siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 314   353   360   399   404   425   465  
Biltr, Rnaxs, Sidirect 71   124   168   242   359   363   374   379   403   436  
Biltr, Sidirect 162   467   484  
Biltr, Rnaxs 21   22   23   24   25   26   69   70   74   75   76   77   78   79   80   83   84   85   88   89  
90   118   119   120   121   123   131   166   167   176   203   204   205   206   232   234   237   238   239   241  
245   246   250   251   255   256   260   264   265   266   267   301   305   306   307   308   309   312   313   315  
316   317   318   319   331   332   333   336   337   338   339   340   354   355   356   358   362   364   365   367  
370   371   372   373   378   380   391   392   395   396   397   398   400   401   402   405   406   409   423   424  
427   428   431   432   433   434   435   437   438   439   443   444   445   446   450   451   452   457   458   462  
463   464   466   469   470   471   472   475   476   477   480   481   491   492   493  
Biltr, Ernai, Rnaxs, Sidirect 122   366  
Biltr, Ernai 2  


Target Position: 354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
354UUCUUCCAUCAAGCUUAAU59.6234385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153372TTCTTCCATCAAGCTTAATATTAAGCTTGATGGAAGAA0.082600.022000.663800.500000.994600.75000


Target Position: 484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484GUAUUCUGUGUCAAAUAAA93.08311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
482-504TTGTATTCTGTGTCAAATAAAGTUUUAUUUGACACAGAAUACAAGUAUUCUGUGUCAAAUAAAGUU-1.413.401


Target Position: 25, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
25GCAGCGAUGGAUGUGGAUA86.680444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4043GCAGCGATGGATGTGGATATATCCACATCCATCGCTGC0.305800.056600.810301.000001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436GUUUUUUUCUGCUUUGUUU80.5269103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67454GTTTTTTTCTGCTTTGTTTAAACAAAGCAGAAAAAAAC0.184300.145500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
434-456GTGTTTTTTTCTGCTTTGTTTTTAAACAAAGCAGAAAAAAACACGUUUUUUUCUGCUUUGUUUUUU10.3-11.301


Target Position: 124, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124GAUAUUGUGGUUGAUAACU77.2658150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150142GATATTGTGGTTGATAACTAGTTATCAACCACAATATC0.169900.002700.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
122-144GGGATATTGTGGTTGATAACTGTAGUUAUCAACCACAAUAUCCCGAUAUUGUGGUUGAUAACUGUU16.16.703


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458CAGUUUGCUGUUUCUGUAG73.2998195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110476CAGTTTGCTGTTTCTGTAGCTACAGAAACAGCAAACTG0.115100.007600.612100.500000.989100.62500


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401CUGCUGUUACCUAAUUACA85.942451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147419CTGCTGTTACCTAATTACATGTAATTAGGTAACAGCAG0.292400.129400.577600.500001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435UGUUUUUUUCUGCUUUGUU70.3247235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104453TGTTTTTTTCTGCTTTGTTAACAAAGCAGAAAAAAACA0.178500.136000.560300.750001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367CUUAAUUGUUUUGUUAUUC64.1547327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153385CTTAATTGTTTTGTTATTCGAATAACAAAACAATTAAG0.102800.036700.465500.500001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362UCAAGCUUAAUUGUUUUGU53.1737454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116380TCAAGCTTAATTGTTTTGTACAAAACAATTAAGCTTGA0.100300.014200.517200.500001.000001.00000


Target Position: 359, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359CCAUCAAGCUUAAUUGUUU88.96125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47377CCATCAAGCTTAATTGTTTAAACAATTAAGCTTGATGG0.263800.046800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
357-379TTCCATCAAGCTTAATTGTTTTGAAACAAUUAAGCUUGAUGGAACCAUCAAGCUUAAUUGUUUUGU5.318.102


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308ACAACAGAGAGUGGGAAUU68.6937267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143326ACAACAGAGAGTGGGAATTAATTCCCACTCTCTGTTGT0.021100.015700.698300.750001.000001.00000


Target Position: 166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166AUGGAUCUUUGCAUAGAAU80.7341101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145184ATGGATCTTTGCATAGAATATTCTATGCAAAGATCCAT0.032100.001800.646600.500001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445UGCUUUGUUUUUUCAGUUU69.8755241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84463TGCTTTGTTTTTTCAGTTTAAACTGAAAAAACAAAGCA0.095900.027500.853400.750001.000001.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307GACAACAGAGAGUGGGAAU83.090571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
133325GACAACAGAGAGTGGGAATATTCCCACTCTCTGTTGTC0.039100.024100.810300.750001.000001.00000


Target Position: 237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237AGUCUGUAACCAUGCUUUU78.4176132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59255AGTCTGTAACCATGCTTTTAAAAGCATGGTTACAGACT0.152500.056800.706900.750000.983700.62500


Target Position: 22, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
22GCGGCAGCGAUGGAUGUGG55.8549431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9840GCGGCAGCGATGGATGTGGCCACATCCATCGCTGCCGC0.211600.010300.577600.500001.000001.00000


Target Position: 89, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89UGAAAAAGUGGAAUGCAGU72.0399210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119107TGAAAAAGTGGAATGCAGTACTGCATTCCACTTTTTCA0.110100.005300.517200.500001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74AGAAGCGCUUUGAAGUGAA86.379447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
13892AGAAGCGCTTTGAAGTGAATTCACTTCAAAGCGCTTCT0.827500.002600.551700.750001.000001.00000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88GUGAAAAAGUGGAAUGCAG76.8477154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120106GTGAAAAAGTGGAATGCAGCTGCATTCCACTTTTTCAC0.112500.005600.508600.500001.000001.00000


Target Position: 84, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84UGAAGUGAAAAAGUGGAAU68.8869265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57102TGAAGTGAAAAAGTGGAATATTCCACTTTTTCACTTCA0.152800.073600.715500.750001.000001.00000


Target Position: 24, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
24GGCAGCGAUGGAUGUGGAU78.182135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042GGCAGCGATGGATGTGGATATCCACATCCATCGCTGCC0.283100.040300.819001.000001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370AAUUGUUUUGUUAUUCAUU78.6595129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126388AATTGTTTTGTTATTCATTAATGAATAACAAAACAATT0.120200.039100.500000.500001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCUGUAGCCAUAUUGUAUU72.1267209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121488TCTGTAGCCATATTGTATTAATACAATATGGCTACAGA0.153400.004700.715500.750001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424GGAUGGAACUGUGUUUUUU88.400429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88442GGATGGAACTGTGTTTTTTAAAAAACACAGTTCCATCC0.179100.014300.870701.000001.000001.00000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397UUCCCUGCUGUUACCUAAU63.969332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94415TTCCCTGCTGTTACCTAATATTAGGTAACAGCAGGGAA0.536300.247200.663800.500001.000001.00000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450UGUUUUUUCAGUUUGCUGU65.0884309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131468TGTTTTTTCAGTTTGCTGTACAGCAAACTGAAAAAACA0.057100.023700.500000.500000.956500.62500


Target Position: 314, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314GAGAGUGGGAAUUCCAAAA90.847816

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_631419GAGAGTGGGAATTCCAAAA1/1/0/091.46RBX1NM_014248.21NANANA22:41363870..41363888(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128332GAGAGTGGGAATTCCAAAATTTTGGAATTCCCACTCTC0.044000.004500.810300.750000.923900.87500


Target Position: 123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
123GGAUAUUGUGGUUGAUAAC81.378695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137141GGATATTGTGGTTGATAACGTTATCAACCACAATATCC0.054100.002600.724100.750001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204CGCUACUUCAGAAGAGUGU73.2617197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140222CGCTACTTCAGAAGAGTGTACACTCTTCTGAAGTAGCG0.044600.002400.715500.750001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452UUUUUUCAGUUUGCUGUUU57.7808405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125470TTTTTTCAGTTTGCTGTTTAAACAGCAAACTGAAAAAA0.095200.021400.500000.500000.956500.87500


Target Position: 21, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
21GGCGGCAGCGAUGGAUGUG62.5725356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10939GGCGGCAGCGATGGATGTGCACATCCATCGCTGCCGCC0.152400.006000.706900.750000.983700.75000


Target Position: 353, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
353CUUCUUCCAUCAAGCUUAA87.429438

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_835319CTTCTTCCATCAAGCTTAA1/1/0/090.92RBX1NM_014248.21NANANA22:41368500..41368518(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97371CTTCTTCCATCAAGCTTAATTAAGCTTGATGGAAGAAG0.079100.019900.603400.750000.994600.87500


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437UUUUUUUCUGCUUUGUUUU60.374377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148455TTTTTTTCTGCTTTGTTTTAAAACAAAGCAGAAAAAAA0.213100.154100.500000.500001.000001.00000


Target Position: 358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358UCCAUCAAGCUUAAUUGUU63.6353338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88376TCCATCAAGCTTAATTGTTAACAATTAAGCTTGATGGA0.194700.049300.724100.750001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434GUGUUUUUUUCUGCUUUGU68.0938276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117452GTGTTTTTTTCTGCTTTGTACAAAGCAGAAAAAAACAC0.174400.126200.586200.500001.000001.00000


Target Position: 427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427UGGAACUGUGUUUUUUUCU64.1137328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96445TGGAACTGTGTTTTTTTCTAGAAAAAAACACAGTTCCA0.603700.016300.620700.500001.000001.00000


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264CUGCAUCUCUCGCUGGCUC65.2904305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148282CTGCATCTCTCGCTGGCTCGAGCCAGCGAGAGATGCAG0.033600.005200.474100.500000.978300.75000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462UUGCUGUUUCUGUAGCCAU69.9847238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140480TTGCTGTTTCTGTAGCCATATGGCTACAGAAACAGCAA0.094900.005500.491400.500000.907600.62500


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255UCACUUCCACUGCAUCUCU70.3789233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149273TCACTTCCACTGCATCTCTAGAGATGCAGTGGAAGTGA0.032300.026400.500000.500001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438UUUUUUCUGCUUUGUUUUU59.5206386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127456TTTTTTCTGCTTTGTTTTTAAAAACAAAGCAGAAAAAA0.214000.149900.500000.500001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203CCGCUACUUCAGAAGAGUG75.6831169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146221CCGCTACTTCAGAAGAGTGCACTCTTCTGAAGTAGCGG0.029700.001800.620700.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338GGCACUAGGAAAAGACUUC72.3694207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110356GGCACTAGGAAAAGACTTCGAAGTCTTTTCCTAGTGCC0.539400.006000.827600.750001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444CUGCUUUGUUUUUUCAGUU78.0756139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83462CTGCTTTGTTTTTTCAGTTAACTGAAAAAACAAAGCAG0.098700.020500.637900.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162CAUUAUGGAUCUUUGCAUA98.76784

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
160-182CACATTATGGATCTTTGCATAGAUAUGCAAAGAUCCAUAAUGUGCAUUAUGGAUCUUUGCAUAGAU20.012.602


Target Position: 391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
391AUGACUUUCCCUGCUGUUA73.5648191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144409ATGACTTTCCCTGCTGTTATAACAGCAGGGAAAGTCAT0.343400.076400.620700.500001.000001.00000


Target Position: 428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428GGAACUGUGUUUUUUUCUG76.6208158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94446GGAACTGTGTTTTTTTCTGCAGAAAAAAACACAGTTCC0.203400.020500.586200.750001.000001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406GUUACCUAAUUACAAAUUG69.8654242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137424GTTACCTAATTACAAATTGCAATTTGTAATTAGGTAAC0.061800.023400.500000.500001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378UGUUAUUCAUUUAAUGACU75.7819168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141396TGTTATTCATTTAATGACTAGTCATTAAATGAATAACA0.064400.028800.500000.500001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232UGGGGAGUCUGUAACCAUG70.3563234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153250TGGGGAGTCTGTAACCATGCATGGTTACAGACTCCCCA0.092400.001100.689700.500001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331AAGUAUGGGCACUAGGAAA89.40221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152349AAGTATGGGCACTAGGAAATTTCCTAGTGCCCATACTT0.015800.002200.637900.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402UGCUGUUACCUAAUUACAA87.178141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84420TGCTGTTACCTAATTACAATTGTAATTAGGTAACAGCA0.263600.143700.706900.750001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396UUUCCCUGCUGUUACCUAA77.1684151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152414TTTCCCTGCTGTTACCTAATTAGGTAACAGCAGGGAAA0.396400.242800.465500.500001.000001.00000


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83UUGAAGUGAAAAAGUGGAA71.2479227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146101TTGAAGTGAAAAAGTGGAATTCCACTTTTTCACTTCAA0.203200.094700.474100.500001.000001.00000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CGCUUUGAAGUGAAAAAGU76.7803155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7497CGCTTTGAAGTGAAAAAGTACTTTTTCACTTCAAAGCG0.168900.020600.715500.750001.000001.00000


Target Position: 366, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366GCUUAAUUGUUUUGUUAUU84.511462

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_436619GCTTAATTGTTTTGTTATT1/1/0/096.22RBX1NM_014248.21NANANA22:41368513..41368531(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88384GCTTAATTGTTTTGTTATTAATAACAAAACAATTAAGC0.094700.018600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
364-386AAGCTTAATTGTTTTGTTATTCAAAUAACAAAACAAUUAAGCUUGCUUAAUUGUUUUGUUAUUCAU6.9-4.302


