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2868AGUUUCUGUUAAUCAUGUA91.6754206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412886AGTTTCTGTTAATCATGTATACATGATTAACAGAAACT0.098500.025700.525900.750001.000001.00000


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125AGAUGAAUUUACAACCAAU95.330599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
658143AGATGAATTTACAACCAATATTGGTTGTAAATTCATCT0.102900.088200.715500.750001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246GCAUACAAUUCCCUUUCCU78.60831209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911264GCATACAATTCCCTTTCCTAGGAAAGGGAATTGTATGC0.147400.036000.508600.750001.000001.00000


Target Position: 3055, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055GUGUAAAAUACGUUUGAAA93.6122139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293073GTGTAAAATACGTTTGAAATTTCAAACGTATTTTACAC0.380000.034500.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3053-3075TGGTGTAAAATACGTTTGAAATAUUUCAAACGUAUUUUACACCAGUGUAAAAUACGUUUGAAAUAU14.97.222


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992UCCGAAGUUUCAAGGGCAA72.06121954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712010TCCGAAGTTTCAAGGGCAATTGCCCTTGAAACTTCGGA0.068100.016900.724100.750001.000001.00000


Target Position: 1307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CAAUAAGUUACAAAUCUUA97.914147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1305-1327AACAATAAGTTACAAATCTTACTUAAGAUUUGUAACUUAUUGUUCAAUAAGUUACAAAUCUUACUU5.34.623


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594CACUAGUCACAUUCUUGUU86.6963486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6683612CACTAGTCACATTCTTGTTAACAAGAATGTGACTAGTG0.101600.029100.646600.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GAGAAAAGAAAGACACAUG81.8325907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302108GAGAAAAGAAAGACACATGCATGTGTCTTTCTTTTCTC0.572700.535100.655200.500001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802ACUAAUAAAGGAGAAGUAU77.45241349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606820ACTAATAAAGGAGAAGTATATACTTCTCCTTTATTAGT0.208700.062400.663800.750001.000001.00000


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832UGAAAGGGCAAUAGUUAAA79.2391137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072850TGAAAGGGCAATAGTTAAATTTAACTATTGCCCTTTCA0.146800.049200.724100.750001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389AGAUGAGGUUCAAUUUGAA98.797537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121407AGATGAGGTTCAATTTGAATTCAAATTGAACCTCATCT0.102900.010600.551700.750001.000001.00000


Target Position: 3370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3370UCUUCUAAUCUUUUAAUGU72.78031879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613388TCTTCTAATCTTTTAATGTACATTAAAAGATTAGAAGA0.134200.125800.517200.500001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286GCAAAUUGUCAGAAGGAGU79.9891064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7561304GCAAATTGTCAGAAGGAGTACTCCTTCTGACAATTTGC0.084900.012400.646600.750001.000001.00000


Target Position: 3508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508ACCUACGCGAGUCUUACUU64.87532658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4323526ACCTACGCGAGTCTTACTTAAGTAAGACTCGCGTAGGT0.186000.039700.715500.750001.000001.00000


Target Position: 3569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3569CAUUUGAGUUGCCCAUCUU86.2796516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9683587CATTTGAGTTGCCCATCTTAAGATGGGCAACTCAAATG0.572200.091900.517200.750000.967401.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GGGAGCCACAGACAUUUAC69.26292261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516521GGGAGCCACAGACATTTACGTAAATGTCTGTGGCTCCC0.568700.026200.810300.750001.000001.00000


Target Position: 1211, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211CAAAUUCUAGCAAUGUAAU85.0326621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1209-1231TGCAAATTCTAGCAATGTAATTCAUUACAUUGCUAGAAUUUGCACAAAUUCUAGCAAUGUAAUUCU6.95.322


Target Position: 266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266GGUGCACAAAUUCAACAUU85.039620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929284GGTGCACAAATTCAACATTAATGTTGAATTTGTGCACC0.285500.005600.844801.000001.000001.00000


Target Position: 3371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371CUUCUAAUCUUUUAAUGUA96.353477

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3369-3391CTCTTCTAATCTTTTAATGTATTUACAUUAAAAGAUUAGAAGAGCUUCUAAUCUUUUAAUGUAUUU6.96.921


Target Position: 2866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2866AGAGUUUCUGUUAAUCAUG71.51222014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382884AGAGTTTCTGTTAATCATGCATGATTAACAGAAACTCT0.070900.015000.569000.500001.000001.00000


Target Position: 3449, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3449GGUCAAUUUGCCUUUUUAA95.729893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3993467GGTCAATTTGCCTTTTTAATTAAAAAGGCAAATTGACC0.267700.037800.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3447-3469GCGGTCAATTTGCCTTTTTAATGUUAAAAAGGCAAAUUGACCGCGGUCAAUUUGCCUUUUUAAUGU-3.814.822


Target Position: 1748, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1748GGGAUAAUACAAAUGAAAU92.9667160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151766GGGATAATACAAATGAAATATTTCATTTGTATTATCCC0.357700.106300.982801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1746-1768GAGGGATAATACAAATGAAATTTAUUUCAUUUGUAUUAUCCCUCGGGAUAAUACAAAUGAAAUUUU7.415.412


Target Position: 846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846CAUAUCUGGAAAUUUGGAU78.46581229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
844-866CGCATATCTGGAAATTTGGATTCAUCCAAAUUUCCAGAUAUGCGCAUAUCUGGAAAUUUGGAUUCU20.113.322


Target Position: 3620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3620CCUUUAGUUUUAACAGUUC72.11961949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373638CCTTTAGTTTTAACAGTTCGAACTGTTAAAACTAAAGG0.233100.174700.672400.750001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350AGGGGAAAAUGGAAGAAAA92.3854178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001368AGGGGAAAATGGAAGAAAATTTTCTTCCATTTTCCCCT0.367000.370200.844800.750001.000001.00000


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308CUGCACGAUGUGAUGAUUU76.91231406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355326CTGCACGATGTGATGATTTAAATCATCACATCGTGCAG0.495000.047800.784500.750001.000001.00000


Target Position: 2192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2192CCCAUUGUAAGGAGAAGGA76.60011440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752210CCCATTGTAAGGAGAAGGATCCTTCTCCTTACAATGGG0.054600.006200.620700.750000.945700.62500


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327UGCAAGAACGGGGUGAAUG55.71413275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411345TGCAAGAACGGGGTGAATGCATTCACCCCGTTCTTGCA0.229200.047100.698300.500001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806UGAUAGAUCCAAUGGCUUA88.2576376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821824TGATAGATCCAATGGCTTATAAGCCATTGGATCTATCA0.160500.036700.689700.750001.000001.00000


Target Position: 3057, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3057GUAAAAUACGUUUGAAAUA89.7715295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5643075GTAAAATACGTTTGAAATATATTTCAAACGTATTTTAC0.365300.066800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3055-3077GTGTAAAATACGTTTGAAATAGTUAUUUCAAACGUAUUUUACACGUAAAAUACGUUUGAAAUAGUU7.4-7.523


Target Position: 3201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3201AUUCAAGCCUUAGAUAAAA82.0413880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843219ATTCAAGCCTTAGATAAAATTTTATCTAAGGCTTGAAT0.446000.300600.508600.500001.000001.00000


Target Position: 2203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2203GAGAAGGAUGUUGACGACU75.64851548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502221GAGAAGGATGTTGACGACTAGTCGTCAACATCCTTCTC0.154800.032100.603400.500001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193GAUGAAAAUAGAUGUUUAA99.212131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
594211GATGAAAATAGATGTTTAATTAAACATCTATTTTCATC0.116500.060500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
191-213CAGATGAAAATAGATGTTTAAAAUUAAACAUCUAUUUUCAUCUGGAUGAAAAUAGAUGUUUAAAAU6.97.402


Target Position: 2349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349UCUUAUUGGCCUUGCAUUA77.33841358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052367TCTTATTGGCCTTGCATTATAATGCAAGGCCAATAAGA0.414400.024100.689700.750001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374CCAGAGGCUCCAAAGAUAU82.5719828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125392CCAGAGGCTCCAAAGATATATATCTTTGGAGCCTCTGG0.830400.174900.801701.000001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626CAGAUCUGAUGAAUGAAAU87.762404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
636644CAGATCTGATGAATGAAATATTTCATTCATCAGATCTG0.155200.018300.775900.750001.000001.00000


Target Position: 1060, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060CAUUAUUAUGAUUAUCCUU90.1194269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631078CATTATTATGATTATCCTTAAGGATAATCATAATAATG0.512900.225000.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1058-1080GCCATTATTATGATTATCCTTCTAAGGAUAAUCAUAAUAAUGGCCAUUAUUAUGAUUAUCCUUCUU19.9-8.022


Target Position: 3032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032GACAAGUAUGUUGAGAGUU80.02621058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073050GACAAGTATGTTGAGAGTTAACTCTCAACATACTTGTC0.113400.030400.672400.750000.994600.62500


Target Position: 2409, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409GGAGUUUGCUAAAUUUGAA98.986533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3012427GGAGTTTGCTAAATTTGAATTCAAATTTAGCAAACTCC0.464600.065400.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2407-2429AGGGAGTTTGCTAAATTTGAAAAUUCAAAUUUAGCAAACUCCCUGGAGUUUGCUAAAUUUGAAAAU7.419.222


Target Position: 3447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3447GCGGUCAAUUUGCCUUUUU72.35851927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853465GCGGTCAATTTGCCTTTTTAAAAAGGCAAATTGACCGC0.120500.021800.922401.000000.972800.75000


Target Position: 3116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3116GAAGGAAAAACCAAUAGCU83.121780

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3114-3136AGGAAGGAAAAACCAATAGCTTTAGCUAUUGGUUUUUCCUUCCUGAAGGAAAAACCAAUAGCUUUU19.718.732


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585AGGUAGCUUUAGGGCAAUA84.7568635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442603AGGTAGCTTTAGGGCAATATATTGCCCTAAAGCTACCT0.081400.005300.801700.750000.989101.00000


Target Position: 2211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211UGUUGACGACUGUUGGUUC69.58692224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562229TGTTGACGACTGTTGGTTCGAACCAACAGTCGTCAACA0.057600.010900.534500.500001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CCUUGCACAAGUGAACAGA78.41321235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
628760CCTTGCACAAGTGAACAGATCTGTTCACTTGTGCAAGG0.259200.039200.620700.750000.972800.62500


Target Position: 3135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3135UUAAAACCUGUGUGCCAUU66.63942515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233153TTAAAACCTGTGTGCCATTAATGGCACACAGGTTTTAA0.479100.309500.525900.500001.000001.00000


Target Position: 2557, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2557CAAAGUAGCAAUUUCCAUA95.776592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242575CAAAGTAGCAATTTCCATATATGGAAATTGCTACTTTG0.187700.013300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2555-2577TGCAAAGTAGCAATTTCCATAGTUAUGGAAAUUGCUACUUUGCACAAAGUAGCAAUUUCCAUAGUU20.19.821


Target Position: 640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640GAAAUGAGGAGGAUUACUU87.4586422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
638-660ATGAAATGAGGAGGATTACTTCGAAGUAAUCCUCCUCAUUUCAUGAAAUGAGGAGGAUUACUUCGU14.512.032


Target Position: 3378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3378UCUUUUAAUGUAUUUGUUU71.25482046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853396TCTTTTAATGTATTTGTTTAAACAAATACATTAAAAGA0.098800.038700.724100.750001.000001.00000


Target Position: 1198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198GGAACAUUAUCUGCAAAUU87.3083435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1196-1218TAGGAACATTATCTGCAAATTCTAAUUUGCAGAUAAUGUUCCUAGGAACAUUAUCUGCAAAUUCUU20.014.832


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791UGCUCAGUCUUACUAAUAA92.5864167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878809TGCTCAGTCTTACTAATAATTATTAGTAAGACTGAGCA0.435500.006800.819000.750000.945700.75000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423CAAAGGAACAGCAGAGAAG76.41291463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999441CAAAGGAACAGCAGAGAAGCTTCTCTGCTGTTCCTTTG0.054900.014800.508600.500001.000001.00000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811GAUCCAAUGGCUUAAUUUG78.54531219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701829GATCCAATGGCTTAATTTGCAAATTAAGCCATTGGATC0.085100.010900.534500.500001.000001.00000


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314AGUUGAAUUUAUUUUAUUA99.578821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4213332AGTTGAATTTATTTTATTATAATAAAATAAATTCAACT0.438600.118900.672400.750001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598GAUUUGGAGAAUGUAAAAA88.831336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
620616GATTTGGAGAATGTAAAAATTTTTACATTCTCCAAATC0.291100.032600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
596-618ACGATTTGGAGAATGTAAAAAGTUUUUUACAUUCUCCAAAUCGUGAUUUGGAGAAUGUAAAAAGUU7.220.112


Target Position: 2505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505GAAGUAUGAGGGAAAAUGA95.526997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2503-2525CCGAAGTATGAGGGAAAATGAGTUCAUUUUCCCUCAUACUUCGGGAAGUAUGAGGGAAAAUGAGUU7.411.622


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501AGGGGAGCCACAGACAUUU71.34312032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579519AGGGGAGCCACAGACATTTAAATGTCTGTGGCTCCCCT0.531400.021300.844800.750001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792GAUAAUUUCAACUGUGAUA94.886111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391810GATAATTTCAACTGTGATATATCACAGTTGAAATTATC0.334000.026500.637900.750001.000001.00000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735GUUUGUAGGAAGAGGGAUA89.7534297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581753GTTTGTAGGAAGAGGGATATATCCCTCTTCCTACAAAC0.466100.007200.603400.750001.000001.00000


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118GCGGAAAAGAUGAAUUUAC72.65121899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511136GCGGAAAAGATGAATTTACGTAAATTCATCTTTTCCGC0.448200.040300.741400.750001.000001.00000


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984UGUACAGAUCCGAAGUUUC68.06252378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652002TGTACAGATCCGAAGTTTCGAAACTTCGGATCTGTACA0.141900.026100.534500.500001.000001.00000


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738UGUAGGAAGAGGGAUAAUA82.4637840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091756TGTAGGAAGAGGGATAATATATTATCCCTCTTCCTACA0.376800.057700.663800.750001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081UCAAUAAAGGAGAAAAGAA85.5587580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162099TCAATAAAGGAGAAAAGAATTCTTTTCTCCTTTATTGA0.431300.087900.551700.750001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GCAAAGGAACAGCAGAGAA92.4684173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858440GCAAAGGAACAGCAGAGAATTCTCTGCTGTTCCTTTGC0.068800.021400.681001.000001.000001.00000


Target Position: 2828, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2828CGAUUGAAAGGGCAAUAGU80.53751023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842846CGATTGAAAGGGCAATAGTACTATTGCCCTTTCAATCG0.080900.016300.586200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2826-2848AGCGATTGAAAGGGCAATAGTTAACUAUUGCCCUUUCAAUCGCUCGAUUGAAAGGGCAAUAGUUAU19.716.332


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637CAGAUGAAGUUAACAGUGA89.9568277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311655CAGATGAAGTTAACAGTGATCACTGTTAACTTCATCTG0.061500.019400.560300.500001.000001.00000


Target Position: 2371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371CUGAUAUGGAAGCUUUUAA88.2523377

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2369-2391TGCTGATATGGAAGCTTTTAATGUUAAAAGCUUCCAUAUCAGCACUGAUAUGGAAGCUUUUAAUGU13.714.933


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UGCAAAUCCCACAACACUG66.07852563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032552TGCAAATCCCACAACACTGCAGTGTTGTGGGATTTGCA0.245500.069200.569000.500001.000001.00000


Target Position: 480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480GUUGGUUUUGCGAUUAAGA82.4808839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
478-500CAGTTGGTTTTGCGATTAAGATCUCUUAAUCGCAAAACCAACUGGUUGGUUUUGCGAUUAAGAUCU6.918.822


Target Position: 3439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3439AAGUUUUAGCGGUCAAUUU77.22181373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543457AAGTTTTAGCGGTCAATTTAAATTGACCGCTAAAACTT0.076400.007300.637900.500001.000001.00000


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387AGAUAUAAAGAAAAAUAAA96.894666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241405AGATATAAAGAAAAATAAATTTATTTTTCTTTATATCT0.923400.849200.724100.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346GAACAGGGGAAAAUGGAAG70.30552150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691364GAACAGGGGAAAATGGAAGCTTCCATTTTCCCCTGTTC0.382100.067200.534500.500001.000001.00000


Target Position: 2402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402ACAGAAGGGAGUUUGCUAA85.1433611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702420ACAGAAGGGAGTTTGCTAATTAGCAAACTCCCTTCTGT0.123900.021900.672400.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360GGAAGAAAAUGUUCCAAUA102.389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1358-1380ATGGAAGAAAATGTTCCAATATTUAUUGGAACAUUUUCUUCCAUGGAAGAAAAUGUUCCAAUAUUU20.114.822


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563AGCAAUUUCCAUAGUCACA82.9678793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412581AGCAATTTCCATAGTCACATGTGACTATGGAAATTGCT0.237300.052100.646600.500001.000001.00000


Target Position: 2215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2215GACGACUGUUGGUUCUAUU87.5922415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642233GACGACTGTTGGTTCTATTAATAGAACCAACAGTCGTC0.068400.040000.810300.750001.000001.00000


Target Position: 3051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051GCUGGUGUAAAAUACGUUU81.1238960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103069GCTGGTGTAAAATACGTTTAAACGTATTTTACACCAGC0.113000.027100.853401.000001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448CCAGAGGAUAUUACUCAGA84.4523663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966466CCAGAGGATATTACTCAGATCTGAGTAATATCCTCTGG0.056400.005400.620700.750000.962000.75000


Target Position: 1169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1169UGAAAAACUUGAUCCCUAA89.5285304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521187TGAAAAACTTGATCCCTAATTAGGGATCAAGTTTTTCA0.085400.023800.689700.750001.000001.00000


Target Position: 1340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340UGAAUGGAACAGGGGAAAA74.54221684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151358TGAATGGAACAGGGGAAAATTTTCCCCTGTTCCATTCA0.467600.114100.724100.750001.000001.00000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825UAGCGAUUGAAAGGGCAAU64.52882695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172843TAGCGATTGAAAGGGCAATATTGCCCTTTCAATCGCTA0.062800.010000.663800.500001.000001.00000


Target Position: 2807, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GAUUAAGUGAUAUUUCUAU93.9372129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2805-2827TGGATTAAGTGATATTTCTATAGAUAGAAAUAUCACUUAAUCCAGAUUAAGUGAUAUUUCUAUAGU6.94.622


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GGACUUCAGAAUUGGAUUU81.961891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494678GGACTTCAGAATTGGATTTAAATCCAATTCTGAAGTCC0.330100.027200.870701.000001.000001.00000


Target Position: 2776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2776UCUUCCUGGACUAUUGAAA74.93921627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002794TCTTCCTGGACTATTGAAATTTCAATAGTCCAGGAAGA0.149800.092200.724100.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740ACCCUUGCACAAGUGAACA72.75641881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928758ACCCTTGCACAAGTGAACATGTTCACTTGTGCAAGGGT0.308200.036700.646600.500000.983700.62500


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535GCAUCCCUGAAAGUCCCAA79.3331124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901553GCATCCCTGAAAGTCCCAATTGGGACTTTCAGGGATGC0.137100.010700.706901.000001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317GUGAUGAUUUAGAAGCCUU85.3093595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630335GTGATGATTTAGAAGCCTTAAGGCTTCTAAATCATCAC0.107900.111400.655200.750001.000001.00000


Target Position: 2379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2379GAAGCUUUUAAUGAUAAUU81.8939897

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2377-2399TGGAAGCTTTTAATGATAATTCAAAUUAUCAUUAAAAGCUUCCAGAAGCUUUUAAUGAUAAUUCAU8.717.022


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089GGAGAAAAGAAAGACACAU86.6342491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2162107GGAGAAAAGAAAGACACATATGTGTCTTTCTTTTCTCC0.592400.261700.715501.000001.000001.00000


Target Position: 354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
354UCCAGAUGACAUAGAAAAU78.27971253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389372TCCAGATGACATAGAAAATATTTTCTATGTCATCTGGA0.216300.119700.862100.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284CGGCAAAUUGUCAGAAGGA87.0358460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571302CGGCAAATTGTCAGAAGGATCCTTCTGACAATTTGCCG0.097400.029000.543100.750001.000001.00000


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223UUGGUUCUAUUUUACGUAU70.4332133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722241TTGGTTCTATTTTACGTATATACGTAAAATAGAACCAA0.067900.020600.603400.500001.000001.00000


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186GCCUUCACUUUACAAAUUC67.71572411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183204GCCTTCACTTTACAAATTCGAATTTGTAAAGTGAAGGC0.739700.604000.827600.750001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GACAAUGUCACCUGGAAAA89.9174281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761040GACAATGTCACCTGGAAAATTTTCCAGGTGACATTGTC0.195800.029300.819000.750001.000001.00000


Target Position: 3295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295GCUGAAUGGGGACCUUUUG66.44972533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993313GCTGAATGGGGACCTTTTGCAAAAGGTCCCCATTCAGC0.259000.010000.706900.750001.000001.00000


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345GGGUUGCCCUCCAGAUGAC73.93721752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890363GGGTTGCCCTCCAGATGACGTCATCTGGAGGGCAACCC0.172100.006500.672400.750000.913000.62500


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655ACUUCGGACUUCAGAAUUG70.08612173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997673ACTTCGGACTTCAGAATTGCAATTCTGAAGTCCGAAGT0.051000.012900.560300.500001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235UGAUCAUUGAUGCAUACAA89.8657286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401253TGATCATTGATGCATACAATTGTATGCATCAATGATCA0.210900.053900.577600.750001.000001.00000


Target Position: 3574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3574GAGUUGCCCAUCUUGUUUC70.39542139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9683592GAGTTGCCCATCTTGTTTCGAAACAAGATGGGCAACTC0.557500.226100.637900.500001.000001.00000


Target Position: 2082, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082CAAUAAAGGAGAAAAGAAA96.84367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492100CAATAAAGGAGAAAAGAAATTTCTTTTCTCCTTTATTG0.871000.100000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2080-2102TTCAATAAAGGAGAAAAGAAAGAUUUCUUUUCUCCUUUAUUGAACAAUAAAGGAGAAAAGAAAGAU5.5-4.321


Target Position: 3450, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3450GUCAAUUUGCCUUUUUAAU76.46831455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5093468GTCAATTTGCCTTTTTAATATTAAAAAGGCAAATTGAC0.582200.051200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3448-3470CGGTCAATTTGCCTTTTTAATGAAUUAAAAAGGCAAAUUGACCGGUCAAUUUGCCUUUUUAAUGAU-9.17.422


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GGACAAUGUCACCUGGAAA99.557323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571039GGACAATGTCACCTGGAAATTTCCAGGTGACATTGTCC0.205300.023300.870701.000001.000001.00000


Target Position: 1998, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998GUUUCAAGGGCAAACGUGU74.60061670

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1996-2018AAGTTTCAAGGGCAAACGTGTGAACACGUUUGCCCUUGAAACUUGUUUCAAGGGCAAACGUGUGAU19.812.233


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338GGUGAAUGGAACAGGGGAA89.5587301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131356GGTGAATGGAACAGGGGAATTCCCCTGTTCCATTCACC0.142300.077200.681001.000001.000001.00000


Target Position: 3324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3324AUUUUAUUAUUUUUAUUUU81.238950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813342ATTTTATTATTTTTATTTTAAAATAAAAATAATAAAAT0.529000.364100.508600.500001.000001.00000


Target Position: 2893, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2893CUGAUUUUUAGCUUUACAA86.7045485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502911CTGATTTTTAGCTTTACAATTGTAAAGCTAAAAATCAG0.544500.039700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2891-2913AACTGATTTTTAGCTTTACAAATUUGUAAAGCUAAAAAUCAGUUCUGAUUUUUAGCUUUACAAAUU11.87.422


Target Position: 3096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096GGAAAAAUUCAGAGAGUUA100.98514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233114GGAAAAATTCAGAGAGTTATAACTCTCTGAATTTTTCC0.138900.052300.836201.000001.000001.00000


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530UCAAGAGAGCUGAAGACUA86.5859495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811548TCAAGAGAGCTGAAGACTATAGTCTTCAGCTCTCTTGA0.218600.037900.551700.750001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312ACGAUGUGAUGAUUUAGAA91.5075217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684330ACGATGTGATGATTTAGAATTCTAAATCATCACATCGT0.261600.020500.603400.750001.000001.00000


Target Position: 3304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3304GGACCUUUUGAGUUGAAUU88.765341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733322GGACCTTTTGAGTTGAATTAATTCAACTCAAAAGGTCC0.123700.104300.862101.000001.000001.00000


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293GUCAGAAGGAGUAACAAUA93.8566132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691311GTCAGAAGGAGTAACAATATATTGTTACTCCTTCTGAC0.056100.026400.775900.750001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895GUGACUGUUCUUUGGAUAC70.53092115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821913GTGACTGTTCTTTGGATACGTATCCAAAGAACAGTCAC0.053100.006000.612100.500001.000001.00000


Target Position: 3095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095GGGAAAAAUUCAGAGAGUU85.1266615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5343113GGGAAAAATTCAGAGAGTTAACTCTCTGAATTTTTCCC0.135500.055000.844801.000001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318UGAUGAUUUAGAAGCCUUA87.3462432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643336TGATGATTTAGAAGCCTTATAAGGCTTCTAAATCATCA0.104400.101600.689700.750001.000001.00000


Target Position: 2858, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858GCAUGAUGAGAGUUUCUGU90.8574239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2856-2878GAGCATGATGAGAGTTTCTGTTAACAGAAACUCUCAUCAUGCUCGCAUGAUGAGAGUUUCUGUUAU19.219.422


Target Position: 3588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3588GUUUCACACUAGUCACAUU94.0055128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6403606GTTTCACACTAGTCACATTAATGTGACTAGTGTGAAAC0.161200.089500.637900.750001.000001.00000


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700GCAGUAACAAUGGAGAGUG72.27221934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861718GCAGTAACAATGGAGAGTGCACTCTCCATTGTTACTGC0.281500.030400.560300.750001.000001.00000


Target Position: 1790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790GUGAUAAUUUCAACUGUGA88.624355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651808GTGATAATTTCAACTGTGATCACAGTTGAAATTATCAC0.162600.017100.569000.500001.000001.00000


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232AGUUGAUCAUUGAUGCAUA99.563722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6241250AGTTGATCATTGATGCATATATGCATCAATGATCAACT0.108800.026900.663800.750001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793CUCAGUCUUACUAAUAAAG72.10541951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
957811CTCAGTCTTACTAATAAAGCTTTATTAGTAAGACTGAG0.227800.032000.672400.500000.945700.62500


Target Position: 3459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459CCUUUUUAAUGAACAUGUG74.27021715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133477CCTTTTTAATGAACATGTGCACATGTTCATTAAAAAGG0.148900.128500.551700.750001.000001.00000


Target Position: 383, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCAAAGAUAUAAAGAAAAA95.0783106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
55401CCAAAGATATAAAGAAAAATTTTTCTTTATATCTTTGG0.916000.800900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
381-403CTCCAAAGATATAAAGAAAAATAUUUUUCUUUAUAUCUUUGGAGCCAAAGAUAUAAAGAAAAAUAU5.512.021


Target Position: 1353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353GGAAAAUGGAAGAAAAUGU82.7302816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1351-1373GGGGAAAATGGAAGAAAATGTTCACAUUUUCUUCCAUUUUCCCCGGAAAAUGGAAGAAAAUGUUCU7.47.412


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542UGAAAGUCCCAAGUGUCAU71.21582052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771560TGAAAGTCCCAAGTGTCATATGACACTTGGGACTTTCA0.114700.053000.569000.750001.000001.00000


Target Position: 3457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3457UGCCUUUUUAAUGAACAUG55.59283283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923475TGCCTTTTTAATGAACATGCATGTTCATTAAAAAGGCA0.174100.054900.698300.500001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667CUUACUGCAGGAAAGAAAA85.9264547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431685CTTACTGCAGGAAAGAAAATTTTCTTTCCTGCAGTAAG0.337700.007700.637900.750001.000001.00000


Target Position: 2643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643CAAUAUGUAUAAUUUUUAA103.2487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2641-2663TACAATATGTATAATTTTTAAAAUUAAAAAUUAUACAUAUUGUACAAUAUGUAUAAUUUUUAAAAU-9.76.722


Target Position: 2133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133CAUUACCAAGGUAGAAAGU74.55421680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2131-2153AACATTACCAAGGTAGAAAGTCGACUUUCUACCUUGGUAAUGUUCAUUACCAAGGUAGAAAGUCGU11.720.022


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411AGUUUGCUAAAUUUGAAAA84.2292679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022429AGTTTGCTAAATTTGAAAATTTTCAAATTTAGCAAACT0.383400.064900.706900.750001.000001.00000


Target Position: 2855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855UGAGCAUGAUGAGAGUUUC69.21412264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152873TGAGCATGATGAGAGTTTCGAAACTCTCATCATGCTCA0.062900.016700.551700.500001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415UGCUAAAUUUGAAAAGGAG70.31932148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392433TGCTAAATTTGAAAAGGAGCTCCTTTTCAAATTTAGCA0.510100.254300.543100.500001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CAAAGAUAUAAAGAAAAAU85.9523543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557402CAAAGATATAAAGAAAAATATTTTTCTTTATATCTTTG0.908000.805000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
382-404TCCAAAGATATAAAGAAAAATAAAUUUUUCUUUAUAUCUUUGGACAAAGAUAUAAAGAAAAAUAAU5.56.921


Target Position: 3509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3509CCUACGCGAGUCUUACUUU82.8364805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5653527CCTACGCGAGTCTTACTTTAAAGTAAGACTCGCGTAGG0.162100.022200.844801.000001.000001.00000


Target Position: 3425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425GUACUUUUUCUUUGAAGUU79.53171103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3423-3445GAGTACTTTTTCTTTGAAGTTTTAACUUCAAAGAAAAAGUACUCGUACUUUUUCUUUGAAGUUUUU19.24.922


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455ACGGGUGAAAAUCCUAUUU68.30952359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952473ACGGGTGAAAATCCTATTTAAATAGGATTTTCACCCGT0.088400.006400.775900.750000.962000.75000


Target Position: 3640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3640CUUUUUACAGUGCUAUUUA89.1584319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3638-3660CACTTTTTACAGTGCTATTTACTUAAAUAGCACUGUAAAAAGUGCUUUUUACAGUGCUAUUUACUU13.60.022


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743GAAGAGGGAUAAUACAAAU95.624795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211761GAAGAGGGATAATACAAATATTTGTATTATCCCTCTTC0.234000.157000.663800.750001.000001.00000


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200AUAGAUGUUUAAAAGCAAA86.6152493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881218ATAGATGTTTAAAAGCAAATTTGCTTTTAAACATCTAT0.080200.025400.543100.500001.000001.00000


Target Position: 1096, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096CAGAAACUGAGUGAAAAUA88.9627328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1094-1116TCCAGAAACTGAGTGAAAATAATUAUUUUCACUCAGUUUCUGGACAGAAACUGAGUGAAAAUAAUU7.417.722


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221CCAAAUCAUGUGGAGAAUG67.48422431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994239CCAAATCATGTGGAGAATGCATTCTCCACATGATTTGG0.052000.025400.689700.750001.000001.00000


Target Position: 2894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2894UGAUUUUUAGCUUUACAAA85.1422613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342912TGATTTTTAGCTTTACAAATTTGTAAAGCTAAAAATCA0.542100.052200.724100.750001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313CGAUGUGAUGAUUUAGAAG83.9247715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782331CGATGTGATGATTTAGAAGCTTCTAAATCATCACATCG0.198100.011200.655200.750001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677UGAAAAUAAUGUUGUAAUU80.0921052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632695TGAAAATAATGTTGTAATTAATTACAACATTATTTTCA0.459100.037900.715500.750001.000001.00000


Target Position: 3398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3398CAAUUUUGGGGUAAGACUU80.38011037

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3396-3418TGCAATTTTGGGGTAAGACTTTTAAGUCUUACCCCAAAAUUGCACAAUUUUGGGGUAAGACUUUUU18.9-3.332


Target Position: 2799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799GCUUAUUGGAUUAAGUGAU83.45752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982817GCTTATTGGATTAAGTGATATCACTTAATCCAATAAGC0.067700.006300.672401.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2797-2819AAGCTTATTGGATTAAGTGATATAUCACUUAAUCCAAUAAGCUUGCUUAUUGGAUUAAGUGAUAUU20.33.533


Target Position: 3343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3343GUUUAAUGUCUGGUGCUUU80.7843993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9903361GTTTAATGTCTGGTGCTTTAAAGCACCAGACATTAAAC0.052200.032800.646600.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813UCCAAUGGCUUAAUUUGUG58.76213089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321831TCCAATGGCTTAATTTGTGCACAAATTAAGCCATTGGA0.061500.006900.577600.500001.000001.00000


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117CGCGGAAAAGAUGAAUUUA88.605358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
648135CGCGGAAAAGATGAATTTATAAATTCATCTTTTCCGCG0.532100.017500.887901.000001.000001.00000


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658UCGGACUUCAGAAUUGGAU64.15482724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654676TCGGACTTCAGAATTGGATATCCAATTCTGAAGTCCGA0.183500.024000.612100.750001.000001.00000


Target Position: 3270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270ACAGGCCAUACUUUACAAA82.0133883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703288ACAGGCCATACTTTACAAATTTGTAAAGTATGGCCTGT0.056100.018600.706900.750001.000001.00000


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228AUGUGGAGAAUGUAUACAA91.3933220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982246ATGTGGAGAATGTATACAATTGTATACATTCTCCACAT0.096700.022500.508600.500001.000001.00000


Target Position: 1421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421CAAAUAAGUGUCCAAAAAA95.45498

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1419-1441TTCAAATAAGTGTCCAAAAAAGGUUUUUUGGACACUUAUUUGAACAAAUAAGUGUCCAAAAAAGGU11.5-4.322


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405GAAGGGAGUUUGCUAAAUU90.8377241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5202423GAAGGGAGTTTGCTAAATTAATTTAGCAAACTCCCTTC0.160200.026100.663800.750001.000001.00000


Target Position: 187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CAAACAGAUGAAAAUAGAU92.0865188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
185-207CTCAAACAGATGAAAATAGATGTAUCUAUUUUCAUCUGUUUGAGCAAACAGAUGAAAAUAGAUGUU6.919.222


Target Position: 3246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3246UCCUUGAUUUAGCACUAUU75.80321530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4023264TCCTTGATTTAGCACTATTAATAGTGCTAAATCAAGGA0.208600.069300.862100.750001.000001.00000


Target Position: 2806, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2806GGAUUAAGUGAUAUUUCUA104.9334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2804-2826TTGGATTAAGTGATATTTCTATAUAGAAAUAUCACUUAAUCCAAGGAUUAAGUGAUAUUUCUAUAU6.96.922


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907UGGAUACUAGUACUUGUGA78.3941238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351925TGGATACTAGTACTTGTGATCACAAGTACTAGTATCCA0.113900.058400.620700.500001.000001.00000


Target Position: 483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483GGUUUUGCGAUUAAGAUCA85.5632578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760501GGTTTTGCGATTAAGATCATGATCTTAATCGCAAAACC0.237500.011600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
481-503TTGGTTTTGCGATTAAGATCAGGUGAUCUUAAUCGCAAAACCAAGGUUUUGCGAUUAAGAUCAGGU16.021.133


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345GGAACAGGGGAAAAUGGAA92.2407186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891363GGAACAGGGGAAAATGGAATTCCATTTTCCCCTGTTCC0.391900.076500.698301.000001.000001.00000


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369CUCUUCUAAUCUUUUAAUG69.82552200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8203387CTCTTCTAATCTTTTAATGCATTAAAAGATTAGAAGAG0.145800.138000.655200.500001.000001.00000


Target Position: 3356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3356UGCUUUCUAUCACCUCUUC62.69782828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533374TGCTTTCTATCACCTCTTCGAAGAGGTGATAGAAAGCA0.064300.031100.681000.500001.000001.00000


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385AUGUAUUUGUUUGCAAUUU68.45062350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7983403ATGTATTTGTTTGCAATTTAAATTGCAAACAAATACAT0.078600.019100.655200.500001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GAUUCUGACAGCUUUAAAA98.856635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281459GATTCTGACAGCTTTAAAATTTTAAAGCTGTCAGAATC0.558100.126300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1439-1461AGGATTCTGACAGCTTTAAAATTUUUUAAAGCUGUCAGAAUCCUGAUUCUGACAGCUUUAAAAUUU-3.820.422


Target Position: 1236, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236GAUCAUUGAUGCAUACAAU99.233629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181254GATCATTGATGCATACAATATTGTATGCATCAATGATC0.215300.059300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1234-1256TTGATCATTGATGCATACAATTCAUUGUAUGCAUCAAUGAUCAAGAUCAUUGAUGCAUACAAUUCU13.513.623


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082CUACAAAGGCCAUGGGAAA85.7163569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3613100CTACAAAGGCCATGGGAAATTTCCCATGGCCTTTGTAG0.403100.108600.672400.750001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027UGUCACCUGGAAAAUAAUA79.52891104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781045TGTCACCTGGAAAATAATATATTATTTTCCAGGTGACA0.567900.062900.663800.750001.000001.00000


Target Position: 3469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469GAACAUGUGAAGUUAUACU89.0025326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3467-3489ATGAACATGTGAAGTTATACTGTAGUAUAACUUCACAUGUUCAUGAACAUGUGAAGUUAUACUGUU9.519.333


Target Position: 184, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GCUCAAACAGAUGAAAAUA92.5446168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
182-204TTGCTCAAACAGATGAAAATAGAUAUUUUCAUCUGUUUGAGCAAGCUCAAACAGAUGAAAAUAGAU7.419.221


Target Position: 1691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691CAGAAAUCUGCAGUAACAA91.1467227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1689-1711TTCAGAAATCTGCAGTAACAATGUUGUUACUGCAGAUUUCUGAACAGAAAUCUGCAGUAACAAUGU19.014.822


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746GAGGGAUAAUACAAAUGAA106.9342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721764GAGGGATAATACAAATGAATTCATTTGTATTATCCCTC0.356700.115200.637900.750001.000001.00000


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676AUAUGCCUAAAAUACUUAA84.2096682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883694ATATGCCTAAAATACTTAATTAAGTATTTTAGGCATAT0.885500.063800.508600.500001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894UGUGACUGUUCUUUGGAUA82.5138834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611912TGTGACTGTTCTTTGGATATATCCAAAGAACAGTCACA0.057000.005200.663800.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737GGAACCCUUGCACAAGUGA80.7611997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489755GGAACCCTTGCACAAGTGATCACTTGTGCAAGGGTTCC0.266800.029800.646600.750000.978300.62500


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908GGAUACUAGUACUUGUGAA103.5385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911926GGATACTAGTACTTGTGAATTCACAAGTACTAGTATCC0.117700.063400.698301.000001.000001.00000


Target Position: 3331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3331UAUUUUUAUUUUGUUUAAU71.18582056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343349TATTTTTATTTTGTTTAATATTAAACAAAATAAAAATA0.495700.328500.534500.500001.000001.00000


Target Position: 269, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
269GCACAAAUUCAACAUUUUU85.6662572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310287GCACAAATTCAACATTTTTAAAAATGTTGAATTTGTGC0.267800.173900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
267-289GTGCACAAATTCAACATTTTTACAAAAAUGUUGAAUUUGUGCACGCACAAAUUCAACAUUUUUACU5.312.122


Target Position: 1217, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217CUAGCAAUGUAAUUCAGUU89.9952275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401235CTAGCAATGTAATTCAGTTAACTGAATTACATTGCTAG0.061900.006500.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1215-1237TTCTAGCAATGTAATTCAGTTGAAACUGAAUUACAUUGCUAGAACUAGCAAUGUAAUUCAGUUGAU19.219.722


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700CCAGGGACUGACAAAAGAC75.86161525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442718CCAGGGACTGACAAAAGACGTCTTTTGTCAGTCCCTGG0.083500.009800.525900.750000.983700.62500


Target Position: 1024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024CAAUGUCACCUGGAAAAUA94.4563121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781042CAATGTCACCTGGAAAATATATTTTCCAGGTGACATTG0.490700.044800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1022-1044GACAATGTCACCTGGAAAATAATUAUUUUCCAGGUGACAUUGUCCAAUGUCACCUGGAAAAUAAUU14.220.522


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272CAUUUUGGAAAACGGCAAA81.0329970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201290CATTTTGGAAAACGGCAAATTTGCCGTTTTCCAAAATG0.155300.008400.655200.750001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902AGCUUUACAAAUAUGUCAG70.21372161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482920AGCTTTACAAATATGTCAGCTGACATATTTGTAAAGCT0.139800.068200.569000.500000.972800.87500


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807GAUAGAUCCAAUGGCUUAA90.4539249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091825GATAGATCCAATGGCTTAATTAAGCCATTGGATCTATC0.113200.027900.646600.750001.000001.00000


Target Position: 3428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428CUUUUUCUUUGAAGUUUUA85.865555

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3426-3448TACTTTTTCTTTGAAGTTTTAGCUAAAACUUCAAAGAAAAAGUACUUUUUCUUUGAAGUUUUAGCU3.25.511


Target Position: 1033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033CUGGAAAAUAAUAUGUACA88.3078372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001051CTGGAAAATAATATGTACATGTACATATTATTTTCCAG0.490900.329200.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1031-1053ACCTGGAAAATAATATGTACACAUGUACAUAUUAUUUUCCAGGUCUGGAAAAUAAUAUGUACACAU15.820.112


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535GCAAAUCCCACAACACUGA82.3228855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5922553GCAAATCCCACAACACTGATCAGTGTTGTGGGATTTGC0.261400.119100.629300.750001.000001.00000


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663AUGUUUUAUUAUUUUGAAA85.0595619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092681ATGTTTTATTATTTTGAAATTTCAAAATAATAAAACAT0.076500.024200.655200.500001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676GGAAAGAAAACAGUUCAGA84.074699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921694GGAAAGAAAACAGTTCAGATCTGAACTGTTTTCTTTCC0.279000.218400.646600.750001.000001.00000


