siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 18   23   28   132   362   449   450   454   463   478   531   628   635   636   643   657   677   682   685   696  
804   845   851   853   958   961   968   982   1027   1115   1116   1120   1128   1131   1215   1224   1235   1246   1249   1282  
1292   1333   1404   1406   1470   1471   1475   1500   1502   1503   1539   1585   1586   1587   1629   1786   1795   1809   1957   2137  
2255   2277   2310   2313   2368   2377   2402   2505   2521   2561   2604   2620   2664   2666   2668   2680   2692   2715   2891   2919  
2929   2952   2974   2984   2995   3024   3035   3038   3066   3070   3108   3197   3226   3257   3258   3492   3523   3525   3531   3999  
4203   4271   4275   4277   4280   4467   4494   4515   4560   4564   4584   4590   4615   4681   4685   4690   4722   4786   4851  
Biltr, Rnaxs, Sidirect 360   473   475   520   840   866   928   947   980   1001   1025   1054   1124   1214   1226   1238   1241   1245   1280   1414  
1416   1418   1513   1564   1602   1626   1628   1810   1864   2342   2371   2372   2398   2512   2514   2515   2595   2597   2603   2628  
2629   2654   2658   2673   2677   2702   2705   2826   2991   3033   3158   3160   3194   3224   3335   3502   3703   3989   4129   4267  
4269   4301   4306   4311   4313   4332   4333   4444   4457   4464   4484   4486   4517   4537   4563   4570   4580   4583   4604   4605  
4611   4657   4701   4711   4712   4755   4759   4760  
Biltr, Rnaxs 68   69   70   73   91   92   95   96   148   150   151   321   322   359   431   437   438   442   443   444  
474   487   488   493   494   501   502   511   512   515   516   519   521   551   552   623   624   655   656   661  
662   686   701   711   828   829   830   831   832   833   835   836   837   838   839   841   842   843   852   865  
892   893   899   900   901   945   946   948   949   975   1000   1002   1012   1013   1014   1023   1053   1056   1057   1130  
1186   1187   1219   1220   1222   1223   1230   1237   1240   1260   1261   1267   1268   1269   1279   1281   1319   1320   1321   1388  
1389   1390   1391   1415   1417   1493   1507   1512   1515   1525   1526   1535   1563   1565   1566   1571   1572   1593   1594   1600  
1601   1614   1615   1621   1622   1623   1731   1732   1773   1774   1775   1839   1840   1894   1904   1905   1906   1943   1944   1945  
1959   1960   2057   2107   2231   2232   2233   2262   2263   2265   2270   2271   2272   2275   2301   2335   2336   2339   2341   2344  
2348   2370   2393   2394   2395   2396   2397   2400   2454   2455   2474   2475   2476   2513   2535   2536   2542   2543   2591   2592  
2593   2594   2596   2618   2625   2626   2627   2644   2652   2653   2676   2699   2700   2701   2704   2730   2737   2768   2769   2771  
2772   2776   2777   2778   2825   2948   2954   2978   2986   3000   3031   3032   3034   3037   3055   3058   3059   3060   3129   3135  
3156   3157   3159   3189   3190   3191   3192   3193   3213   3214   3220   3221   3225   3251   3252   3253   3254   3255   3301   3306  
3307   3332   3333   3334   3407   3408   3409   3413   3429   3432   3433   3434   3435   3436   3437   3441   3442   3443   3450   3462  
3463   3464   3472   3499   3500   3501   3510   3511   3701   3702   3704   3705   3706   3861   3862   3863   3872   3873   3883   3884  
3888   3889   3891   3892   3893   3894   3895   3896   3901   3902   3903   3984   3985   3986   3988   3997   4034   4035   4036   4122  
4128   4199   4257   4268   4299   4300   4305   4310   4312   4324   4331   4336   4356   4357   4369   4394   4395   4396   4397   4401  
4402   4405   4433   4434   4437   4438   4441   4442   4443   4445   4446   4456   4462   4463   4465   4471   4482   4483   4485   4516  
4524   4535   4536   4544   4545   4569   4576   4581   4600   4603   4606   4610   4612   4655   4656   4658   4662   4663   4664   4665  
4666   4668   4669   4670   4676   4677   4678   4679   4700   4702   4708   4715   4753   4754   4758   4779   4780   4817   4818  


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501AGGAAAAGAAACCAACUGU74.57692051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851519AGGAAAAGAAACCAACTGTACAGTTGGTTTCTTTTCCT0.077800.021900.637900.500000.967400.75000


Target Position: 4668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4668GUGAAUAUAUCUUCUCUCA94.5444133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8744686GTGAATATATCTTCTCTCATGAGAGAAGATATATTCAC0.169100.062500.569000.500000.967400.75000


Target Position: 2371, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371GGAAAUGUCUUCAAAUGAU93.8737156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952389GGAAATGTCTTCAAATGATATCATTTGAAGACATTTCC0.234500.039900.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2369-2391TTGGAAATGTCTTCAAATGATTCAUCAUUUGAAGACAUUUCCAAGGAAAUGUCUUCAAAUGAUUCU13.814.822


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839GUCAGGAACCUGUAUUGUU84.8024768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031857GTCAGGAACCTGTATTGTTAACAATACAGGTTCCTGAC0.087800.014700.672400.750000.934800.75000


Target Position: 2664, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664GACAGAAUAGUAACUUGUU89.5274402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2662-2684ACGACAGAATAGTAACTTGTTTTAACAAGUUACUAUUCUGUCGUGACAGAAUAGUAACUUGUUUUU17.819.232


Target Position: 4305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4305AGAUAUGACAUUUAUUCAA92.8588199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8374323AGATATGACATTTATTCAATTGAATAAATGTCATATCT0.146000.042500.577600.750001.000001.00000


Target Position: 4584, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4584CAAAAAGUAUUGAAAUGUU89.8707378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4582-4604AGCAAAAAGTATTGAAATGTTTGAACAUUUCAAUACUUUUUGCUCAAAAAGUAUUGAAAUGUUUGU14.83.222


Target Position: 2627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627GGGGUUUUUACAAGAAUUG68.93962823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722645GGGGTTTTTACAAGAATTGCAATTCTTGTAAAAACCCC0.167300.014300.844800.750001.000001.00000


Target Position: 2231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2231GUCAUUGUGGAGAAAGGAA87.4201550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5612249GTCATTGTGGAGAAAGGAATTCCTTTCTCCACAATGAC0.765200.024800.646600.750001.000001.00000


Target Position: 845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CAAAUACACAAAAUUAGAA95.0652117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
843-865GACAAATACACAAAATTAGAAAAUUCUAAUUUUGUGUAUUUGUCCAAAUACACAAAAUUAGAAAAU6.96.921


Target Position: 531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CAAUGUUUCGCUAUUCAAA95.183112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
529-551TTCAATGTTTCGCTATTCAAATTUUUGAAUAGCGAAACAUUGAACAAUGUUUCGCUAUUCAAAUUU8.95.333


Target Position: 4563, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4563GCUAAAAGAUUAUAGAAGU86.9078591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6924581GCTAAAAGATTATAGAAGTACTTCTATAATCTTTTAGC0.112700.051000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4561-4583TTGCTAAAAGATTATAGAAGTAGACUUCUAUAAUCUUUUAGCAAGCUAAAAGAUUAUAGAAGUAGU11.61.322


Target Position: 4711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4711GCUUUAAAAAAGUUUUCUU82.9269976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4854729GCTTTAAAAAAGTTTTCTTAAGAAAACTTTTTTAAAGC0.182500.083800.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4709-4731CTGCTTTAAAAAAGTTTTCTTTAAAGAAAACUUUUUUAAAGCAGGCUUUAAAAAAGUUUUCUUUAU13.3-3.822


Target Position: 980, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980GACAAAAUUGGAAUGUUCU82.64771014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958998GACAAAATTGGAATGTTCTAGAACATTCCAATTTTGTC0.061600.013900.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
978-1000GTGACAAAATTGGAATGTTCTTTAGAACAUUCCAAUUUUGUCACGACAAAAUUGGAAUGUUCUUUU14.85.322


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830CUGGCAGCUGGAAGACAAA87.2985560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
723848CTGGCAGCTGGAAGACAAATTTGTCTTCCAGCTGCCAG0.547800.036300.784500.750001.000001.00000


Target Position: 4581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4581UAGCAAAAAGUAUUGAAAU77.7161635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8014599TAGCAAAAAGTATTGAAATATTTCAATACTTTTTGCTA0.363000.048600.663800.500001.000001.00000


Target Position: 968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968GAAGGAAUUGGUGACAAAA94.7781125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
966-988ATGAAGGAATTGGTGACAAAATTUUUUGUCACCAAUUCCUUCAUGAAGGAAUUGGUGACAAAAUUU20.518.712


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944CCUAUGACUUUAUCAUGAA96.223586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031962CCTATGACTTTATCATGAATTCATGATAAAGTCATAGG0.296800.029600.672401.000000.923900.75000


Target Position: 3160, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160GAAGUUUGAACAUAUGUAU90.0777360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923178GAAGTTTGAACATATGTATATACATATGTTCAAACTTC0.157200.041900.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3158-3180CAGAAGTTTGAACATATGTATGCAUACAUAUGUUCAAACUUCUGGAAGUUUGAACAUAUGUAUGCU8.210.332


Target Position: 4535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4535UCCCAUUUGGACUGUAACU64.96743350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8364553TCCCATTTGGACTGTAACTAGTTACAGTCCAAATGGGA0.138300.014900.663800.500000.940200.62500


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945CUAUGACUUUAUCAUGAAA98.860435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301963CTATGACTTTATCATGAAATTTCATGATAAAGTCATAG0.307600.039600.672400.750000.923900.75000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960GAAACUGCCUCAUAAAUUU89.7975382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791978GAAACTGCCTCATAAATTTAAATTTATGAGGCAGTTTC0.116900.052700.672400.750001.000001.00000


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623AUGCUGGUGUUUGGAGAAA73.30862228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911641ATGCTGGTGTTTGGAGAAATTTCTCCAAACACCAGCAT0.068100.013000.655200.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892GGAGAUAGGCUGGUUUGAU86.9488588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929910GGAGATAGGCTGGTTTGATATCAAACCAGCCTATCTCC0.096300.009600.689701.000001.000001.00000


Target Position: 2777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2777CGGCUCCGAUACAUGGUUU79.72241369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902795CGGCTCCGATACATGGTTTAAACCATGTATCGGAGCCG0.070700.020700.913801.000001.000001.00000


Target Position: 3197, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197CCAUACAGAAACUCUUUGA85.68692

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3195-3217TACCATACAGAAACTCTTTGAGGUCAAAGAGUUUCUGUAUGGUACCAUACAGAAACUCUUUGAGGU16.617.922


Target Position: 3531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3531GUGAAGUUGUAUUCAACUA93.0895184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3529-3551TGGTGAAGTTGTATTCAACTATCUAGUUGAAUACAACUUCACCAGUGAAGUUGUAUUCAACUAUCU19.219.232


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056AGCUAACCCUUGUGAUUUU81.50141146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381074AGCTAACCCTTGTGATTTTAAAATCACAAGGGTTAGCT0.192700.055100.853400.750001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054GAAGCUAACCCUUGUGAUU85.9598658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771072GAAGCTAACCCTTGTGATTAATCACAAGGGTTAGCTTC0.210300.036000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1052-1074TGGAAGCTAACCCTTGTGATTTTAAUCACAAGGGUUAGCUUCCAGAAGCUAACCCUUGUGAUUUUU20.518.313


Target Position: 4465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4465UGCAUUAUAAAUUUUAUAA83.7753878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4084483TGCATTATAAATTTTATAATTATAAAATTTATAATGCA0.201300.044200.819000.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240UGAAAGGUACAACAAAAAU75.95391868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741258TGAAAGGTACAACAAAAATATTTTTGTTGTACCTTTCA0.349300.127900.715500.750001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68CAGGAAGCAACCAGAUAAA91.9365249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65386CAGGAAGCAACCAGATAAATTTATCTGGTTGCTTCCTG0.127300.040500.784500.750000.962000.75000


Target Position: 1471, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471CAUUGAAGCAUUUGCAAAU86.3224629

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1469-1491AGCATTGAAGCATTTGCAAATGCAUUUGCAAAUGCUUCAAUGCUCAUUGAAGCAUUUGCAAAUGCU20.012.021


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193GGUACCAUACAGAAACUCU88.677455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313211GGTACCATACAGAAACTCTAGAGTTTCTGTATGGTACC0.081800.015800.629300.750001.000001.00000


Target Position: 677, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAUCUGAUGUCAAACAUCA98.942634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
675-697AAGATCTGATGTCAAACATCACTUGAUGUUUGACAUCAGAUCUUGAUCUGAUGUCAAACAUCACUU14.820.432


Target Position: 3889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889CAUCGAGUCACUGCCUAAU81.72381120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053907CATCGAGTCACTGCCTAATATTAGGCAGTGACTCGATG0.186400.150300.646600.750001.000001.00000


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954GGAAUAAUUAUAUCCUUCA95.0704116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792972GGAATAATTATATCCTTCATGAAGGATATAATTATTCC0.123200.040200.646600.750000.902200.62500


Target Position: 4604, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4604GCAUAAAGUGUCUAUAAUA105.5394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1354622GCATAAAGTGTCTATAATATATTATAGACACTTTATGC0.743300.118600.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4602-4624TTGCATAAAGTGTCTATAATAAAUAUUAUAGACACUUUAUGCAAGCAUAAAGUGUCUAUAAUAAAU-2.73.533


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442UGGAGGAGCAAAGAAGAAG60.81943817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915460TGGAGGAGCAAAGAAGAAGCTTCTTCTTTGCTCCTCCA0.388400.100100.706900.500001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525UGAUAAUAAGCCAAGUAUU81.96031091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391543TGATAATAAGCCAAGTATTAATACTTGGCTTATTATCA0.289000.035600.715500.750001.000001.00000


Target Position: 3108, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3108CUACUGAAGCAAUAGAAAA93.6551167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3106-3128CGCTACTGAAGCAATAGAAAACTUUUUCUAUUGCUUCAGUAGCGCUACUGAAGCAAUAGAAAACUU6.920.332


Target Position: 4464, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4464CUGCAUUAUAAAUUUUAUA89.6046393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4814482CTGCATTATAAATTTTATATATAAAATTTATAATGCAG0.201300.033900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4462-4484AACTGCATTATAAATTTTATAACUAUAAAAUUUAUAAUGCAGUUCUGCAUUAUAAAUUUUAUAACU-10.321.122


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70GGAAGCAACCAGAUAAAAG80.85881216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50588GGAAGCAACCAGATAAAAGCTTTTATCTGGTTGCTTCC0.814100.054000.732800.750001.000001.00000


Target Position: 1014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1014CAUUUUUCACUGGGUUUAU78.64471509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541032CATTTTTCACTGGGTTTATATAAACCCAGTGAAAAATG0.109600.017900.612100.750001.000001.00000


Target Position: 2702, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702CUUGGAAUUAUUUCUUUUA87.4111551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982720CTTGGAATTATTTCTTTTATAAAAGAAATAATTCCAAG0.810100.010300.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2700-2722CCCTTGGAATTATTTCTTTTATTUAAAAGAAAUAAUUCCAAGGGCUUGGAAUUAUUUCUUUUAUUU5.520.122


Target Position: 4128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4128UCCAGAAUGCAGACUUAAU77.95441605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4204146TCCAGAATGCAGACTTAATATTAAGTCTGCATTCTGGA0.273900.116100.862100.750001.000001.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700CCCUUGGAAUUAUUUCUUU79.59591387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942718CCCTTGGAATTATTTCTTTAAAGAAATAATTCCAAGGG0.551400.010400.991401.000001.000001.00000


Target Position: 3502, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3502GAACACAUUGGAAGGAAAU82.47021035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7083520GAACACATTGGAAGGAAATATTTCCTTCCAATGTGTTC0.237900.016700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3500-3522CCGAACACATTGGAAGGAAATGTAUUUCCUUCCAAUGUGUUCGGGAACACAUUGGAAGGAAAUGUU18.719.333


Target Position: 3226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226CAUCUUUGGAAUUACAUUU82.8094997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3224-3246CACATCTTTGGAATTACATTTTCAAAUGUAAUUCCAAAGAUGUGCAUCUUUGGAAUUACAUUUUCU6.912.022


Target Position: 463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463CUUUUUUAAACUGAACAAU72.87772288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
461-483AACTTTTTTAAACTGAACAATAAAUUGUUCAGUUUAAAAAAGUUCUUUUUUAAACUGAACAAUAAU20.5-9.121


Target Position: 2737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2737GGGUUUCACAUUUGGCAAA86.3718626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192755GGGTTTCACATTTGGCAAATTTGCCAAATGTGAAACCC0.085000.086300.991401.000001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237ACUUGAAAGGUACAACAAA88.8807444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611255ACTTGAAAGGTACAACAAATTTGTTGTACCTTTCAAGT0.502000.156500.706900.750001.000001.00000


Target Position: 3703, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3703GCUUGAUGGCAAAGAAAUA95.643498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1393721GCTTGATGGCAAAGAAATATATTTCTTTGCCATCAAGC0.853300.109300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3701-3723CTGCTTGATGGCAAAGAAATAAAUAUUUCUUUGCCAUCAAGCAGGCUUGAUGGCAAAGAAAUAAAU5.318.122


Target Position: 4605, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4605CAUAAAGUGUCUAUAAUAA103.337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7334623CATAAAGTGTCTATAATAATTATTATAGACACTTTATG0.742100.119300.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4603-4625TGCATAAAGTGTCTATAATAAAAUUAUUAUAGACACUUUAUGCACAUAAAGUGUCUAUAAUAAAAU-5.94.632


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002AGUCAAUGGCAACAUUUUU79.59771386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451020AGTCAATGGCAACATTTTTAAAAATGTTGCCATTGACT0.064000.016400.706900.750000.994600.87500


Target Position: 473, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473CUGAACAAUAAAAGUGAAA81.16321175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241491CTGAACAATAAAAGTGAAATTTCACTTTTATTGTTCAG0.326200.214300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
471-493AACTGAACAATAAAAGTGAAAAAUUUCACUUUUAUUGUUCAGUUCUGAACAAUAAAAGUGAAAAAU19.220.522


Target Position: 1333, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1333GAUCUAUGCAUCUUAUGCU87.1477571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1331-1353CTGATCTATGCATCTTATGCTCTAGCAUAAGAUGCAUAGAUCAGGAUCUAUGCAUCUUAUGCUCUU19.713.333


Target Position: 4467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4467CAUUAUAAAUUUUAUAACA97.672853

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4465-4487TGCATTATAAATTTTATAACAGAUGUUAUAAAAUUUAUAAUGCACAUUAUAAAUUUUAUAACAGAU1.4-8.022


Target Position: 4401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4401GACUUCGUAAUUAAAGGAA85.9318663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5844419GACTTCGTAATTAAAGGAATTCCTTTAATTACGAAGTC0.302000.033500.646600.750000.989100.62500


Target Position: 3986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3986CUUGUUAGACAGCCUCAUA91.6782264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7944004CTTGTTAGACAGCCTCATATATGAGGCTGTCTAACAAG0.249400.022100.594800.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833GCAGCUGGAAGACAAAUAC73.91832130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425851GCAGCTGGAAGACAAATACGTATTTGTCTTCCAGCTGC0.561200.064600.672400.750001.000001.00000


Target Position: 3701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3701CUGCUUGAUGGCAAAGAAA86.8915596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543719CTGCTTGATGGCAAAGAAATTTCTTTGCCATCAAGCAG0.427100.011700.784500.750000.913000.62500


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GGCUGGUUUGAUGUGCACG66.50523150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904917GGCTGGTTTGATGTGCACGCGTGCACATCAAACCAGCC0.225700.027800.724100.500001.000001.00000


Target Position: 3863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863GCAAAGGAGGCCAACAUAC70.50942626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5833881GCAAAGGAGGCCAACATACGTATGTTGGCCTCCTTTGC0.588400.050900.672400.750001.000001.00000


Target Position: 840, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
840GAAGACAAAUACACAAAAU92.3271221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502858GAAGACAAATACACAAAATATTTTGTGTATTTGTCTTC0.833900.483800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
838-860TGGAAGACAAATACACAAAATTAAUUUUGUGUAUUUGUCUUCCAGAAGACAAAUACACAAAAUUAU12.219.222


Target Position: 635, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635GGAGAAAUGACAGAUAUCU85.5354707

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
633-655TTGGAGAAATGACAGATATCTTTAGAUAUCUGUCAUUUCUCCAAGGAGAAAUGACAGAUAUCUUUU15.914.812


Target Position: 4759, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4759GGUUAAGCAGUUUAAAUAA99.269832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4114777GGTTAAGCAGTTTAAATAATTATTTAAACTGCTTAACC0.454800.038600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4757-4779ATGGTTAAGCAGTTTAAATAATTUUAUUUAAACUGCUUAACCAUGGUUAAGCAGUUUAAAUAAUUU-7.520.922


Target Position: 2705, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2705GGAAUUAUUUCUUUUAUUA100.25126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1212723GGAATTATTTCTTTTATTATAATAAAAGAAATAATTCC0.837600.108500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2703-2725TTGGAATTATTTCTTTTATTACAUAAUAAAAGAAAUAAUUCCAAGGAAUUAUUUCUUUUAUUACAU-9.71.811


Target Position: 4754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4754GGAAUGGUUAAGCAGUUUA90.9512308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4264772GGAATGGTTAAGCAGTTTATAAACTGCTTAACCATTCC0.223400.036600.836201.000001.000001.00000


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037UGUUGAAAUGAAAAUGUUG70.3942646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833055TGTTGAAATGAAAATGTTGCAACATTTTCATTTCAACA0.144600.029400.560300.500001.000001.00000


Target Position: 2301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301UGCAGACAGCAGGAAAUGA77.81311620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612319TGCAGACAGCAGGAAATGATCATTTCCTGCTGTCTGCA0.164100.023400.629300.500000.918500.62500


Target Position: 696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696CUAAUAGAAGUGAUAUCAA97.202860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
694-716CACTAATAGAAGTGATATCAATGUUGAUAUCACUUCUAUUAGUGCUAAUAGAAGUGAUAUCAAUGU17.48.432


Target Position: 4786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4786GUAUAUGUCUAUUCACAUU92.9819193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4784-4806TTGTATATGTCTATTCACATTGGAAUGUGAAUAGACAUAUACAAGUAUAUGUCUAUUCACAUUGGU20.58.212


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625UAGGGGUUUUUACAAGAAU73.66452171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9072643TAGGGGTTTTTACAAGAATATTCTTGTAAAAACCCCTA0.199900.010000.663800.500001.000001.00000


Target Position: 3437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3437CACAUCAUCAUGAUCAUUG73.82072145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783455CACATCATCATGATCATTGCAATGATCATGATGATGTG0.084500.055700.646600.500000.978300.87500


Target Position: 3334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3334GGAUGUUCUGUUAGUAUUU89.9507372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753352GGATGTTCTGTTAGTATTTAAATACTAACAGAACATCC0.150000.026400.870701.000001.000001.00000


Target Position: 1282, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282GAUAAAGAAAGCUAUUACA96.006591

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1280-1302GGGATAAAGAAAGCTATTACAGCUGUAAUAGCUUUCUUUAUCCCGAUAAAGAAAGCUAUUACAGCU6.36.932


Target Position: 4444, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4444GAGAGAAAUCAUAGUUUAA103.3416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5404462GAGAGAAATCATAGTTTAATTAAACTATGATTTCTCTC0.184200.101100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4442-4464TGGAGAGAAATCATAGTTTAAACUUAAACUAUGAUUUCUCUCCAGAGAGAAAUCAUAGUUUAAACU6.619.122


Target Position: 2692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692GUUUCUAGCCCUUGGAAUU79.45421404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2690-2712TTGTTTCTAGCCCTTGGAATTATAAUUCCAAGGGCUAGAAACAAGUUUCUAGCCCUUGGAAUUAUU20.111.732


Target Position: 1116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116CAAAGAUACUAUCUUCAUU94.308143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1114-1136GGCAAAGATACTATCTTCATTTAAAUGAAGAUAGUAUCUUUGCCCAAAGAUACUAUCUUCAUUUAU20.46.923


Target Position: 362, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362GUAUCUUCUUCCAAAAUUU88.5129468

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
360-382GAGTATCTTCTTCCAAAATTTCAAAAUUUUGGAAGAAGAUACUCGUAUCUUCUUCCAAAAUUUCAU-3.316.022


Target Position: 359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359GGAGUAUCUUCUUCCAAAA100.17227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313377GGAGTATCTTCTTCCAAAATTTTGGAAGAAGATACTCC0.239400.066500.870701.000001.000001.00000


Target Position: 4600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4600GUUUGCAUAAAGUGUCUAU84.202835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8034618GTTTGCATAAAGTGTCTATATAGACACTTTATGCAAAC0.185800.013500.603400.750001.000001.00000


Target Position: 2668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2668GAAUAGUAACUUGUUUUCA90.0709363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2666-2688CAGAATAGTAACTTGTTTTCACTUGAAAACAAGUUACUAUUCUGGAAUAGUAACUUGUUUUCACUU14.96.312


Target Position: 4445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4445AGAGAAAUCAUAGUUUAAA88.9645436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3384463AGAGAAATCATAGTTTAAATTTAAACTATGATTTCTCT0.230900.106300.724100.750001.000001.00000


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614UCAGUUACCCAUCUCGAAA79.53281395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941632TCAGTTACCCATCTCGAAATTTCGAGATGGGTAACTGA0.251600.057400.724100.750001.000001.00000


Target Position: 4034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4034CUGGAUACAGAAAGUGAAA88.3595482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5004052CTGGATACAGAAAGTGAAATTTCACTTTCTGTATCCAG0.324100.029700.784500.750001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224CACAUCUUUGGAAUUACAU79.77221365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393242CACATCTTTGGAATTACATATGTAATTCCAAAGATGTG0.064400.030100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3222-3244CACACATCTTTGGAATTACATTTAUGUAAUUCCAAAGAUGUGUGCACAUCUUUGGAAUUACAUUUU6.919.222


Target Position: 1810, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810GUUUCUACGGGAAAUCAUU81.54861141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521828GTTTCTACGGGAAATCATTAATGATTTCCCGTAGAAAC0.095900.008700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1808-1830AGGTTTCTACGGGAAATCATTGGAAUGAUUUCCCGUAGAAACCUGUUUCUACGGGAAAUCAUUGGU7.214.632


Target Position: 2313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313GAAAUGAAGUUGAAUUAGA94.3149141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2311-2333AGGAAATGAAGTTGAATTAGAAAUCUAAUUCAACUUCAUUUCCUGAAAUGAAGUUGAAUUAGAAAU6.97.422


Target Position: 4122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4122CCACCAUCCAGAAUGCAGA84.7089782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7284140CCACCATCCAGAATGCAGATCTGCATTCTGGATGGTGG0.183800.016800.620700.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CAUGGAUGAGAUUGAGAAA98.842336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351924CATGGATGAGATTGAGAAATTTCTCAATCTCATCCATG0.159000.015600.655200.750001.000001.00000


Target Position: 2929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929CCAGAAUAUAGCAAAUCUU86.9627587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2927-2949ACCCAGAATATAGCAAATCTTGGAAGAUUUGCUAUAUUCUGGGUCCAGAAUAUAGCAAAUCUUGGU12.013.422


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772CCAAGCGGCUCCGAUACAU74.93382006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992790CCAAGCGGCTCCGATACATATGTATCGGAGCCGCTTGG0.069500.010700.689701.000001.000001.00000


Target Position: 2310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310CAGGAAAUGAAGUUGAAUU86.2012635

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2308-2330AGCAGGAAATGAAGTTGAATTAGAAUUCAACUUCAUUUCCUGCUCAGGAAAUGAAGUUGAAUUAGU14.818.722


Target Position: 3135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3135CCGUUGUUUCUUUGACUCA84.662786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703153CCGTTGTTTCTTTGACTCATGAGTCAAAGAAACAACGG0.074000.014600.689700.750001.000001.00000


Target Position: 2543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543CCUUAUUUUGUUGUUGGUG62.24893646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472561CCTTATTTTGTTGTTGGTGCACCAACAACAAAATAAGG0.072700.047500.551700.750001.000001.00000


Target Position: 3901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3901GCCUAAUAAAUAUAGCACU82.70321010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4903919GCCTAATAAATATAGCACTAGTGCTATATTTATTAGGC0.502300.415100.793100.750001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946AGAUGAUGUCUCCAAGAUU89.5614397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649964AGATGATGTCTCCAAGATTAATCTTGGAGACATCATCT0.175700.021800.715500.750001.000001.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265UGAAAGAGAAAGGCAUUUA79.23731435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962283TGAAAGAGAAAGGCATTTATAAATGCCTTTCTCTTTCA0.188200.134500.689700.750001.000001.00000


Target Position: 487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487UGAAAAAGAUAAGAAGGAA87.0265581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917505TGAAAAAGATAAGAAGGAATTCCTTCTTATCTTTTTCA0.177100.048800.551700.750001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686UCAAACAUCACUAAUAGAA79.69491374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929704TCAAACATCACTAATAGAATTCTATTAGTGATGTTTGA0.104500.023800.551700.750001.000001.00000


Target Position: 3159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3159AGAAGUUUGAACAUAUGUA92.9512195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543177AGAAGTTTGAACATATGTATACATATGTTCAAACTTCT0.258200.113000.543100.750001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219UGGAGGACAAAAGAAAGAA78.42681544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541237TGGAGGACAAAAGAAAGAATTCTTTCTTTTGTCCTCCA0.342700.018900.672400.750001.000001.00000


Target Position: 4677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4677UCUUCUCUCAAUUGGAAUA78.9331473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9104695TCTTCTCTCAATTGGAATATATTCCAATTGAGAGAAGA0.068200.027400.681000.750001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841AAGACAAAUACACAAAAUU79.36111416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982859AAGACAAATACACAAAATTAATTTTGTGTATTTGTCTT0.843300.503400.629300.500001.000001.00000


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190GCAGGUACCAUACAGAAAC72.87952286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333208GCAGGTACCATACAGAAACGTTTCTGTATGGTACCTGC0.103200.032700.706900.750001.000001.00000


Target Position: 4516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4516UGUAAUUUUGUUUAUAUUU73.97232117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8724534TGTAATTTTGTTTATATTTAAATATAAACAAAATTACA0.073900.013700.706900.750001.000001.00000


Target Position: 3704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3704CUUGAUGGCAAAGAAAUAA82.9963967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693722CTTGATGGCAAAGAAATAATTATTTCTTTGCCATCAAG0.842500.181000.603400.750001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221GCACACAUCUUUGGAAUUA86.8247601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833239GCACACATCTTTGGAATTATAATTCCAAAGATGTGTGC0.057000.057500.819001.000001.000001.00000


Target Position: 928, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928GCUUAACACCCGACUUACA91.333281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635946GCTTAACACCCGACTTACATGTAAGTCGGGTGTTAAGC0.132300.044100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
926-948GAGCTTAACACCCGACTTACAGAUGUAAGUCGGGUGUUAAGCUCGCUUAACACCCGACUUACAGAU21.411.834


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GGAAUUCAGAAAUGUUCAC72.4672349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201612GGAATTCAGAAATGTTCACGTGAACATTTCTGAATTCC0.143900.086000.577600.750001.000001.00000


Target Position: 2629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GGUUUUUACAAGAAUUGAU88.6188458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072647GGTTTTTACAAGAATTGATATCAATTCTTGTAAAAACC0.173200.029900.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2627-2649GGGGTTTTTACAAGAATTGATGAAUCAAUUCUUGUAAAAACCCCGGUUUUUACAAGAAUUGAUGAU16.30.033


Target Position: 2372, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372GAAAUGUCUUCAAAUGAUU87.7079528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432390GAAATGTCTTCAAATGATTAATCATTTGAAGACATTTC0.257000.043600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2370-2392TGGAAATGTCTTCAAATGATTCAAAUCAUUUGAAGACAUUUCCAGAAAUGUCUUCAAAUGAUUCAU7.214.822


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186GGUCUUGGCAGCAAUUAGA88.2262489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171204GGTCTTGGCAGCAATTAGATCTAATTGCTGCCAAGACC0.067300.011800.629300.750001.000001.00000


Target Position: 3891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3891UCGAGUCACUGCCUAAUAA86.8334600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3893909TCGAGTCACTGCCTAATAATTATTAGGCAGTGACTCGA0.207000.133900.758600.750001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CUGGGUUUAUAGUAGGAUU85.3361726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441041CTGGGTTTATAGTAGGATTAATCCTACTATAAACCCAG0.079700.018400.775900.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CAGUCAAUGGCAACAUUUU86.3761625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561019CAGTCAATGGCAACATTTTAAAATGTTGCCATTGACTG0.076400.014500.784500.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
999-1021TTCAGTCAATGGCAACATTTTTCAAAAUGUUGCCAUUGACUGAACAGUCAAUGGCAACAUUUUUCU5.319.223


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GGCAGCUGGAAGACAAAUA88.9811433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
257850GGCAGCTGGAAGACAAATATATTTGTCTTCCAGCTGCC0.567200.058000.956901.000001.000001.00000


Target Position: 4310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4310UGACAUUUAUUCAAAGUUA89.7624384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124328TGACATTTATTCAAAGTTATAACTTTGAATAAATGTCA0.086400.033400.689700.750001.000001.00000


Target Position: 4611, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4611GUGUCUAUAAUAAAACUAA97.531857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4384629GTGTCTATAATAAAACTAATTAGTTTTATTATAGACAC0.702900.579700.758600.750000.940200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4609-4631AAGTGTCTATAATAAAACTAAACUUAGUUUUAUUAUAGACACUUGUGUCUAUAAUAAAACUAAACU4.920.322


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332GAGGAUGUUCUGUUAGUAU93.742162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063350GAGGATGTTCTGTTAGTATATACTAACAGAACATCCTC0.109200.021800.767200.750001.000001.00000


Target Position: 4515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4515GUGUAAUUUUGUUUAUAUU90.0388367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4513-4535ATGTGTAATTTTGTTTATATTTTAAUAUAAACAAAAUUACACAUGUGUAAUUUUGUUUAUAUUUUU-8.06.922


Target Position: 1131, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131CAUUUACUGAUAAAGAACU82.0451082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1129-1151TTCATTTACTGATAAAGAACTCTAGUUCUUUAUCAGUAAAUGAACAUUUACUGAUAAAGAACUCUU13.34.622


Target Position: 3335, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3335GAUGUUCUGUUAGUAUUUU84.7164780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5703353GATGTTCTGTTAGTATTTTAAAATACTAACAGAACATC0.153800.027800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3333-3355AGGATGTTCTGTTAGTATTTTCAAAAAUACUAACAGAACAUCCUGAUGUUCUGUUAGUAUUUUCAU4.619.222


Target Position: 1809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809GGUUUCUACGGGAAAUCAU84.3271817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1807-1829AAGGTTTCTACGGGAAATCATTGAUGAUUUCCCGUAGAAACCUUGGUUUCUACGGGAAAUCAUUGU16.314.622


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GGGGAAUAUUCUAUUGGAC79.25091432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561406GGGGAATATTCTATTGGACGTCCAATAGAATATTCCCC0.227700.025000.672400.750001.000001.00000


Target Position: 1292, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292GCUAUUACAGCCAAUAUUU85.2856732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1290-1312AAGCTATTACAGCCAATATTTCTAAAUAUUGGCUGUAAUAGCUUGCUAUUACAGCCAAUAUUUCUU-1.86.322


Target Position: 1115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115GCAAAGAUACUAUCUUCAU89.5669396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1113-1135GGGCAAAGATACTATCTTCATTTAUGAAGAUAGUAUCUUUGCCCGCAAAGAUACUAUCUUCAUUUU20.412.033


Target Position: 23, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
23CUAAAGAUUAGAGAUCAUU79.82031359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
21-43TCCTAAAGATTAGAGATCATTTCAAUGAUCUCUAAUCUUUAGGACUAAAGAUUAGAGAUCAUUUCU20.46.932


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676ACUUGUUUUCACUAUUGUU82.54061026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132694ACTTGTTTTCACTATTGTTAACAATAGTGAAAACAAGT0.221800.071400.560300.750001.000001.00000


Target Position: 4657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4657CCAAACUGCCUGUGAAUAU81.37721156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4954675CCAAACTGCCTGTGAATATATATTCACAGGCAGTTTGG0.177100.139000.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4655-4677GTCCAAACTGCCTGTGAATATATAUAUUCACAGGCAGUUUGGACCCAAACUGCCUGUGAAUAUAUU16.116.723


Target Position: 4569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4569AGAUUAUAGAAGUAGCAAA96.853770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9014587AGATTATAGAAGTAGCAAATTTGCTACTTCTATAATCT0.069300.023000.724100.750001.000001.00000


Target Position: 3888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3888UCAUCGAGUCACUGCCUAA90.1316354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4353906TCATCGAGTCACTGCCTAATTAGGCAGTGACTCGATGA0.193800.136800.689700.750001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656GCAAAUGCAGGAAAUUUAG72.3192361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640674GCAAATGCAGGAAATTTAGCTAAATTTCCTGCATTTGC0.331900.034000.681000.750001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GCUGGUUUGAUGUGCACGA82.1871065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906918GCTGGTTTGATGTGCACGATCGTGCACATCAAACCAGC0.215500.030900.560300.750001.000001.00000


Target Position: 2393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2393AGAUCCAGUCUAAUAAGAA95.907594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392411AGATCCAGTCTAATAAGAATTCTTATTAGACTGGATCT0.203600.028100.551700.750001.000001.00000


Target Position: 4715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4715UAAAAAAGUUUUCUUUAAA83.9055861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9774733TAAAAAAGTTTTCTTTAAATTTAAAGAAAACTTTTTTA0.191900.117500.534500.500001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843GACAAAUACACAAAAUUAG78.47591534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840861GACAAATACACAAAATTAGCTAATTTTGTGTATTTGTC0.772900.616400.646600.500001.000001.00000


Target Position: 4753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4753GGGAAUGGUUAAGCAGUUU80.18631306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5434771GGGAATGGTTAAGCAGTTTAAACTGCTTAACCATTCCC0.160000.034600.991401.000001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661UGCAGGAAAUUUAGAAGAU77.36621684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433679TGCAGGAAATTTAGAAGATATCTTCTAAATTTCCTGCA0.267600.038900.672400.750001.000001.00000


Target Position: 2776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2776GCGGCUCCGAUACAUGGUU71.37932493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692794GCGGCTCCGATACATGGTTAACCATGTATCGGAGCCGC0.074200.017000.775901.000001.000001.00000


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521AGUGUAUUUUCAAUGUUUC71.76492441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981539AGTGTATTTTCAATGTTTCGAAACATTGAAAATACACT0.060900.034500.534500.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948AUGAUGUCUCCAAGAUUAA83.4899910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
780966ATGATGTCTCCAAGATTAATTAATCTTGGAGACATCAT0.251500.023800.620700.500001.000001.00000


Target Position: 4663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4663UGCCUGUGAAUAUAUCUUC63.61153515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9684681TGCCTGTGAATATATCTTCGAAGATATATTCACAGGCA0.262900.086100.681000.500000.956500.62500


Target Position: 2342, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2342GAUGAAUCCAAAAGUGAAA92.4129217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742360GATGAATCCAAAAGTGAAATTTCACTTTTGGATTCATC0.404500.069100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2340-2362CTGATGAATCCAAAAGTGAAATTUUUCACUUUUGGAUUCAUCAGGAUGAAUCCAAAAGUGAAAUUU19.216.222


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493AGAGGAGCAGCUUAUGAAA91.8712253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591511AGAGGAGCAGCTTATGAAATTTCATAAGCTGCTCCTCT0.096200.015100.724100.750001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000UCUUAGCAAUUGUACCCAU77.76341628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823018TCTTAGCAATTGTACCCATATGGGTACAATTGCTAAGA0.057000.009800.569000.750000.956500.87500


Target Position: 4701, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4701GAUAACUUCUGCUUUAAAA96.454580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9934719GATAACTTCTGCTTTAAAATTTTAAAGCAGAAGTTATC0.073200.007700.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4699-4721TAGATAACTTCTGCTTTAAAAAAUUUUAAAGCAGAAGUUAUCUAGAUAACUUCUGCUUUAAAAAAU-3.84.622


Target Position: 3525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3525CAUUUGGUGAAGUUGUAUU83.5453900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3523-3545CACATTTGGTGAAGTTGTATTCAAAUACAACUUCACCAAAUGUGCAUUUGGUGAAGUUGUAUUCAU14.618.822


Target Position: 636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636GAGAAAUGACAGAUAUCUU96.392782

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
634-656TGGAGAAATGACAGATATCTTTGAAGAUAUCUGUCAUUUCUCCAGAGAAAUGACAGAUAUCUUUGU15.912.022


Target Position: 961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961GAUUAAUGAAGGAAUUGGU81.56761139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
959-981AAGATTAATGAAGGAATTGGTGAACCAAUUCCUUCAUUAAUCUUGAUUAAUGAAGGAAUUGGUGAU20.1-1.822


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GCUAACCCUUGUGAUUUUG63.63513510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851075GCTAACCCTTGTGATTTTGCAAAATCACAAGGGTTAGC0.056900.022900.706900.750001.000001.00000


Target Position: 3984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3984CCCUUGUUAGACAGCCUCA83.5025908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7074002CCCTTGTTAGACAGCCTCATGAGGCTGTCTAACAAGGG0.252500.022000.767200.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012AACAUUUUUCACUGGGUUU71.0452551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021030AACATTTTTCACTGGGTTTAAACCCAGTGAAAAATGTT0.069300.011100.646600.500001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711UCAAUGAUACAGGGUUCUU68.45322888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959729TCAATGATACAGGGTTCTTAAGAACCCTGTATCATTGA0.061400.009600.586200.750001.000001.00000


Target Position: 1470, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GCAUUGAAGCAUUUGCAAA93.4506176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1468-1490AAGCATTGAAGCATTTGCAAATGUUUGCAAAUGCUUCAAUGCUUGCAUUGAAGCAUUUGCAAAUGU20.013.822


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512CCAACUGUCAGUGUAUUUU77.60011650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196530CCAACTGTCAGTGTATTTTAAAATACACTGACAGTTGG0.317100.075900.844801.000001.000001.00000


Target Position: 4483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4483ACAGAAUUAAAGUAGAUUU81.80911108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5024501ACAGAATTAAAGTAGATTTAAATCTACTTTAATTCTGT0.192900.046800.706900.750001.000001.00000


Target Position: 92, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
92GGUGCAACGGAAGCCAGAA87.9459509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566110GGTGCAACGGAAGCCAGAATTCTGGCTTCCGTTGCACC0.159000.024500.681001.000000.951100.87500


Target Position: 2603, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603GCAAUAAUAUUUUCAAAGA91.167291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982621GCAATAATATTTTCAAAGATCTTTGAAAATATTATTGC0.299700.247300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2601-2623TTGCAATAATATTTTCAAAGATTUCUUUGAAAAUAUUAUUGCAAGCAAUAAUAUUUUCAAAGAUUU12.2-1.821


Target Position: 2398, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398CAGUCUAAUAAGAAAAAGA94.1832147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842416CAGTCTAATAAGAAAAAGATCTTTTTCTTATTAGACTG0.089500.039300.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2396-2418TCCAGTCTAATAAGAAAAAGATCUCUUUUUCUUAUUAGACUGGACAGUCUAAUAAGAAAAAGAUCU5.518.922


Target Position: 3999, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3999CUCAUAUUUUGCUUUUGGA83.8286870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3997-4019GCCTCATATTTTGCTTTTGGATGUCCAAAAGCAAAAUAUGAGGCCUCAUAUUUUGCUUUUGGAUGU16.18.722