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118GCCUGGGAUAUUGUGGUUG61.3305366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153136GCCTGGGATATTGTGGTTGCAACCACAATATCCCAGGC0.011600.001100.853400.750001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380UUAUUCAUUUAAUGACUUU71.8831212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120398TTATTCATTTAATGACTTTAAAGTCATTAAATGAATAA0.067500.031800.534500.500001.000001.00000


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131UGGUUGAUAACUGUGCCAU69.5357251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
106149TGGTTGATAACTGTGCCATATGGCACAGTTATCAACCA0.064200.014500.689700.750001.000001.00000


Target Position: 76, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
76AAGCGCUUUGAAGUGAAAA75.3823171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14894AAGCGCTTTGAAGTGAAAATTTTCACTTCAAAGCGCTT0.183700.001600.637900.500001.000001.00000


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70GGCAAGAAGCGCUUUGAAG74.0648185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14988GGCAAGAAGCGCTTTGAAGCTTCAAAGCGCTTCTTGCC0.015400.012700.862100.750000.951100.75000


Target Position: 315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315AGAGUGGGAAUUCCAAAAG63.3554344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130333AGAGTGGGAATTCCAAAAGCTTTTGGAATTCCCACTCT0.041600.003900.586200.500000.923901.00000


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356CUUCCAUCAAGCUUAAUUG73.1011199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142374CTTCCATCAAGCTTAATTGCAATTAAGCTTGATGGAAG0.083600.019600.491400.500001.000001.00000


Target Position: 363, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CAAGCUUAAUUGUUUUGUU87.477637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128381CAAGCTTAATTGTTTTGTTAACAAAACAATTAAGCTTG0.095600.013700.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
361-383ATCAAGCTTAATTGTTTTGTTATAACAAAACAAUUAAGCUUGAUCAAGCUUAAUUGUUUUGUUAUU13.318.301


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472UGUAGCCAUAUUGUAUUCU64.4305324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143490TGTAGCCATATTGTATTCTAGAATACAATATGGCTACA0.156800.004600.482800.500001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GCAUAGAAUGUCAAGCUAA99.89172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
16194GCATAGAATGTCAAGCTAATTAGCTTGACATTCTATGC0.345400.123000.819001.000001.000001.00000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77AGCGCUUUGAAGUGAAAAA82.73978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14995AGCGCTTTGAAGTGAAAAATTTTTCACTTCAAAGCGCT0.176000.001500.853400.750001.000001.00000


Target Position: 465, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465CUGUUUCUGUAGCCAUAUU82.609479

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1046519CTGTTTCTGTAGCCATATT1/1/0/090.92RBX1NM_014248.21NANANANA00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100483CTGTTTCTGTAGCCATATTAATATGGCTACAGAAACAG0.072400.066100.775900.750001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251CUUUUCACUUCCACUGCAU78.1288137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144269CTTTTCACTTCCACTGCATATGCAGTGGAAGTGAAAAG0.055500.047900.482800.750001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365AGCUUAAUUGUUUUGUUAU81.438394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83383AGCTTAATTGTTTTGTTATATAACAAAACAATTAAGCT0.109600.016300.810300.750001.000001.00000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492UGUCAAAUAAAGUCCAGUU78.4874130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131510TGTCAAATAAAGTCCAGTTAACTGGACTTTATTTGACA0.041200.033300.560300.750001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168GGAUCUUUGCAUAGAAUGU85.815652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134186GGATCTTTGCATAGAATGTACATTCTATGCAAAGATCC0.237200.003000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
166-188ATGGATCTTTGCATAGAATGTCAACAUUCUAUGCAAAGAUCCAUGGAUCUUUGCAUAGAAUGUCAU13.414.803


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238GUCUGUAACCAUGCUUUUC67.3933280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101256GTCTGTAACCATGCTTTTCGAAAAGCATGGTTACAGAC0.162600.065700.646600.500001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313AGAGAGUGGGAAUUCCAAA89.031224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124331AGAGAGTGGGAATTCCAAATTTGGAATTCCCACTCTCT0.045100.004900.724100.750000.923900.75000


Target Position: 463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463UGCUGUUUCUGUAGCCAUA86.574746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103481TGCTGTTTCTGTAGCCATATATGGCTACAGAAACAGCA0.067400.063300.810300.750000.907600.62500


Target Position: 90, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
90GAAAAAGUGGAAUGCAGUA93.65588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139108GAAAAAGTGGAATGCAGTATACTGCATTCCACTTTTTC0.107700.005300.491400.750001.000001.00000


Target Position: 467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467GUUUCUGUAGCCAUAUUGU80.4055108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
465-487CTGTTTCTGTAGCCATATTGTATACAAUAUGGCUACAGAAACAGGUUUCUGUAGCCAUAUUGUAUU5.619.202


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319UGGGAAUUCCAAAAGUAUG65.3313304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151337TGGGAATTCCAAAAGTATGCATACTTTTGGAATTCCCA0.050600.008300.689700.500000.951100.62500


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306GGACAACAGAGAGUGGGAA90.167918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121324GGACAACAGAGAGTGGGAATTCCCACTCTCTGTTGTCC0.047400.007400.698301.000001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245ACCAUGCUUUUCACUUCCA76.4466160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121263ACCATGCTTTTCACTTCCATGGAAGTGAAAAGCATGGT0.514600.128500.508600.500001.000001.00000


Target Position: 23, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
23CGGCAGCGAUGGAUGUGGA87.400239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
11041CGGCAGCGATGGATGTGGATCCACATCCATCGCTGCCG0.234000.023300.543100.750001.000001.00000


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120CUGGGAUAUUGUGGUUGAU80.084113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150138CTGGGATATTGTGGTTGATATCAACCACAATATCCCAG0.014900.003100.603400.750001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409ACCUAAUUACAAAUUGGAU79.81116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137427ACCTAATTACAAATTGGATATCCAATTTGTAATTAGGT0.033300.034000.672400.750001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480UAUUGUAUUCUGUGUCAAA91.582713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107498TATTGTATTCTGTGTCAAATTTGACACAGAATACAATA0.262800.100600.543100.500001.000001.00000


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336UGGGCACUAGGAAAAGACU71.3484223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131354TGGGCACTAGGAAAAGACTAGTCTTTTCCTAGTGCCCA0.044600.003700.637900.500001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446GCUUUGUUUUUUCAGUUUG68.6812268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
132464GCTTTGTTTTTTCAGTTTGCAAACTGAAAAAACAAAGC0.039900.009200.706900.750001.000001.00000


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267CAUCUCUCGCUGGCUCAAA82.296283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122285CATCTCTCGCTGGCTCAAATTTGAGCCAGCGAGAGATG0.046600.014100.655200.750001.000001.00000


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340CACUAGGAAAAGACUUCUU82.548582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135358CACTAGGAAAAGACTTCTTAAGAAGTCTTTTCCTAGTG0.058800.003000.655200.750001.000001.00000


Target Position: 266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266GCAUCUCUCGCUGGCUCAA85.369454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127284GCATCTCTCGCTGGCTCAATTGAGCCAGCGAGAGATGC0.044600.015300.706901.000001.000001.00000


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371AUUGUUUUGUUAUUCAUUU73.2311198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136389ATTGTTTTGTTATTCATTTAAATGAATAACAAAACAAT0.121000.034500.508600.500001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CAGAGAGUGGGAAUUCCAA93.72327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116330CAGAGAGTGGGAATTCCAATTGGAATTCCCACTCTCTG0.052200.006500.637900.750000.923900.62500


Target Position: 2, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2GACCGUGUGUUUCCAAAAU83.053672

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7219GACCGTGTGTTTCCAAAAT1/1/0/090.92RBX1NM_014248.21NANANA22:41347386..41347404(+)00RBX1(0.002)


Target Position: 404, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404CUGUUACCUAAUUACAAAU83.807666

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_540419CTGTTACCTAATTACAAAT1/1/0/093.97RBX1NM_014248.21NANANA22:41368551..41368569(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65422CTGTTACCTAATTACAAATATTTGTAATTAGGTAACAG0.121500.076400.775900.750001.000001.00000


Target Position: 309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309CAACAGAGAGUGGGAAUUC71.0643229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152327CAACAGAGAGTGGGAATTCGAATTCCCACTCTCTGTTG0.011800.006200.474100.500001.000001.00000


Target Position: 71, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
71GCAAGAAGCGCUUUGAAGU78.8677122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14089GCAAGAAGCGCTTTGAAGTACTTCAAAGCGCTTCTTGC0.032100.007500.646600.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
69-91GGGCAAGAAGCGCTTTGAAGTGAACUUCAAAGCGCUUCUUGCCCGCAAGAAGCGCUUUGAAGUGAU12.216.603


Target Position: 78, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
78GCGCUUUGAAGUGAAAAAG65.1962306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
13296GCGCTTTGAAGTGAAAAAGCTTTTTCACTTCAAAGCGC0.176100.003500.784500.750001.000001.00000


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305UGGACAACAGAGAGUGGGA78.7822124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147323TGGACAACAGAGAGTGGGATCCCACTCTCTGTTGTCCA0.045600.002200.474100.500001.000001.00000


Target Position: 26, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
26CAGCGAUGGAUGUGGAUAC75.8319167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
12844CAGCGATGGATGTGGATACGTATCCACATCCATCGCTG0.308200.072100.603400.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318GUGGGAAUUCCAAAAGUAU86.113550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101336GTGGGAATTCCAAAAGTATATACTTTTGGAATTCCCAC0.124900.007700.750000.750000.923900.62500


Target Position: 121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
121UGGGAUAUUGUGGUUGAUA79.9044115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122139TGGGATATTGTGGTTGATATATCAACCACAATATCCCA0.093600.004700.801700.750001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451GUUUUUUCAGUUUGCUGUU73.9713186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124469GTTTTTTCAGTTTGCTGTTAACAGCAAACTGAAAAAAC0.099500.022300.500000.750000.956500.75000


Target Position: 75, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
75GAAGCGCUUUGAAGUGAAA94.00136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14393GAAGCGCTTTGAAGTGAAATTTCACTTCAAAGCGCTTC0.176000.002100.672400.750001.000001.00000


Target Position: 360, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360CAUCAAGCUUAAUUGUUUU87.874432

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_336019CATCAAGCTTAATTGTTTT1/1/0/096.22RBX1NM_014248.21NANANA22:41368507..41368525(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62378CATCAAGCTTAATTGTTTTAAAACAATTAAGCTTGATG0.334100.049600.655200.750001.000001.00000


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398UCCCUGCUGUUACCUAAUU65.0159311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34416TCCCTGCTGTTACCTAATTAATTAGGTAACAGCAGGGA0.575700.250400.862100.750001.000001.00000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372UUGUUUUGUUAUUCAUUUA80.5061104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112390TTGTTTTGTTATTCATTTATAAATGAATAACAAAACAA0.120500.032500.612100.500001.000001.00000


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316GAGUGGGAAUUCCAAAAGU82.568180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130334GAGTGGGAATTCCAAAAGTACTTTTGGAATTCCCACTC0.043800.003800.603400.500000.923900.87500


Target Position: 119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CCUGGGAUAUUGUGGUUGA86.213249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151137CCTGGGATATTGTGGTTGATCAACCACAATATCCCAGG0.012200.001200.620700.750001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167UGGAUCUUUGCAUAGAAUG60.0417381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139185TGGATCTTTGCATAGAATGCATTCTATGCAAAGATCCA0.092300.002500.689700.500001.000001.00000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423UGGAUGGAACUGUGUUUUU71.8603215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98441TGGATGGAACTGTGTTTTTAAAAACACAGTTCCATCCA0.113300.009100.844800.750001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CUGUAGCCAUAUUGUAUUC73.371194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124489CTGTAGCCATATTGTATTCGAATACAATATGGCTACAG0.276500.004600.612100.500001.000001.00000


Target Position: 475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475AGCCAUAUUGUAUUCUGUG71.7124219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
102493AGCCATATTGTATTCTGTGCACAGAATACAATATGGCT0.271900.089300.560300.500001.000001.00000


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265UGCAUCUCUCGCUGGCUCA72.393206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138283TGCATCTCTCGCTGGCTCATGAGCCAGCGAGAGATGCA0.038700.017300.629300.500000.978300.75000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250GCUUUUCACUUCCACUGCA88.35730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130268GCTTTTCACTTCCACTGCATGCAGTGGAAGTGAAAAGC0.061000.052500.500000.750001.000001.00000


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333GUAUGGGCACUAGGAAAAG68.5897269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147351GTATGGGCACTAGGAAAAGCTTTTCCTAGTGCCCATAC0.038600.001700.543100.500001.000001.00000


Target Position: 425, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
425GAUGGAACUGUGUUUUUUU89.706519

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_242519GATGGAACTGTGTTTTTTT1/1/0/097.75RBX1NM_014248.21NANANA22:41368572..41368590(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95443GATGGAACTGTGTTTTTTTAAAAAAACACAGTTCCATC0.213800.009800.681000.750001.000001.00000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433UGUGUUUUUUUCUGCUUUG62.7227353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145451TGTGTTTTTTTCTGCTTTGCAAAGCAGAAAAAAACACA0.171900.104900.560300.500001.000001.00000


Target Position: 69, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
69GGGCAAGAAGCGCUUUGAA90.392517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14487GGGCAAGAAGCGCTTTGAATTCAAAGCGCTTCTTGCCC0.020700.018000.819001.000000.951100.75000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469UUCUGUAGCCAUAUUGUAU77.6627144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130487TTCTGTAGCCATATTGTATATACAATATGGCTACAGAA0.149700.004800.629300.500001.000001.00000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CACUUCCACUGCAUCUCUC73.4134193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145274CACTTCCACTGCATCTCTCGAGAGATGCAGTGGAAGTG0.026100.021900.482800.500001.000001.00000


Target Position: 122, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122GGGAUAUUGUGGUUGAUAA102.3651

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_112219GGGATATTGTGGTTGATAA1/1/0/0100.00RBX1NM_014248.21NANANA22:41349584..41349602(+)00RBX1(0.002)&MIR1261(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112140GGGATATTGTGGTTGATAATTATCAACCACAATATCCC0.079700.005600.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
120-142CTGGGATATTGTGGTTGATAACTUUAUCAACCACAAUAUCCCAGGGGAUAUUGUGGUUGAUAACUU16.115.402


Target Position: 399, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399CCCUGCUGUUACCUAAUUA91.329715

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_939919CCCTGCTGTTACCTAATTA1/1/0/090.92RBX1NM_014248.21NANANA22:41368546..41368564(+)00RBX1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
16417CCCTGCTGTTACCTAATTATAATTAGGTAACAGCAGGG0.325600.150100.956901.000001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476GCCAUAUUGUAUUCUGUGU79.9747114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32494GCCATATTGTATTCTGTGTACACAGAATACAATATGGC0.286200.091900.793100.750001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373UGUUUUGUUAUUCAUUUAA79.3357120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69391TGTTTTGTTATTCATTTAATTAAATGAATAACAAAACA0.113900.030200.672400.750001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457UCAGUUUGCUGUUUCUGUA84.686159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112475TCAGTTTGCTGTTTCTGTATACAGAAACAGCAAACTGA0.103100.008700.543100.750000.956500.62500


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464GCUGUUUCUGUAGCCAUAU78.0022141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101482GCTGTTTCTGTAGCCATATATATGGCTACAGAAACAGC0.067700.064000.810301.000000.983700.62500


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317AGUGGGAAUUCCAAAAGUA93.390410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127335AGTGGGAATTCCAAAAGTATACTTTTGGAATTCCCACT0.055800.004100.525900.750000.923900.75000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432CUGUGUUUUUUUCUGCUUU77.5208146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80450CTGTGTTTTTTTCTGCTTTAAAGCAGAAAAAAACACAG0.201500.108000.784500.750001.000001.00000


Target Position: 403, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403GCUGUUACCUAAUUACAAA99.39413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61421GCTGTTACCTAATTACAAATTTGTAATTAGGTAACAGC0.141200.092800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
401-423CTGCTGTTACCTAATTACAAATTUUUGUAAUUAGGUAACAGCAGGCUGUUACCUAAUUACAAAUUU6.919.002


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477CCAUAUUGUAUUCUGUGUC70.6301230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114495CCATATTGTATTCTGTGTCGACACAGAATACAATATGG0.269000.099400.525900.750001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206CUACUUCAGAAGAGUGUAC70.5664231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141224CTACTTCAGAAGAGTGTACGTACACTCTTCTGAAGTAG0.049400.007000.491400.500001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374GUUUUGUUAUUCAUUUAAU86.378248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95392GTTTTGTTATTCATTTAATATTAAATGAATAACAAAAC0.080200.029000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
372-394TTGTTTTGTTATTCATTTAATGAAUUAAAUGAAUAACAAAACAAGUUUUGUUAUUCAUUUAAUGAU-1.45.601


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339GCACUAGGAAAAGACUUCU77.9833142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119357GCACTAGGAAAAGACTTCTAGAAGTCTTTTCCTAGTGC0.073000.004900.629300.750001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405UGUUACCUAAUUACAAAUU69.2167258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
75423TGTTACCTAATTACAAATTAATTTGTAATTAGGTAACA0.103200.056800.698300.750001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241UGUAACCAUGCUUUUCACU66.147295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146259TGTAACCATGCTTTTCACTAGTGAAAAGCATGGTTACA0.607200.077500.500000.500001.000001.00000


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332AGUAUGGGCACUAGGAAAA81.449993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147350AGTATGGGCACTAGGAAAATTTTCCTAGTGCCCATACT0.016400.002000.706900.750001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439UUUUUCUGCUUUGUUUUUU55.9418427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150457TTTTTCTGCTTTGTTTTTTAAAAAACAAAGCAGAAAAA0.213300.156400.500000.500001.000001.00000


Target Position: 392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
392UGACUUUCCCUGCUGUUAC63.0242349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111410TGACTTTCCCTGCTGTTACGTAACAGCAGGGAAAGTCA0.342700.114600.543100.500001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491GUGUCAAAUAAAGUCCAGU76.3703161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142509GTGTCAAATAAAGTCCAGTACTGGACTTTATTTGACAC0.059200.044700.586200.500001.000001.00000