Target Position: 3383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3383UAAUGUAUUUGUUUGCAAU83.4952749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163401TAATGTATTTGTTTGCAATATTGCAAACAAATACATTA0.071200.012000.525900.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CACAAUGAGCCAUUAUUAU87.0847454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1048-1070TACACAATGAGCCATTATTATGAAUAAUAAUGGCUCAUUGUGUACACAAUGAGCCAUUAUUAUGAU-8.020.522


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174GGUAACUUUUAUGCCUUCA82.3777851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5863192GGTAACTTTTATGCCTTCATGAAGGCATAAAAGTTACC0.572900.042900.629300.750001.000001.00000


Target Position: 3579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3579GCCCAUCUUGUUUCACACU76.16021484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4143597GCCCATCTTGTTTCACACTAGTGTGAAACAAGATGGGC0.195900.132300.793100.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899CUGUUCUUUGGAUACUAGU72.96911858

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1897-1919GACTGTTCTTTGGATACTAGTACACUAGUAUCCAAAGAACAGUCCUGUUCUUUGGAUACUAGUACU11.219.222


Target Position: 2959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2959GCUAGUUAAGGAUUGUUUU83.3788760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2957-2979TAGCTAGTTAAGGATTGTTTTAAAAAACAAUCCUUAACUAGCUAGCUAGUUAAGGAUUGUUUUAAU5.311.323


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311CACGAUGUGAUGAUUUAGA86.3363510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888329CACGATGTGATGATTTAGATCTAAATCATCACATCGTG0.470400.059100.569000.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430GUCCAAAAAAGGAUUCUGA84.4066667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1428-1450GTGTCCAAAAAAGGATTCTGACAUCAGAAUCCUUUUUUGGACACGUCCAAAAAAGGAUUCUGACAU20.420.123


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GAUGAUUUAGAAGCCUUAA90.2373260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708337GATGATTTAGAAGCCTTAATTAAGGCTTCTAAATCATC0.095300.090500.646600.750001.000001.00000


Target Position: 1301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301GAGUAACAAUAAGUUACAA100.42717

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1299-1321AGGAGTAACAATAAGTTACAAATUUGUAACUUAUUGUUACUCCUGAGUAACAAUAAGUUACAAAUU19.019.0


Target Position: 322, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322GAUUUAGAAGCCUUAAAAA98.777838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441340GATTTAGAAGCCTTAAAAATTTTTAAGGCTTCTAAATC0.179600.064000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342ATGATTTAGAAGCCTTAAAAAAGUUUUUAAGGCUUCUAAAUCAUGAUUUAGAAGCCUUAAAAAAGU-3.86.922


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185UGCCUUCACUUUACAAAUU72.25371936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3253203TGCCTTCACTTTACAAATTAATTTGTAAAGTGAAGGCA0.729400.523700.844800.750001.000001.00000


Target Position: 3312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3312UGAGUUGAAUUUAUUUUAU79.6981091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3293330TGAGTTGAATTTATTTTATATAAAATAAATTCAACTCA0.382200.076800.681000.750001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762CCUUUUUGACCUUUUCUUC67.89772393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312780CCTTTTTGACCTTTTCTTCGAAGAAAAGGTCAAAAAGG0.186300.049200.672400.750001.000001.00000


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596ACGAUUUGGAGAAUGUAAA80.7858992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483614ACGATTTGGAGAATGTAAATTTACATTCTCCAAATCGT0.171100.048000.775900.750001.000001.00000


Target Position: 2972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972UGUUUUAAAUCUGUUAUUU74.38771705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332990TGTTTTAAATCTGTTATTTAAATAACAGATTTAAAACA0.061400.020800.706900.750001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900UGUUCUUUGGAUACUAGUA86.1282532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461918TGTTCTTTGGATACTAGTATACTAGTATCCAAAGAACA0.123300.011800.525900.750001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390GAUGAGGUUCAAUUUGAAA95.898489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201408GATGAGGTTCAATTTGAAATTTCAAATTGAACCTCATC0.105300.013700.681000.750001.000001.00000


Target Position: 3317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317UGAAUUUAUUUUAUUAUUU77.14981380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3383335TGAATTTATTTTATTATTTAAATAATAAAATAAATTCA0.482400.178400.724100.750001.000001.00000


Target Position: 3446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3446AGCGGUCAAUUUGCCUUUU67.20072465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6833464AGCGGTCAATTTGCCTTTTAAAAGGCAAATTGACCGCT0.108600.015600.853400.750000.972800.87500


Target Position: 190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
190ACAGAUGAAAAUAGAUGUU76.74371423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797208ACAGATGAAAATAGATGTTAACATCTATTTTCATCTGT0.115800.019300.560300.750001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054AUGAGCCAUUAUUAUGAUU75.14561598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831072ATGAGCCATTATTATGATTAATCATAATAATGGCTCAT0.257300.016300.646600.500001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537AGCUGAAGACUAUCCCAUU85.886551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584555AGCTGAAGACTATCCCATTAATGGGATAGTCTTCAGCT0.162200.115200.844800.750001.000001.00000


Target Position: 2826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826AGCGAUUGAAAGGGCAAUA76.08051494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542844AGCGATTGAAAGGGCAATATATTGCCCTTTCAATCGCT0.069400.012800.810300.750001.000001.00000


Target Position: 845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GCAUAUCUGGAAAUUUGGA85.9905541

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
843-865GCGCATATCTGGAAATTTGGATTUCCAAAUUUCCAGAUAUGCGCGCAUAUCUGGAAAUUUGGAUUU11.313.332


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105CAGAGAGUUAGGAAGGAAA94.7898115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5533123CAGAGAGTTAGGAAGGAAATTTCCTTCCTAACTCTCTG0.128600.032600.784500.750001.000001.00000


Target Position: 3661, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661GAAGUUAUUUAUUAAAUAU98.333542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3659-3681CTGAAGTTATTTATTAAATATGCAUAUUUAAUAAAUAACUUCAGGAAGUUAUUUAUUAAAUAUGCU-7.54.612


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058GCCAUUAUUAUGAUUAUCC68.56162336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911076GCCATTATTATGATTATCCGGATAATCATAATAATGGC0.389100.098900.629300.500001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056GAGCCAUUAUUAUGAUUAU96.352878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391074GAGCCATTATTATGATTATATAATCATAATAATGGCTC0.307000.029700.767200.750001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074UCCUUCUAUUGCUCACCUU69.85772198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131092TCCTTCTATTGCTCACCTTAAGGTGAGCAATAGAAGGA0.129000.082300.732800.750001.000001.00000


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CAUUGACCUCUACUACCUU89.2115318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
952570CATTGACCTCTACTACCTTAAGGTAGTAGAGGTCAATG0.291800.226800.517200.750001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321UGAUUUAGAAGCCUUAAAA85.4843586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
633339TGATTTAGAAGCCTTAAAATTTTAAGGCTTCTAAATCA0.175000.072500.724100.750001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974ACUUUGCUGGAGAUGGGAA80.8712982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911992ACTTTGCTGGAGATGGGAATTCCCATCTCCAGCAAAGT0.074100.009100.534500.750001.000001.00000


Target Position: 2854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854AUGAGCAUGAUGAGAGUUU70.35852144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632872ATGAGCATGATGAGAGTTTAAACTCTCATCATGCTCAT0.068700.023900.655200.500001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602UGGAGAAUGUAAAAAGUCU79.32491125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853620TGGAGAATGTAAAAAGTCTAGACTTTTTACATTCTCCA0.069600.034500.620700.500001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201ACAUUAUCUGCAAAUUCUA88.8056338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881219ACATTATCTGCAAATTCTATAGAATTTGCAGATAATGT0.825300.006500.534500.750001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349CAGGGGAAAAUGGAAGAAA84.5453656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941367CAGGGGAAAATGGAAGAAATTTCTTCCATTTTCCCCTG0.364400.378000.784500.750001.000001.00000


Target Position: 304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
304ACUUCUGCACGAUGUGAUG68.87062304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983322ACTTCTGCACGATGTGATGCATCACATCGTGCAGAAGT0.108500.004400.551700.500001.000001.00000


Target Position: 3104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3104UCAGAGAGUUAGGAAGGAA84.7211637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043122TCAGAGAGTTAGGAAGGAATTCCTTCCTAACTCTCTGA0.132600.034900.551700.750001.000001.00000


Target Position: 3089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3089GGCCAUGGGAAAAAUUCAG68.93612298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4983107GGCCATGGGAAAAATTCAGCTGAATTTTTCCCATGGCC0.313600.196700.715500.750001.000001.00000


Target Position: 2123, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123CCUAUUUUAACAUUACCAA88.2162382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062141CCTATTTTAACATTACCAATTGGTAATGTTAAAATAGG0.077100.012000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2121-2143TTCCTATTTTAACATTACCAAGGUUGGUAAUGUUAAAAUAGGAACCUAUUUUAACAUUACCAAGGU20.0-4.312


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213AGCAAAUGCCAAAUCAUGU74.89091629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877231AGCAAATGCCAAATCATGTACATGATTTGGCATTTGCT0.139400.009400.646600.500000.940200.62500


Target Position: 2598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598GCAAUAUUGCCAUGGUUUU78.94871165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2596-2618GGGCAATATTGCCATGGTTTTACAAAACCAUGGCAAUAUUGCCCGCAAUAUUGCCAUGGUUUUACU18.8-1.832


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192AGAUGAAAAUAGAUGUUUA103.4966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
620210AGATGAAAATAGATGTTTATAAACATCTATTTTCATCT0.110900.054300.689700.750001.000001.00000


Target Position: 3357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3357GCUUUCUAUCACCUCUUCU79.31641128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703375GCTTTCTATCACCTCTTCTAGAAGAGGTGATAGAAAGC0.068200.036700.629300.750001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750GAUAAUACAAAUGAAAUUU82.4817838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681768GATAATACAAATGAAATTTAAATTTCATTTGTATTATC0.056200.048800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1748-1770GGGATAATACAAATGAAATTTATAAAUUUCAUUUGUAUUAUCCCGAUAAUACAAAUGAAAUUUAUU7.41.122


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679UGCCUAAAAUACUUAAAUC72.05871955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183697TGCCTAAAATACTTAAATCGATTTAAGTATTTTAGGCA0.854700.235500.672400.500001.000001.00000


Target Position: 3318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318GAAUUUAUUUUAUUAUUUU92.5167170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4073336GAATTTATTTTATTATTTTAAAATAATAAAATAAATTC0.486700.187400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3316-3338TTGAATTTATTTTATTATTTTTAAAAAUAAUAAAAUAAAUUCAAGAAUUUAUUUUAUUAUUUUUAU-10.3-10.311


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554UUGACCUCUACUACCUUAU64.50112701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811572TTGACCTCTACTACCTTATATAAGGTAGTAGAGGTCAA0.102700.018100.603400.500001.000001.00000


Target Position: 2838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2838GGCAAUAGUUAAAGUAAUG80.49541028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802856GGCAATAGTTAAAGTAATGCATTACTTTAACTATTGCC0.368700.090600.844800.750001.000001.00000


Target Position: 2561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561GUAGCAAUUUCCAUAGUCA97.459653

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2559-2581AAGTAGCAATTTCCATAGTCACAUGACUAUGGAAAUUGCUACUUGUAGCAAUUUCCAUAGUCACAU20.319.733


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604GAGAAUGUAAAAAGUCUUG73.51041798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832622GAGAATGTAAAAAGTCTTGCAAGACTTTTTACATTCTC0.071600.039400.663800.500001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GUCACCUGGAAAAUAAUAU78.24731260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691046GTCACCTGGAAAATAATATATATTATTTTCCAGGTGAC0.541700.107200.775900.750001.000001.00000


Target Position: 1354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GAAAAUGGAAGAAAAUGUU83.7069736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1352-1374GGGAAAATGGAAGAAAATGTTCCAACAUUUUCUUCCAUUUUCCCGAAAAUGGAAGAAAAUGUUCCU5.311.312


Target Position: 2993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2993CUAUUUGCCUGUUAGACAU85.5015583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2991-3013TGCTATTTGCCTGTTAGACATGAAUGUCUAACAGGCAAAUAGCACUAUUUGCCUGUUAGACAUGAU20.315.332


Target Position: 1002, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002CAUUGUUUUACCAAAUGAU87.8684397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1000-1022GGCATTGTTTTACCAAATGATGGAUCAUUUGGUAAAACAAUGCCCAUUGUUUUACCAAAUGAUGGU13.85.322


Target Position: 3507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CACCUACGCGAGUCUUACU82.9698791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923525CACCTACGCGAGTCTTACTAGTAAGACTCGCGTAGGTG0.135300.036100.586200.500000.956500.62500


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065CGUUUGAAAUAGUUGAUCU90.0958270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953083CGTTTGAAATAGTTGATCTAGATCAACTATTTCAAACG0.065400.029200.551700.750001.000001.00000


Target Position: 3172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3172UUGGUAACUUUUAUGCCUU68.20972365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973190TTGGTAACTTTTATGCCTTAAGGCATAAAAGTTACCAA0.155300.012500.508600.500001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100AGACACAUGCACACAGGAA91.1215229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172118AGACACATGCACACAGGAATTCCTGTGTGCATGTGTCT0.257600.246900.551700.750001.000001.00000


Target Position: 3275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3275CCAUACUUUACAAAGUAUU78.95841163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3273-3295GGCCATACTTTACAAAGTATTTGAAUACUUUGUAAAGUAUGGCCCCAUACUUUACAAAGUAUUUGU4.611.632


Target Position: 3251, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251GAUUUAGCACUAUUUACAU93.5019142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353269GATTTAGCACTATTTACATATGTAAATAGTGCTAAATC0.343300.024600.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3249-3271TTGATTTAGCACTATTTACATACAUGUAAAUAGUGCUAAAUCAAGAUUUAGCACUAUUUACAUACU6.913.622


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464AGAUCCAACCACAGCAGUU81.0334969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910482AGATCCAACCACAGCAGTTAACTGCTGTGGTTGGATCT0.063300.030600.577600.750001.000001.00000


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498CUUCAGUACAUCUGUGAAU81.6879917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841516CTTCAGTACATCTGTGAATATTCACAGATGTACTGAAG0.079800.006700.629300.750000.962000.87500