Target Position: 4755, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4755GAAUGGUUAAGCAGUUUAA96.828171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6244773GAATGGTTAAGCAGTTTAATTAAACTGCTTAACCATTC0.290300.039000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4753-4775GGGAATGGTTAAGCAGTTTAAATUUAAACUGCUUAACCAUUCCCGAAUGGUUAAGCAGUUUAAAUU11.818.822


Target Position: 2515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515GAUUAUGAAGCUAAAUUUA97.63255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822533GATTATGAAGCTAAATTTATAAATTTAGCTTCATAATC0.228300.088800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2513-2535AGGATTATGAAGCTAAATTTAACUAAAUUUAGCUUCAUAAUCCUGAUUAUGAAGCUAAAUUUAACU-9.78.732


Target Position: 2658, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658CAAAACGACAGAAUAGUAA89.6652391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492676CAAAACGACAGAATAGTAATTACTATTCTGTCGTTTTG0.112000.077000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2656-2678AACAAAACGACAGAATAGTAACTUUACUAUUCUGUCGUUUUGUUCAAAACGACAGAAUAGUAACUU6.315.322


Target Position: 4662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662CUGCCUGUGAAUAUAUCUU80.22151300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7444680CTGCCTGTGAATATATCTTAAGATATATTCACAGGCAG0.280700.094400.646600.750001.000001.00000


Target Position: 4203, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4203CACAGAAAGGCAUCUAUUU85.7637683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4201-4223GGCACAGAAAGGCATCTATTTTTAAAUAGAUGCCUUUCUGUGCCCACAGAAAGGCAUCUAUUUUUU6.619.201


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563GGCACAAACCAGAUAAUAU96.790474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631581GGCACAAACCAGATAATATATATTATCTGGTTTGTGCC0.562900.224200.956901.000000.940200.62500


Target Position: 3413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413GCCAAAGCCAAAAUAUCAG69.43332772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783431GCCAAAGCCAAAATATCAGCTGATATTTTGGCTTTGGC0.414900.262900.715500.750001.000001.00000


Target Position: 4433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4433AUCAUCAAGUGGAGAGAAA81.52561143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8684451ATCATCAAGTGGAGAGAAATTTCTCTCCACTTGATGAT0.131400.016600.681000.500001.000001.00000


Target Position: 3883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3883UGCCUUCAUCGAGUCACUG59.79263923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8583901TGCCTTCATCGAGTCACTGCAGTGACTCGATGAAGGCA0.236000.016900.569000.500001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437CGCAAUGGAGGAGCAAAGA76.69871764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400455CGCAATGGAGGAGCAAAGATCTTTGCTCCTCCATTGCG0.203100.065500.698300.750000.967400.75000


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320CUGCUUUCCUGCUGAUCUA90.0997358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671338CTGCTTTCCTGCTGATCTATAGATCAGCAGGAAAGCAG0.059600.023400.612100.750000.945700.75000


Target Position: 4817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4817ACCAUCUGGCUUCAUUCUU64.58183392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9744835ACCATCTGGCTTCATTCTTAAGAATGAAGCCAGATGGT0.180600.008200.715500.750000.918500.62500


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GCCUGGCAGCUGGAAGACA81.04441192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825846GCCTGGCAGCTGGAAGACATGTCTTCCAGCTGCCAGGC0.349400.012600.793100.750000.945700.62500


Target Position: 2677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677CUUGUUUUCACUAUUGUUU73.97592116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722695CTTGTTTTCACTATTGTTTAAACAATAGTGAAAACAAG0.200100.081900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2675-2697AACTTGTTTTCACTATTGTTTCTAAACAAUAGUGAAAACAAGUUCUUGUUUUCACUAUUGUUUCUU6.95.612


Target Position: 148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
148CGAGGAAUCAGCAUUCAGU86.3477628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810166CGAGGAATCAGCATTCAGTACTGAATGCTGATTCCTCG0.299800.030800.586200.750000.940200.87500


Target Position: 2978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2978GGUUGGCAACUAACACUGU83.5062907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572996GGTTGGCAACTAACACTGTACAGTGTTAGTTGCCAACC0.079900.008600.646600.750001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519UCAGUGUAUUUUCAAUGUU73.39552211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827537TCAGTGTATTTTCAATGTTAACATTGAAAATACACTGA0.131300.061900.577600.750001.000001.00000


Target Position: 4443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4443GGAGAGAAAUCAUAGUUUA103.8635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4814461GGAGAGAAATCATAGTTTATAAACTATGATTTCTCTCC0.183400.045700.836201.000001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455CAGAAAGCUUAGUACCAAA100.63822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192473CAGAAAGCTTAGTACCAAATTTGGTACTAAGCTTTCTG0.402500.039500.784500.750001.000001.00000


Target Position: 2995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2995GUUACUCUUAGCAAUUGUA91.5749268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2993-3015CTGTTACTCTTAGCAATTGTACCUACAAUUGCUAAGAGUAACAGGUUACUCUUAGCAAUUGUACCU12.118.922


Target Position: 2891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891GUUAAAGGGGCUAUAGGUU77.23411698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2889-2911AAGTTAAAGGGGCTATAGGTTCCAACCUAUAGCCCCUUUAACUUGUUAAAGGGGCUAUAGGUUCCU19.811.032


Target Position: 4664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4664GCCUGUGAAUAUAUCUUCU88.0292501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4804682GCCTGTGAATATATCTTCTAGAAGATATATTCACAGGC0.183600.068800.775900.750000.967400.62500


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837CUGGAAGACAAAUACACAA91.0745296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622855CTGGAAGACAAATACACAATTGTGTATTTGTCTTCCAG0.814100.403100.637900.750001.000001.00000


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474GAGGCUCUGGAUGAAAGUA89.9814371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972492GAGGCTCTGGATGAAAGTATACTTTCATCCAGAGCCTC0.222900.013800.629300.750001.000001.00000


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396UCCAGUCUAAUAAGAAAAA76.7891756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3812414TCCAGTCTAATAAGAAAAATTTTTCTTATTAGACTGGA0.209500.062400.870700.750001.000001.00000


Target Position: 2626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626AGGGGUUUUUACAAGAAUU81.11311182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002644AGGGGTTTTTACAAGAATTAATTCTTGTAAAAACCCCT0.203800.010200.836200.750001.000001.00000


Target Position: 3472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472UGACAGCUACAGCACGGAA85.8134677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453490TGACAGCTACAGCACGGAATTCCGTGCTGTAGCTGTCA0.135700.068000.551700.750001.000001.00000


Target Position: 3301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301CUACUUGGUGGCACAUAAA91.1007293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733319CTACTTGGTGGCACATAAATTTATGTGCCACCAAGTAG0.059800.008200.672400.750001.000001.00000


Target Position: 2137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137GGAUAAGGCCAGAAAAGGU86.0694647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2135-2157CTGGATAAGGCCAGAAAAGGTCGACCUUUUCUGGCCUUAUCCAGGGAUAAGGCCAGAAAAGGUCGU18.719.912


Target Position: 2919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2919CUGUAAUUACCCAGAAUAU88.5516465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2917-2939TGCTGTAATTACCCAGAATATAGAUAUUCUGGGUAAUUACAGCACUGUAAUUACCCAGAAUAUAGU13.46.921


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566ACAAACCAGAUAAUAUUAA81.67781127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7381584ACAAACCAGATAATATTAATTAATATTATCTGGTTTGT0.822600.238300.672400.750001.000001.00000


Target Position: 4524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4524UGUUUAUAUUUUCCCAUUU74.54672053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244542TGTTTATATTTTCCCATTTAAATGGGAAAATATAAACA0.099600.009700.706900.750001.000001.00000


Target Position: 4685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4685CAAUUGGAAUAUUGUAGAU91.7728256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4683-4705CTCAATTGGAATATTGTAGATAAAUCUACAAUAUUCCAAUUGAGCAAUUGGAAUAUUGUAGAUAAU20.320.122


Target Position: 2597, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597GCAUUUGCAAUAAUAUUUU80.96141204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2212615GCATTTGCAATAATATTTTAAAATATTATTGCAAATGC0.476300.065900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2595-2617CAGCATTTGCAATAATATTTTCAAAAAUAUUAUUGCAAAUGCUGGCAUUUGCAAUAAUAUUUUCAU-10.320.022


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335UGCAGCUGAUGAAUCCAAA83.8156871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742353TGCAGCTGATGAATCCAAATTTGGATTCATCAGCTGCA0.134300.011000.853400.750001.000001.00000


Target Position: 95, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
95GCAACGGAAGCCAGAACAU81.31851162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491113GCAACGGAAGCCAGAACATATGTTCTGGCTTCCGTTGC0.179000.075300.698301.000001.000001.00000


Target Position: 657, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CAAAUGCAGGAAAUUUAGA83.7262885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
655-677TGCAAATGCAGGAAATTTAGAAGUCUAAAUUUCCUGCAUUUGCACAAAUGCAGGAAAUUUAGAAGU-4.320.022


