Input target sequence

Length: 1973
GGGATATTGGAGTAGCAAGAGGCTGGGAAGCCATCACTTACCTTGCACTGAGAAAGAAGACAAAGGCCAGTATGCACAGCTTTCCTCCACTGCTGCTGCTGCTGTTCTGGGGTGTGGTGTCTCACAGCTTCCCAGCGACTCTAGAAACACAAGAGCAAGATGTGGACTTAGTCCAGAAATACCTGGAAAAATACTACAACCTGAAGAATGATGGGAGGCAAGTTGAAAAGCGGAGAAATAGTGGCCCAGTGGTTGAAAAATTGAAGCAAATGCAGGAATTCTTTGGGCTGAAAGTGACTGGGAAACCAGATGCTGAAACCCTGAAGGTGATGAAGCAGCCCAGATGTGGAGTGCCTGATGTGGCTCAGTTTGTCCTCACTGAGGGGAACCCTCGCTGGGAGCAAACACATCTGACCTACAGGATTGAAAATTACACGCCAGATTTGCCAAGAGCAGATGTGGACCATGCCATTGAGAAAGCCTTCCAACTCTGGAGTAATGTCACACCTCTGACATTCACCAAGGTCTCTGAGGGTCAAGCAGACATCATGATATCTTTTGTCAGGGGAGATCATCGGGACAACTCTCCTTTTGATGGACCTGGAGGAAATCTTGCTCATGCTTTTCAACCAGGCCCAGGTATTGGAGGGGATGCTCATTTTGATGAAGATGAAAGGTGGACCAACAATTTCAGAGAGTACAACTTACATCGTGTTGCGGCTCATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGACATCTACAGCTCCTTTGGCTTCCCTAGAACTGTGAAGCATATCGATGCTGCTCTTTCTGAGGAAAACACTGGAAAAACCTACTTCTTTGTTGCTAACAAATACTGGAGGTATGATGAATATAAACGATCTATGGATCCAGGTTATCCCAAAATGATAGCACATGACTTTCCTGGAATTGGCCACAAAGTTGATGCAGTTTTCATGAAAGATGGATTTTTCTATTTCTTTCATGGAACAAGACAATACAAATTTGATCCTAAAACGAAGAGAATTTTGACTCTCCAGAAAGCTAATAGCTGGTTCAACTGCAGGAAAAATTGAACATTACTAATTTGAATGGAAAACACATGGTGTGAGTCCAAAGAAGGTGTTTTCCTGAAGAACTGTCTATTTTCTCAGTCATTTTTAACCTCTAGAGTCACTGATACACAGAATATAATCTTATTTATACCTCAGTTTGCATATTTTTTTACTATTTAGAATGTAGCCCTTTTTGTACTGATATAATTTAGTTCCACAAATGGTGGGTACAAAAAGTCAAGTTTGTGGCTTATGGATTCATATAGGCCAGAGTTGCAAAGATCTTTTCCAGAGTATGCAACTCTGACGTTGATCCCAGAGAGCAGCTTCAGTGACAAACATATCCTTTCAAGACAGAAAGAGACAGGAGACATGAGTCTTTGCCGGAGGAAAAGCAGCTCAAGAACACATGTGCAGTCACTGGTGTCACCCTGGATAGGCAAGGGATAACTCTTCTAACACAAAATAAGTGTTTTATGTTTGGAATAAAGTCAACCTTGTTTCTACTGTTTT