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116GCGCGGAAAAGAUGAAUUU78.28571251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821134GCGCGGAAAAGATGAATTTAAATTCATCTTTTCCGCGC0.529400.008400.922401.000001.000001.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307UCUGCACGAUGUGAUGAUU74.58871673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592325TCTGCACGATGTGATGATTAATCATCACATCGTGCAGA0.163300.022500.715500.750001.000001.00000


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112AUAAUAUUCAGACAAUUUU75.13121601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381130ATAATATTCAGACAATTTTAAAATTGTCTGAATATTAT0.239700.056900.543100.500001.000001.00000


Target Position: 3149, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149CCAUUUUAAGAGUUACUUA96.78369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3147-3169TGCCATTTTAAGAGTTACTTAATUAAGUAACUCUUAAAAUGGCACCAUUUUAAGAGUUACUUAAUU12.9-1.432


Target Position: 623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GAACAGAUCUGAUGAAUGA99.314728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
621-643TGGAACAGATCTGATGAATGAAAUCAUUCAUCAGAUCUGUUCCAGAACAGAUCUGAUGAAUGAAAU13.619.232


Target Position: 3408, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3408GUAAGACUUUUUUAUGAGU81.8851900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3406-3428GGGTAAGACTTTTTTATGAGTACACUCAUAAAAAAGUCUUACCCGUAAGACUUUUUUAUGAGUACU13.418.9


Target Position: 2629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GUUUUGAAAAUGUACAAUA91.5905213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2627-2649AGGTTTTGAAAATGTACAATATGUAUUGUACAUUUUCAAAACCUGUUUUGAAAAUGUACAAUAUGU14.67.712


Target Position: 1144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144GAAUUUCAGCCUGUUUACA86.2069524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1142-1164AAGAATTTCAGCCTGTTTACAAGUGUAAACAGGCUGAAAUUCUUGAAUUUCAGCCUGUUUACAAGU14.77.432


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394AAGAAAAAUAAAAAUGUAA87.4256428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876412AAGAAAAATAAAAATGTAATTACATTTTTATTTTTCTT0.437300.430100.603400.500001.000001.00000


Target Position: 3308, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3308CUUUUGAGUUGAAUUUAUU84.5573654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853326CTTTTGAGTTGAATTTATTAATAAATTCAACTCAAAAG0.245700.088700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3306-3328ACCTTTTGAGTTGAATTTATTTTAAUAAAUUCAACUCAAAAGGUCUUUUGAGUUGAAUUUAUUUUU-10.312.222


Target Position: 681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681CUCAUUUGUGGAAAAGACU73.35391814

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
679-701GGCTCATTTGTGGAAAAGACTGTAGUCUUUUCCACAAAUGAGCCCUCAUUUGUGGAAAAGACUGUU13.313.822


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252GGAACAACGAGGUCAUGGU82.8006809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932270GGAACAACGAGGTCATGGTACCATGACCTCGTTGTTCC0.119400.004200.517200.750001.000001.00000


Target Position: 1059, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059CCAUUAUUAUGAUUAUCCU90.0062274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1057-1079AGCCATTATTATGATTATCCTTCAGGAUAAUCAUAAUAAUGGCUCCAUUAUUAUGAUUAUCCUUCU15.4-1.832


Target Position: 3315, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315GUUGAAUUUAUUUUAUUAU84.137693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6803333GTTGAATTTATTTTATTATATAATAAAATAAATTCAAC0.449800.155400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3313-3335GAGTTGAATTTATTTTATTATTTAUAAUAAAAUAAAUUCAACUCGUUGAAUUUAUUUUAUUAUUUU-7.57.422


Target Position: 3580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580CCCAUCUUGUUUCACACUA81.5493926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4493598CCCATCTTGTTTCACACTATAGTGTGAAACAAGATGGG0.176000.120100.819001.000001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842AGCGCAUAUCUGGAAAUUU77.02611394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850860AGCGCATATCTGGAAATTTAAATTTCCAGATATGCGCT0.069900.012600.853400.750001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813AGAAGUAUUUAAUGAACUU87.637410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711831AGAAGTATTTAATGAACTTAAGTTCATTAAATACTTCT0.166800.080800.586200.750001.000001.00000


Target Position: 3179, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179CUUUUAUGCCUUCACUUUA87.7458405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6873197CTTTTATGCCTTCACTTTATAAAGTGAAGGCATAAAAG0.765400.116800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3177-3199AACTTTTATGCCTTCACTTTACAUAAAGUGAAGGCAUAAAAGUUCUUUUAUGCCUUCACUUUACAU19.2-1.422


Target Position: 3207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3207GCCUUAGAUAAAAGAACCG65.4882607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863225GCCTTAGATAAAAGAACCGCGGTTCTTTTATCTAAGGC0.424000.309200.586200.500000.989100.62500


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326CUGCAAGAACGGGGUGAAU73.13871837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061344CTGCAAGAACGGGGTGAATATTCACCCCGTTCTTGCAG0.227800.036300.775900.750001.000001.00000


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741CCCUUGCACAAGUGAACAG69.60362221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504759CCCTTGCACAAGTGAACAGCTGTTCACTTGTGCAAGGG0.246600.033900.706900.750000.972800.62500


Target Position: 3265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3265UACAUACAGGCCAUACUUU75.7421536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903283TACATACAGGCCATACTTTAAAGTATGGCCTGTATGTA0.065800.054800.681000.500001.000001.00000


Target Position: 3307, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3307CCUUUUGAGUUGAAUUUAU85.7712562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3473325CCTTTTGAGTTGAATTTATATAAATTCAACTCAAAAGG0.243400.093900.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3305-3327GACCTTTTGAGTTGAATTTATTTAUAAAUUCAACUCAAAAGGUCCCUUUUGAGUUGAAUUUAUUUU2.112.222


Target Position: 3578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578UGCCCAUCUUGUUUCACAC67.76932405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933596TGCCCATCTTGTTTCACACGTGTGAAACAAGATGGGCA0.199300.137800.560300.500001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GCCCAUUUAGCUACAAAAA86.6027494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777788GCCCATTTAGCTACAAAAATTTTTGTAGCTAAATGGGC0.081800.027301.000001.000000.967400.62500


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482UGGUUUUGCGAUUAAGAUC62.43652844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894500TGGTTTTGCGATTAAGATCGATCTTAATCGCAAAACCA0.225500.006400.663800.500001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GACUAUCCCAUUGACCUCU75.22921591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727562GACTATCCCATTGACCTCTAGAGGTCAATGGGATAGTC0.239400.014700.594800.500000.994601.00000


Target Position: 3066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066GUUUGAAAUAGUUGAUCUA95.3146102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086ACGTTTGAAATAGTTGATCTACAUAGAUCAACUAUUUCAAACGUGUUUGAAAUAGUUGAUCUACAU20.47.722


Target Position: 3303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3303GGGACCUUUUGAGUUGAAU78.73721194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5623321GGGACCTTTTGAGTTGAATATTCAACTCAAAAGGTCCC0.126600.109700.982801.000001.000001.00000


Target Position: 587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587CAAUGAAAGACGAUUUGGA88.5171362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
585-607CTCAATGAAAGACGATTTGGAGAUCCAAAUCGUCUUUCAUUGAGCAAUGAAAGACGAUUUGGAGAU20.17.423


Target Position: 3305, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305GACCUUUUGAGUUGAAUUU78.99871161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5423323GACCTTTTGAGTTGAATTTAAATTCAACTCAAAAGGTC0.132900.097500.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3303-3325GGGACCTTTTGAGTTGAATTTATAAAUUCAACUCAAAAGGUCCCGACCUUUUGAGUUGAAUUUAUU7.417.323


Target Position: 2968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968GGAUUGUUUUAAAUCUGUU90.8023242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332986GGATTGTTTTAAATCTGTTAACAGATTTAAAACAATCC0.063900.005500.724101.000000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2966-2988AAGGATTGTTTTAAATCTGTTATAACAGAUUUAAAACAAUCCUUGGAUUGUUUUAAAUCUGUUAUU19.214.822


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434CAGAGAAGCUCAAGCCAGA92.4994172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860452CAGAGAAGCTCAAGCCAGATCTGGCTTGAGCTTCTCTG0.102800.007600.560300.500000.951100.87500


Target Position: 3313, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313GAGUUGAAUUUAUUUUAUU91.3564224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3473331GAGTTGAATTTATTTTATTAATAAAATAAATTCAACTC0.402700.082600.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3311-3333TTGAGTTGAATTTATTTTATTATAAUAAAAUAAAUUCAACUCAAGAGUUGAAUUUAUUUUAUUAUU-10.319.212


Target Position: 1737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737UUGUAGGAAGAGGGAUAAU67.20112464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521755TTGTAGGAAGAGGGATAATATTATCCCTCTTCCTACAA0.346800.032100.637900.500001.000001.00000


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035GGAAAAUAAUAUGUACACA97.553552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161053GGAAAATAATATGTACACATGTGTACATATTATTTTCC0.468700.352300.663800.750001.000001.00000


Target Position: 3649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3649GUGCUAUUUACUGAAGUUA86.0392538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3647-3669CAGTGCTATTTACTGAAGTTATTUAACUUCAGUAAAUAGCACUGGUGCUAUUUACUGAAGUUAUUU19.219.732


Target Position: 2382, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2382GCUUUUAAUGAUAAUUCAU87.7102408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992400GCTTTTAATGATAATTCATATGAATTATCATTAAAAGC0.064900.006800.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2380-2402AAGCTTTTAATGATAATTCATGAAUGAAUUAUCAUUAAAAGCUUGCUUUUAAUGAUAAUUCAUGAU8.9-3.822


Target Position: 2701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2701CAGGGACUGACAAAAGACU80.58721015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642719CAGGGACTGACAAAAGACTAGTCTTTTGTCAGTCCCTG0.104000.014400.577600.500001.000001.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447GCCAGAGGAUAUUACUCAG82.6168822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925465GCCAGAGGATATTACTCAGCTGAGTAATATCCTCTGGC0.255800.005700.715500.750000.962000.75000


Target Position: 1741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1741AGGAAGAGGGAUAAUACAA90.1799264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821759AGGAAGAGGGATAATACAATTGTATTATCCCTCTTCCT0.364900.262500.698300.750001.000001.00000


Target Position: 3248, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248CUUGAUUUAGCACUAUUUA87.6958409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863266CTTGATTTAGCACTATTTATAAATAGTGCTAAATCAAG0.359100.099300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3246-3268TCCTTGATTTAGCACTATTTACAUAAAUAGUGCUAAAUCAAGGACUUGAUUUAGCACUAUUUACAU4.67.423


Target Position: 2587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587GUAGCUUUAGGGCAAUAUU82.4835837

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2585-2607AGGTAGCTTTAGGGCAATATTGCAAUAUUGCCCUAAAGCUACCUGUAGCUUUAGGGCAAUAUUGCU15.218.333


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365UCACCUCUUCUAAUCUUUU74.00391743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4593383TCACCTCTTCTAATCTTTTAAAAGATTAGAAGAGGTGA0.314800.030500.724100.750001.000001.00000


Target Position: 3302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3302GGGGACCUUUUGAGUUGAA88.5083364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5723320GGGGACCTTTTGAGTTGAATTCAACTCAAAAGGTCCCC0.123800.114900.819001.000001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348ACAGGGGAAAAUGGAAGAA74.72291656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051366ACAGGGGAAAATGGAAGAATTCTTCCATTTTCCCCTGT0.362100.386100.534500.750001.000001.00000


Target Position: 773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CAUUUAGCUACAAAAAUGU79.81531081

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
771-793CCCATTTAGCTACAAAAATGTGCACAUUUUUGUAGCUAAAUGGGCAUUUAGCUACAAAAAUGUGCU-3.313.622


Target Position: 3342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3342UGUUUAAUGUCUGGUGCUU71.15392062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223360TGTTTAATGTCTGGTGCTTAAGCACCAGACATTAAACA0.062400.038900.569000.750001.000001.00000


Target Position: 3386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386UGUAUUUGUUUGCAAUUUU74.2561719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463404TGTATTTGTTTGCAATTTTAAAATTGCAAACAAATACA0.087000.025700.706900.750001.000001.00000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256CCCUUUCCUCAGAAGUCAU81.2559947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821274CCCTTTCCTCAGAAGTCATATGACTTCTGAGGAAAGGG0.193400.021200.836201.000000.989100.62500


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141CCUGUGUGCCAUUUUAAGA84.2138680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993159CCTGTGTGCCATTTTAAGATCTTAAAATGGCACACAGG0.050300.033600.620700.750001.000001.00000


Target Position: 2456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456CGGGUGAAAAUCCUAUUUA88.8825334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922474CGGGTGAAAATCCTATTTATAAATAGGATTTTCACCCG0.097800.019600.879301.000000.962000.75000


Target Position: 3624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3624UAGUUUUAACAGUUCACUU78.59771210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733642TAGTTTTAACAGTTCACTTAAGTGAACTGTTAAAACTA0.192900.132800.534500.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GCUGAAGACUAUCCCAUUG76.42541462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
748556GCTGAAGACTATCCCATTGCAATGGGATAGTCTTCAGC0.086200.053200.706900.750001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043UGAGAGUUGCUGGUGUAAA81.4585933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653061TGAGAGTTGCTGGTGTAAATTTACACCAGCAACTCTCA0.082700.004800.724100.750001.000001.00000


Target Position: 2881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881CAUGUAUUAAAACUGAUUU83.4196755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2879-2901ATCATGTATTAAAACTGATTTTTAAAUCAGUUUUAAUACAUGAUCAUGUAUUAAAACUGAUUUUUU19.26.711


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088AGGAGAAAAGAAAGACACA88.5924360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332106AGGAGAAAAGAAAGACACATGTGTCTTTCTTTTCTCCT0.722700.333500.637900.500001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GCAAGUGUCGUGUGUGUGA88.7915339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771865GCAAGTGTCGTGTGTGTGATCACACACACGACACTTGC0.100500.019800.629300.750001.000001.00000


Target Position: 1300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300GGAGUAACAAUAAGUUACA93.8984130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1298-1320AAGGAGTAACAATAAGTTACAAAUGUAACUUAUUGUUACUCCUUGGAGUAACAAUAAGUUACAAAU12.921.4


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375CAGAGGCUCCAAAGAUAUA94.5762119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182393CAGAGGCTCCAAAGATATATATATCTTTGGAGCCTCTG0.841000.186700.741400.750001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139AACCUGUGUGCCAUUUUAA85.2538601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9133157AACCTGTGTGCCATTTTAATTAAAATGGCACACAGGTT0.091700.062700.612100.500001.000001.00000