Target Position: 866, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866CAGUUUUUUCAUGCUAUAA90.1074357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843884CAGTTTTTTCATGCTATAATTATAGCATGAAAAAACTG0.096000.012100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
864-886AACAGTTTTTTCATGCTATAATGUUAUAGCAUGAAAAAACUGUUCAGUUUUUUCAUGCUAUAAUGU20.93.222


Target Position: 3220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220AGCACACAUCUUUGGAAUU77.48021666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303238AGCACACATCTTTGGAATTAATTCCAAAGATGTGTGCT0.065900.063800.844800.750001.000001.00000


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493AGAUAAGAAGGAAAAGAAA93.6218171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
269511AGATAAGAAGGAAAAGAAATTTCTTTTCCTTCTTATCT0.580100.063900.724100.750001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494GAUAAGAAGGAAAAGAAAC75.09961988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978512GATAAGAAGGAAAAGAAACGTTTCTTTTCCTTCTTATC0.088300.056800.534500.500001.000001.00000


Target Position: 4851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4851GCUGAUUCUUGCAUUUCCA90.3686342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4849-4871CTGCTGATTCTTGCATTTCCACAUGGAAAUGCAAGAAUCAGCAGGCUGAUUCUUGCAUUUCCACAU20.120.422


Target Position: 947, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GAUGAUGUCUCCAAGAUUA101.76914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555965GATGATGTCTCCAAGATTATAATCTTGGAGACATCATC0.184200.025000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
945-967CAGATGATGTCTCCAAGATTAATUAAUCUUGGAGACAUCAUCUGGAUGAUGUCUCCAAGAUUAAUU12.020.522


Target Position: 1503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503CUUAUGAAAUCUUCAAGAU85.6223697

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1501-1523AGCTTATGAAATCTTCAAGATAAAUCUUGAAGAUUUCAUAAGCUCUUAUGAAAUCUUCAAGAUAAU20.48.912


Target Position: 4665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4665CCUGUGAAUAUAUCUUCUC70.96632559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9974683CCTGTGAATATATCTTCTCGAGAAGATATATTCACAGG0.166000.060600.534500.750000.967400.75000


Target Position: 4267, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4267GACUGUAUGAGAUGUUAAA99.270531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7964285GACTGTATGAGATGTTAAATTTAACATCTCATACAGTC0.088600.054100.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4265-4287CTGACTGTATGAGATGTTAAATAUUUAACAUCUCAUACAGUCAGGACUGUAUGAGAUGUUAAAUAU6.919.023


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593UGGAAUUCAGAAAUGUUCA78.07741586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201611TGGAATTCAGAAATGTTCATGAACATTTCTGAATTCCA0.157900.072300.620700.500001.000001.00000


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768CUCACCAAGCGGCUCCGAU70.4632634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842786CTCACCAAGCGGCTCCGATATCGGAGCCGCTTGGTGAG0.116000.031400.629300.750000.907600.87500


Target Position: 4268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4268ACUGUAUGAGAUGUUAAAU79.37811411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8064286ACTGTATGAGATGTTAAATATTTAACATCTCATACAGT0.087300.042100.698300.750001.000001.00000


Target Position: 1226, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226CAAAAGAAAGAACUUGAAA90.6972318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831244CAAAAGAAAGAACTTGAAATTTCAAGTTCTTTCTTTTG0.172700.131600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1224-1246GACAAAAGAAAGAACTTGAAAGGUUUCAAGUUCUUUCUUUUGUCCAAAAGAAAGAACUUGAAAGGU19.25.522


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840UCAGGAACCUGUAUUGUUU78.55921523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661858TCAGGAACCTGTATTGTTTAAACAATACAGGTTCCTGA0.178200.018300.724100.750000.934800.62500


Target Position: 3702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702UGCUUGAUGGCAAAGAAAU72.02582404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6503720TGCTTGATGGCAAAGAAATATTTCTTTGCCATCAAGCA0.592300.042800.844800.750000.956500.62500


Target Position: 2377, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377GUCUUCAAAUGAUUCAAGA85.8702672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2375-2397ATGTCTTCAAATGATTCAAGATCUCUUGAAUCAUUUGAAGACAUGUCUUCAAAUGAUUCAAGAUCU12.020.422


Target Position: 4612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4612UGUCUAUAAUAAAACUAAA93.8122158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5084630TGTCTATAATAAAACTAAATTTAGTTTTATTATAGACA0.296300.150400.706900.750000.940200.62500


Target Position: 2701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2701CCUUGGAAUUAUUUCUUUU86.2631633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952719CCTTGGAATTATTTCTTTTAAAAGAAATAATTCCAAGG0.626000.010400.844801.000001.000001.00000


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861CAGCAAAGGAGGCCAACAU81.91071098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623879CAGCAAAGGAGGCCAACATATGTTGGCCTCCTTTGCTG0.061000.054000.629300.750000.967400.62500


Target Position: 2454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454ACAGAAAGCUUAGUACCAA89.5308400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112472ACAGAAAGCTTAGTACCAATTGGTACTAAGCTTTCTGT0.415100.052100.560300.750001.000001.00000


Target Position: 1404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404GACAAGUACUCACUGUAUU88.3959479

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1402-1424TGGACAAGTACTCACTGTATTCTAAUACAGUGAGUACUUGUCCAGACAAGUACUCACUGUAUUCUU19.019.032


Target Position: 3989, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3989GUUAGACAGCCUCAUAUUU83.9439855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6324007GTTAGACAGCCTCATATTTAAATATGAGGCTGTCTAAC0.484300.183600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3987-4009TTGTTAGACAGCCTCATATTTTGAAAUAUGAGGCUGUCUAACAAGUUAGACAGCCUCAUAUUUUGU8.720.323


Target Position: 1246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246GUACAACAAAAAUUUAGAA93.0664186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1244-1266AGGTACAACAAAAATTTAGAAGAUUCUAAAUUUUUGUUGUACCUGUACAACAAAAAUUUAGAAGAU6.920.432


Target Position: 3156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3156AGCAGAAGUUUGAACAUAU91.2869284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423174AGCAGAAGTTTGAACATATATATGTTCAAACTTCTGCT0.221000.019700.810300.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414CACUGUAUUCUUUUCUGUA98.212345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571432CACTGTATTCTTTTCTGTATACAGAAAAGAATACAGTG0.175100.032400.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1412-1434CTCACTGTATTCTTTTCTGTATTUACAGAAAAGAAUACAGUGAGCACUGUAUUCUUUUCUGUAUUU19.219.022


Target Position: 520, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520CAGUGUAUUUUCAAUGUUU91.9551244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709538CAGTGTATTTTCAATGTTTAAACATTGAAAATACACTG0.108500.046300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
518-540GTCAGTGTATTTTCAATGTTTCGAAACAUUGAAAAUACACUGACCAGUGUAUUUUCAAUGUUUCGU12.119.023


Target Position: 1513, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CUUCAAGAUAAUUGAUAAU84.4016809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6941531CTTCAAGATAATTGATAATATTATCAATTATCTTGAAG0.154700.017900.629300.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1511-1533ATCTTCAAGATAATTGATAATAAAUUAUCAAUUAUCUUGAAGAUCUUCAAGAUAAUUGAUAAUAAU8.920.422


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370UGGAAAUGUCUUCAAAUGA78.99331467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002388TGGAAATGTCTTCAAATGATCATTTGAAGACATTTCCA0.202400.017300.620700.500001.000001.00000


Target Position: 4434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4434UCAUCAAGUGGAGAGAAAU77.24681695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7234452TCATCAAGTGGAGAGAAATATTTCTCTCCACTTGATGA0.127200.016200.715500.750001.000001.00000


Target Position: 3985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3985CCUUGUUAGACAGCCUCAU75.7221899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5994003CCTTGTTAGACAGCCTCATATGAGGCTGTCTAACAAGG0.247400.022100.689701.000001.000001.00000


Target Position: 2339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339GCUGAUGAAUCCAAAAGUG78.4661535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952357GCTGATGAATCCAAAAGTGCACTTTTGGATTCATCAGC0.126000.046300.560300.750001.000001.00000


Target Position: 2952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952CAGGAAUAAUUAUAUCCUU91.9563243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2950-2972GACAGGAATAATTATATCCTTCAAAGGAUAUAAUUAUUCCUGUCCAGGAAUAAUUAUAUCCUUCAU19.919.922


Target Position: 1224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GACAAAAGAAAGAACUUGA90.9746305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1222-1244AGGACAAAAGAAAGAACTTGAAAUCAAGUUCUUUCUUUUGUCCUGACAAAAGAAAGAACUUGAAAU19.210.322


Target Position: 1585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585GGGAAAUUUGGAAUUCAGA87.6893531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1583-1605AAGGGAAATTTGGAATTCAGAAAUCUGAAUUCCAAAUUUCCCUUGGGAAAUUUGGAAUUCAGAAAU12.014.222