Target Position: 400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
400CCUGCUGUUACCUAAUUAC73.603190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58418CCTGCTGTTACCTAATTACGTAATTAGGTAACAGCAGG0.271700.126600.663800.750001.000001.00000


Target Position: 481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
481AUUGUAUUCUGUGUCAAAU77.0164153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129499ATTGTATTCTGTGTCAAATATTTGACACAGAATACAAT0.386300.098300.500000.500001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395CUUUCCCUGCUGUUACCUA84.573661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151413CTTTCCCTGCTGTTACCTATAGGTAACAGCAGGGAAAG0.387800.243000.465500.750001.000001.00000


Target Position: 301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
301CCAUUGGACAACAGAGAGU76.0014165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151319CCATTGGACAACAGAGAGTACTCTCTGTTGTCCAATGG0.101300.001200.637900.750001.000001.00000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337GGGCACUAGGAAAAGACUU78.4448131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107355GGGCACTAGGAAAAGACTTAAGTCTTTTCCTAGTGCCC0.061800.006700.853401.000001.000001.00000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205GCUACUUCAGAAGAGUGUA89.29223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126223GCTACTTCAGAAGAGTGTATACACTCTTCTGAAGTAGC0.051200.004300.672401.000001.000001.00000


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260UCCACUGCAUCUCUCGCUG57.5253414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120278TCCACTGCATCTCTCGCTGCAGCGAGAGATGCAGTGGA0.048900.009100.586200.500000.978300.75000


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239UCUGUAACCAUGCUUUUCA75.3803172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140257TCTGTAACCATGCTTTTCATGAAAAGCATGGTTACAGA0.154100.051400.500000.500001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443UCUGCUUUGUUUUUUCAGU65.1776307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134461TCTGCTTTGTTTTTTCAGTACTGAAAAAACAAAGCAGA0.102500.023300.517200.500001.000001.00000


Target Position: 466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466UGUUUCUGUAGCCAUAUUG62.5483357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146484TGTTTCTGTAGCCATATTGCAATATGGCTACAGAAACA0.018000.005200.560300.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364AAGCUUAAUUGUUUUGUUA88.49326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116382AAGCTTAATTGTTTTGTTATAACAAAACAATTAAGCTT0.102900.014100.603400.500001.000001.00000


Target Position: 85, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
85GAAGUGAAAAAGUGGAAUG75.3624173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117103GAAGTGAAAAAGTGGAATGCATTCCACTTTTTCACTTC0.078200.041500.517200.500001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246CCAUGCUUUUCACUUCCAC69.0658261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
106264CCATGCTTTTCACTTCCACGTGGAAGTGAAAAGCATGG0.507900.141500.551700.750001.000001.00000


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234GGGAGUCUGUAACCAUGCU83.45770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128252GGGAGTCTGTAACCATGCTAGCATGGTTACAGACTCCC0.119300.004100.637900.750000.994600.62500


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493GUCAAAUAAAGUCCAGUUG66.2173291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145511GTCAAATAAAGTCCAGTTGCAACTGGACTTTATTTGAC0.019400.015700.672400.500001.000001.00000


Target Position: 80, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
80GCUUUGAAGUGAAAAAGUG77.3215149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10198GCTTTGAAGTGAAAAAGTGCACTTTTTCACTTCAAAGC0.211100.060700.560300.750001.000001.00000


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355UCUUCCAUCAAGCUUAAUU68.5705270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92373TCTTCCATCAAGCTTAATTAATTAAGCTTGATGGAAGA0.086300.024800.715500.750000.994600.62500


Target Position: 379, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379GUUAUUCAUUUAAUGACUU81.988486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123397GTTATTCATTTAATGACTTAAGTCATTAAATGAATAAC0.067300.030600.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
377-399TTGTTATTCATTTAATGACTTTCAAGUCAUUAAAUGAAUAACAAGUUAUUCAUUUAAUGACUUUCU19.28.901


Target Position: 242, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GUAACCAUGCUUUUCACUU77.4199148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109260GTAACCATGCTTTTCACTTAAGTGAAAAGCATGGTTAC0.615000.093100.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
240-262CTGTAACCATGCTTTTCACTTCCAAGUGAAAAGCAUGGUUACAGGUAACCAUGCUUUUCACUUCCU19.220.002


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431ACUGUGUUUUUUUCUGCUU71.3233225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98449ACTGTGTTTTTTTCTGCTTAAGCAGAAAAAAACACAGT0.207800.048600.569000.750001.000001.00000