Input target sequence

Length: 4872
TATTCAGATATTCTCCAGATTCCTAAAGATTAGAGATCATTTCTCATTCTCCTAGGAGTACTCACTTCAGGAAGCAACCAGATAAAAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCGCAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGCCGGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGGGCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCTCTCTTTGCCACAGGAAGCCTGAGCTCATTCGAGTAGCGGCTCTTCCAAGCTCAAAGAAGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAGTCGGAGTATCTTCTTCCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTCGGAATGGATCTTGAAGGGGACCGCAATGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAACAATAAAAGTGAAAAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTCAATGTTTCGCTATTCAAATTGGCTTGACAAGTTGTATATGGTGGTGGGAACTTTGGCTGCCATCATCCATGGGGCTGGACTTCCTCTCATGATGCTGGTGTTTGGAGAAATGACAGATATCTTTGCAAATGCAGGAAATTTAGAAGATCTGATGTCAAACATCACTAATAGAAGTGATATCAATGATACAGGGTTCTTCATGAATCTGGAGGAAGACATGACCAGGTATGCCTATTATTACAGTGGAATTGGTGCTGGGGTGCTGGTTGCTGCTTACATTCAGGTTTCATTTTGGTGCCTGGCAGCTGGAAGACAAATACACAAAATTAGAAAACAGTTTTTTCATGCTATAATGCGACAGGAGATAGGCTGGTTTGATGTGCACGATGTTGGGGAGCTTAACACCCGACTTACAGATGATGTCTCCAAGATTAATGAAGGAATTGGTGACAAAATTGGAATGTTCTTTCAGTCAATGGCAACATTTTTCACTGGGTTTATAGTAGGATTTACACGTGGTTGGAAGCTAACCCTTGTGATTTTGGCCATCAGTCCTGTTCTTGGACTGTCAGCTGCTGTCTGGGCAAAGATACTATCTTCATTTACTGATAAAGAACTCTTAGCGTATGCAAAAGCTGGAGCAGTAGCTGAAGAGGTCTTGGCAGCAATTAGAACTGTGATTGCATTTGGAGGACAAAAGAAAGAACTTGAAAGGTACAACAAAAATTTAGAAGAAGCTAAAAGAATTGGGATAAAGAAAGCTATTACAGCCAATATTTCTATAGGTGCTGCTTTCCTGCTGATCTATGCATCTTATGCTCTGGCCTTCTGGTATGGGACCACCTTGGTCCTCTCAGGGGAATATTCTATTGGACAAGTACTCACTGTATTCTTTTCTGTATTAATTGGGGCTTTTAGTGTTGGACAGGCATCTCCAAGCATTGAAGCATTTGCAAATGCAAGAGGAGCAGCTTATGAAATCTTCAAGATAATTGATAATAAGCCAAGTATTGACAGCTATTCGAAGAGTGGGCACAAACCAGATAATATTAAGGGAAATTTGGAATTCAGAAATGTTCACTTCAGTTACCCATCTCGAAAAGAAGTTAAGATCTTGAAGGGTCTGAACCTGAAGGTGCAGAGTGGGCAGACGGTGGCCCTGGTTGGAAACAGTGGCTGTGGGAAGAGCACAACAGTCCAGCTGATGCAGAGGCTCTATGACCCCACAGAGGGGATGGTCAGTGTTGATGGACAGGATATTAGGACCATAAATGTAAGGTTTCTACGGGAAATCATTGGTGTGGTGAGTCAGGAACCTGTATTGTTTGCCACCACGATAGCTGAAAACATTCGCTATGGCCGTGAAAATGTCACCATGGATGAGATTGAGAAAGCTGTCAAGGAAGCCAATGCCTATGACTTTATCATGAAACTGCCTCATAAATTTGACACCCTGGTTGGAGAGAGAGGGGCCCAGTTGAGTGGTGGGCAGAAGCAGAGGATCGCCATTGCACGTGCCCTGGTTCGCAACCCCAAGATCCTCCTGCTGGATGAGGCCACGTCAGCCTTGGACACAGAAAGCGAAGCAGTGGTTCAGGTGGCTCTGGATAAGGCCAGAAAAGGTCGGACCACCATTGTGATAGCTCATCGTTTGTCTACAGTTCGTAATGCTGACGTCATCGCTGGTTTCGATGATGGAGTCATTGTGGAGAAAGGAAATCATGATGAACTCATGAAAGAGAAAGGCATTTACTTCAAACTTGTCACAATGCAGACAGCAGGAAATGAAGTTGAATTAGAAAATGCAGCTGATGAATCCAAAAGTGAAATTGATGCCTTGGAAATGTCTTCAAATGATTCAAGATCCAGTCTAATAAGAAAAAGATCAACTCGTAGGAGTGTCCGTGGATCACAAGCCCAAGACAGAAAGCTTAGTACCAAAGAGGCTCTGGATGAAAGTATACCTCCAGTTTCCTTTTGGAGGATTATGAAGCTAAATTTAACTGAATGGCCTTATTTTGTTGTTGGTGTATTTTGTGCCATTATAAATGGAGGCCTGCAACCAGCATTTGCAATAATATTTTCAAAGATTATAGGGGTTTTTACAAGAATTGATGATCCTGAAACAAAACGACAGAATAGTAACTTGTTTTCACTATTGTTTCTAGCCCTTGGAATTATTTCTTTTATTACATTTTTCCTTCAGGGTTTCACATTTGGCAAAGCTGGAGAGATCCTCACCAAGCGGCTCCGATACATGGTTTTCCGATCCATGCTCAGACAGGATGTGAGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTACCAGGCTCGCCAATGATGCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCAAATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTCTTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAGCACTGAAAGATAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATAGAAAACTTCCGAACCGTTGTTTCTTTGACTCAGGAGCAGAAGTTTGAACATATGTATGCTCAGAGTTTGCAGGTACCATACAGAAACTCTTTGAGGAAAGCACACATCTTTGGAATTACATTTTCCTTCACCCAGGCAATGATGTATTTTTCCTATGCTGGATGTTTCCGGTTTGGAGCCTACTTGGTGGCACATAAACTCATGAGCTTTGAGGATGTTCTGTTAGTATTTTCAGCTGTTGTCTTTGGTGCCATGGCCGTGGGGCAAGTCAGTTCATTTGCTCCTGACTATGCCAAAGCCAAAATATCAGCAGCCCACATCATCATGATCATTGAAAAAACCCCTTTGATTGACAGCTACAGCACGGAAGGCCTAATGCCGAACACATTGGAAGGAAATGTCACATTTGGTGAAGTTGTATTCAACTATCCCACCCGACCGGACATCCCAGTGCTTCAGGGACTGAGCCTGGAGGTGAAGAAGGGCCAGACGCTGGCTCTGGTGGGCAGCAGTGGCTGTGGGAAGAGCACAGTGGTCCAGCTCCTGGAGCGGTTCTACGACCCCTTGGCAGGGAAAGTGCTGCTTGATGGCAAAGAAATAAAGCGACTGAATGTTCAGTGGCTCCGAGCACACCTGGGCATCGTGTCCCAGGAGCCCATCCTGTTTGACTGCAGCATTGCTGAGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCACAGGAAGAGATTGTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTGCCTAATAAATATAGCACTAAAGTAGGAGACAAAGGAACTCAGCTCTCTGGTGGCCAGAAACAACGCATTGCCATAGCTCGTGCCCTTGTTAGACAGCCTCATATTTTGCTTTTGGATGAAGCCACGTCAGCTCTGGATACAGAAAGTGAAAAGGTTGTCCAAGAAGCCCTGGACAAAGCCAGAGAAGGCCGCACCTGCATTGTGATTGCTCACCGCCTGTCCACCATCCAGAATGCAGACTTAATAGTGGTGTTTCAGAATGGCAGAGTCAAGGAGCATGGCACGCATCAGCAGCTGCTGGCACAGAAAGGCATCTATTTTTCAATGGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGAACTCTGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGATATGACATTTATTCAAAGTTAAAAGCAAACACTTACAGAATTATGAAGAGGTATCTGTTTAACATTTCCTCAGTCAAGTTCAGAGTCTTCAGAGACTTCGTAATTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAATCATAGTTTAAACTGCATTATAAATTTTATAACAGAATTAAAGTAGATTTTAAAAGATAAAATGTGTAATTTTGTTTATATTTTCCCATTTGGACTGTAACTGACTGCCTTGCTAAAAGATTATAGAAGTAGCAAAAAGTATTGAAATGTTTGCATAAAGTGTCTATAATAAAACTAAACTTTCATGTGACTGGAGTCATCTTGTCCAAACTGCCTGTGAATATATCTTCTCTCAATTGGAATATTGTAGATAACTTCTGCTTTAAAAAAGTTTTCTTTAAATATACCTACTCATTTTTGTGGGAATGGTTAAGCAGTTTAAATAATTCCTGTTGTATATGTCTATTCACATTGGGTCTTACAGAACCATCTGGCTTCATTCTTCTTGGACTTGATCCTGCTGATTCTTGCATTTCCACAT