Input target sequence

Length: 521
AGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGGCGCGGGCAAGAAGCGCTTTGAAGTGAAAAAGTGGAATGCAGTAGCCCTCTGGGCCTGGGATATTGTGGTTGATAACTGTGCCATCTGCAGGAACCACATTATGGATCTTTGCATAGAATGTCAAGCTAACCAGGCGTCCGCTACTTCAGAAGAGTGTACTGTCGCATGGGGAGTCTGTAACCATGCTTTTCACTTCCACTGCATCTCTCGCTGGCTCAAAACACGACAGGTGTGTCCATTGGACAACAGAGAGTGGGAATTCCAAAAGTATGGGCACTAGGAAAAGACTTCTTCCATCAAGCTTAATTGTTTTGTTATTCATTTAATGACTTTCCCTGCTGTTACCTAATTACAAATTGGATGGAACTGTGTTTTTTTCTGCTTTGTTTTTTCAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAGTTGGATTCTGGAA