siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 413   415   537   945   1535  
Biltr, Rnaxs, Sidirect 222   266   655   657   951   1010   1011   1052   1209   1218   1228   1297   1330   1393   1416   1417   1460   1469   1471   1472  
1480   1488   1519   1527   1536   1548   1580   1582   1590   1592   1612   1620   1621   1640   1648   1649   1650   1656   1678   1687  
1850   1905   1906   1911  
Biltr, Ernai 999   1293  
Biltr, Ernai, Sidirect 1183  
Biltr, Ernai, Rnaxs, Sidirect 1392   1588  
Biltr, Sidirect 173   174   885   915   991   1002   1081   1083   1221   1231   1241   1268   1364   1368   1372   1396   1538   1584   1616   1699  
1733   1796   1806   1913   1916   1920   1922   1930   1932  
Biltr, Rnaxs 1   2   22   35   36   37   40   41   44   45   46   47   55   56   59   60   79   86   87   88  
102   116   117   135   136   140   141   143   144   151   152   153   175   176   181   182   184   185   191   193  
194   199   200   203   205   206   209   210   211   212   213   216   217   218   219   220   221   224   230   231  
232   239   240   241   242   243   244   245   246   247   248   250   251   252   253   254   261   262   263   265  
267   271   272   273   274   275   276   311   312   313   314   319   320   327   328   329   393   394   395   396  
397   400   406   407   408   410   411   412   414   416   425   426   427   433   434   435   436   459   460   461  
462   468   469   494   506   520   521   524   525   531   532   533   534   535   536   544   578   599   600   601  
602   603   605   636   653   656   667   668   669   670   671   672   673   675   676   677   678   679   680   681  
682   683   685   686   689   691   692   693   711   712   720   722   725   730   731   734   744   745   746   747  
748   749   772   779   800   801   802   806   807   810   811   812   813   815   816   853   886   891   892   893  
894   895   899   900   901   904   905   906   907   908   909   918   919   922   923   924   932   936   937   938  
944   946   947   948   954   955   956   958   966   968   976   977   979   1003   1004   1005   1007   1008   1009   1012  
1013   1024   1049   1050   1051   1053   1054   1055   1056   1060   1061   1062   1066   1067   1068   1091   1092   1093   1094   1119  
1125   1126   1127   1131   1132   1133   1151   1152   1153   1158   1162   1163   1206   1207   1210   1211   1215   1216   1217   1219  
1220   1225   1226   1227   1229   1230   1236   1237   1238   1261   1262   1263   1264   1265   1266   1267   1271   1272   1273   1274  
1296   1298   1304   1305   1306   1310   1316   1317   1318   1319   1320   1331   1332   1341   1342   1343   1345   1346   1348   1349  
1350   1352   1369   1370   1371   1385   1386   1387   1388   1390   1391   1394   1395   1398   1401   1402   1403   1404   1405   1412  
1413   1414   1415   1422   1429   1430   1434   1435   1436   1438   1441   1456   1457   1458   1459   1461   1464   1465   1466   1467  
1468   1470   1473   1474   1475   1476   1479   1485   1486   1487   1504   1505   1506   1508   1509   1513   1514   1515   1516   1517  
1525   1526   1528   1529   1533   1534   1537   1547   1549   1550   1551   1555   1556   1557   1559   1573   1581   1586   1587   1589  
1591   1600   1601   1609   1610   1611   1613   1614   1615   1618   1619   1625   1635   1636   1637   1639   1645   1646   1647   1651  
1652   1653   1655   1676   1677   1682   1683   1684   1685   1686   1688   1708   1709   1727   1728   1729   1730   1731   1735   1736  
1739   1743   1768   1771   1772   1774   1775   1776   1777   1779   1780   1781   1786   1791   1792   1793   1795   1813   1815   1816  
1844   1845   1846   1847   1848   1849   1853   1854   1855   1856   1859   1860   1864   1903   1904   1907   1908   1909   1910   1912  
1924   1937   1938   1941   1942   1943   1944   1945   1950   1951   1952   1953   1954   1955  


Target Position: 1469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469CAGGAAAAAUUGAACAUUA99.388914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491487CAGGAAAAATTGAACATTATAATGTTCAATTTTTCCTG0.126000.056700.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1467-1489TGCAGGAAAAATTGAACATTACTUAAUGUUCAAUUUUUCCUGCACAGGAAAAAUUGAACAUUACUU14.818.722


Target Position: 1733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733GUUGCAAAGAUCUUUUCCA83.2527358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1731-1753GAGTTGCAAAGATCTTTTCCAGAUGGAAAAGAUCUUUGCAACUCGUUGCAAAGAUCUUUUCCAGAU18.720.011


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158GACAUCUACAGCUCCUUUG70.44221095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421176GACATCTACAGCTCCTTTGCAAAGGAGCTGTAGATGTC0.033200.007100.672400.500001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310AAUGAUAGCACAUGACUUU81.0067470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741328AATGATAGCACATGACTTTAAAGTCATGTGCTATCATT0.201600.008400.508600.500001.000001.00000


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739AAGAUCUUUUCCAGAGUAU78.17624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021757AAGATCTTTTCCAGAGTATATACTCTGGAAAAGATCTT0.018600.013100.594800.500000.967401.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062GCUUACGAAUUUGCCGACA75.4342790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341080GCTTACGAATTTGCCGACATGTCGGCAAATTCGTAAGC0.079700.038400.646600.750001.000001.00000


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247CAGUGGUUGAAAAAUUGAA91.989190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276265CAGTGGTTGAAAAATTGAATTCAATTTTTCAACCACTG0.244200.072100.612100.750001.000001.00000


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907ACAGUAAGCUAACCUUUGA84.0227325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508925ACAGTAAGCTAACCTTTGATCAAAGGTTAGCTTACTGT0.262300.016800.482800.500001.000001.00000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320CCUGAAGGUGAUGAAGCAG69.37621136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431338CCTGAAGGTGATGAAGCAGCTGCTTCATCACCTTCAGG0.037500.021600.560300.750001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505CACAUGGUGUGAGUCCAAA89.5387145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861523CACATGGTGTGAGTCCAAATTTGGACTCACACCATGTG0.057900.016000.793100.750000.956500.75000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342ACAAAGUUGAUGCAGUUUU70.19521106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931360ACAAAGTTGATGCAGTTTTAAAACTGCATCAACTTTGT0.023100.001900.706900.750001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203GAAGAAUGAUGGGAGGCAA94.696549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469221GAAGAATGATGGGAGGCAATTGCCTCCCATCATTCTTC0.026400.021500.525900.750001.000001.00000


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435UGACUCUCCAGAAAGCUAA79.9632528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331453TGACTCTCCAGAAAGCTAATTAGCTTTCTGGAGAGTCA0.108100.002900.689700.750000.929300.62500


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459GUGGACCAUGCCAUUGAGA77.9242639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404477GTGGACCATGCCATTGAGATCTCAATGGCATGGTCCAC0.232700.009000.569000.500000.967400.62500


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136CGACUCUAGAAACACAAGA82.9963369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330154CGACTCTAGAAACACAAGATCTTGTGTTTCTAGAGTCG0.148000.011900.569000.750001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210GAUGGGAGGCAAGUUGAAA90.5324121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350228GATGGGAGGCAAGTTGAAATTTCAACTTGCCTCCCATC0.286900.008400.681000.750001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691UCAGAGAGUACAACUUACA80.5054499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419709TCAGAGAGTACAACTTACATGTAAGTTGTACTCTCTGA0.068600.017200.517200.500001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243GGCCCAGUGGUUGAAAAAU77.451661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405261GGCCCAGTGGTTGAAAAATATTTTTCAACCACTGGGCC0.143700.004300.991401.000000.989100.75000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GCCAUUGAGAAAGCCUUCC51.44631840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507486GCCATTGAGAAAGCCTTCCGGAAGGCTTTCTCAATGGC0.119400.030800.629300.500000.951100.62500


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441UCCAGAAAGCUAAUAGCUG63.10661472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311459TCCAGAAAGCTAATAGCTGCAGCTATTAGCTTTCTGGA0.030300.008000.586200.500000.902200.62500


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CGAUUCGGGGAGAAGUGAU81.1772456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502955CGATTCGGGGAGAAGTGATATCACTTCTCCCCGAATCG0.028000.001700.612101.000001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CCAUUCUCUUGGACUCUCC66.79941281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542752CCATTCTCTTGGACTCTCCGGAGAGTCCAAGAGAATGG0.012000.006400.474100.500000.918500.62500


Target Position: 1479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1479UGAACAUUACUAAUUUGAA89.559144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581497TGAACATTACTAATTTGAATTCAAATTAGTAATGTTCA0.547500.154200.551700.750001.000001.00000


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273CAGGAAUUCUUUGGGCUGA78.3898616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526291CAGGAATTCTTTGGGCTGATCAGCCCAAAGAATTCCTG0.015000.006300.560300.500001.000001.00000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407ACAUCUGACCUACAGGAUU77.9748634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
257425ACATCTGACCTACAGGATTAATCCTGTAGGTCAGATGT0.138600.019100.698300.750000.913001.00000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692CAGAGAGUACAACUUACAU92.579481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450710CAGAGAGTACAACTTACATATGTAAGTTGTACTCTCTG0.032000.013200.629300.750001.000001.00000


Target Position: 141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
141CUAGAAACACAAGAGCAAG72.82931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463159CTAGAAACACAAGAGCAAGCTTGCTCTTGTGTTTCTAG0.317500.087900.534500.500001.000001.00000


Target Position: 1396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396CAAGACAAUACAAAUUUGA84.2406315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1394-1416AACAAGACAATACAAATTTGATCUCAAAUUUGUAUUGUCUUGUUCAAGACAAUACAAAUUUGAUCU-3.319.232


Target Position: 951, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951GUGAUGUUCUUUAAAGACA87.5727185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394969GTGATGTTCTTTAAAGACATGTCTTTAAAGAACATCAC0.122900.006100.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971AAGTGATGTTCTTTAAAGACAGAUGUCUUUAAAGAACAUCACUUGUGAUGUUCUUUAAAGACAGAU14.620.520


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410UCUGACCUACAGGAUUGAA76.0176756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366428TCTGACCTACAGGATTGAATTCAATCCTGTAGGTCAGA0.178000.032900.551700.750000.913000.62500


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683CAACAAUUUCAGAGAGUAC81.4459446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534701CAACAATTTCAGAGAGTACGTACTCTCTGAAATTGTTG0.079500.064100.465500.500001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932AACUACGAUUCGGGGAGAA75.8507765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518950AACTACGATTCGGGGAGAATTCTCCCCGAATCGTAGTT0.024300.015300.474100.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591AGAAUAUAAUCUUAUUUAU92.931373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511609AGAATATAATCTTATTTATATAAATAAGATTATATTCT0.143100.048100.681000.750000.994600.62500


Target Position: 655, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655CUCAUUUUGAUGAAGAUGA78.7921587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513673CTCATTTTGATGAAGATGATCATCTTCATCAAAATGAG0.022400.001600.586200.500000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
653-675TGCTCATTTTGATGAAGATGAAAUCAUCUUCAUCAAAAUGAGCACUCAUUUUGAUGAAGAUGAAAU20.47.422


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438CUCUCCAGAAAGCUAAUAG71.36171031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721456CTCTCCAGAAAGCTAATAGCTATTAGCTTTCTGGAGAG0.070900.002100.637900.500001.000001.00000


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262CUGGAGGUAUGAUGAAUAU87.503187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991280CTGGAGGTATGATGAATATATATTCATCATACCTCCAG0.361700.004600.741400.750001.000001.00000


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555CUCAGUCAUUUUUAACCUC69.73931124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691573CTCAGTCATTTTTAACCTCGAGGTTAAAAATGACTGAG0.160200.011900.500000.500000.929300.62500


Target Position: 1730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1730AGAGUUGCAAAGAUCUUUU78.8387584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041748AGAGTTGCAAAGATCTTTTAAAAGATCTTTGCAACTCT0.104900.013000.724100.750001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87CCACUGCUGCUGCUGCUGU73.3193905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532105CCACTGCTGCTGCTGCTGTACAGCAGCAGCAGCAGTGG0.016500.001200.637900.750000.951100.62500


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547UCUAUUUUCUCAGUCAUUU69.63731128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241565TCTATTTTCTCAGTCATTTAAATGACTGAGAAAATAGA0.015400.002100.724100.750001.000001.00000


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213GGGAGGCAAGUUGAAAAGC58.49421638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412231GGGAGGCAAGTTGAAAAGCGCTTTTCAACTTGCCTCCC0.193800.025400.637900.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211UCUUUCUGAGGAAAACACU66.16021321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081229TCTTTCTGAGGAAAACACTAGTGTTTTCCTCAGAAAGA0.330400.003300.517200.500000.972800.62500


Target Position: 426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
426GAAAAUUACACGCCAGAUU80.1955514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475444GAAAATTACACGCCAGATTAATCTGGCGTGTAATTTTC0.024900.026200.663800.750001.000001.00000


Target Position: 945, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945GGAGAAGUGAUGUUCUUUA98.900418

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_294519GGAGAAGTGATGTTCTTTA1/1/0/097.75MMP1NM_001145938.1+NM_002421.31+1NANANANA00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468963GGAGAAGTGATGTTCTTTATAAAGAACATCACTTCTCC0.026500.002700.836201.000000.978300.62500


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116GGUGUCUCACAGCUUCCCA86.3589236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529134GGTGTCTCACAGCTTCCCATGGGAAGCTGTGAGACACC0.014400.002100.508600.750001.000001.00000


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578GGACAACUCUCCUUUUGAU95.941939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
269596GGACAACTCTCCTTTTGATATCAAAAGGAGAGTTGTCC0.114500.027900.689701.000000.913000.62500


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693AGAGAGUACAACUUACAUC76.1023749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491711AGAGAGTACAACTTACATCGATGTAAGTTGTACTCTCT0.021000.009500.543100.500001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536CUGAAGAACUGUCUAUUUU83.8202334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801554CTGAAGAACTGTCTATTTTAAAATAGACAGTTCTTCAG0.411500.053000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1534-1556TCCTGAAGAACTGTCTATTTTCTAAAAUAGACAGUUCUUCAGGACUGAAGAACUGUCUAUUUUCUU6.920.422


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678UGGACCAACAAUUUCAGAG61.94361511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385696TGGACCAACAATTTCAGAGCTCTGAAATTGTTGGTCCA0.141900.020900.534500.500001.000001.00000


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37CUUACCUUGCACUGAGAAA84.9874285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42955CTTACCTTGCACTGAGAAATTTCTCAGTGCAAGGTAAG0.096400.003000.637900.750001.000001.00000


Target Position: 1943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1943GGAAUAAAGUCAACCUUGU84.5905301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2351961GGAATAAAGTCAACCTTGTACAAGGTTGACTTTATTCC0.169700.054800.663800.750001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GUUCAACUGCAGGAAAAAU81.055465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511478GTTCAACTGCAGGAAAAATATTTTTCCTGCAGTTGAAC0.127000.019400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1458-1480TGGTTCAACTGCAGGAAAAATTGAUUUUUCCUGCAGUUGAACCAGUUCAACUGCAGGAAAAAUUGU14.319.222


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GGCUUGAAGCUGCUUACGA85.6796259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891069GGCTTGAAGCTGCTTACGATCGTAAGCAGCTTCAAGCC0.198900.033300.706900.750000.967400.62500


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312GCUGAAACCCUGAAGGUGA86.0473247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
380330GCTGAAACCCTGAAGGTGATCACCTTCAGGGTTTCAGC0.218600.006300.629300.750000.902200.75000