Target Position: 3111, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111GUUAGGAAGGAAAAACCAA88.6109357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3109-3131GAGTTAGGAAGGAAAAACCAATAUUGGUUUUUCCUUCCUAACUCGUUAGGAAGGAAAAACCAAUAU18.819.923


Target Position: 3164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3164CUUAAUGUUUGGUAACUUU84.1576687

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3162-3184TACTTAATGTTTGGTAACTTTTAAAAGUUACCAAACAUUAAGUACUUAAUGUUUGGUAACUUUUAU12.96.922


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454GAUAUUACUCAGAUCCAAC83.6581738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907472GATATTACTCAGATCCAACGTTGGATCTGAGTAATATC0.236800.029500.534500.500001.000001.00000


Target Position: 386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386AAGAUAUAAAGAAAAAUAA90.9923236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745404AAGATATAAAGAAAAATAATTATTTTTCTTTATATCTT0.915400.826900.603400.500001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770ACCUUUUCUUCCUGGACUA81.5994923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642788ACCTTTTCTTCCTGGACTATAGTCCAGGAAGAAAAGGT0.322200.067400.681000.750001.000001.00000


Target Position: 3025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3025UCUGAAAGACAAGUAUGUU75.43291573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913043TCTGAAAGACAAGTATGTTAACATACTTGTCTTTCAGA0.065800.011500.577600.750000.994600.62500


Target Position: 270, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CACAAAUUCAACAUUUUUA91.3763222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327288CACAAATTCAACATTTTTATAAAAATGTTGAATTTGTG0.257800.174500.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
268-290TGCACAAATTCAACATTTTTACAUAAAAAUGUUGAAUUUGUGCACACAAAUUCAACAUUUUUACAU-3.35.322


Target Position: 310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
310GCACGAUGUGAUGAUUUAG78.9041172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555328GCACGATGTGATGATTTAGCTAAATCATCACATCGTGC0.516300.058700.681000.750001.000001.00000


Target Position: 2873, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873CUGUUAAUCAUGUAUUAAA96.146584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882891CTGTTAATCATGTATTAAATTTAATACATGATTAACAG0.052400.023100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2871-2893TTCTGTTAATCATGTATTAAAACUUUAAUACAUGAUUAACAGAACUGUUAAUCAUGUAUUAAAACU1.46.922


Target Position: 3296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3296CUGAAUGGGGACCUUUUGA75.61771551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9963314CTGAATGGGGACCTTTTGATCAAAAGGTCCCCATTCAG0.239200.018500.560300.500001.000001.00000


Target Position: 226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
226UCAUGUGGAGAAUGUAUAC69.69752214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875244TCATGTGGAGAATGTATACGTATACATTCTCCACATGA0.104300.020500.543100.500001.000001.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GACAGAAGGGAGUUUGCUA97.203559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292419GACAGAAGGGAGTTTGCTATAGCAAACTCCCTTCTGTC0.123300.021300.646600.750001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494GUGGUCAAUCCGAAGUAUG69.81592202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522512GTGGTCAATCCGAAGTATGCATACTTCGGATTGACCAC0.241800.005100.637900.500000.989100.75000


Target Position: 3355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355GUGCUUUCUAUCACCUCUU77.53851336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6833373GTGCTTTCTATCACCTCTTAAGAGGTGATAGAAAGCAC0.099000.034900.655200.750000.994600.62500


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499UCAGGGGAGCCACAGACAU68.93242299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
759517TCAGGGGAGCCACAGACATATGTCTGTGGCTCCCCTGA0.271700.017600.569000.750001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509CACAGACAUUUACAUUAAA98.034645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140527CACAGACATTTACATTAAATTTAATGTAAATGTCTGTG0.735300.486400.793100.750001.000001.00000


Target Position: 3596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3596CUAGUCACAUUCUUGUUUU81.2691946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5603614CTAGTCACATTCTTGTTTTAAAACAAGAATGTGACTAG0.126800.027600.672400.750001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408UGUAACCAACCGUAGCAAA79.47811112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
624426TGTAACCAACCGTAGCAAATTTGCTACGGTTGGTTACA0.518300.149100.706900.750000.989100.87500


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219UGCCAAAUCAUGUGGAGAA82.6056823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
722237TGCCAAATCATGTGGAGAATTCTCCACATGATTTGGCA0.091200.050100.681000.750000.994600.75000


Target Position: 795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795CAGUCUUACUAAUAAAGGA97.004462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815CTCAGTCTTACTAATAAAGGAGAUCCUUUAUUAGUAAGACUGAGCAGUCUUACUAAUAAAGGAGAU10.918.933


Target Position: 3598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598AGUCACAUUCUUGUUUUAA82.7628811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8963616AGTCACATTCTTGTTTTAATTAAAACAAGAATGTGACT0.065400.011200.672400.750001.000001.00000


Target Position: 2829, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829GAUUGAAAGGGCAAUAGUU91.6105212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672847GATTGAAAGGGCAATAGTTAACTATTGCCCTTTCAATC0.092000.023500.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2827-2849GCGATTGAAAGGGCAATAGTTAAAACUAUUGCCCUUUCAAUCGCGAUUGAAAGGGCAAUAGUUAAU11.67.432


Target Position: 2930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2930AUGCAGAAUCCAAAGUAAA84.3368673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902948ATGCAGAATCCAAAGTAAATTTACTTTGGATTCTGCAT0.620100.011300.655200.500001.000001.00000


Target Position: 3083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3083UACAAAGGCCAUGGGAAAA71.28042042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083101TACAAAGGCCATGGGAAAATTTTCCCATGGCCTTTGTA0.353500.098200.681000.500001.000001.00000


Target Position: 2761, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761GCCUUUUUGACCUUUUCUU74.44311697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632779GCCTTTTTGACCTTTTCTTAAGAAAAGGTCAAAAAGGC0.126500.044500.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2759-2781GTGCCTTTTTGACCTTTTCTTCCAAGAAAAGGUCAAAAAGGCACGCCUUUUUGACCUUUUCUUCCU10.39.521


Target Position: 3372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3372UUCUAAUCUUUUAAUGUAU75.63841549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7483390TTCTAATCTTTTAATGTATATACATTAAAAGATTAGAA0.111300.108100.629300.500001.000001.00000


Target Position: 2791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791GAAAUCAAGCUUAUUGGAU82.2504861

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2789-2811TTGAAATCAAGCTTATTGGATTAAUCCAAUAAGCUUGAUUUCAAGAAAUCAAGCUUAUUGGAUUAU21.27.432


Target Position: 2963, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963GUUAAGGAUUGUUUUAAAU84.1937683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2961-2983TAGTTAAGGATTGTTTTAAATCTAUUUAAAACAAUCCUUAACUAGUUAAGGAUUGUUUUAAAUCUU-9.119.922


Target Position: 2871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2871UUCUGUUAAUCAUGUAUUA84.0456703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7212889TTCTGTTAATCATGTATTATAATACATGATTAACAGAA0.146900.045200.637900.500001.000001.00000


Target Position: 3090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3090GCCAUGGGAAAAAUUCAGA77.97061295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263108GCCATGGGAAAAATTCAGATCTGAATTTTTCCCATGGC0.137700.104400.775900.750001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627GAAUGCAGCACAGAUGAAG73.98781745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081645GAATGCAGCACAGATGAAGCTTCATCTGTGCTGCATTC0.271800.006100.534500.500001.000001.00000


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872UCUGUUAAUCAUGUAUUAA83.2813767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962890TCTGTTAATCATGTATTAATTAATACATGATTAACAGA0.079400.035700.689700.750001.000001.00000


Target Position: 377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
377GAGGCUCCAAAGAUAUAAA96.910365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176395GAGGCTCCAAAGATATAAATTTATATCTTTGGAGCCTC0.844400.226100.810300.750001.000001.00000


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444UCUGACAGCUUUAAAAUUA81.0902964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321462TCTGACAGCTTTAAAATTATAATTTTAAAGCTGTCAGA0.509400.387700.689700.750001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500CAGGGGAGCCACAGACAUU86.5548498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616518CAGGGGAGCCACAGACATTAATGTCTGTGGCTCCCCTG0.397000.019400.775900.750001.000001.00000


Target Position: 3106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106AGAGAGUUAGGAAGGAAAA87.0054464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4823124AGAGAGTTAGGAAGGAAAATTTTCCTTCCTAACTCTCT0.233500.028700.724100.750001.000001.00000


Target Position: 3452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3452CAAUUUGCCUUUUUAAUGA87.0559458

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3450-3472GTCAATTTGCCTTTTTAATGAACUCAUUAAAAAGGCAAAUUGACCAAUUUGCCUUUUUAAUGAACU-1.414.021


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GGAGAAGUAUUUAAUGAAC82.8915798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263829GGAGAAGTATTTAATGAACGTTCATTAAATACTTCTCC0.344000.118600.724100.750001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255UCCCUUUCCUCAGAAGUCA69.14082274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321273TCCCTTTCCTCAGAAGTCATGACTTCTGAGGAAAGGGA0.179400.025500.646600.500000.962000.62500


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045AGAGUUGCUGGUGUAAAAU76.57161444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9943063AGAGTTGCTGGTGTAAAATATTTTACACCAGCAACTCT0.094400.004200.715500.750001.000001.00000


Target Position: 3366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366CACCUCUUCUAAUCUUUUA90.6714245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503384CACCTCTTCTAATCTTTTATAAAAGATTAGAAGAGGTG0.293800.030900.758600.750001.000001.00000


Target Position: 1210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210GCAAAUUCUAGCAAUGUAA92.7511165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1208-1230CTGCAAATTCTAGCAATGTAATTUUACAUUGCUAGAAUUUGCAGGCAAAUUCUAGCAAUGUAAUUU13.57.423


Target Position: 3050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050UGCUGGUGUAAAAUACGUU75.40921575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943068TGCTGGTGTAAAATACGTTAACGTATTTTACACCAGCA0.127300.028300.706900.750001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392UGAGGUUCAAUUUGAAAUU71.40882024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6401410TGAGGTTCAATTTGAAATTAATTTCAAATTGAACCTCA0.138700.018100.715500.750001.000001.00000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672UGCAGGAAAGAAAACAGUU73.50851799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361690TGCAGGAAAGAAAACAGTTAACTGTTTTCTTTCCTGCA0.289400.063100.706900.750001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410GAGUUUGCUAAAUUUGAAA91.6374208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3532428GAGTTTGCTAAATTTGAAATTTCAAATTTAGCAAACTC0.467300.064800.810300.750001.000001.00000


Target Position: 3323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3323UAUUUUAUUAUUUUUAUUU77.46361346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363341TATTTTATTATTTTTATTTAAATAAAAATAATAAAATA0.512900.351700.543100.500001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GCAAUGUAAUUCAGUUGAU87.9911389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361238GCAATGTAATTCAGTTGATATCAACTGAATTACATTGC0.061200.006700.672401.000001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625AGUUUUAACAGUUCACUUU80.05161056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5443643AGTTTTAACAGTTCACTTTAAAGTGAACTGTTAAAACT0.209600.143700.706900.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GAGCCACAGACAUUUACAU89.939279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470523GAGCCACAGACATTTACATATGTAAATGTCTGTGGCTC0.668700.042400.655200.750001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307AGACAUCAUUCCAAUUGUA95.912188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982325AGACATCATTCCAATTGTATACAATTGGAATGATGTCT0.065200.006600.543100.750001.000001.00000


Target Position: 3188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188CUUCACUUUACAAAUUCAA81.8673904

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3186-3208GCCTTCACTTTACAAATTCAAGCUUGAAUUUGUAAAGUGAAGGCCUUCACUUUACAAAUUCAAGCU7.419.232


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115CGCGCGGAAAAGAUGAAUU76.37321467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870133CGCGCGGAAAAGATGAATTAATTCATCTTTTCCGCGCG0.525500.006900.913801.000001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055UGAGCCAUUAUUAUGAUUA81.8832902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621073TGAGCCATTATTATGATTATAATCATAATAATGGCTCA0.272100.022300.689700.750001.000001.00000


Target Position: 2836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836AGGGCAAUAGUUAAAGUAA91.6123211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952854AGGGCAATAGTTAAAGTAATTACTTTAACTATTGCCCT0.213900.074300.810300.750001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101GACACAUGCACACAGGAAU85.9392545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932119GACACATGCACACAGGAATATTCCTGTGTGCATGTGTC0.079500.077300.810300.750001.000001.00000


Target Position: 1993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1993CCGAAGUUUCAAGGGCAAA76.57931442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132011CCGAAGTTTCAAGGGCAAATTTGCCCTTGAAACTTCGG0.063000.027100.913801.000001.000001.00000


Target Position: 3160, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160GUUACUUAAUGUUUGGUAA93.1466151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3158-3180GAGTTACTTAATGTTTGGTAACTUUACCAAACAUUAAGUAACUCGUUACUUAAUGUUUGGUAACUU20.06.633


Target Position: 3293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293UUGCUGAAUGGGGACCUUU60.58662955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923311TTGCTGAATGGGGACCTTTAAAGGTCCCCATTCAGCAA0.379200.009000.646600.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GAAAACAGUUCAGAAAUCU81.2372951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1679-1701AAGAAAACAGTTCAGAAATCTGCAGAUUUCUGAACUGUUUUCUUGAAAACAGUUCAGAAAUCUGCU14.810.322


Target Position: 120, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120GGAAAAGAUGAAUUUACAA99.233530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201138GGAAAAGATGAATTTACAATTGTAAATTCATCTTTTCC0.632500.303200.724101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
118-140GCGGAAAAGATGAATTTACAACCUUGUAAAUUCAUCUUUUCCGCGGAAAAGAUGAAUUUACAACCU6.914.812


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CACCUGGAAAAUAAUAUGU76.11811487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861048CACCTGGAAAATAATATGTACATATTATTTTCCAGGTG0.521800.140200.586200.500001.000001.00000


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772CUUUUCUUCCUGGACUAUU71.37532030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962790CTTTTCTTCCTGGACTATTAATAGTCCAGGAAGAAAAG0.302800.105700.629300.750001.000001.00000