Target Position: 224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
224UGAAAAGCGGAGAAAUAGU70.64111079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464242TGAAAAGCGGAGAAATAGTACTATTTCTCCGCTTTTCA0.296500.057500.517200.500001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GUUGAGCUCAAUUUCAUUU78.7878589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551023GTTGAGCTCAATTTCATTTAAATGAAATTGAGCTCAAC0.224000.019300.646600.750001.000001.00000


Target Position: 144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144GAAACACAAGAGCAAGAUG80.5344496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532162GAAACACAAGAGCAAGATGCATCTTGCTCTTGTGTTTC0.018500.012200.517200.500001.000001.00000


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194CUACAACCUGAAGAAUGAU81.9071415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499212CTACAACCTGAAGAATGATATCATTCTTCAGGTTGTAG0.458800.059000.491400.750001.000001.00000


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945AAUAAAGUCAACCUUGUUU75.2629800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791963AATAAAGTCAACCTTGTTTAAACAAGGTTGACTTTATT0.074700.060500.508600.500001.000001.00000


Target Position: 1772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1772GAUCCCAGAGAGCAGCUUC72.5346952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311790GATCCCAGAGAGCAGCTTCGAAGCTGCTCTCTGGGATC0.064300.009800.508600.500001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612CUCAGUUUGCAUAUUUUUU77.3239671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1321630CTCAGTTTGCATATTTTTTAAAAAATATGCAAACTGAG0.220800.071300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1610-1632ACCTCAGTTTGCATATTTTTTTAAAAAAAUAUGCAAACUGAGGUCUCAGUUUGCAUAUUUUUUUAU-9.719.222


Target Position: 1052, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052GCUUGAAGCUGCUUACGAA104.6364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861070GCTTGAAGCTGCTTACGAATTCGTAAGCAGCTTCAAGC0.205500.033600.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1050-1072GGGCTTGAAGCTGCTTACGAATTUUCGUAAGCAGCUUCAAGCCCGCUUGAAGCUGCUUACGAAUUU20.916.633


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619UGCAUAUUUUUUUACUAUU76.5883718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291637TGCATATTTTTTTACTATTAATAGTAAAAAAATATGCA0.679900.104800.844800.750001.000001.00000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205AGAAUGAUGGGAGGCAAGU64.93461387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414223AGAATGATGGGAGGCAAGTACTTGCCTCCCATCATTCT0.082000.012200.517200.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GUGGACCAACAAUUUCAGA80.9777472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
416695GTGGACCAACAATTTCAGATCTGAAATTGTTGGTCCAC0.262200.027100.569000.500001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853AAGCAGCUCAAGAACACAU80.3306505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111871AAGCAGCTCAAGAACACATATGTGTTCTTGAGCTGCTT0.091200.001700.482800.500001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618UUGCAUAUUUUUUUACUAU75.5874780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691636TTGCATATTTTTTTACTATATAGTAAAAAAATATGCAA0.672200.114000.603400.500001.000001.00000


Target Position: 46, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
46CACUGAGAAAGAAGACAAA96.503835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23664CACTGAGAAAGAAGACAAATTTGTCTTCTTTCTCAGTG0.292900.071700.793100.750001.000001.00000


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683GGUGGGUACAAAAAGUCAA92.930674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001701GGTGGGTACAAAAAGTCAATTGACTTTTTGTACCCACC0.274000.031300.706901.000001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GCCCAGUGGUUGAAAAAUU81.4598445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348262GCCCAGTGGTTGAAAAATTAATTTTTCAACCACTGGGC0.212000.008500.991401.000000.989100.75000


Target Position: 1083, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083GAUGAAGUCCGGUUUUUCA93.624864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1081-1103GAGATGAAGTCCGGTTTTTCAAAUGAAAAACCGGACUUCAUCUCGAUGAAGUCCGGUUUUUCAAAU8.719.222


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613UCAGUUUGCAUAUUUUUUU67.64161228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2591631TCAGTTTGCATATTTTTTTAAAAAAATATGCAAACTGA0.243800.062500.724100.750001.000001.00000


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393CGCUGGGAGCAAACACAUC72.4134959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536411CGCTGGGAGCAAACACATCGATGTGTTTGCTCCCAGCG0.109400.001200.741400.750000.940200.62500


Target Position: 222, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222GUUGAAAAGCGGAGAAAUA91.3245100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283240GTTGAAAAGCGGAGAAATATATTTCTCCGCTTTTCAAC0.555900.156600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
220-242AAGTTGAAAAGCGGAGAAATAGTUAUUUCUCCGCUUUUCAACUUGUUGAAAAGCGGAGAAAUAGUU14.87.713


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525GUCUCUGAGGGUCAAGCAG69.21711145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481543GTCTCTGAGGGTCAAGCAGCTGCTTGACCCTCAGAGAC0.023300.002000.534500.500000.994600.62500


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953CAACCUUGUUUCUACUGUU91.1441103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511971CAACCTTGTTTCTACTGTTAACAGTAGAAACAAGGTTG0.148500.002500.500000.750001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274AGGAAUUCUUUGGGCUGAA79.2892563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515292AGGAATTCTTTGGGCTGAATTCAGCCCAAAGAATTCCT0.016400.007200.672400.750001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669GAUGAAAGGUGGACCAACA97.209726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542687GATGAAAGGTGGACCAACATGTTGGTCCACCTTTCATC0.154600.013700.474100.500001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485UUACUAAUUUGAAUGGAAA83.4982348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141503TTACTAATTTGAATGGAAATTTCCATTCAAATTAGTAA0.093100.079100.534500.500001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182CCUGGAAAAAUACUACAAC73.0125924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170200CCTGGAAAAATACTACAACGTTGTAGTATTTTTCCAGG0.202400.070200.698300.750001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951GUCAACCUUGUUUCUACUG62.3811499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281969GTCAACCTTGTTTCTACTGCAGTAGAAACAAGGTTGAC0.018500.009900.534500.500001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220AAGUUGAAAAGCGGAGAAA78.0142632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488238AAGTTGAAAAGCGGAGAAATTTCTCCGCTTTTCAACTT0.198100.167400.637900.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CUCUUUCUGAGGAAAACAC67.04031265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441228CTCTTTCTGAGGAAAACACGTGTTTTCCTCAGAAAGAG0.110900.002600.517200.500000.967400.62500


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151CCCCAAGGACAUCUACAGC63.27751465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341169CCCCAAGGACATCTACAGCGCTGTAGATGTCCTTGGGG0.328800.001200.637900.500001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209GCUCUUUCUGAGGAAAACA84.3047310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781227GCTCTTTCTGAGGAAAACATGTTTTCCTCAGAAAGAGC0.048000.002100.646600.750000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1207-1229CTGCTCTTTCTGAGGAAAACACTUGUUUUCCUCAGAAAGAGCAGGCUCUUUCUGAGGAAAACACUU21.219.112


Target Position: 1221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1221GAAAACACUGGAAAAACCU74.4598846

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1219-1241AGGAAAACACTGGAAAAACCTACAGGUUUUUCCAGUGUUUUCCUGAAAACACUGGAAAAACCUACU12.613.322


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646AGCCCUUUUUGUACUGAUA87.0181209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401664AGCCCTTTTTGTACTGATATATCAGTACAAAAAGGGCT0.078400.064700.810300.750001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514UGAGUCCAAAGAAGGUGUU64.97551386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171532TGAGTCCAAAGAAGGTGTTAACACCTTCTTTGGACTCA0.019200.001500.577600.750000.940201.00000


Target Position: 991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CCUUCUACCCGGAAGUUGA84.6314299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
989-1011TCCCTTCTACCCGGAAGTTGAGCUCAACUUCCGGGUAGAAGGGACCUUCUACCCGGAAGUUGAGCU19.218.932


Target Position: 1401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1401CAAUACAAAUUUGAUCCUA90.5779116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161419CAATACAAATTTGATCCTATAGGATCAAATTTGTATTG0.275500.201800.474100.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372GAUUUUUCUAUUUCUUUCA86.7143222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1370-1392TGGATTTTTCTATTTCTTTCATGUGAAAGAAAUAGAAAAAUCCAGAUUUUUCUAUUUCUUUCAUGU14.80.422


Target Position: 1341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341CACAAAGUUGAUGCAGUUU76.9566694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461359CACAAAGTTGATGCAGTTTAAACTGCATCAACTTTGTG0.040600.002600.793100.750000.994600.62500


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226CACUGGAAAAACCUACUUC73.6981888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961244CACTGGAAAAACCTACTTCGAAGTAGGTTTTTCCAGTG0.065200.036000.620700.500000.962001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581ACUGAUACACAGAAUAUAA96.806829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871599ACTGATACACAGAATATAATTATATTCTGTGTATCAGT0.118700.002000.672400.750000.956500.62500


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470AGGAAAAAUUGAACAUUAC74.5519840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301488AGGAAAAATTGAACATTACGTAATGTTCAATTTTTCCT0.277100.052400.663800.500001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653UGCUCAUUUUGAUGAAGAU83.2802357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529671TGCTCATTTTGATGAAGATATCTTCATCAAAATGAGCA0.030200.001300.672400.750000.945700.62500


Target Position: 1930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930GUGUUUUAUGUUUGGAAUA86.1307244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1928-1950AAGTGTTTTATGTTTGGAATAAAUAUUCCAAACAUAAAACACUUGUGUUUUAUGUUUGGAAUAAAU20.17.222


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791AGUGACAAACAUAUCCUUU80.3226506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431809AGTGACAAACATATCCTTTAAAGGATATGTTTGTCACT0.076800.050100.706900.750000.902200.87500


Target Position: 174, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174CAGAAAUACCUGGAAAAAU84.0288324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
172-194TCCAGAAATACCTGGAAAAATACAUUUUUCCAGGUAUUUCUGGACAGAAAUACCUGGAAAAAUACU14.36.922


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091CCGGUUUUUCAAAGGGAAU70.57571083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491109CCGGTTTTTCAAAGGGAATATTCCCTTTGAAAAACCGG0.306600.008500.905201.000001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460UGGACCAUGCCAUUGAGAA79.5734547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
240478TGGACCATGCCATTGAGAATTCTCAATGGCATGGTCCA0.231500.113200.672400.750000.983700.62500


Target Position: 885, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885CCACAAACCCCAAAAGCGU71.28121038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
883-905GCCCACAAACCCCAAAAGCGTGTACGCUUUUGGGGUUUGUGGGCCCACAAACCCCAAAAGCGUGUU19.119.333


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320CAUGACUUUCCUGGAAUUG63.70641448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391338CATGACTTTCCTGGAATTGCAATTCCAGGAAAGTCATG0.019500.017800.508600.500001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529UGUUUUCCUGAAGAACUGU64.98461384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501547TGTTTTCCTGAAGAACTGTACAGTTCTTCAGGAAAACA0.123700.011700.500000.500001.000001.00000


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317GCACAUGACUUUCCUGGAA90.5944115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271335GCACATGACTTTCCTGGAATTCCAGGAAAGTCATGTGC0.040700.041400.681001.000001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230GGAAAAACCUACUUCUUUG83.9937326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381248GGAAAAACCTACTTCTTTGCAAAGAAGTAGGTTTTTCC0.013000.004600.724100.750000.972800.62500


Target Position: 749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749CUCCCAUUCUACUGAUAUC77.356667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454767CTCCCATTCTACTGATATCGATATCAGTAGAATGGGAG0.208800.068300.629300.500001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414AUCCUAAAACGAAGAGAAU75.6138776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891432ATCCTAAAACGAAGAGAATATTCTCTTCGTTTTAGGAT0.055900.047200.672400.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590CAGAAUAUAAUCUUAUUUA99.157216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411608CAGAATATAATCTTATTTATAAATAAGATTATATTCTG0.128700.045100.750000.750000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1588-1610CACAGAATATAATCTTATTTATAUAAAUAAGAUUAUAUUCUGUGCAGAAUAUAAUCUUAUUUAUAU-4.36.622


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250UGGUUGAAAAAUUGAAGCA75.8985761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501268TGGTTGAAAAATTGAAGCATGCTTCAATTTTTCAACCA0.046400.022300.491400.500001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589ACAGAAUAUAAUCUUAUUU80.7055488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651607ACAGAATATAATCTTATTTAAATAAGATTATATTCTGT0.117900.042900.706900.750000.951100.75000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636UUUAGAAUGUAGCCCUUUU71.21361041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571654TTTAGAATGTAGCCCTTTTAAAAGGGCTACATTCTAAA0.059100.014800.500000.500001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466CUGCAGGAAAAAUUGAACA80.1973513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111484CTGCAGGAAAAATTGAACATGTTCAATTTTTCCTGCAG0.094900.031400.577600.500001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748UCUCCCAUUCUACUGAUAU72.7087938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163766TCTCCCATTCTACTGATATATATCAGTAGAATGGGAGA0.209500.073300.681000.750001.000001.00000


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521CAAGGUCUCUGAGGGUCAA89.4596147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540539CAAGGTCTCTGAGGGTCAATTGACCCTCAGAGACCTTG0.060800.001100.500000.750001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UAUUUUCUCAGUCAUUUUU70.26391101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861567TATTTTCTCAGTCATTTTTAAAAATGACTGAGAAAATA0.054400.002000.543100.500001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775CCCAGAGAGCAGCUUCAGU76.4822726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381793CCCAGAGAGCAGCTTCAGTACTGAAGCTGCTCTCTGGG0.078600.012500.784500.750001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GAAAUACCUGGAAAAAUAC77.9361638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500194GAAATACCTGGAAAAATACGTATTTTTCCAGGTATTTC0.172100.039200.491400.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859CUCAAGAACACAUGUGCAG67.33011249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601877CTCAAGAACACATGTGCAGCTGCACATGTGTTCTTGAG0.027600.007900.525900.500001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053CUUGAAGCUGCUUACGAAU79.0898571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461071CTTGAAGCTGCTTACGAATATTCGTAAGCAGCTTCAAG0.269100.032300.629300.750001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264GGAGGUAUGAUGAAUAUAA104.3975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061282GGAGGTATGATGAATATAATTATATTCATCATACCTCC0.752900.012600.836201.000001.000001.00000


Target Position: 413, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413GACCUACAGGAUUGAAAAU86.6656223

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_141319GACCTACAGGATTGAAAAT1/1/0/097.75MMP1NM_001145938.1+NM_002421.31+1NANANA11:102667884,102667987..102667893,102667995(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183431GACCTACAGGATTGAAAATATTTTCAATCCTGTAGGTC0.495400.116100.810300.750001.000001.00000


Target Position: 600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600CCUGGAGGAAAUCUUGCUC65.1821374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544618CCTGGAGGAAATCTTGCTCGAGCAAGATTTCCTCCAGG0.078200.001000.534500.750001.000001.00000


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709GCUUAUGGAUUCAUAUAGG77.1784679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511727GCTTATGGATTCATATAGGCCTATATGAATCCATAAGC0.107100.005800.508600.500000.962000.87500


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815CAGAAAGAGACAGGAGACA82.4656395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581833CAGAAAGAGACAGGAGACATGTCTCCTGTCTCTTTCTG0.229200.047700.577600.500001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602UGGAGGAAAUCUUGCUCAU77.448662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454620TGGAGGAAATCTTGCTCATATGAGCAAGATTTCCTCCA0.158600.002500.689700.750001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548CUAUUUUCUCAGUCAUUUU84.9474286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751566CTATTTTCTCAGTCATTTTAAAATGACTGAGAAAATAG0.025000.002100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1546-1568GTCTATTTTCTCAGTCATTTTTAAAAAUGACUGAGAAAAUAGACCUAUUUUCUCAGUCAUUUUUAU14.82.122


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786GCUUCAGUGACAAACAUAU89.2363150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561804GCTTCAGTGACAAACATATATATGTTTGTCACTGAAGC0.313700.098400.810301.000001.000001.00000