Target Position: 2225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225GGUUCUAUUUUACGUAUUC78.48221225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852243GGTTCTATTTTACGTATTCGAATACGTAAAATAGAACC0.066300.011700.681000.750001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394AGGUUCAAUUUGAAAUUAG73.31561818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341412AGGTTCAATTTGAAATTAGCTAATTTCAAATTGAACCT0.118600.016500.672400.500001.000001.00000


Target Position: 3361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3361UCUAUCACCUCUUCUAAUC60.7852942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693379TCTATCACCTCTTCTAATCGATTAGAAGAGGTGATAGA0.347100.026900.543100.500001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GGCUCAUUUGUGGAAAAGA86.3044513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966697GGCTCATTTGTGGAAAAGATCTTTTCCACAAATGAGCC0.100400.004800.775900.750001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458GGUGAAAAUCCUAUUUAUA101.33911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3762476GGTGAAAATCCTATTTATATATAAATAGGATTTTCACC0.338600.042500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2456-2478CGGGTGAAAATCCTATTTATAAGUAUAAAUAGGAUUUUCACCCGGGUGAAAAUCCUAUUUAUAAGU-8.014.902


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903UCUUUGGAUACUAGUACUU70.00912184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101921TCTTTGGATACTAGTACTTAAGTACTAGTATCCAAAGA0.501700.018300.586200.750001.000001.00000


Target Position: 3397, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397GCAAUUUUGGGGUAAGACU76.82111414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3395-3417TTGCAATTTTGGGGTAAGACTTTAGUCUUACCCCAAAAUUGCAAGCAAUUUUGGGGUAAGACUUUU21.4-3.332


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591UCACACUAGUCACAUUCUU71.88911973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163609TCACACTAGTCACATTCTTAAGAATGTGACTAGTGTGA0.074700.041500.586200.750001.000001.00000


Target Position: 114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
114CCGCGCGGAAAAGAUGAAU65.45822609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970132CCGCGCGGAAAAGATGAATATTCATCTTTTCCGCGCGG0.452400.004700.905201.000001.000001.00000


Target Position: 2214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214UGACGACUGUUGGUUCUAU81.3329938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012232TGACGACTGTTGGTTCTATATAGAACCAACAGTCGTCA0.064400.046200.681000.750001.000001.00000


Target Position: 3651, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651GCUAUUUACUGAAGUUAUU86.0903535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8493669GCTATTTACTGAAGTTATTAATAACTTCAGTAAATAGC0.098400.007500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3649-3671GTGCTATTTACTGAAGTTATTTAAAUAACUUCAGUAAAUAGCACGCUAUUUACUGAAGUUAUUUAU4.6-2.321


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351GGGGAAAAUGGAAGAAAAU85.3946590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281369GGGGAAAATGGAAGAAAATATTTTCTTCCATTTTCCCC0.072300.054800.982801.000001.000001.00000


Target Position: 3198, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198CAAAUUCAAGCCUUAGAUA93.3398146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6853216CAAATTCAAGCCTTAGATATATCTAAGGCTTGAATTTG0.477200.376800.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3196-3218TACAAATTCAAGCCTTAGATAAAUAUCUAAGGCUUGAAUUUGUACAAAUUCAAGCCUUAGAUAAAU11.67.422


Target Position: 1413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413CAUAACUUCAAAUAAGUGU75.00451614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1411-1433AGCATAACTTCAAATAAGTGTCCACACUUAUUUGAAGUUAUGCUCAUAACUUCAAAUAAGUGUCCU11.64.623


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271ACAAAUUCAACAUUUUUAC62.67772830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972289ACAAATTCAACATTTTTACGTAAAAATGTTGAATTTGT0.162000.100800.525900.500001.000001.00000


Target Position: 597, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597CGAUUUGGAGAAUGUAAAA94.9278110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378615CGATTTGGAGAATGTAAAATTTTACATTCTCCAAATCG0.298800.042100.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
595-617GACGATTTGGAGAATGTAAAAAGUUUUACAUUCUCCAAAUCGUCCGAUUUGGAGAAUGUAAAAAGU6.920.112


Target Position: 595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595GACGAUUUGGAGAAUGUAA94.8099113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515613GACGATTTGGAGAATGTAATTACATTCTCCAAATCGTC0.141800.026400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
593-615AAGACGATTTGGAGAATGTAAAAUUACAUUCUCCAAAUCGUCUUGACGAUUUGGAGAAUGUAAAAU16.115.222


Target Position: 2552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552GAAUGCAAAGUAGCAAUUU79.92081071

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2550-2572CTGAATGCAAAGTAGCAATTTCCAAAUUGCUACUUUGCAUUCAGGAAUGCAAAGUAGCAAUUUCCU18.520.022


Target Position: 3228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228CAAUUUUCUGCUAAAAAGU77.32641360

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3226-3248AGCAATTTTCTGCTAAAAAGTCCACUUUUUAGCAGAAAAUUGCUCAAUUUUCUGCUAAAAAGUCCU-3.80.432


Target Position: 2649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649GUAUAAUUUUUAAAAUGUU88.1199385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2647-2669ATGTATAATTTTTAAAATGTTTTAACAUUUUAAAAAUUAUACAUGUAUAAUUUUUAAAAUGUUUUU5.3-8.021


Target Position: 2798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798AGCUUAUUGGAUUAAGUGA83.7653729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372816AGCTTATTGGATTAAGTGATCACTTAATCCAATAAGCT0.115400.005400.629300.500000.983700.62500


Target Position: 1742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1742GGAAGAGGGAUAAUACAAA99.394426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611760GGAAGAGGGATAATACAAATTTGTATTATCCCTCTTCC0.411600.269000.870701.000001.000001.00000


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GCAGGAAAGAAAACAGUUC72.40781922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411691GCAGGAAAGAAAACAGTTCGAACTGTTTTCTTTCCTGC0.282800.069500.681000.750001.000001.00000


Target Position: 3414, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3414CUUUUUUAUGAGUACUUUU82.1846868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903432CTTTTTTATGAGTACTTTTAAAAGTACTCATAAAAAAG0.079900.015300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3412-3434GACTTTTTTATGAGTACTTTTTCAAAAGUACUCAUAAAAAAGUCCUUUUUUAUGAGUACUUUUUCU12.9-9.1


Target Position: 3052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3052CUGGUGUAAAAUACGUUUG63.54622767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243070CTGGTGTAAAATACGTTTGCAAACGTATTTTACACCAG0.107400.031700.637900.500001.000001.00000


Target Position: 225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
225AUCAUGUGGAGAAUGUAUA81.3034943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
679243ATCATGTGGAGAATGTATATATACATTCTCCACATGAT0.118200.021400.637900.500001.000001.00000


Target Position: 2626, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626CAGGUUUUGAAAAUGUACA84.1687686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2624-2646TGCAGGTTTTGAAAATGTACAATUGUACAUUUUCAAAACCUGCACAGGUUUUGAAAAUGUACAAUU14.617.322


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113UAAUAUUCAGACAAUUUUU78.73241197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711131TAATATTCAGACAATTTTTAAAAATTGTCTGAATATTA0.241500.059000.534500.500001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361GACAUAGAAAAUCCCAGAG73.00861853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980379GACATAGAAAATCCCAGAGCTCTGGGATTTTCTATGTC0.125500.073000.508600.500001.000001.00000


Target Position: 3208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3208CCUUAGAUAAAAGAACCGA79.29311130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8203226CCTTAGATAAAAGAACCGATCGGTTCTTTTATCTAAGG0.258300.176700.551700.750001.000001.00000


Target Position: 1497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497UCUUCAGUACAUCUGUGAA87.2006444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341515TCTTCAGTACATCTGTGAATTCACAGATGTACTGAAGA0.081100.005500.551700.750000.962001.00000


Target Position: 621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
621UGGAACAGAUCUGAUGAAU73.44951807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
746639TGGAACAGATCTGATGAATATTCATCAGATCTGTTCCA0.213100.012300.836200.750001.000001.00000


Target Position: 2869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2869GUUUCUGUUAAUCAUGUAU83.3633761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712887GTTTCTGTTAATCATGTATATACATGATTAACAGAAAC0.111400.031300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2867-2889GAGTTTCTGTTAATCATGTATTAAUACAUGAUUAACAGAAACUCGUUUCUGUUAAUCAUGUAUUAU21.519.222


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545ACUAUCCCAUUGACCUCUA80.7933990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888563ACTATCCCATTGACCTCTATAGAGGTCAATGGGATAGT0.247300.015500.534500.750000.994600.87500


Target Position: 2837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2837GGGCAAUAGUUAAAGUAAU91.7618202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372855GGGCAATAGTTAAAGTAATATTACTTTAACTATTGCCC0.252900.079600.982801.000001.000001.00000


Target Position: 1122, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122GACAAUUUUUGCAGUUACU82.8571799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041140GACAATTTTTGCAGTTACTAGTAACTGCAAAAATTGTC0.123900.040500.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1120-1142CAGACAATTTTTGCAGTTACTGAAGUAACUGCAAAAAUUGUCUGGACAAUUUUUGCAGUUACUGAU19.05.332


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337GGGUGAAUGGAACAGGGGA84.3328674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171355GGGTGAATGGAACAGGGGATCCCCTGTTCCATTCACCC0.152200.076100.620700.750001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536GAGCUGAAGACUAUCCCAU86.2522519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459554GAGCTGAAGACTATCCCATATGGGATAGTCTTCAGCTC0.181100.047900.655200.750001.000001.00000


Target Position: 3368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3368CCUCUUCUAAUCUUUUAAU83.0844784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343386CCTCTTCTAATCTTTTAATATTAAAAGATTAGAAGAGG0.185700.174800.836201.000001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GGCUGGAGGAAUGUUACAC71.42472022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
889940GGCTGGAGGAATGTTACACGTGTAACATTCCTCCAGCC0.065900.011300.706900.750001.000001.00000


Target Position: 2634, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634GAAAAUGUACAAUAUGUAU93.8021134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2632-2654TTGAAAATGTACAATATGTATAAAUACAUAUUGUACAUUUUCAAGAAAAUGUACAAUAUGUAUAAU8.25.321


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046GAGUUGCUGGUGUAAAAUA96.528373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803064GAGTTGCTGGTGTAAAATATATTTTACACCAGCAACTC0.114500.004500.767200.750001.000001.00000


Target Position: 222, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222CAAAUCAUGUGGAGAAUGU80.62041011

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
220-242GCCAAATCATGTGGAGAATGTATACAUUCUCCACAUGAUUUGGCCAAAUCAUGUGGAGAAUGUAUU20.47.222


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044GAGAGUUGCUGGUGUAAAA101.37310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923062GAGAGTTGCTGGTGTAAAATTTTACACCAGCAACTCTC0.089100.004200.810300.750001.000001.00000


Target Position: 119, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CGGAAAAGAUGAAUUUACA95.959387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569137CGGAAAAGATGAATTTACATGTAAATTCATCTTTTCCG0.635100.310200.706900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
117-139CGCGGAAAAGATGAATTTACAACUGUAAAUUCAUCUUUUCCGCGCGGAAAAGAUGAAUUUACAACU-0.318.722


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564GCAAUUUCCAUAGUCACAG67.25652459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762582GCAATTTCCATAGTCACAGCTGTGACTATGGAAATTGC0.223400.086800.569000.750001.000001.00000


Target Position: 1747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747AGGGAUAAUACAAAUGAAA88.4128366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6101765AGGGATAATACAAATGAAATTTCATTTGTATTATCCCT0.363100.110500.844800.750001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443UCAAGCCAGAGGAUAUUAC60.14622995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983461TCAAGCCAGAGGATATTACGTAATATCCTCTGGCTTGA0.070900.008200.543100.500001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732GCUCAGGAACCCUUGCACA87.2032443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
955750GCTCAGGAACCCTTGCACATGTGCAAGGGTTCCTGAGC0.057800.007500.646600.750000.918500.62500


Target Position: 572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
572UGGACCUGUCUUACUCAAU73.54941795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996590TGGACCTGTCTTACTCAATATTGAGTAAGACAGGTCCA0.130700.004200.836200.750001.000001.00000


Target Position: 3610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610GUUUUAAGUGCCUUUAGUU85.288597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3608-3630TTGTTTTAAGTGCCTTTAGTTTTAACUAAAGGCACUUAAAACAAGUUUUAAGUGCCUUUAGUUUUU9.8-3.822


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799UCAACUGUGAUAGAUCCAA76.40311466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291817TCAACTGTGATAGATCCAATTGGATCTATCACAGTTGA0.104300.083900.577600.750001.000001.00000


Target Position: 1699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699UGCAGUAACAAUGGAGAGU62.66522832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461717TGCAGTAACAATGGAGAGTACTCTCCATTGTTACTGCA0.302800.018700.646600.500001.000001.00000


Target Position: 550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550CCCAUUGACCUCUACUACC65.43612611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825568CCCATTGACCTCTACTACCGGTAGTAGAGGTCAATGGG0.263500.012300.637900.500001.000001.00000


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CAAGAGAGCUGAAGACUAU95.529196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677549CAAGAGAGCTGAAGACTATATAGTCTTCAGCTCTCTTG0.237500.038400.603400.750001.000001.00000


Target Position: 176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GUGUGUUUGCUCAAACAGA89.358309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
174-196CTGTGTGTTTGCTCAAACAGATGUCUGUUUGAGCAAACACACAGGUGUGUUUGCUCAAACAGAUGU16.719.332


Target Position: 515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CAUUUACAUUAAAAUUCAA99.325827

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
513-535GACATTTACATTAAAATTCAAGAUUGAAUUUUAAUGUAAAUGUCCAUUUACAUUAAAAUUCAAGAU7.46.912


Target Position: 3367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367ACCUCUUCUAAUCUUUUAA82.9916789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6283385ACCTCTTCTAATCTTTTAATTAAAAGATTAGAAGAGGT0.293800.269300.819000.750001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634GCACAGAUGAAGUUAACAG80.9269977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781652GCACAGATGAAGTTAACAGCTGTTAACTTCATCTGTGC0.060800.004500.569000.750001.000001.00000


Target Position: 2702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702AGGGACUGACAAAAGACUU75.67091544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6032720AGGGACTGACAAAAGACTTAAGTCTTTTGTCAGTCCCT0.123400.020000.706900.750001.000001.00000