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907AUAACUCUUCUAACACAAA86.5048227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081925ATAACTCTTCTAACACAAATTTGTGTTAGAAGAGTTAT0.118700.097200.543100.500001.000001.00000


Target Position: 1060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060CUGCUUACGAAUUUGCCGA73.6932889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931078CTGCTTACGAATTTGCCGATCGGCAAATTCGTAAGCAG0.092300.045300.491400.500001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772CUUUGAUGUACCCUAGCUA90.9701107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538790CTTTGATGTACCCTAGCTATAGCTAGGGTACATCAAAG0.021600.010600.465500.750001.000001.00000


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587ACACAGAAUAUAAUCUUAU83.9373330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791605ACACAGAATATAATCTTATATAAGATTATATTCTGTGT0.107400.056800.663800.750000.951100.87500


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GUGAUGUUCAGCUAGCUCA87.7959180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
395820GTGATGTTCAGCTAGCTCATGAGCTAGCTGAACATCAC0.103300.047400.569000.500001.000001.00000


Target Position: 40, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
40ACCUUGCACUGAGAAAGAA83.1896360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
38158ACCTTGCACTGAGAAAGAATTCTTTCTCAGTGCAAGGT0.256900.006200.681000.750001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686CAAUUUCAGAGAGUACAAC72.1433976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471704CAATTTCAGAGAGTACAACGTTGTACTCTCTGAAATTG0.053300.045800.500000.500001.000001.00000


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412UGAUCCUAAAACGAAGAGA71.8541002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021430TGATCCTAAAACGAAGAGATCTCTTCGTTTTAGGATCA0.088000.046200.500000.500001.000001.00000


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966GACAGAUUCUACAUGCGCA98.770819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544984GACAGATTCTACATGCGCATGCGCATGTAGAATCTGTC0.279900.087800.465500.500001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807GUUCAGCUAGCUCAGGAUG67.3161251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488825GTTCAGCTAGCTCAGGATGCATCCTGAGCTAGCTGAAC0.024200.001900.491400.500001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216CUGAGGAAAACACUGGAAA82.9938370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311234CTGAGGAAAACACTGGAAATTTCCAGTGTTTTCCTCAG0.217500.024400.784500.750001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526AGGUGUUUUCCUGAAGAAC65.4521359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221544AGGTGTTTTCCTGAAGAACGTTCTTCAGGAAAACACCT0.135900.003200.698300.500000.951100.62500


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207CUGCUCUUUCUGAGGAAAA81.734431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151225CTGCTCTTTCTGAGGAAAATTTTCCTCAGAAAGAGCAG0.030900.001600.784500.750000.945700.87500


Target Position: 1538, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538GAAGAACUGUCUAUUUUCU89.4061149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1536-1558CTGAAGAACTGTCTATTTTCTCAAGAAAAUAGACAGUUCUUCAGGAAGAACUGUCUAUUUUCUCAU2.117.732


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415UCCUAAAACGAAGAGAAUU67.97011209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211433TCCTAAAACGAAGAGAATTAATTCTCTTCGTTTTAGGA0.044200.038200.862100.750001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533GGGUCAAGCAGACAUCAUG82.3052405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462551GGGTCAAGCAGACATCATGCATGATGTCTGCTTGACCC0.027500.004500.836200.750000.902200.75000


Target Position: 1533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1533UUCCUGAAGAACUGUCUAU70.39411097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981551TTCCTGAAGAACTGTCTATATAGACAGTTCTTCAGGAA0.210200.015200.629300.500001.000001.00000


Target Position: 1920, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920CACAAAAUAAGUGUUUUAU80.887481

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1918-1940AACACAAAATAAGTGTTTTATGTAUAAAACACUUAUUUUGUGUUCACAAAAUAAGUGUUUUAUGUU7.25.321


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909AACUCUUCUAACACAAAAU80.9682474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011927AACTCTTCTAACACAAAATATTTTGTGTTAGAAGAGTT0.093200.070400.637900.500001.000001.00000


Target Position: 1656, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1656GUACUGAUAUAAUUUAGUU92.756176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371674GTACTGATATAATTTAGTTAACTAAATTATATCAGTAC0.035500.003100.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1654-1676TTGTACTGATATAATTTAGTTCCAACUAAAUUAUAUCAGUACAAGUACUGAUAUAAUUUAGUUCCU4.620.322


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688GUACAAAAAGUCAAGUUUG75.8063770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831706GTACAAAAAGTCAAGTTTGCAAACTTGACTTTTTGTAC0.132300.038500.534500.500001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621CAUAUUUUUUUACUAUUUA93.764561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681639CATATTTTTTTACTATTTATAAATAGTAAAAAAATATG0.179500.121700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1619-1641TGCATATTTTTTTACTATTTAGAUAAAUAGUAAAAAAAUAUGCACAUAUUUUUUUACUAUUUAGAU4.6-10.322


Target Position: 2, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2GGAUAUUGGAGUAGCAAGA89.8982135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50020GGATATTGGAGTAGCAAGATCTTGCTACTCCAATATCC0.018800.033800.646600.750001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640GAAUGUAGCCCUUUUUGUA99.488712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951658GAATGTAGCCCTTTTTGTATACAAAAAGGGCTACATTC0.159900.004000.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1638-1660TAGAATGTAGCCCTTTTTGTACTUACAAAAAGGGCUACAUUCUAGAAUGUAGCCCUUUUUGUACUU5.611.622


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955UGUUCUUUAAAGACAGAUU76.5059721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204973TGTTCTTTAAAGACAGATTAATCTGTCTTTAAAGAACA0.152700.068600.698300.750000.956500.62500


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551UUUUCUCAGUCAUUUUUAA81.616439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431569TTTTCTCAGTCATTTTTAATTAAAAATGACTGAGAAAA0.087600.001900.465500.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003AAGUUGAGCUCAAUUUCAU84.8592291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091021AAGTTGAGCTCAATTTCATATGAAATTGAGCTCAACTT0.148600.011500.482800.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519CCAAAGAAGGUGUUUUCCU74.9049821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651537CCAAAGAAGGTGTTTTCCTAGGAAAACACCTTCTTTGG0.047900.002300.500000.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1517-1539GTCCAAAGAAGGTGTTTTCCTGAAGGAAAACACCUUCUUUGGACCCAAAGAAGGUGUUUUCCUGAU21.212.212


Target Position: 1922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922CAAAAUAAGUGUUUUAUGU83.8754332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1920-1942CACAAAATAAGTGTTTTATGTTTACAUAAAACACUUAUUUUGUGCAAAAUAAGUGUUUUAUGUUUU-1.4-9.722


Target Position: 55, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
55AGAAGACAAAGGCCAGUAU81.2881452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53973AGAAGACAAAGGCCAGTATATACTGGCCTTTGTCTTCT0.012600.007600.681000.750000.978301.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730UCGGCCAUUCUCUUGGACU61.93921512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455748TCGGCCATTCTCTTGGACTAGTCCAAGAGAATGGCCGA0.029300.002500.586200.500000.934800.62500


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199ACCUGAAGAAUGAUGGGAG69.19971147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400217ACCTGAAGAATGATGGGAGCTCCCATCATTCTTCAGGT0.050400.029200.543100.500001.000001.00000


Target Position: 1649, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649CCUUUUUGUACUGAUAUAA87.9753176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471667CCTTTTTGTACTGATATAATTATATCAGTACAAAAAGG0.073600.044700.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1647-1669GCCCTTTTTGTACTGATATAATTUUAUAUCAGUACAAAAAGGGCCCUUUUUGUACUGAUAUAAUUU10.22.132


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474AAAAUUGAACAUUACUAAU82.4763394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851492AAAATTGAACATTACTAATATTAGTAATGTTCAATTTT0.581500.081500.491400.500001.000001.00000


Target Position: 1422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422ACGAAGAGAAUUUUGACUC61.64211525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351440ACGAAGAGAATTTTGACTCGAGTCAAAATTCTCTTCGT0.016200.005600.465500.500000.902200.62500


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316AGCACAUGACUUUCCUGGA81.7357430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051334AGCACATGACTTTCCTGGATCCAGGAAAGTCATGTGCT0.049300.050200.482800.500001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UUGAAGCUGCUUACGAAUU61.8331514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661072TTGAAGCTGCTTACGAATTAATTCGTAAGCAGCTTCAA0.264700.035200.637900.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CCCAAAAGCGUGUGACAGU75.3122798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318911CCCAAAAGCGTGTGACAGTACTGTCACACGCTTTTGGG0.171100.011800.784500.750001.000001.00000


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385CUUUCAUGGAACAAGACAA91.906492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981403CTTTCATGGAACAAGACAATTGTCTTGTTCCATGAAAG0.240600.001800.491400.750001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525AAGGUGUUUUCCUGAAGAA87.6793182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311543AAGGTGTTTTCCTGAAGAATTCTTCAGGAAAACACCTT0.020000.002200.465500.500000.934800.62500


Target Position: 59, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
59GACAAAGGCCAGUAUGCAC77.8419641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45677GACAAAGGCCAGTATGCACGTGCATACTGGCCTTTGTC0.028800.006900.525900.500000.989100.75000


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394GCUGGGAGCAAACACAUCU79.569548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514412GCTGGGAGCAAACACATCTAGATGTGTTTGCTCCCAGC0.034500.001600.629300.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527GGUGUUUUCCUGAAGAACU82.7151383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921545GGTGTTTTCCTGAAGAACTAGTTCTTCAGGAAAACACC0.145000.004900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1525-1547AAGGTGTTTTCCTGAAGAACTGTAGUUCUUCAGGAAAACACCUUGGUGUUUUCCUGAAGAACUGUU21.513.322


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398AGACAAUACAAAUUUGAUC72.1257979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751416AGACAATACAAATTTGATCGATCAAATTTGTATTGTCT0.260700.184700.543100.500001.000001.00000


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599ACCUGGAGGAAAUCUUGCU69.36571137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538617ACCTGGAGGAAATCTTGCTAGCAAGATTTCCTCCAGGT0.072900.001200.500000.500001.000001.00000


Target Position: 45, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
45GCACUGAGAAAGAAGACAA96.71831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
12163GCACTGAGAAAGAAGACAATTGTCTTCTTTCTCAGTGC0.277900.056500.706901.000001.000001.00000


Target Position: 1796, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796CAAACAUAUCCUUUCAAGA91.958891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1794-1816GACAAACATATCCTTTCAAGACAUCUUGAAAGGAUAUGUUUGUCCAAACAUAUCCUUUCAAGACAU12.26.933


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175AGAAAUACCUGGAAAAAUA95.171845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287193AGAAATACCTGGAAAAATATATTTTTCCAGGTATTTCT0.136600.035300.681000.750001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125CAGGGACAGAAUGUGCUAC70.46361093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241143CAGGGACAGAATGTGCTACGTAGCACATTCTGTCCCTG0.022700.001400.603400.500001.000001.00000


Target Position: 1535, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535CCUGAAGAACUGUCUAUUU86.7789220

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4153519CCTGAAGAACTGTCTATTT1/1/0/097.75MMP1NM_001145938.1+NM_002421.31+1NANANA11:102661071..102661089(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751553CCTGAAGAACTGTCTATTTAAATAGACAGTTCTTCAGG0.179100.056000.844801.000001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024CUGUUUUCUGGCCACAACU73.0188923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321042CTGTTTTCTGGCCACAACTAGTTGTGGCCAGAAAACAG0.037100.013900.577600.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812GCUAGCUCAGGAUGACAUU81.2136455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470830GCTAGCTCAGGATGACATTAATGTCATCCTGAGCTAGC0.123000.002200.844801.000001.000001.00000


Target Position: 1364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364GAAAGAUGGAUUUUUCUAU90.2702130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1362-1384ATGAAAGATGGATTTTTCTATTTAUAGAAAAAUCCAUCUUUCAUGAAAGAUGGAUUUUUCUAUUUU7.112.022


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237CCUACUUCUUUGUUGCUAA94.365952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361255CCTACTTCTTTGTTGCTAATTAGCAACAAAGAAGTAGG0.035600.005500.810301.000001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012UCAAUUUCAUUUCUGUUUU67.32481250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021030TCAATTTCATTTCTGTTTTAAAACAGAAATGAAATTGA0.154400.077000.724100.750001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CAAAAGCGUGUGACAGUAA93.813260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334913CAAAAGCGTGTGACAGTAATTACTGTCACACGCTTTTG0.206500.010100.612100.750001.000001.00000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848AGGAAAAGCAGCUCAAGAA90.4518123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251866AGGAAAAGCAGCTCAAGAATTCTTGAGCTGCTTTTCCT0.042500.006300.672400.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049UGGGCUUGAAGCUGCUUAC61.01561553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201067TGGGCTTGAAGCTGCTTACGTAAGCAGCTTCAAGCCCA0.142400.001500.663800.500000.967400.87500


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004AGUUGAGCUCAAUUUCAUU86.7981219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891022AGTTGAGCTCAATTTCATTAATGAAATTGAGCTCAACT0.241600.014200.698300.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864GAACACAUGUGCAGUCACU87.9828175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321882GAACACATGTGCAGTCACTAGTGACTGCACATGTGTTC0.028800.003000.465500.500000.918500.62500


Target Position: 1910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910ACUCUUCUAACACAAAAUA82.7819380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3321928ACTCTTCTAACACAAAATATATTTTGTGTTAGAAGAGT0.081700.059600.663800.750001.000001.00000


Target Position: 1844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1844CCGGAGGAAAAGCAGCUCA77.572654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981862CCGGAGGAAAAGCAGCTCATGAGCTGCTTTTCCTCCGG0.113600.013600.689700.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777CAGAGAGCAGCUUCAGUGA89.0815153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271795CAGAGAGCAGCTTCAGTGATCACTGAAGCTGCTCTCTG0.226400.019200.560300.500001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319ACAUGACUUUCCUGGAAUU82.88374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711337ACATGACTTTCCTGGAATTAATTCCAGGAAAGTCATGT0.025800.025600.698300.750001.000001.00000


Target Position: 1916, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916CUAACACAAAAUAAGUGUU80.6063491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1914-1936TTCTAACACAAAATAAGTGTTTTAACACUUAUUUUGUGUUAGAACUAACACAAAAUAAGUGUUUUU19.020.422


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768CGUUGAUCCCAGAGAGCAG80.5181497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941786CGTTGATCCCAGAGAGCAGCTGCTCTCTGGGATCAACG0.035900.006800.491400.750001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094GUUUUUCAAAGGGAAUAAG65.57231350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811112GTTTTTCAAAGGGAATAAGCTTATTCCCTTTGAAAAAC0.101400.061500.508600.500001.000001.00000


Target Position: 537, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537CAAGCAGACAUCAUGAUAU93.151269

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_953719CAAGCAGACATCATGATAT1/1/0/094.96MMP1NM_001145938.1+NM_002421.31+1NANANA11:102667760..102667778(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331555CAAGCAGACATCATGATATATATCATGATGTCTGCTTG0.121700.010300.603400.750001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506ACCUCUGACAUUCACCAAG64.13631429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522524ACCTCTGACATTCACCAAGCTTGGTGAATGTCAGAGGT0.124000.002100.715500.500001.000001.00000


Target Position: 1183, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183CUAGAACUGUGAAGCAUAU88.6274161

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6118319CTAGAACTGTGAAGCATAT1/1/0/097.21MMP1NM_001145938.1+NM_002421.31+1NANANA11:102662130..102662148(-)00MMP1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1181-1203CCCTAGAACTGTGAAGCATATCGAUAUGCUUCACAGUUCUAGGGCUAGAACUGUGAAGCAUAUCGU19.718.922


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370UGGAUUUUUCUAUUUCUUU72.6927941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901388TGGATTTTTCTATTTCTTTAAAGAAATAGAAAAATCCA0.055900.008000.844800.750001.000001.00000


Target Position: 1781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781GAGCAGCUUCAGUGACAAA99.6729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211799GAGCAGCTTCAGTGACAAATTTGTCACTGAAGCTGCTC0.309000.057000.810300.750001.000001.00000


Target Position: 605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605AGGAAAUCUUGCUCAUGCU80.9282478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533623AGGAAATCTTGCTCATGCTAGCATGAGCAAGATTTCCT0.066700.001200.491400.500000.956500.75000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954AUGUUCUUUAAAGACAGAU66.98681269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517972ATGTTCTTTAAAGACAGATATCTGTCTTTAAAGAACAT0.150200.013700.474100.500000.956500.62500


Target Position: 86, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
86UCCACUGCUGCUGCUGCUG48.47461891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531104TCCACTGCTGCTGCTGCTGCAGCAGCAGCAGCAGTGGA0.014000.001200.586200.500000.951100.62500


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140UCUAGAAACACAAGAGCAA81.6822435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312158TCTAGAAACACAAGAGCAATTGCTCTTGTGTTTCTAGA0.201700.073900.577600.750001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979UGCGCACAAAUCCCUUCUA75.3747793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159997TGCGCACAAATCCCTTCTATAGAAGGGATTTGTGCGCA0.429900.218400.681000.750001.000001.00000


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067CGAAUUUGCCGACAGAGAU83.7504337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771085CGAATTTGCCGACAGAGATATCTCTGTCGGCAAATTCG0.210200.052100.612101.000001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221AGUUGAAAAGCGGAGAAAU79.5198550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125239AGTTGAAAAGCGGAGAAATATTTCTCCGCTTTTCAACT0.555500.164000.698300.750001.000001.00000


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229UGGAAAAACCUACUUCUUU73.9094873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051247TGGAAAAACCTACTTCTTTAAAGAAGTAGGTTTTTCCA0.018100.007600.844800.750000.962000.75000


Target Position: 1592, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592GAAUAUAAUCUUAUUUAUA105.5642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481610GAATATAATCTTATTTATATATAAATAAGATTATATTC0.169700.049400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1590-1612CAGAATATAATCTTATTTATACCUAUAAAUAAGAUUAUAUUCUGGAAUAUAAUCUUAUUUAUACCU-8.0-8.022


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271UGAUGAAUAUAAACGAUCU84.6365298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721289TGATGAATATAAACGATCTAGATCGTTTATATTCATCA0.100600.085900.500000.500001.000001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406CACAUCUGACCUACAGGAU81.0754461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272424CACATCTGACCTACAGGATATCCTGTAGGTCAGATGTG0.126800.019300.612100.750000.913000.87500


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GAGGAAAAGCAGCUCAAGA91.2077101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471865GAGGAAAAGCAGCTCAAGATCTTGAGCTGCTTTTCCTC0.099500.020200.586200.500001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GUACCCUAGCUACACCUUC66.1911318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498797GTACCCTAGCTACACCTTCGAAGGTGTAGCTAGGGTAC0.020800.001800.508600.500001.000001.00000


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811AGCUAGCUCAGGAUGACAU81.7558429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485829AGCTAGCTCAGGATGACATATGTCATCCTGAGCTAGCT0.027200.002000.698300.750001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246CCAGUGGUUGAAAAAUUGA82.5366388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266264CCAGTGGTTGAAAAATTGATCAATTTTTCAACCACTGG0.265800.078900.620700.750001.000001.00000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UGCAAAGAUCUUUUCCAGA76.485725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981753TGCAAAGATCTTTTCCAGATCTGGAAAAGATCTTTGCA0.051400.037900.629300.500000.978300.62500


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793UGACAAACAUAUCCUUUCA85.9722252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991811TGACAAACATATCCTTTCATGAAAGGATATGTTTGTCA0.057700.057100.500000.500000.902200.62500


Target Position: 1620, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620GCAUAUUUUUUUACUAUUU86.3271239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471638GCATATTTTTTTACTATTTAAATAGTAAAAAAATATGC0.748200.095400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1618-1640TTGCATATTTTTTTACTATTTAGAAAUAGUAAAAAAAUAUGCAAGCAUAUUUUUUUACUAUUUAGU6.3-1.811


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813GACAGAAAGAGACAGGAGA88.0223172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991831GACAGAAAGAGACAGGAGATCTCCTGTCTCTTTCTGTC0.166300.045500.594800.500001.000001.00000


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955ACCUUGUUUCUACUGUUUU71.23881039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481973ACCTTGTTTCTACTGTTTTAAAACAGTAGAAACAAGGT0.338600.002600.853400.750001.000001.00000


Target Position: 425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
425UGAAAAUUACACGCCAGAU74.3544854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443443TGAAAATTACACGCCAGATATCTGGCGTGTAATTTTCA0.033100.034800.543100.750001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670AUGAAAGGUGGACCAACAA79.6551540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497688ATGAAAGGTGGACCAACAATTGTTGGTCCACCTTTCAT0.162600.026900.508600.500001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615AGUUUGCAUAUUUUUUUAC65.50571355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241633AGTTTGCATATTTTTTTACGTAAAAAAATATGCAAACT0.193300.140900.525900.500001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143AGAAACACAAGAGCAAGAU72.606948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374161AGAAACACAAGAGCAAGATATCTTGCTCTTGTGTTTCT0.071400.031800.543100.750001.000001.00000


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253UUGAAAAAUUGAAGCAAAU70.79821066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
380271TTGAAAAATTGAAGCAAATATTTGCTTCAATTTTTCAA0.066200.031500.637900.500001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318CACAUGACUUUCCUGGAAU83.4515350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441336CACATGACTTTCCTGGAATATTCCAGGAAAGTCATGTG0.033100.033600.784500.750001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524GGUCUCUGAGGGUCAAGCA88.6805160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480542GGTCTCTGAGGGTCAAGCATGCTTGACCCTCAGAGACC0.023400.004100.500000.750000.994600.62500


Target Position: 211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211AUGGGAGGCAAGUUGAAAA82.4585397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427229ATGGGAGGCAAGTTGAAAATTTTCAACTTGCCTCCCAT0.298300.008000.655200.500001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405ACAAAUUUGAUCCUAAAAC61.82041516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761423ACAAATTTGATCCTAAAACGTTTTAGGATCAAATTTGT0.358900.213300.560300.500001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UUCAACUGCAGGAAAAAUU60.89771555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211479TTCAACTGCAGGAAAAATTAATTTTTCCTGCAGTTGAA0.099800.035600.663800.500001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010GCUCAAUUUCAUUUCUGUU86.5035228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931028GCTCAATTTCATTTCTGTTAACAGAAATGAAATTGAGC0.188900.032500.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1008-1030GAGCTCAATTTCATTTCTGTTTTAACAGAAAUGAAAUUGAGCUCGCUCAAUUUCAUUUCUGUUUUU19.212.022


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395ACAAGACAAUACAAAUUUG76.9738691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931413ACAAGACAATACAAATTTGCAAATTTGTATTGTCTTGT0.266200.181200.560300.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CUAAUUUGAAUGGAAAACA78.4235612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421506CTAATTTGAATGGAAAACATGTTTTCCATTCAAATTAG0.041100.038700.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1486-1508TACTAATTTGAATGGAAAACACAUGUUUUCCAUUCAAAUUAGUACUAAUUUGAAUGGAAAACACAU21.2-1.422


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800UGGUGAUGUUCAGCUAGCU75.025816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500818TGGTGATGTTCAGCTAGCTAGCTAGCTGAACATCACCA0.084600.001700.491400.500001.000001.00000


Target Position: 272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272GCAGGAAUUCUUUGGGCUG69.51581133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537290GCAGGAATTCTTTGGGCTGCAGCCCAAAGAATTCCTGC0.013000.006000.569000.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801GGUGAUGUUCAGCUAGCUC77.1677680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389819GGTGATGTTCAGCTAGCTCGAGCTAGCTGAACATCACC0.096200.005000.543100.750001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191AUACUACAACCUGAAGAAU76.0887750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495209ATACTACAACCTGAAGAATATTCTTCAGGTTGTAGTAT0.495000.205000.534500.500001.000001.00000


Target Position: 1002, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002GAAGUUGAGCUCAAUUUCA92.943272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1000-1022CGGAAGTTGAGCTCAATTTCATTUGAAAUUGAGCUCAACUUCCGGAAGUUGAGCUCAAUUUCAUUU7.419.232


Target Position: 35, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
35CACUUACCUUGCACUGAGA91.0007106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46653CACTTACCTTGCACTGAGATCTCAGTGCAAGGTAAGTG0.064300.002300.569000.500001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GUCAAGCAGACAUCAUGAU80.9667475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375553GTCAAGCAGACATCATGATATCATGATGTCTGCTTGAC0.095300.006500.637900.750000.945700.62500


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88CACUGCUGCUGCUGCUGUU84.8944288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539106CACTGCTGCTGCTGCTGTTAACAGCAGCAGCAGCAGTG0.021200.001200.646600.750000.951100.75000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728CCAGAGUUGCAAAGAUCUU80.725487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401746CCAGAGTTGCAAAGATCTTAAGATCTTTGCAACTCTGG0.126800.009700.706901.000001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743UCUUUUCCAGAGUAUGCAA81.3201450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411761TCTTTTCCAGAGTATGCAATTGCATACTCTGGAAAAGA0.014500.001100.577600.750001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681ACCAACAAUUUCAGAGAGU67.31071252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364699ACCAACAATTTCAGAGAGTACTCTCTGAAATTGTTGGT0.093200.081000.646600.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390AUGGAACAAGACAAUACAA88.032171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281408ATGGAACAAGACAATACAATTGTATTGTCTTGTTCCAT0.631600.014800.508600.500001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219CAAGUUGAAAAGCGGAGAA85.3845274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526237CAAGTTGAAAAGCGGAGAATTCTCCGCTTTTCAACTTG0.196100.168400.474100.750001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093GGUUUUUCAAAGGGAAUAA86.4222229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501111GGTTTTTCAAAGGGAATAATTATTCCCTTTGAAAAACC0.125700.059900.819001.000001.000001.00000


Target Position: 276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
276GAAUUCUUUGGGCUGAAAG70.25241103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461294GAATTCTTTGGGCTGAAAGCTTTCAGCCCAAAGAATTC0.027500.004500.534500.500001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GGAUAACUCUUCUAACACA105.3183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301923GGATAACTCTTCTAACACATGTGTTAGAAGAGTTATCC0.143300.121800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1903-1925AGGGATAACTCTTCTAACACAAAUGUGUUAGAAGAGUUAUCCCUGGAUAACUCUUCUAACACAAAU19.014.532


Target Position: 1504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504ACACAUGGUGUGAGUCCAA87.7813181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361522ACACATGGTGTGAGTCCAATTGGACTCACACCATGTGT0.099700.002800.560300.750000.934800.62500


Target Position: 1228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228CUGGAAAAACCUACUUCUU78.9916577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631246CTGGAAAAACCTACTTCTTAAGAAGTAGGTTTTTCCAG0.027400.012000.646600.750000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1226-1248CACTGGAAAAACCTACTTCTTTGAAGAAGUAGGUUUUUCCAGUGCUGGAAAAACCUACUUCUUUGU18.920.122


Target Position: 275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275GGAAUUCUUUGGGCUGAAA88.2185168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527293GGAATTCTTTGGGCTGAAATTTCAGCCCAAAGAATTCC0.014800.004800.870701.000001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GGUGGACCAACAAUUUCAG76.3647734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342694GGTGGACCAACAATTTCAGCTGAAATTGTTGGTCCACC0.253000.024300.569000.750001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919CCUUUGAUGCUAUAACUAC77.5403655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
254937CCTTTGATGCTATAACTACGTAGTTATAGCATCAAAGG0.557600.019300.663800.750001.000001.00000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184UGGAAAAAUACUACAACCU70.67011074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455202TGGAAAAATACTACAACCTAGGTTGTAGTATTTTTCCA0.209400.109700.500000.500001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846GGAGGAAAAGCAGCUCAAG75.194806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731864GGAGGAAAAGCAGCTCAAGCTTGAGCTGCTTTTCCTCC0.065600.015100.732800.750001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685UGGGUACAAAAAGUCAAGU62.70781489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751703TGGGTACAAAAAGTCAAGTACTTGACTTTTTGTACCCA0.245400.061700.637900.500001.000001.00000


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GAAGCAAAUGCAGGAAUUC71.2941035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473281GAAGCAAATGCAGGAATTCGAATTCCTGCATTTGCTTC0.232300.028400.500000.500000.972800.87500


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464AACUGCAGGAAAAAUUGAA81.9504414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221482AACTGCAGGAAAAATTGAATTCAATTTTTCCTGCAGTT0.111500.030800.474100.500001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435ACGCCAGAUUUGCCAAGAG67.3641243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537453ACGCCAGATTTGCCAAGAGCTCTTGGCAAATCTGGCGT0.015700.002400.465500.500000.956500.87500


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434CACGCCAGAUUUGCCAAGA75.207805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530452CACGCCAGATTTGCCAAGATCTTGGCAAATCTGGCGTG0.014300.003400.569000.500000.956500.87500


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614CAGUUUGCAUAUUUUUUUA94.094353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1411632CAGTTTGCATATTTTTTTATAAAAAAATATGCAAACTG0.241500.069500.750000.750001.000001.00000


Target Position: 1293, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293GAUCCAGGUUAUCCCAAAA96.621433

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7129319GATCCAGGTTATCCCAAAA1/1/0/097.21MMP1NM_001145938.1+NM_002421.31+1NANANA11:102661494..102661512(-)00MMP1(0.002)


Target Position: 1081, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081GAGAUGAAGUCCGGUUUUU79.4681553

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1079-1101CAGAGATGAAGTCCGGTTTTTCAAAAAACCGGACUUCAUCUCUGGAGAUGAAGUCCGGUUUUUCAU19.420.423


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686GGGUACAAAAAGUCAAGUU84.4023308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691704GGGTACAAAAAGTCAAGTTAACTTGACTTTTTGTACCC0.186200.072300.844801.000001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853GACGUUCCCAAAAUCCUGU72.1395977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519871GACGTTCCCAAAATCCTGTACAGGATTTTGGGAACGTC0.111600.012200.612100.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CUAAAACGAAGAGAAUUUU74.8247828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581435CTAAAACGAAGAGAATTTTAAAATTCTCTTCGTTTTAG0.028200.023800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1415-1437TCCTAAAACGAAGAGAATTTTGAAAAAUUCUCUUCGUUUUAGGACUAAAACGAAGAGAAUUUUGAU5.37.121


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689UUUCAGAGAGUACAACUUA80.8413482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539707TTTCAGAGAGTACAACTTATAAGTTGTACTCTCTGAAA0.067700.023900.465500.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685ACAAUUUCAGAGAGUACAA86.8267218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
380703ACAATTTCAGAGAGTACAATTGTACTCTCTGAAATTGT0.059600.055100.560300.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584GAUACACAGAAUAUAAUCU90.5481119

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1582-1604CTGATACACAGAATATAATCTTAAGAUUAUAUUCUGUGUAUCAGGAUACACAGAAUAUAAUCUUAU3.520.422


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395CUGGGAGCAAACACAUCUG70.36341100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523413CTGGGAGCAAACACATCTGCAGATGTGTTTGCTCCCAG0.032600.003800.500000.500001.000001.00000


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332GGAAUUGGCCACAAAGUUG76.1134748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911350GGAATTGGCCACAAAGTTGCAACTTTGTGGCCAATTCC0.069500.005000.724100.750001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GUGUUGCGGCUCAUGAACU77.7392647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523730GTGTTGCGGCTCATGAACTAGTTCATGAGCCGCAACAC0.139300.001400.586200.500001.000001.00000