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196GAAAAUAGAUGUUUAAAAG85.6562573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867214GAAAATAGATGTTTAAAAGCTTTTAAACATCTATTTTC0.068200.032900.534500.500001.000001.00000


Target Position: 2224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224UGGUUCUAUUUUACGUAUU71.12482064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152242TGGTTCTATTTTACGTATTAATACGTAAAATAGAACCA0.075000.018200.836200.750001.000001.00000


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069UGAAAUAGUUGAUCUACAA93.2509149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303087TGAAATAGTTGATCTACAATTGTAGATCAACTATTTCA0.089600.031700.577600.750000.989100.75000


Target Position: 622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622GGAACAGAUCUGAUGAAUG85.535581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700640GGAACAGATCTGATGAATGCATTCATCAGATCTGTTCC0.170200.014900.715500.750001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220GCCAAAUCAUGUGGAGAAU79.44251116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981238GCCAAATCATGTGGAGAATATTCTCCACATGATTTGGC0.053400.033800.991401.000000.994600.62500


Target Position: 3677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3677UAUGCCUAAAAUACUUAAA77.91621301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893695TATGCCTAAAATACTTAAATTTAAGTATTTTAGGCATA0.875600.071800.543100.500001.000001.00000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551CAAGUGUCAUGAAGGAAAU87.0892453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421569CAAGTGTCATGAAGGAAATATTTCCTTCATGACACTTG0.060400.011000.637900.750001.000001.00000


Target Position: 3070, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070GAAAUAGUUGAUCUACAAA99.444725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093088GAAATAGTTGATCTACAAATTTGTAGATCAACTATTTC0.095000.029500.672400.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090TTGAAATAGTTGATCTACAAAGGUUUGUAGAUCAACUAUUUCAAGAAAUAGUUGAUCUACAAAGGU20.34.623


Target Position: 3652, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652CUAUUUACUGAAGUUAUUU80.44191032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503670CTATTTACTGAAGTTATTTAAATAACTTCAGTAAATAG0.137400.007500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3650-3672TGCTATTTACTGAAGTTATTTATAAAUAACUUCAGUAAAUAGCACUAUUUACUGAAGUUAUUUAUU4.61.422


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421AGCAAAGGAACAGCAGAGA72.73871882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959439AGCAAAGGAACAGCAGAGATCTCTGCTGTTCCTTTGCT0.072700.013700.629300.500000.983700.75000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119UCAGACAAUUUUUGCAGUU68.61692332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351137TCAGACAATTTTTGCAGTTAACTGCAAAAATTGTCTGA0.162700.034800.577600.750001.000001.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393GAGGUUCAAUUUGAAAUUA90.5085248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581411GAGGTTCAATTTGAAATTATAATTTCAAATTGAACCTC0.115800.017000.775900.750001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639GAUGAAGUUAACAGUGAAG79.51841105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641657GATGAAGTTAACAGTGAAGCTTCACTGTTAACTTCATC0.056500.019500.543100.500001.000001.00000


Target Position: 3568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3568CCAUUUGAGUUGCCCAUCU76.56951445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6413586CCATTTGAGTTGCCCATCTAGATGGGCAACTCAAATGG0.368900.107300.620700.750000.967400.87500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512AGACAUUUACAUUAAAAUU85.1922608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340530AGACATTTACATTAAAATTAATTTTAATGTAAATGTCT0.526000.349500.715500.750001.000001.00000


Target Position: 1405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405GAAAUUAGCAUAACUUCAA93.8425133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1403-1425TTGAAATTAGCATAACTTCAAATUUGAAGUUAUGCUAAUUUCAAGAAAUUAGCAUAACUUCAAAUU19.2-4.322


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736AGGAACCCUUGCACAAGUG64.81192666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813754AGGAACCCTTGCACAAGTGCACTTGTGCAAGGGTTCCT0.098000.027200.551700.500000.978300.62500


Target Position: 2305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2305CCAGACAUCAUUCCAAUUG65.32632620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182323CCAGACATCATTCCAATTGCAATTGGAATGATGTCTGG0.084300.005900.698300.750001.000001.00000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443GCCAAAUGGGACACGGGUG63.72282751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912461GCCAAATGGGACACGGGTGCACCCGTGTCCCATTTGGC0.232300.015300.706900.750001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036GAAAAUAAUAUGUACACAA100.37818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271054GAAAATAATATGTACACAATTGTGTACATATTATTTTC0.426300.331000.525900.750001.000001.00000


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704GGACUGACAAAAGACUUGA86.1563529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102722GGACTGACAAAAGACTTGATCAAGTCTTTTGTCAGTCC0.145100.030700.646600.750001.000001.00000


Target Position: 2404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404AGAAGGGAGUUUGCUAAAU75.54381560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5552422AGAAGGGAGTTTGCTAAATATTTAGCAAACTCCCTTCT0.128300.024700.715500.750001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626UGAAUGCAGCACAGAUGAA87.1142452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971644TGAATGCAGCACAGATGAATTCATCTGTGCTGCATTCA0.088200.006400.551700.750001.000001.00000


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377UGGAAGCUUUUAAUGAUAA84.3456672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012395TGGAAGCTTTTAATGATAATTATCATTAAAAGCTTCCA0.116100.009800.810300.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214AUAAAAGAACCGAGCAAUU73.23951827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803232ATAAAAGAACCGAGCAATTAATTGCTCGGTTCTTTTAT0.323600.170000.534500.500001.000001.00000


Target Position: 3126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126CCAAUAGCUUUAAAACCUG72.90481866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993144CCAATAGCTTTAAAACCTGCAGGTTTTAAAGCTATTGG0.546900.066300.560300.750000.983700.75000


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195UGAAAAUAGAUGUUUAAAA86.2833515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588213TGAAAATAGATGTTTAAAATTTTAAACATCTATTTTCA0.118500.064400.724100.750001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511CAGACAUUUACAUUAAAAU89.2217317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170529CAGACATTTACATTAAAATATTTTAATGTAAATGTCTG0.627800.422300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
509-531CACAGACATTTACATTAAAATTCAUUUUAAUGUAAAUGUCUGUGCAGACAUUUACAUUAAAAUUCU-9.719.222


Target Position: 2884, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884GUAUUAAAACUGAUUUUUA97.631348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632902GTATTAAAACTGATTTTTATAAAAATCAGTTTTAATAC0.083500.043300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2882-2904ATGTATTAAAACTGATTTTTAGCUAAAAAUCAGUUUUAAUACAUGUAUUAAAACUGAUUUUUAGCU0.4-7.512


Target Position: 3659, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3659CUGAAGUUAUUUAUUAAAU84.0905698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763677CTGAAGTTATTTATTAAATATTTAATAAATAACTTCAG0.054600.019800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3657-3679TACTGAAGTTATTTATTAAATATAUUUAAUAAAUAACUUCAGUACUGAAGUUAUUUAUUAAAUAUU-7.519.211


Target Position: 2931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931UGCAGAAUCCAAAGUAAAU78.7751190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692949TGCAGAATCCAAAGTAAATATTTACTTTGGATTCTGCA0.622300.044500.844800.750001.000001.00000


Target Position: 3084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3084ACAAAGGCCAUGGGAAAAA70.19562163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2403102ACAAAGGCCATGGGAAAAATTTTTCCCATGGCCTTTGT0.342400.098900.706900.750001.000001.00000


Target Position: 2243, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243CAGUGAAUGGGAACAACGA89.8797284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2241-2263TTCAGTGAATGGGAACAACGAGGUCGUUGUUCCCAUUCACUGAACAGUGAAUGGGAACAACGAGGU19.819.222


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242UGAUGCAUACAAUUCCCUU77.52451339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021260TGATGCATACAATTCCCTTAAGGGAATTGTATGCATCA0.337200.084200.586200.750001.000001.00000


Target Position: 1503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503GUACAUCUGUGAAUGUGAA97.62949

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1501-1523CAGTACATCTGTGAATGTGAATGUUCACAUUCACAGAUGUACUGGUACAUCUGUGAAUGUGAAUGU20.520.312


Target Position: 1482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GGAAGUAGAGGUUAUUCUU92.4632174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1480-1502GAGGAAGTAGAGGTTATTCTTCAAAGAAUAACCUCUACUUCCUCGGAAGUAGAGGUUAUUCUUCAU6.918.922


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982AGUGUACAGAUCCGAAGUU77.16041379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982000AGTGTACAGATCCGAAGTTAACTTCGGATCTGTACACT0.253700.083700.560300.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GCUCAGUCUUACUAAUAAA102.9948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469810GCTCAGTCTTACTAATAAATTTATTAGTAAGACTGAGC0.235100.029900.853401.000000.945700.75000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212AGAUAAAAGAACCGAGCAA87.8536398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323230AGATAAAAGAACCGAGCAATTGCTCGGTTCTTTTATCT0.340600.167000.577600.750001.000001.00000


Target Position: 581, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CUUACUCAAUGAAAGACGA82.289857

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
579-601GTCTTACTCAATGAAAGACGATTUCGUCUUUCAUUGAGUAAGACCUUACUCAAUGAAAGACGAUUU19.720.323


Target Position: 3266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3266ACAUACAGGCCAUACUUUA87.2415441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293284ACATACAGGCCATACTTTATAAAGTATGGCCTGTATGT0.061800.047200.672400.750001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325ACUGCAAGAACGGGGUGAA77.14041381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091343ACTGCAAGAACGGGGTGAATTCACCCCGTTCTTGCAGT0.259300.025000.534500.750001.000001.00000


Target Position: 2429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2429AGGAGAAAAUGAAUGCCAA93.2759147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942447AGGAGAAAATGAATGCCAATTGGCATTCATTTTCTCCT0.154400.093400.698300.750001.000001.00000


Target Position: 2218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218GACUGUUGGUUCUAUUUUA101.30412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032236GACTGTTGGTTCTATTTTATAAAATAGAACCAACAGTC0.096000.033500.784500.750001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096AGAAAGACACAUGCACACA85.1425612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492114AGAAAGACACATGCACACATGTGTGCATGTGTCTTTCT0.458800.394700.517200.500001.000001.00000


Target Position: 2370, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370GCUGAUAUGGAAGCUUUUA86.1511530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2368-2390CTGCTGATATGGAAGCTTTTAATUAAAAGCUUCCAUAUCAGCAGGCUGAUAUGGAAGCUUUUAAUU17.013.323


Target Position: 3294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3294UGCUGAAUGGGGACCUUUU73.06311841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223312TGCTGAATGGGGACCTTTTAAAAGGTCCCCATTCAGCA0.357100.013500.853400.750001.000001.00000


Target Position: 2865, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865GAGAGUUUCUGUUAAUCAU95.1787105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412883GAGAGTTTCTGTTAATCATATGATTAACAGAAACTCTC0.060700.011300.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2863-2885ATGAGAGTTTCTGTTAATCATGTAUGAUUAACAGAAACUCUCAUGAGAGUUUCUGUUAAUCAUGUU8.917.732


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128UGAAUUUACAACCAAUUUU71.48562018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919146TGAATTTACAACCAATTTTAAAATTGGTTGTAAATTCA0.062800.047000.724100.750001.000001.00000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923GCUGGAGGAAUGUUACACG74.11681736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925941GCTGGAGGAATGTTACACGCGTGTAACATTCCTCCAGC0.062000.008900.577600.500001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550CCAAGUGUCAUGAAGGAAA89.2727315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6561568CCAAGTGTCATGAAGGAAATTTCCTTCATGACACTTGG0.102900.059500.844801.000001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442CUCAAGCCAGAGGAUAUUA83.095782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769460CTCAAGCCAGAGGATATTATAATATCCTCTGGCTTGAG0.082700.015100.775900.750000.918500.62500


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412GUUUGCUAAAUUUGAAAAG64.54382693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872430GTTTGCTAAATTTGAAAAGCTTTTCAAATTTAGCAAAC0.340100.070500.508600.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057AGCCAUUAUUAUGAUUAUC68.98462292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541075AGCCATTATTATGATTATCGATAATCATAATAATGGCT0.326000.087700.672400.500001.000001.00000


Target Position: 2800, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800CUUAUUGGAUUAAGUGAUA89.0358322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2798-2820AGCTTATTGGATTAAGTGATATTUAUCACUUAAUCCAAUAAGCUCUUAUUGGAUUAAGUGAUAUUU19.212.832


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CCUCUACUACCUUAUGGAC74.67651664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915576CCTCTACTACCTTATGGACGTCCATAAGGTAGTAGAGG0.103800.021300.525900.750001.000001.00000


Target Position: 3595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595ACUAGUCACAUUCUUGUUU72.71061883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423613ACTAGTCACATTCTTGTTTAAACAAGAATGTGACTAGT0.104700.030500.706900.750001.000001.00000


Target Position: 2925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925CAGUUAUGCAGAAUCCAAA96.653770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2923-2945TGCAGTTATGCAGAATCCAAAGTUUUGGAUUCUGCAUAACUGCACAGUUAUGCAGAAUCCAAAGUU20.111.622


Target Position: 201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
201UAGAUGUUUAAAAGCAAAU69.8662196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905219TAGATGTTTAAAAGCAAATATTTGCTTTTAAACATCTA0.080600.026200.663800.500001.000001.00000


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CAGAAGGGAGUUUGCUAAA87.8756395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582421CAGAAGGGAGTTTGCTAAATTTAGCAAACTCCCTTCTG0.127400.024700.784500.750001.000001.00000


Target Position: 2599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2599CAAUAUUGCCAUGGUUUUA88.3053373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2597-2619GGCAATATTGCCATGGTTTTACTUAAAACCAUGGCAAUAUUGCCCAAUAUUGCCAUGGUUUUACUU18.8-1.832


Target Position: 3150, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150CAUUUUAAGAGUUACUUAA95.797591

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3148-3170GCCATTTTAAGAGTTACTTAATGUUAAGUAACUCUUAAAAUGGCCAUUUUAAGAGUUACUUAAUGU6.6-9.722


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495UGGUCAAUCCGAAGUAUGA83.4123756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222513TGGTCAATCCGAAGTATGATCATACTTCGGATTGACCA0.250400.008300.620700.500000.989100.75000


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185CUCAAACAGAUGAAAAUAG72.38541925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997203CTCAAACAGATGAAAATAGCTATTTTCATCTGTTTGAG0.320600.004100.637900.500000.956500.62500