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912UCUUCUAACACAAAAUAAG67.00181267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041930TCTTCTAACACAAAATAAGCTTATTTTGTGTTAGAAGA0.048800.032800.586200.500001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610ACCUCAGUUUGCAUAUUUU83.4175354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231628ACCTCAGTTTGCATATTTTAAAATATGCAAACTGAGGT0.226900.065800.853400.750001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854AGCAGCUCAAGAACACAUG64.41511418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731872AGCAGCTCAAGAACACATGCATGTGTTCTTGAGCTGCT0.083800.002100.698300.500001.000001.00000


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651UUUUUGUACUGAUAUAAUU76.0866751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031669TTTTTGTACTGATATAATTAATTATATCAGTACAAAAA0.094200.029300.491400.500001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404UACAAAUUUGAUCCUAAAA79.599543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381422TACAAATTTGATCCTAAAATTTTAGGATCAAATTTGTA0.396100.223600.681000.500001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206GCUGCUCUUUCUGAGGAAA87.0902202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191224GCTGCTCTTTCTGAGGAAATTTCCTCAGAAAGAGCAGC0.018000.001500.853401.000000.945701.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486UACUAAUUUGAAUGGAAAA82.9493371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111504TACTAATTTGAATGGAAAATTTTCCATTCAAATTAGTA0.071900.059900.681000.500001.000001.00000


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153GAGCAAGAUGUGGACUUAG77.9697636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510171GAGCAAGATGTGGACTTAGCTAAGTCCACATCTTGCTC0.017500.003700.637900.500001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557CAGUCAUUUUUAACCUCUA97.695623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791575CAGTCATTTTTAACCTCTATAGAGGTTAAAAATGACTG0.188600.047300.612100.750000.929300.62500


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655UGUACUGAUAUAAUUUAGU72.441957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511673TGTACTGATATAATTTAGTACTAAATTATATCAGTACA0.046000.003800.500000.500001.000001.00000


Target Position: 1932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1932GUUUUAUGUUUGGAAUAAA92.506183

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1930-1952GTGTTTTATGTTTGGAATAAAGTUUUAUUCCAAACAUAAAACACGUUUUAUGUUUGGAAUAAAGUU15.5-1.422


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950AGUCAACCUUGUUUCUACU82.392400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201968AGTCAACCTTGTTTCTACTAGTAGAAACAAGGTTGACT0.017800.013700.500000.500001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711CGUGUUGCGGCUCAUGAAC66.16491320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535729CGTGTTGCGGCTCATGAACGTTCATGAGCCGCAACACG0.039400.001200.629300.750001.000001.00000


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467UGCAGGAAAAAUUGAACAU72.0166987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841485TGCAGGAAAAATTGAACATATGTTCAATTTTTCCTGCA0.102100.036100.698300.750001.000001.00000


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273AUGAAUAUAAACGAUCUAU76.4251729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3791291ATGAATATAAACGATCTATATAGATCGTTTATATTCAT0.081700.068200.612100.500001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007UGAGCUCAAUUUCAUUUCU73.6704892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101025TGAGCTCAATTTCATTTCTAGAAATGAAATTGAGCTCA0.203900.035400.500000.500001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066ACGAAUUUGCCGACAGAGA74.7314831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001084ACGAATTTGCCGACAGAGATCTCTGTCGGCAAATTCGT0.166500.050700.551700.500001.000001.00000


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918ACCUUUGAUGCUAUAACUA84.9892284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291936ACCTTTGATGCTATAACTATAGTTATAGCATCAAAGGT0.468300.014000.681000.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906GAUAACUCUUCUAACACAA95.742241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901924GATAACTCTTCTAACACAATTGTGTTAGAAGAGTTATC0.124800.110200.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1904-1926GGGATAACTCTTCTAACACAAAAUUGUGUUAGAAGAGUUAUCCCGAUAACUCUUCUAACACAAAAU20.414.532


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947AGAAGUGAUGUUCUUUAAA88.817157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461965AGAAGTGATGTTCTTTAAATTTAAAGAACATCACTTCT0.084100.002400.724100.750001.000001.00000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397GGGAGCAAACACAUCUGAC78.356618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
367415GGGAGCAAACACATCTGACGTCAGATGTGTTTGCTCCC0.122100.007100.672400.750001.000001.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36ACUUACCUUGCACUGAGAA79.3781557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46254ACTTACCTTGCACTGAGAATTCTCAGTGCAAGGTAAGT0.096400.002400.534500.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845CGGAGGAAAAGCAGCUCAA89.1716152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381863CGGAGGAAAAGCAGCTCAATTGAGCTGCTTTTCCTCCG0.131100.023500.767201.000001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068GAAUUUGCCGACAGAGAUG75.8763763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801086GAATTTGCCGACAGAGATGCATCTCTGTCGGCAAATTC0.174200.041200.517200.500001.000001.00000


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936ACGAUUCGGGGAGAAGUGA67.55471231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459954ACGATTCGGGGAGAAGTGATCACTTCTCCCCGAATCGT0.034400.002400.551700.500001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CUAGAGUCACUGAUACACA94.033955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411591CTAGAGTCACTGATACACATGTGTATCAGTGACTCTAG0.020400.001600.465500.500001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388UCAUGGAACAAGACAAUAC69.1961148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411406TCATGGAACAAGACAATACGTATTGTCTTGTTCCATGA0.476800.002600.543100.500001.000001.00000


Target Position: 266, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266GCAAAUGCAGGAAUUCUUU80.2053512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97284GCAAATGCAGGAATTCTTTAAAGAATTCCTGCATTTGC0.260700.065800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
264-286AAGCAAATGCAGGAATTCTTTGGAAAGAAUUCCUGCAUUUGCUUGCAAAUGCAGGAAUUCUUUGGU5.320.032


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653UUUGUACUGAUAUAAUUUA80.0113526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301671TTTGTACTGATATAATTTATAAATTATATCAGTACAAA0.086700.014500.465500.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UAGCCCUUUUUGUACUGAU75.0508813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871663TAGCCCTTTTTGTACTGATATCAGTACAAAAAGGGCTA0.086700.014900.491400.500001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816AGAAAGAGACAGGAGACAU83.6968340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301834AGAAAGAGACAGGAGACATATGTCTCCTGTCTCTTTCT0.088800.010300.569000.750001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516AGUCCAAAGAAGGUGUUUU75.3534795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341534AGTCCAAAGAAGGTGTTTTAAAACACCTTCTTTGGACT0.013700.001700.706900.750000.940200.87500


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267GGUAUGAUGAAUAUAAACG75.4744789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751285GGTATGATGAATATAAACGCGTTTATATTCATCATACC0.540200.041100.577600.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GAGGUAUGAUGAAUAUAAA107.3481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2591283GAGGTATGATGAATATAAATTTATATTCATCATACCTC0.879500.018900.810300.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GCAAAGAUCUUUUCCAGAG76.5046723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191754GCAAAGATCTTTTCCAGAGCTCTGGAAAAGATCTTTGC0.045100.036500.543100.750000.967400.62500


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977CAUGCGCACAAAUCCCUUC66.9641271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510995CATGCGCACAAATCCCTTCGAAGGGATTTGTGCGCATG0.433100.194700.482800.500001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241GUGGCCCAGUGGUUGAAAA85.2607278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471259GTGGCCCAGTGGTTGAAAATTTTCAACCACTGGGCCAC0.172400.002200.793100.750000.989101.00000


Target Position: 1330, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1330CUGGAAUUGGCCACAAAGU70.5671084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121348CTGGAATTGGCCACAAAGTACTTTGTGGCCAATTCCAG0.045700.001600.577600.500000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1328-1350TCCTGGAATTGGCCACAAAGTTGACUUUGUGGCCAAUUCCAGGACUGGAAUUGGCCACAAAGUUGU16.720.121


Target Position: 1268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268GUAUGAUGAAUAUAAACGA90.3046129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1266-1288AGGTATGATGAATATAAACGATCUCGUUUAUAUUCAUCAUACCUGUAUGAUGAAUAUAAACGAUCU6.914.932


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GGAAAACACUGGAAAAACC75.9914757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981238GGAAAACACTGGAAAAACCGGTTTTTCCAGTGTTTTCC0.149600.106400.517200.500000.951100.75000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922UUGAUGCUAUAACUACGAU74.0152865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533940TTGATGCTATAACTACGATATCGTAGTTATAGCATCAA0.257000.048800.465500.500001.000001.00000


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816GCUCAGGAUGACAUUGAUG77.4155664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427834GCTCAGGATGACATTGATGCATCAATGTCATCCTGAGC0.042900.003000.698300.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687GGUACAAAAAGUCAAGUUU85.9055253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291705GGTACAAAAAGTCAAGTTTAAACTTGACTTTTTGTACC0.135700.042100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1685-1707TGGGTACAAAAAGTCAAGTTTGTAAACUUGACUUUUUGUACCCAGGUACAAAAAGUCAAGUUUGUU19.214.732


Target Position: 1218, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218GAGGAAAACACUGGAAAAA87.6649183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601236GAGGAAAACACTGGAAAAATTTTTCCAGTGTTTTCCTC0.197500.057500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1216-1238CTGAGGAAAACACTGGAAAAACCUUUUUCCAGUGUUUUCCUCAGGAGGAAAACACUGGAAAAACCU20.118.721


Target Position: 1331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1331UGGAAUUGGCCACAAAGUU68.6581176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471349TGGAATTGGCCACAAAGTTAACTTTGTGGCCAATTCCA0.058100.002600.698300.750000.989100.62500


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722UCAUGAACUCGGCCAUUCU73.9317871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
448740TCATGAACTCGGCCATTCTAGAATGGCCGAGTTCATGA0.068500.030200.500000.500000.907600.62500


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468GCAGGAAAAAUUGAACAUU80.0968521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721486GCAGGAAAAATTGAACATTAATGTTCAATTTTTCCTGC0.113000.040100.844801.000001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905UGACAGUAAGCUAACCUUU76.4205730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148923TGACAGTAAGCTAACCTTTAAAGGTTAGCTTACTGTCA0.308500.042800.724100.750001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CCCCAAAAGCGUGUGACAG64.7481400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321910CCCCAAAAGCGTGTGACAGCTGTCACACGCTTTTGGGG0.127900.011700.706900.750000.983700.75000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119GCUGUUCAGGGACAGAAUG69.09691154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121137GCTGTTCAGGGACAGAATGCATTCTGTCCCTGAACAGC0.016700.006900.698300.750000.907600.62500


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946GAGAAGUGAUGUUCUUUAA100.3158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434964GAGAAGTGATGTTCTTTAATTAAAGAACATCACTTCTC0.035900.002900.775900.750000.978300.62500


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055UGAAGCUGCUUACGAAUUU70.64671078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891073TGAAGCTGCTTACGAATTTAAATTCGTAAGCAGCTTCA0.277300.046100.724100.750001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944GGGAGAAGUGAUGUUCUUU87.4904189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498962GGGAGAAGTGATGTTCTTTAAAGAACATCACTTCTCCC0.019100.002900.991401.000000.978300.62500


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CGGCCAUUCUCUUGGACUC72.069982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466749CGGCCATTCTCTTGGACTCGAGTCCAAGAGAATGGCCG0.027000.003000.603400.750000.934800.62500


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013CAAUUUCAUUUCUGUUUUC74.6551835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191031CAATTTCATTTCTGTTTTCGAAAACAGAAATGAAATTG0.155800.078300.474100.500001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747CUCUCCCAUUCUACUGAUA86.891213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141765CTCTCCCATTCTACTGATATATCAGTAGAATGGGAGAG0.213500.080100.767200.750001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544ACAUCAUGAUAUCUUUUGU81.67436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503562ACATCATGATATCTTTTGTACAAAAGATATCATGATGT0.144200.054300.500000.500001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677ACAAAUGGUGGGUACAAAA86.4171230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831695ACAAATGGTGGGTACAAAATTTTGTACCCACCATTTGT0.159800.014800.706900.750001.000001.00000


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559GUCAUUUUUAACCUCUAGA79.7872534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291577GTCATTTTTAACCTCTAGATCTAGAGGTTAAAAATGAC0.198800.070700.594800.500001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924GAUGCUAUAACUACGAUUC75.8768762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433942GATGCTATAACTACGATTCGAATCGTAGTTATAGCATC0.134300.034700.508600.500001.000001.00000


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242UGGCCCAGUGGUUGAAAAA76.1536745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457260TGGCCCAGTGGTTGAAAAATTTTTCAACCACTGGGCCA0.133800.002400.844800.750000.989100.87500


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343CAAAGUUGAUGCAGUUUUC77.1944677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201361CAAAGTTGATGCAGTTTTCGAAAACTGCATCAACTTTG0.063100.001700.474100.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413GAUCCUAAAACGAAGAGAA96.804930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461431GATCCTAAAACGAAGAGAATTCTCTTCGTTTTAGGATC0.078500.041500.508600.750001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GCGUGUGACAGUAAGCUAA95.315642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258918GCGTGTGACAGTAAGCTAATTAGCTTACTGTCACACGC0.269500.019000.887901.000001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GCAGCUCAAGAACACAUGU80.1369517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821873GCAGCTCAAGAACACATGTACATGTGTTCTTGAGCTGC0.058000.002000.646600.750001.000001.00000


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968CAGAUUCUACAUGCGCACA83.4214353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535986CAGATTCTACATGCGCACATGTGCGCATGTAGAATCTG0.295100.115600.577600.500000.978300.62500


Target Position: 328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328UGAUGAAGCAGCCCAGAUG69.23681143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544346TGATGAAGCAGCCCAGATGCATCTGGGCTGCTTCATCA0.011700.001900.569000.500001.000001.00000


Target Position: 1368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368GAUGGAUUUUUCUAUUUCU91.36999

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1366-1388AAGATGGATTTTTCTATTTCTTTAGAAAUAGAAAAAUCCAUCUUGAUGGAUUUUUCUAUUUCUUUU6.920.102


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433ACACGCCAGAUUUGCCAAG56.37291724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532451ACACGCCAGATTTGCCAAGCTTGGCAAATCTGGCGTGT0.013800.004400.569000.500000.956500.87500


Target Position: 1616, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616GUUUGCAUAUUUUUUUACU78.2406621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1614-1636CAGTTTGCATATTTTTTTACTATAGUAAAAAAAUAUGCAAACUGGUUUGCAUAUUUUUUUACUAUU0.020.021


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600UCUUAUUUAUACCUCAGUU78.4939607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161618TCTTATTTATACCTCAGTTAACTGAGGTATAAATAAGA0.330300.112400.577600.750001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266AGGUAUGAUGAAUAUAAAC76.7672706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971284AGGTATGATGAATATAAACGTTTATATTCATCATACCT0.771100.033500.698300.500001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346AGUUGAUGCAGUUUUCAUG75.603777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741364AGTTGATGCAGTTTTCATGCATGAAAACTGCATCAACT0.099300.002100.551700.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675AGGUGGACCAACAAUUUCA86.2941240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353693AGGTGGACCAACAATTTCATGAAATTGTTGGTCCACCT0.231700.025600.620700.500001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465ACUGCAGGAAAAAUUGAAC64.44211415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921483ACTGCAGGAAAAATTGAACGTTCAATTTTTCCTGCAGT0.085600.027900.560300.500001.000001.00000


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117GUGUCUCACAGCUUCCCAG74.9366819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534135GTGTCTCACAGCTTCCCAGCTGGGAAGCTGTGAGACAC0.022600.003000.508600.500001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CCAAAAGCGUGUGACAGUA88.2673167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315912CCAAAAGCGTGTGACAGTATACTGTCACACGCTTTTGG0.185000.011900.663801.000001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132AGAAUGUGCUACACGGAUA92.121186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641150AGAATGTGCTACACGGATATATCCGTGTAGCACATTCT0.091600.002300.681000.750000.978301.00000


Target Position: 1699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699CAAGUUUGUGGCUUAUGGA85.8754254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1697-1719GTCAAGTTTGTGGCTTATGGATTUCCAUAAGCCACAAACUUGACCAAGUUUGUGGCUUAUGGAUUU17.410.322


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475AAAUUGAACAUUACUAAUU78.5242604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921493AAATTGAACATTACTAATTAATTAGTAATGTTCAATTT0.567200.092000.491400.500001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296CCAGGUUAUCCCAAAAUGA86.9521211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541314CCAGGTTATCCCAAAATGATCATTTTGGGATAACCTGG0.135900.008200.620700.750000.929300.87500


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350GAUGCAGUUUUCAUGAAAG83.7783335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671368GATGCAGTTTTCATGAAAGCTTTCATGAAAACTGCATC0.026900.004600.543100.500001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899AGCGUGUGACAGUAAGCUA91.411998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287917AGCGTGTGACAGTAAGCTATAGCTTACTGTCACACGCT0.257700.014400.681000.750001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245CCCAGUGGUUGAAAAAUUG71.86121001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227263CCCAGTGGTTGAAAAATTGCAATTTTTCAACCACTGGG0.286500.025500.844800.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601CUGGAGGAAAUCUUGCUCA81.2622453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506619CTGGAGGAAATCTTGCTCATGAGCAAGATTTCCTCCAG0.077900.001700.560300.500001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436GACUCUCCAGAAAGCUAAU86.9594210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811454GACTCTCCAGAAAGCTAATATTAGCTTTCTGGAGAGTC0.091400.002000.810300.750000.929300.62500


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239UAGUGGCCCAGUGGUUGAA72.0652983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483257TAGTGGCCCAGTGGTTGAATTCAACCACTGGGCCACTA0.157700.002000.500000.500000.989101.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298AGGUUAUCCCAAAAUGAUA90.5468120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2351316AGGTTATCCCAAAATGATATATCATTTTGGGATAACCT0.154500.023900.801700.750000.929300.75000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GGACCAACAAUUUCAGAGA90.4172124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261697GGACCAACAATTTCAGAGATCTCTGAAATTGTTGGTCC0.122100.018300.646600.750001.000001.00000


Target Position: 1588, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588CACAGAAUAUAAUCUUAUU95.270444

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8158819CACAGAATATAATCTTATT1/1/0/096.22MMP1NM_001145938.1+NM_002421.31+1NANANA11:102661018..102661036(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601606CACAGAATATAATCTTATTAATAAGATTATATTCTGTG0.131600.049200.784500.750000.951100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1586-1608TACACAGAATATAATCTTATTTAAAUAAGAUUAUAUUCUGUGUACACAGAAUAUAAUCUUAUUUAU6.619.222


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386UUUCAUGGAACAAGACAAU67.83831219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911404TTTCATGGAACAAGACAATATTGTCTTGTTCCATGAAA0.367500.001900.491400.500001.000001.00000


Target Position: 999, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999CCGGAAGUUGAGCUCAAUU79.5948544

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1099919CCGGAAGTTGAGCTCAATT1/1/0/094.96MMP1NM_001145938.1+NM_002421.31+1NANANA11:102663423..102663441(-)00MMP1(0.002)


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261ACUGGAGGUAUGAUGAAUA90.3723128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091279ACTGGAGGTATGATGAATATATTCATCATACCTCCAGT0.258800.001600.663800.750001.000001.00000


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636CCAGGUAUUGGAGGGGAUG61.01191554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523654CCAGGTATTGGAGGGGATGCATCCCCTCCAATACCTGG0.015500.004300.689700.750000.983700.62500


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635AUUUAGAAUGUAGCCCUUU67.72761225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291653ATTTAGAATGTAGCCCTTTAAAGGGCTACATTCTAAAT0.050800.021300.508600.500001.000001.00000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254UGAAAAAUUGAAGCAAAUG61.18291545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529272TGAAAAATTGAAGCAAATGCATTTGCTTCAATTTTTCA0.065000.030200.569000.500001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656UCAUUUUGAUGAAGAUGAA87.0756203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488674TCATTTTGATGAAGATGAATTCATCTTCATCAAAATGA0.021600.002600.551700.750001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938GAUUCGGGGAGAAGUGAUG71.30061033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521956GATTCGGGGAGAAGTGATGCATCACTTCTCCCCGAATC0.032800.001400.525900.500001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471GGAAAAAUUGAACAUUACU85.5698266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981489GGAAAAATTGAACATTACTAGTAATGTTCAATTTTTCC0.155800.058000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1469-1491CAGGAAAAATTGAACATTACTAAAGUAAUGUUCAAUUUUUCCUGGGAAAAAUUGAACAUUACUAAU14.60.421


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219AGGAAAACACUGGAAAAAC66.56141293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211237AGGAAAACACTGGAAAAACGTTTTTCCAGTGTTTTCCT0.168100.104200.698300.500001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411CUGACCUACAGGAUUGAAA84.6925296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87429CTGACCTACAGGATTGAAATTTCAATCCTGTAGGTCAG0.324500.083200.784500.750000.978300.62500


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908CAGUAAGCUAACCUUUGAU87.1967200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290926CAGTAAGCTAACCTTTGATATCAAAGGTTAGCTTACTG0.233900.014000.603400.750001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402AAUACAAAUUUGAUCCUAA97.230325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271420AATACAAATTTGATCCTAATTAGGATCAAATTTGTATT0.297300.208600.474100.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650CUUUUUGUACUGAUAUAAU87.3835191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501668CTTTTTGTACTGATATAATATTATATCAGTACAAAAAG0.072300.036800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1648-1670CCCTTTTTGTACTGATATAATTTAUUAUAUCAGUACAAAAAGGGCUUUUUGUACUGAUAUAAUUUU3.55.622


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731GAGUUGCAAAGAUCUUUUC71.8955999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381749GAGTTGCAAAGATCTTTTCGAAAAGATCTTTGCAACTC0.106300.016800.637900.500001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UGGUGGGUACAAAAAGUCA81.8382420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701700TGGTGGGTACAAAAAGTCATGACTTTTTGTACCCACCA0.227500.029000.620700.500001.000001.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671UGAAAGGUGGACCAACAAU74.208858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201689TGAAAGGTGGACCAACAATATTGTTGGTCCACCTTTCA0.194600.081600.715500.750001.000001.00000


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329GAUGAAGCAGCCCAGAUGU79.5253549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535347GATGAAGCAGCCCAGATGTACATCTGGGCTGCTTCATC0.013400.001500.474100.500001.000001.00000


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248AGUGGUUGAAAAAUUGAAG69.0591158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505266AGTGGTTGAAAAATTGAAGCTTCAATTTTTCAACCACT0.084300.029800.569000.500001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667AAGAUGAAAGGUGGACCAA78.6979591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486685AAGATGAAAGGTGGACCAATTGGTCCACCTTTCATCTT0.124800.009400.491400.500001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639AGAAUGUAGCCCUUUUUGU73.0124925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151657AGAATGTAGCCCTTTTTGTACAAAAAGGGCTACATTCT0.272800.014200.517200.500001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352UGCAGUUUUCAUGAAAGAU73.0099926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201370TGCAGTTTTCATGAAAGATATCTTTCATGAAAACTGCA0.015800.009200.672400.750001.000001.00000


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311UGCUGAAACCCUGAAGGUG61.56111528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484329TGCTGAAACCCTGAAGGTGCACCTTCAGGGTTTCAGCA0.242300.002000.560300.500000.902200.62500


Target Position: 1913, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913CUUCUAACACAAAAUAAGU79.74536

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1911-1933CTCTTCTAACACAAAATAAGTGTACUUAUUUUGUGUUAGAAGAGCUUCUAACACAAAAUAAGUGUU-4.314.622


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230GCGGAGAAAUAGUGGCCCA85.5435268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317248GCGGAGAAATAGTGGCCCATGGGCCACTATTTCTCCGC0.099900.032300.577600.750000.994600.62500


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403AUACAAAUUUGAUCCUAAA91.509196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851421ATACAAATTTGATCCTAAATTTAGGATCAAATTTGTAT0.389700.214800.543100.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744GGACUCUCCCAUUCUACUG74.1132863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307762GGACTCTCCCATTCTACTGCAGTAGAATGGGAGAGTCC0.316400.041400.586200.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CAAAUGGUGGGUACAAAAA87.8347179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501696CAAATGGTGGGTACAAAAATTTTTGTACCCACCATTTG0.262500.019500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1676-1698CACAAATGGTGGGTACAAAAAGTUUUUUGUACCCACCAUUUGUGCAAAUGGUGGGUACAAAAAGUU7.218.813


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215UCUGAGGAAAACACUGGAA77.1385684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671233TCTGAGGAAAACACTGGAATTCCAGTGTTTTCCTCAGA0.220300.018300.551700.750001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668AGAUGAAAGGUGGACCAAC70.83151064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513686AGATGAAAGGTGGACCAACGTTGGTCCACCTTTCATCT0.131800.010500.577600.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672GAAAGGUGGACCAACAAUU84.2552313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314690GAAAGGTGGACCAACAATTAATTGTTGGTCCACCTTTC0.089000.048200.663800.750001.000001.00000


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267CAAAUGCAGGAAUUCUUUG71.16211044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467285CAAATGCAGGAATTCTTTGCAAAGAATTCCTGCATTTG0.046500.012000.500000.500001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CGGUUUUUCAAAGGGAAUA78.6646596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731110CGGTTTTTCAAAGGGAATATATTCCCTTTGAAAAACCG0.263500.016300.870701.000001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506ACAUGGUGUGAGUCCAAAG74.3225857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171524ACATGGTGTGAGTCCAAAGCTTTGGACTCACACCATGT0.059600.016100.569000.500000.956500.75000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536UCAAGCAGACAUCAUGAUA82.7891379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352554TCAAGCAGACATCATGATATATCATGATGTCTGCTTGA0.127500.008300.681000.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609UACCUCAGUUUGCAUAUUU73.1304918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221627TACCTCAGTTTGCATATTTAAATATGCAAACTGAGGTA0.227600.071100.681000.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UCUUUAAAGACAGAUUCUA77.9743635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365976TCTTTAAAGACAGATTCTATAGAATCTGTCTTTAAAGA0.182500.041600.551700.750000.983700.62500


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GGAAAAGCAGCUCAAGAAC73.2789909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241867GGAAAAGCAGCTCAAGAACGTTCTTGAGCTGCTTTTCC0.044900.003000.724100.750001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313CUGAAACCCUGAAGGUGAU79.3424559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368331CTGAAACCCTGAAGGTGATATCACCTTCAGGGTTTCAG0.228700.006900.603400.750000.902200.87500


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708GGCUUAUGGAUUCAUAUAG78.7945586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311726GGCTTATGGATTCATATAGCTATATGAATCCATAAGCC0.097600.002900.827600.750000.962000.87500


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494GAGUAAUGUCACACCUCUG85.4194272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486512GAGTAATGTCACACCTCTGCAGAGGTGTGACATTACTC0.021700.002500.525900.500000.940200.62500


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720GCUCAUGAACUCGGCCAUU75.7347772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443738GCTCATGAACTCGGCCATTAATGGCCGAGTTCATGAGC0.076400.002600.844801.000000.994600.62500


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792GUGACAAACAUAUCCUUUC71.29721034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181810GTGACAAACATATCCTTTCGAAAGGATATGTTTGTCAC0.070500.065200.620700.500000.902200.75000


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528GUGUUUUCCUGAAGAACUG72.3795962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041546GTGTTTTCCTGAAGAACTGCAGTTCTTCAGGAAAACAC0.136100.010000.508600.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534GGUCAAGCAGACAUCAUGA96.5734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409552GGTCAAGCAGACATCATGATCATGATGTCTGCTTGACC0.047500.005600.629300.750000.902200.62500


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263UGGAGGUAUGAUGAAUAUA84.7261293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611281TGGAGGTATGATGAATATATATATTCATCATACCTCCA0.366900.007600.801700.750001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193ACUACAACCUGAAGAAUGA86.3464237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518211ACTACAACCTGAAGAATGATCATTCTTCAGGTTGTAGT0.794900.216400.482800.500001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886CACAAACCCCAAAAGCGUG67.35471245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474904CACAAACCCCAAAAGCGTGCACGCTTTTGGGGTTTGTG0.032700.026600.500000.500000.962000.75000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262UGAAGCAAAUGCAGGAAUU73.8139876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
240280TGAAGCAAATGCAGGAATTAATTCCTGCATTTGCTTCA0.129000.028200.715500.750000.972801.00000


Target Position: 47, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
47ACUGAGAAAGAAGACAAAG66.04711330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
38665ACTGAGAAAGAAGACAAAGCTTTGTCTTCTTTCTCAGT0.284300.092100.569000.500001.000001.00000


Target Position: 427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427AAAAUUACACGCCAGAUUU76.3416735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513445AAAATTACACGCCAGATTTAAATCTGGCGTGTAATTTT0.016700.017800.500000.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UGACCUACAGGAUUGAAAA87.8836178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87430TGACCTACAGGATTGAAAATTTTCAATCCTGTAGGTCA0.463400.090800.724100.750001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240AGUGGCCCAGUGGUUGAAA74.8832822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468258AGTGGCCCAGTGGTTGAAATTTCAACCACTGGGCCACT0.191100.002200.706900.750000.989101.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391UGGAACAAGACAAUACAAA80.0229525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371409TGGAACAAGACAATACAAATTTGTATTGTCTTGTTCCA0.630500.027000.844800.750001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60ACAAAGGCCAGUAUGCACA76.6429713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46678ACAAAGGCCAGTATGCACATGTGCATACTGGCCTTTGT0.031000.006800.500000.500000.989100.87500


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135GCGACUCUAGAAACACAAG76.1526747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300153GCGACTCTAGAAACACAAGCTTGTGTTTCTAGAGTCGC0.149100.013300.784500.750001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GAGUCCAAAGAAGGUGUUU76.2079741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221533GAGTCCAAAGAAGGTGTTTAAACACCTTCTTTGGACTC0.015600.001600.810300.750000.940201.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261UUGAAGCAAAUGCAGGAAU61.18371544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393279TTGAAGCAAATGCAGGAATATTCCTGCATTTGCTTCAA0.126700.027700.637900.500000.972801.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436CGCCAGAUUUGCCAAGAGC64.7951395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525454CGCCAGATTTGCCAAGAGCGCTCTTGGCAAATCTGGCG0.017600.001400.569000.500000.929300.62500


Target Position: 1392, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392GGAACAAGACAAUACAAAU98.259520

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3139219GGAACAAGACAATACAAAT1/1/0/097.75MMP1NM_001145938.1+NM_002421.31+1NANANA11:102661214..102661232(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041410GGAACAAGACAATACAAATATTTGTATTGTCTTGTTCC0.453300.057400.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1390-1412ATGGAACAAGACAATACAAATTTAUUUGUAUUGUCUUGUUCCAUGGAACAAGACAAUACAAAUUUU6.919.222


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185GGAAAAAUACUACAACCUG80.2852508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306203GGAAAAATACTACAACCTGCAGGTTGTAGTATTTTTCC0.218300.164800.586200.750001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232GGAGAAAUAGUGGCCCAGU77.1659681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370250GGAGAAATAGTGGCCCAGTACTGGGCCACTATTTCTCC0.066400.034600.663800.750000.983700.75000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GGUUGAAAAAUUGAAGCAA90.4685122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410269GGTTGAAAAATTGAAGCAATTGCTTCAATTTTTCAACC0.047400.024300.706901.000001.000001.00000


Target Position: 1241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241CUUCUUUGUUGCUAACAAA94.431650

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1239-1261TACTTCTTTGTTGCTAACAAATAUUUGUUAGCAACAAAGAAGUACUUCUUUGUUGCUAACAAAUAU11.812.232


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944GAAUAAAGUCAACCUUGUU90.7938110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121962GAATAAAGTCAACCTTGTTAACAAGGTTGACTTTATTC0.121100.104200.525900.750001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908UAACUCUUCUAACACAAAA83.1347366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991926TAACTCTTCTAACACAAAATTTTGTGTTAGAAGAGTTA0.108600.083500.534500.500001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272GAUGAAUAUAAACGAUCUA95.957537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301290GATGAATATAAACGATCTATAGATCGTTTATATTCATC0.091400.077900.508600.750001.000001.00000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462GACCAUGCCAUUGAGAAAG66.23121316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391480GACCATGCCATTGAGAAAGCTTTCTCAATGGCATGGTC0.229200.134000.681000.500001.000001.00000


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416CUACAGGAUUGAAAAUUAC76.3208736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502434CTACAGGATTGAAAATTACGTAATTTTCAATCCTGTAG0.737400.151400.491400.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408CAUCUGACCUACAGGAUUG79.7964533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439426CATCTGACCTACAGGATTGCAATCCTGTAGGTCAGATG0.151900.019800.508600.500000.913000.87500


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252GUUGAAAAAUUGAAGCAAA94.065254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392270GTTGAAAAATTGAAGCAAATTTGCTTCAATTTTTCAAC0.054800.029800.646600.750001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684GUGGGUACAAAAAGUCAAG70.81981065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301702GTGGGTACAAAAAGTCAAGCTTGACTTTTTGTACCCAC0.406700.031200.655200.500001.000001.00000


Target Position: 231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231CGGAGAAAUAGUGGCCCAG66.66111290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290249CGGAGAAATAGTGGCCCAGCTGGGCCACTATTTCTCCG0.099700.042100.629300.750000.983700.62500


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806UGUUCAGCUAGCUCAGGAU79.977527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505824TGTTCAGCTAGCTCAGGATATCCTGAGCTAGCTGAACA0.025200.001700.525900.750001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676CACAAAUGGUGGGUACAAA93.138370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971694CACAAATGGTGGGTACAAATTTGTACCCACCATTTGTG0.051700.010200.793100.750001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586UACACAGAAUAUAAUCUUA92.820775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611604TACACAGAATATAATCTTATAAGATTATATTCTGTGTA0.100300.064900.646600.500000.951100.75000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152AGAGCAAGAUGUGGACUUA93.642663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540170AGAGCAAGATGTGGACTTATAAGTCCACATCTTGCTCT0.012600.001300.689700.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GGGCUUGAAGCUGCUUACG60.69571563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261068GGGCTTGAAGCTGCTTACGCGTAAGCAGCTTCAAGCCC0.180700.002600.715500.500000.967400.75000


Target Position: 1648, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648CCCUUUUUGUACUGAUAUA93.951157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611666CCCTTTTTGTACTGATATATATATCAGTACAAAAAGGG0.068600.048100.948301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1646-1668AGCCCTTTTTGTACTGATATAATUAUAUCAGUACAAAAAGGGCUCCCUUUUUGUACUGAUAUAAUU13.39.531


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396UGGGAGCAAACACAUCUGA73.2978908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515414TGGGAGCAAACACATCTGATCAGATGTGTTTGCTCCCA0.161000.008000.620700.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430AAUUUUGACUCUCCAGAAA86.2103242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411448AATTTTGACTCTCCAGAAATTTCTGGAGAGTCAAAATT0.012400.001600.508600.500001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GUGACAGUAAGCUAACCUU85.5926264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336922GTGACAGTAAGCTAACCTTAAGGTTAGCTTACTGTCAC0.079000.051000.655200.750001.000001.00000


Target Position: 102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
102CUGUUCUGGGGUGUGGUGU59.7671595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476120CTGTTCTGGGGTGTGGTGTACACCACACCCCAGAACAG0.048800.024000.577600.500001.000001.00000


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611CCUCAGUUUGCAUAUUUUU80.0698523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331629CCTCAGTTTGCATATTTTTAAAAATATGCAAACTGAGG0.220400.063700.844801.000001.000001.00000


Target Position: 1457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1457CUGGUUCAACUGCAGGAAA83.3823355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441475CTGGTTCAACTGCAGGAAATTTCCTGCAGTTGAACCAG0.722800.009300.784500.750001.000001.00000


Target Position: 1580, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580CACUGAUACACAGAAUAUA96.824128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431598CACTGATACACAGAATATATATATTCTGTGTATCAGTG0.130900.001100.750000.750000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1578-1600GTCACTGATACACAGAATATAATUAUAUUCUGUGUAUCAGUGACCACUGAUACACAGAAUAUAAUU6.620.322


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265AGCAAAUGCAGGAAUUCUU77.2433674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119283AGCAAATGCAGGAATTCTTAAGAATTCCTGCATTTGCT0.246700.052100.715500.750000.972800.75000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513GUGAGUCCAAAGAAGGUGU73.4369900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301531GTGAGTCCAAAGAAGGTGTACACCTTCTTTGGACTCAC0.024100.001300.586200.500000.940200.87500


Target Position: 1806, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806CUUUCAAGACAGAAAGAGA92.740577

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1804-1826TCCTTTCAAGACAGAAAGAGACAUCUCUUUCUGUCUUGAAAGGACUUUCAAGACAGAAAGAGACAU19.112.222


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537UGAAGAACUGUCUAUUUUC71.53951018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311555TGAAGAACTGTCTATTTTCGAAAATAGACAGTTCTTCA0.413600.052400.551700.500001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517GUCCAAAGAAGGUGUUUUC68.80581170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441535GTCCAAAGAAGGTGTTTTCGAAAACACCTTCTTTGGAC0.017000.001800.646600.500000.940200.75000


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976ACAUGCGCACAAAUCCCUU71.7791007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337994ACATGCGCACAAATCCCTTAAGGGATTTGTGCGCATGT0.437900.183600.569000.750001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394AACAAGACAAUACAAAUUU73.7259885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3121412AACAAGACAATACAAATTTAAATTTGTATTGTCTTGTT0.274400.195500.646600.500001.000001.00000


Target Position: 1534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534UCCUGAAGAACUGUCUAUU71.56041016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691552TCCTGAAGAACTGTCTATTAATAGACAGTTCTTCAGGA0.211100.048700.862100.750001.000001.00000


Target Position: 1942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942UGGAAUAAAGUCAACCUUG65.79471342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551960TGGAATAAAGTCAACCTTGCAAGGTTGACTTTATTCCA0.214200.010700.698300.500001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434UUGACUCUCCAGAAAGCUA79.6355541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151452TTGACTCTCCAGAAAGCTATAGCTTTCTGGAGAGTCAA0.066700.002800.474100.500000.929300.62500


Target Position: 1061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061UGCUUACGAAUUUGCCGAC57.34811682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961079TGCTTACGAATTTGCCGACGTCGGCAAATTCGTAAGCA0.078700.037700.534500.500001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901CGUGUGACAGUAAGCUAAC74.3899849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251919CGTGTGACAGTAAGCTAACGTTAGCTTACTGTCACACG0.198400.038800.629300.750001.000001.00000


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348UUGAUGCAGUUUUCAUGAA77.1094685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411366TTGATGCAGTTTTCATGAATTCATGAAAACTGCATCAA0.081400.003700.474100.500001.000001.00000


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637UUAGAAUGUAGCCCUUUUU66.87711275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841655TTAGAATGTAGCCCTTTTTAAAAAGGGCTACATTCTAA0.096400.013500.534500.500001.000001.00000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327GUGAUGAAGCAGCCCAGAU80.956476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519345GTGATGAAGCAGCCCAGATATCTGGGCTGCTTCATCAC0.016100.002500.612100.750001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133GAAUGUGCUACACGGAUAC74.6451836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041151GAATGTGCTACACGGATACGTATCCGTGTAGCACATTC0.083200.001700.491400.500000.978301.00000


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209UGAUGGGAGGCAAGUUGAA81.4658444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369227TGATGGGAGGCAAGTTGAATTCAACTTGCCTCCCATCA0.281700.009200.551700.750001.000001.00000


Target Position: 1727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1727GCCAGAGUUGCAAAGAUCU79.6625538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901745GCCAGAGTTGCAAAGATCTAGATCTTTGCAACTCTGGC0.130800.005000.775900.750001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954AACCUUGUUUCUACUGUUU75.0868810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841972AACCTTGTTTCTACTGTTTAAACAGTAGAAACAAGGTT0.269300.002600.646600.500001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218GCAAGUUGAAAAGCGGAGA74.6278837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261236GCAAGTTGAAAAGCGGAGATCTCCGCTTTTCAACTTGC0.300900.157400.629300.750001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680GACCAACAAUUUCAGAGAG78.5003605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516698GACCAACAATTTCAGAGAGCTCTCTGAAATTGTTGGTC0.097700.016400.508600.500001.000001.00000


Target Position: 1152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152CCCAAGGACAUCUACAGCU74.3306856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371170CCCAAGGACATCTACAGCTAGCTGTAGATGTCCTTGGG0.083200.002800.637900.750001.000001.00000


Target Position: 173, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173CCAGAAAUACCUGGAAAAA87.0618205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
171-193GTCCAGAAATACCTGGAAAAATAUUUUUCCAGGUAUUUCUGGACCCAGAAAUACCUGGAAAAAUAU20.112.022


Target Position: 1480, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480GAACAUUACUAAUUUGAAU94.399151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911498GAACATTACTAATTTGAATATTCAAATTAGTAATGTTC0.480700.168100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1478-1500TTGAACATTACTAATTTGAATGGAUUCAAAUUAGUAAUGUUCAAGAACAUUACUAAUUUGAAUGGU7.46.932


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647GCCCUUUUUGUACUGAUAU78.8611582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581665GCCCTTTTTGTACTGATATATATCAGTACAAAAAGGGC0.070000.057000.956901.000001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956GUUCUUUAAAGACAGAUUC66.36391307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525974GTTCTTTAAAGACAGATTCGAATCTGTCTTTAAAGAAC0.165100.073400.474100.500000.956500.62500


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319CCCUGAAGGUGAUGAAGCA91.875794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266337CCCTGAAGGTGATGAAGCATGCTTCATCACCTTCAGGG0.116100.029300.637900.750000.983700.75000


Target Position: 1776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776CCAGAGAGCAGCUUCAGUG76.0605754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641794CCAGAGAGCAGCTTCAGTGCACTGAAGCTGCTCTCTGG0.083600.014800.551700.750001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CAUUUUGAUGAAGAUGAAA89.6134141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470675CATTTTGATGAAGATGAAATTTCATCTTCATCAAAATG0.025900.003800.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
655-677CTCATTTTGATGAAGATGAAAGGUUUCAUCUUCAUCAAAAUGAGCAUUUUGAUGAAGAUGAAAGGU20.47.412


Target Position: 400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
400AGCAAACACAUCUGACCUA87.3063194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329418AGCAAACACATCTGACCTATAGGTCAGATGTGTTTGCT0.083100.011700.681000.750001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774UCCCAGAGAGCAGCUUCAG54.55351776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681792TCCCAGAGAGCAGCTTCAGCTGAAGCTGCTCTCTGGGA0.066700.010200.586200.500001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304UCCCAAAAUGAUAGCACAU72.2391970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991322TCCCAAAATGATAGCACATATGTGCTATCATTTTGGGA0.018900.017300.715500.750000.983700.75000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371GGAUUUUUCUAUUUCUUUC79.3503558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571389GGATTTTTCTATTTCTTTCGAAAGAAATAGAAAAATCC0.070300.011500.698300.750001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948GAAGUGAUGUUCUUUAAAG84.3013311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509966GAAGTGATGTTCTTTAAAGCTTTAAAGAACATCACTTC0.087000.002700.534500.500001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771UGAUCCCAGAGAGCAGCUU62.88971482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871789TGATCCCAGAGAGCAGCTTAAGCTGCTCTCTGGGATCA0.057800.008200.586200.750001.000001.00000


Target Position: 1911, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1911CUCUUCUAACACAAAAUAA90.3892126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721929CTCTTCTAACACAAAATAATTATTTTGTGTTAGAAGAG0.066100.045900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1909-1931AACTCTTCTAACACAAAATAAGTUUAUUUUGUGUUAGAAGAGUUCUCUUCUAACACAAAAUAAGUU-1.420.223


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056GAAGCUGCUUACGAAUUUG76.5002724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031074GAAGCTGCTTACGAATTTGCAAATTCGTAAGCAGCTTC0.144500.022500.525900.500001.000001.00000


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780AGAGCAGCUUCAGUGACAA90.6685113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231798AGAGCAGCTTCAGTGACAATTGTCACTGAAGCTGCTCT0.293800.037600.577600.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850GAAAAGCAGCUCAAGAACA90.6858112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401868GAAAAGCAGCTCAAGAACATGTTCTTGAGCTGCTTTTC0.046300.002800.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1848-1870AGGAAAAGCAGCTCAAGAACACAUGUUCUUGAGCUGCUUUUCCUGAAAAGCAGCUCAAGAACACAU19.218.622


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904GGGAUAACUCUUCUAACAC78.8753579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471922GGGATAACTCTTCTAACACGTGTTAGAAGAGTTATCCC0.150800.134300.698300.750001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126AGGGACAGAAUGUGCUACA81.125458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651144AGGGACAGAATGTGCTACATGTAGCACATTCTGTCCCT0.027100.002400.637900.500001.000001.00000


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271UGCAGGAAUUCUUUGGGCU66.76471283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482289TGCAGGAATTCTTTGGGCTAGCCCAAAGAATTCCTGCA0.046300.005900.500000.500001.000001.00000


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305CCCAAAAUGAUAGCACAUG63.9881436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331323CCCAAAATGATAGCACATGCATGTGCTATCATTTTGGG0.013700.012000.836200.750000.983700.62500


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556UCAGUCAUUUUUAACCUCU68.1691200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531574TCAGTCATTTTTAACCTCTAGAGGTTAAAAATGACTGA0.858700.020400.500000.500000.929300.62500


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903AGGGAUAACUCUUCUAACA89.6118142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431921AGGGATAACTCTTCTAACATGTTAGAAGAGTTATCCCT0.162400.002600.637900.500001.000001.00000


Target Position: 22, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
22GCUGGGAAGCCAUCACUUA92.259685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41540GCTGGGAAGCCATCACTTATAAGTGATGGCTTCCCAGC0.333100.003800.819001.000000.945700.62500


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009AGCUCAAUUUCAUUUCUGU81.961413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401027AGCTCAATTTCATTTCTGTACAGAAATGAAATTGAGCT0.211800.040500.646600.500001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429GAAUUUUGACUCUCCAGAA99.485913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651447GAATTTTGACTCTCCAGAATTCTGGAGAGTCAAAATTC0.055500.007200.500000.750001.000001.00000


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1GGGAUAUUGGAGUAGCAAG80.393503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50119GGGATATTGGAGTAGCAAGCTTGCTACTCCAATATCCC0.018800.040300.853400.750001.000001.00000


Target Position: 415, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415CCUACAGGAUUGAAAAUUA98.199822

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_541519CCTACAGGATTGAAAATTA1/1/0/097.21MMP1NM_001145938.1+NM_002421.31+1NANANA11:102667882,102667987..102667893,102667993(-)00MMP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48433CCTACAGGATTGAAAATTATAATTTTCAATCCTGTAGG0.592300.146300.810301.000001.000001.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393GAACAAGACAAUACAAAUU88.8174156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881411GAACAAGACAATACAAATTAATTTGTATTGTCTTGTTC0.313700.107900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1391-1413TGGAACAAGACAATACAAATTTGAAUUUGUAUUGUCUUGUUCCAGAACAAGACAAUACAAAUUUGU6.919.222


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212UGGGAGGCAAGUUGAAAAG58.00081658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350230TGGGAGGCAAGTTGAAAAGCTTTTCAACTTGCCTCCCA0.194500.013800.706900.500001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508AUGGUGUGAGUCCAAAGAA82.3606402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071526ATGGTGTGAGTCCAAAGAATTCTTTGGACTCACACCAT0.019100.015200.482800.500000.956500.62500


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181ACCUGGAAAAAUACUACAA84.6856297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179199ACCTGGAAAAATACTACAATTGTAGTATTTTTCCAGGT0.261900.070600.706900.750001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469CCAUUGAGAAAGCCUUCCA82.4765393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475487CCATTGAGAAAGCCTTCCATGGAAGGCTTTCTCAATGG0.115100.029700.500000.750000.983700.62500


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369AUGGAUUUUUCUAUUUCUU73.7976879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181387ATGGATTTTTCTATTTCTTAAGAAATAGAAAAATCCAT0.045400.004800.517200.500001.000001.00000


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131CAGAAUGUGCUACACGGAU82.1144411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581149CAGAATGTGCTACACGGATATCCGTGTAGCACATTCTG0.097400.002400.603400.750000.978301.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297CAGGUUAUCCCAAAAUGAU86.3445238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031315CAGGTTATCCCAAAATGATATCATTTTGGGATAACCTG0.146300.013100.603400.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317TCCAGGTTATCCCAAAATGATAGAUCAUUUUGGGAUAACCUGGACAGGUUAUCCCAAAAUGAUAGU7.418.522


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860UCAAGAACACAUGUGCAGU68.95751162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791878TCAAGAACACATGTGCAGTACTGCACATGTGTTCTTGA0.023700.012900.517200.500001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CUAGCUCAGGAUGACAUUG68.26681194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407831CTAGCTCAGGATGACATTGCAATGTCATCCTGAGCTAG0.118300.004200.525900.500001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810CAGCUAGCUCAGGAUGACA89.8445137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495828CAGCTAGCTCAGGATGACATGTCATCCTGAGCTAGCTG0.021700.001800.577600.500001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952UCAACCUUGUUUCUACUGU63.14221469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331970TCAACCTTGTTTCTACTGTACAGTAGAAACAAGGTTGA0.036700.004400.517200.500001.000001.00000


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520CCAAGGUCUCUGAGGGUCA83.1879361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527538CCAAGGTCTCTGAGGGTCATGACCCTCAGAGACCTTGG0.186100.001300.620700.750001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163CUACAGCUCCUUUGGCUUC63.64211451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921181CTACAGCTCCTTTGGCTTCGAAGCCAAAGGAGCTGTAG0.052600.001900.500000.500000.923900.75000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127GGGACAGAAUGUGCUACAC76.9586692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291145GGGACAGAATGTGCTACACGTGTAGCACATTCTGTCCC0.039800.004600.698300.750000.967400.62500


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200CCUGAAGAAUGAUGGGAGG64.88041389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470218CCTGAAGAATGATGGGAGGCCTCCCATCATTCTTCAGG0.048300.025500.500000.500001.000001.00000


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601CUUAUUUAUACCUCAGUUU78.4902608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381619CTTATTTATACCTCAGTTTAAACTGAGGTATAAATAAG0.301600.114500.637900.750001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008GAGCUCAAUUUCAUUUCUG76.6429714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521026GAGCTCAATTTCATTTCTGCAGAAATGAAATTGAGCTC0.131000.023200.525900.500001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153CCAAGGACAUCUACAGCUC73.5192897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231171CCAAGGACATCTACAGCTCGAGCTGTAGATGTCCTTGG0.043100.006600.534500.750001.000001.00000


Target Position: 1937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937AUGUUUGGAAUAAAGUCAA79.5036552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271955ATGTTTGGAATAAAGTCAATTGACTTTATTCCAAACAT0.375600.003800.508600.500001.000001.00000


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725UGAACUCGGCCAUUCUCUU73.2195914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298743TGAACTCGGCCATTCTCTTAAGAGAATGGCCGAGTTCA0.127100.018200.586200.750000.907600.62500


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459GGUUCAACUGCAGGAAAAA91.892593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671477GGTTCAACTGCAGGAAAAATTTTTCCTGCAGTTGAACC0.258200.017300.853401.000001.000001.00000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745GACUCUCCCAUUCUACUGA86.9206212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292763GACTCTCCCATTCTACTGATCAGTAGAATGGGAGAGTC0.231300.047000.594800.500001.000001.00000


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909AGUAAGCUAACCUUUGAUG68.06791205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508927AGTAAGCTAACCTTTGATGCATCAAAGGTTAGCTTACT0.017600.011500.551700.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231GAAAAACCUACUUCUUUGU77.231675

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1229-1251TGGAAAAACCTACTTCTTTGTTGACAAAGAAGUAGGUUUUUCCAGAAAAACCUACUUCUUUGUUGU12.212.612


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387UUCAUGGAACAAGACAAUA72.2933965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671405TTCATGGAACAAGACAATATATTGTCTTGTTCCATGAA0.384300.002300.629300.500001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815AGCUCAGGAUGACAUUGAU88.6207162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409833AGCTCAGGATGACATTGATATCAATGTCATCCTGAGCT0.054200.004000.672400.750001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673AAAGGUGGACCAACAAUUU77.7697645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461691AAAGGTGGACCAACAATTTAAATTGTTGGTCCACCTTT0.266400.031800.500000.500001.000001.00000


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473AAAAAUUGAACAUUACUAA88.8875155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361491AAAAATTGAACATTACTAATTAGTAATGTTCAATTTTT0.595800.071400.465500.500001.000001.00000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56GAAGACAAAGGCCAGUAUG73.1721916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51674GAAGACAAAGGCCAGTATGCATACTGGCCTTTGTCTTC0.016300.006500.517200.500000.978300.87500


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531GAGGGUCAAGCAGACAUCA88.0162174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497549GAGGGTCAAGCAGACATCATGATGTCTGCTTGACCCTC0.059600.001800.586200.500000.902201.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217UGAGGAAAACACUGGAAAA89.5763143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761235TGAGGAAAACACTGGAAAATTTTCCAGTGTTTTCCTCA0.214700.025100.724100.750001.000001.00000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151AAGAGCAAGAUGUGGACUU72.0153988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543169AAGAGCAAGATGTGGACTTAAGTCCACATCTTGCTCTT0.011800.001400.500000.500001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458UGGUUCAACUGCAGGAAAA81.7659428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691476TGGTTCAACTGCAGGAAAATTTTCCTGCAGTTGAACCA0.283200.016900.844800.750001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746ACUCUCCCAUUCUACUGAU78.4967606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411764ACTCTCCCATTCTACTGATATCAGTAGAATGGGAGAGT0.228300.080400.525900.750001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011CUCAAUUUCAUUUCUGUUU71.14131045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221029CTCAATTTCATTTCTGTTTAAACAGAAATGAAATTGAG0.158800.037200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1009-1031AGCTCAATTTCATTTCTGTTTTCAAACAGAAAUGAAAUUGAGCUCUCAAUUUCAUUUCUGUUUUCU19.27.411


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487ACUAAUUUGAAUGGAAAAC54.98281766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491505ACTAATTTGAATGGAAAACGTTTTCCATTCAAATTAGT0.047400.041400.560300.500001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891ACCCCAAAAGCGUGUGACA77.9899633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537909ACCCCAAAAGCGTGTGACATGTCACACGCTTTTGGGGT0.135900.013700.646600.500000.978300.62500


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509UGGUGUGAGUCCAAAGAAG72.3182964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171527TGGTGTGAGTCCAAAGAAGCTTCTTTGGACTCACACCA0.016300.014400.706900.500000.989100.62500


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456GCUGGUUCAACUGCAGGAA81.8592419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291474GCTGGTTCAACTGCAGGAATTCCTGCAGTTGAACCAGC0.285400.010400.681001.000001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532AGGGUCAAGCAGACAUCAU79.673537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463550AGGGTCAAGCAGACATCATATGATGTCTGCTTGACCCT0.033600.002400.689700.750000.902200.87500


Target Position: 1582, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582CUGAUACACAGAAUAUAAU87.329193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841600CTGATACACAGAATATAATATTATATTCTGTGTATCAG0.116000.018800.775900.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1580-1602CACTGATACACAGAATATAATCTAUUAUAUUCUGUGUAUCAGUGCUGAUACACAGAAUAUAAUCUU-8.021.522


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652UUUUGUACUGAUAUAAUUU75.9297759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521670TTTTGTACTGATATAATTTAAATTATATCAGTACAAAA0.073200.021900.500000.500001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906GACAGUAAGCUAACCUUUG75.9048760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441924GACAGTAAGCTAACCTTTGCAAAGGTTAGCTTACTGTC0.291400.038400.672400.500001.000001.00000


Target Position: 915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915CUAACCUUUGAUGCUAUAA81.6295438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
913-935AGCTAACCTTTGATGCTATAACTUUAUAGCAUCAAAGGUUAGCUCUAACCUUUGAUGCUAUAACUU20.918.633


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217GGCAAGUUGAAAAGCGGAG64.42971417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144235GGCAAGTTGAAAAGCGGAGCTCCGCTTTTCAACTTGCC0.375800.155700.689700.750000.994600.75000


Target Position: 41, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
41CCUUGCACUGAGAAAGAAG73.9689867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
33559CCTTGCACTGAGAAAGAAGCTTCTTTCTCAGTGCAAGG0.247400.010000.706900.750001.000001.00000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345AAGUUGAUGCAGUUUUCAU83.9906327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111363AAGTTGATGCAGTTTTCATATGAAAACTGCATCAACTT0.153800.001600.482800.500001.000001.00000


Target Position: 1729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1729CAGAGUUGCAAAGAUCUUU80.2714510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421747CAGAGTTGCAAAGATCTTTAAAGATCTTTGCAACTCTG0.114400.009500.784500.750001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550AUUUUCUCAGUCAUUUUUA78.0588631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231568ATTTTCTCAGTCATTTTTATAAAAATGACTGAGAAAAT0.071200.001900.474100.500001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216AGGCAAGUUGAAAAGCGGA77.2012676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521234AGGCAAGTTGAAAAGCGGATCCGCTTTTCAACTTGCCT0.397900.047200.474100.500000.994600.62500


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79GCUUUCCUCCACUGCUGCU73.8066878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53697GCTTTCCTCCACTGCTGCTAGCAGCAGTGGAGGAAAGC0.013300.009900.500000.750001.000001.00000


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856CAGCUCAAGAACACAUGUG72.6871943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421874CAGCTCAAGAACACATGTGCACATGTGTTCTTGAGCTG0.044100.001100.491400.500001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416CCUAAAACGAAGAGAAUUU80.156516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481434CCTAAAACGAAGAGAATTTAAATTCTCTTCGTTTTAGG0.032500.030100.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1414-1436ATCCTAAAACGAAGAGAATTTTGAAAUUCUCUUCGUUUUAGGAUCCUAAAACGAAGAGAAUUUUGU14.84.922


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461GGACCAUGCCAUUGAGAAA99.314115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117479GGACCATGCCATTGAGAAATTTCTCAATGGCATGGTCC0.232700.113100.870701.000001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306CCAAAAUGAUAGCACAUGA92.595280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251324CCAAAATGATAGCACATGATCATGTGCTATCATTTTGG0.015300.012200.620700.750001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GAAUGAUGGGAGGCAAGUU85.6657261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407224GAATGATGGGAGGCAAGTTAACTTGCCTCCCATCATTC0.075600.011200.525900.750001.000001.00000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924AAAUAAGUGUUUUAUGUUU82.8581375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371942AAATAAGTGTTTTATGTTTAAACATAAAACACTTATTT0.089800.001200.500000.500001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225ACACUGGAAAAACCUACUU69.9011117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661243ACACTGGAAAAACCTACTTAAGTAGGTTTTTCCAGTGT0.067300.039300.569000.750000.962001.00000


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274UGAAUAUAAACGAUCUAUG70.73271069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251292TGAATATAAACGATCTATGCATAGATCGTTTATATTCA0.069100.053100.569000.500001.000001.00000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923UGAUGCUAUAACUACGAUU78.2201622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250941TGATGCTATAACTACGATTAATCGTAGTTATAGCATCA0.169400.047800.715500.750001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779GAGAGCAGCUUCAGUGACA93.383667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501797GAGAGCAGCTTCAGTGACATGTCACTGAAGCTGCTCTC0.252400.030900.603400.500001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414ACCUACAGGAUUGAAAAUU65.42911361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210432ACCTACAGGATTGAAAATTAATTTTCAATCCTGTAGGT0.583400.130400.844800.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238CUACUUCUUUGUUGCUAAC71.43961024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041256CTACTTCTTTGTTGCTAACGTTAGCAACAAAGAAGTAG0.049700.006400.525900.500001.000001.00000


Target Position: 44, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
44UGCACUGAGAAAGAAGACA73.1157920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31362TGCACTGAGAAAGAAGACATGTCTTCTTTCTCAGTGCA0.297200.064400.646600.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625UUUUUUUACUAUUUAGAAU74.1579860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331643TTTTTTTACTATTTAGAATATTCTAAATAGTAAAAAAA0.135500.038400.491400.500001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795ACAAACAUAUCCUUUCAAG71.00051054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381813ACAAACATATCCTTTCAAGCTTGAAAGGATATGTTTGT0.034800.032800.569000.500001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349UGAUGCAGUUUUCAUGAAA85.984250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211367TGATGCAGTTTTCATGAAATTTCATGAAAACTGCATCA0.049200.003200.724100.750001.000001.00000


Target Position: 1941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941UUGGAAUAAAGUCAACCUU65.37411364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321959TTGGAATAAAGTCAACCTTAAGGTTGACTTTATTCCAA0.256100.004400.508600.500001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162UCUACAGCUCCUUUGGCUU67.99741207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261180TCTACAGCTCCTTTGGCTTAAGCCAAAGGAGCTGTAGA0.072200.003000.586200.750000.923900.62500


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CCAACAAUUUCAGAGAGUA93.024171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311700CCAACAATTTCAGAGAGTATACTCTCTGAAATTGTTGG0.091400.076500.663801.000001.000001.00000


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314UGAAACCCUGAAGGUGAUG50.77571849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465332TGAAACCCTGAAGGTGATGCATCACCTTCAGGGTTTCA0.220200.007300.569000.500000.902201.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476AAUUGAACAUUACUAAUUU86.8474217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341494AATTGAACATTACTAATTTAAATTAGTAATGTTCAATT0.567300.104300.508600.500001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938UGUUUGGAAUAAAGUCAAC66.40711304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111956TGTTTGGAATAAAGTCAACGTTGACTTTATTCCAAACA0.362100.003800.560300.500001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GAAAAAUUGAACAUUACUA96.628832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541490GAAAAATTGAACATTACTATAGTAATGTTCAATTTTTC0.172200.063000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1470-1492AGGAAAAATTGAACATTACTAATUAGUAAUGUUCAAUUUUUCCUGAAAAAUUGAACAUUACUAAUU11.6-12.021


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227ACUGGAAAAACCUACUUCU76.7389708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121245ACTGGAAAAACCTACTTCTAGAAGTAGGTTTTTCCAGT0.032100.019400.482800.500000.962000.87500


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603GGAGGAAAUCUUGCUCAUG76.9555695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528621GGAGGAAATCTTGCTCATGCATGAGCAAGATTTCCTCC0.068000.001300.715500.750001.000001.00000


Target Position: 1236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236ACCUACUUCUUUGUUGCUA74.8317827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721254ACCTACTTCTTTGTTGCTATAGCAACAAAGAAGTAGGT0.025400.004800.681000.750001.000001.00000