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593ACCAGCAUUUGCAAUAAUA85.6441695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402611ACCAGCATTTGCAATAATATATTATTGCAAATGCTGGT0.200200.029200.810300.750000.972801.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000UCAGUCAAUGGCAACAUUU70.70892596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941018TCAGTCAATGGCAACATTTAAATGTTGCCATTGACTGA0.089700.021800.724100.750000.994600.62500


Target Position: 4482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4482AACAGAAUUAAAGUAGAUU76.99351723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7594500AACAGAATTAAAGTAGATTAATCTACTTTAATTCTGTT0.170100.043500.637900.500001.000001.00000


Target Position: 4271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4271GUAUGAGAUGUUAAAUACU88.7351451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4269-4291CTGTATGAGATGTTAAATACTTTAGUAUUUAACAUCUCAUACAGGUAUGAGAUGUUAAAUACUUUU1.421.432


Target Position: 4036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4036GGAUACAGAAAGUGAAAAG80.57751254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6414054GGATACAGAAAGTGAAAAGCTTTTCACTTTCTGTATCC0.136600.019700.732800.750001.000001.00000


Target Position: 3706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3706UGAUGGCAAAGAAAUAAAG67.80942981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013724TGATGGCAAAGAAATAAAGCTTTATTTCTTTGCCATCA0.132800.026600.586200.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368CUUGGAAAUGUCUUCAAAU86.1661637

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2366-2388GCCTTGGAAATGTCTTCAAATGAAUUUGAAGACAUUUCCAAGGCCUUGGAAAUGUCUUCAAAUGAU12.220.121


Target Position: 4583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4583GCAAAAAGUAUUGAAAUGU74.76122026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5654601GCAAAAAGTATTGAAATGTACATTTCAATACTTTTTGC0.281300.108900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4581-4603TAGCAAAAAGTATTGAAATGTTTACAUUUCAAUACUUUUUGCUAGCAAAAAGUAUUGAAAUGUUUU13.82.122


Target Position: 4722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4722GUUUUCUUUAAAUAUACCU71.07212544

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4720-4742AAGTTTTCTTTAAATATACCTACAGGUAUAUUUAAAGAAAACUUGUUUUCUUUAAAUAUACCUACU15.25.512


Target Position: 3194, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194GUACCAUACAGAAACUCUU86.354627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583212GTACCATACAGAAACTCTTAAGAGTTTCTGTATGGTAC0.090800.015800.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3192-3214AGGTACCATACAGAAACTCTTTGAAGAGUUUCUGUAUGGUACCUGUACCAUACAGAAACUCUUUGU17.721.123


Target Position: 4463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4463ACUGCAUUAUAAAUUUUAU85.6967691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5984481ACTGCATTATAAATTTTATATAAAATTTATAATGCAGT0.205900.022900.663800.750001.000001.00000


Target Position: 3038, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038GUUGAAAUGAAAAUGUUGU74.84532019

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3036-3058TTGTTGAAATGAAAATGTTGTCTACAACAUUUUCAUUUCAACAAGUUGAAAUGAAAAUGUUGUCUU12.17.412


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389GGGAAUAUUCUAUUGGACA92.4034218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7331407GGGAATATTCTATTGGACATGTCCAATAGAATATTCCC0.196800.143300.784500.750001.000001.00000


Target Position: 4484, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484CAGAAUUAAAGUAGAUUUU81.96441090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6164502CAGAATTAAAGTAGATTTTAAAATCTACTTTAATTCTG0.198600.076300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4482-4504AACAGAATTAAAGTAGATTTTAAAAAAUCUACUUUAAUUCUGUUCAGAAUUAAAGUAGAUUUUAAU6.96.922


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GGAAGCUAACCCUUGUGAU86.0578648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161071GGAAGCTAACCCTTGTGATATCACAAGGGTTAGCTTCC0.169900.028300.689701.000000.967400.62500


Target Position: 3884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3884GCCUUCAUCGAGUCACUGC64.56893397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973902GCCTTCATCGAGTCACTGCGCAGTGACTCGATGAAGGC0.207500.017200.646600.500001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628GGGUUUUUACAAGAAUUGA85.1539744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292646GGGTTTTTACAAGAATTGATCAATTCTTGTAAAAACCC0.171000.020400.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2626-2648AGGGGTTTTTACAAGAATTGATGUCAAUUCUUGUAAAAACCCCUGGGUUUUUACAAGAAUUGAUGU12.012.622


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306UGGUGGCACAUAAACUCAU75.91381872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833324TGGTGGCACATAAACTCATATGAGTTTATGTGCCACCA0.160300.010700.689700.750001.000001.00000


Target Position: 4313, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4313CAUUUAUUCAAAGUUAAAA89.4873404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6734331CATTTATTCAAAGTTAAAATTTTAACTTTGAATAAATG0.120800.035500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4311-4333GACATTTATTCAAAGTTAAAAGCUUUUAACUUUGAAUAAAUGUCCAUUUAUUCAAAGUUAAAAGCU4.9-10.322


Target Position: 450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450CAAAGAAGAAGAACUUUUU85.7016689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
448-470AGCAAAGAAGAAGAACTTTTTTAAAAAAGUUCUUCUUCUUUGCUCAAAGAAGAAGAACUUUUUUAU3.210.321


Target Position: 2778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2778GGCUCCGAUACAUGGUUUU75.4061940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872796GGCTCCGATACATGGTTTTAAAACCATGTATCGGAGCC0.056700.021601.000001.000001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835AGCUGGAAGACAAAUACAC70.09232684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897853AGCTGGAAGACAAATACACGTGTATTTGTCTTCCAGCT0.708500.299700.560300.500001.000001.00000


Target Position: 4332, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4332GCAAACACUUACAGAAUUA94.6701130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1224350GCAAACACTTACAGAATTATAATTCTGTAAGTGTTTGC0.381600.201800.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4330-4352AAGCAAACACTTACAGAATTATGUAAUUCUGUAAGUGUUUGCUUGCAAACACUUACAGAAUUAUGU12.019.322


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415ACUGUAUUCUUUUCUGUAU82.1181073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961433ACTGTATTCTTTTCTGTATATACAGAAAAGAATACAGT0.215400.041400.663800.750001.000001.00000


Target Position: 4312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4312ACAUUUAUUCAAAGUUAAA88.2012492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7084330ACATTTATTCAAAGTTAAATTTAACTTTGAATAAATGT0.108500.037100.706900.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UGCAAAUGCAGGAAAUUUA82.01561084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665673TGCAAATGCAGGAAATTTATAAATTTCCTGCATTTGCA0.189900.018300.819000.750000.945700.62500


Target Position: 3492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492GCCUAAUGCCGAACACAUU84.38811

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3490-3512AGGCCTAATGCCGAACACATTGGAAUGUGUUCGGCAUUAGGCCUGCCUAAUGCCGAACACAUUGGU19.317.422


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191CAGGUACCAUACAGAAACU87.6809532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843209CAGGTACCATACAGAAACTAGTTTCTGTATGGTACCTG0.102700.026700.577600.500001.000001.00000


Target Position: 3894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3894AGUCACUGCCUAAUAAAUA89.1326422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4853912AGTCACTGCCTAATAAATATATTTATTAGGCAGTGACT0.677800.109700.663800.750001.000001.00000


Target Position: 3225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225ACAUCUUUGGAAUUACAUU80.84471220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9323243ACATCTTTGGAATTACATTAATGTAATTCCAAAGATGT0.065500.017700.698300.750001.000001.00000


Target Position: 2277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277GCAUUUACUUCAAACUUGU82.766999

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2275-2297AGGCATTTACTTCAAACTTGTCAACAAGUUUGAAGUAAAUGCCUGCAUUUACUUCAAACUUGUCAU10.36.932


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730UCCUUCAGGGUUUCACAUU63.5133525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312748TCCTTCAGGGTTTCACATTAATGTGAAACCCTGAAGGA0.256200.009600.862100.750000.989100.75000


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535CCAAGUAUUGACAGCUAUU86.4534622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731553CCAAGTATTGACAGCTATTAATAGCTGTCAATACTTGG0.073900.037700.836201.000001.000001.00000


Target Position: 4129, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4129CCAGAAUGCAGACUUAAUA92.925197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1454147CCAGAATGCAGACTTAATATATTAAGTCTGCATTCTGG0.388000.128200.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4127-4149ATCCAGAATGCAGACTTAATAGTUAUUAAGUCUGCAUUCUGGAUCCAGAAUGCAGACUUAAUAGUU4.618.102


Target Position: 4257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4257AGUGAACUCUGACUGUAUG76.991724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9204275AGTGAACTCTGACTGTATGCATACAGTCAGAGTTCACT0.103100.018900.551700.500001.000001.00000


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535CUGAAUGGCCUUAUUUUGU70.47612631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202553CTGAATGGCCTTATTTTGTACAAAATAAGGCCATTCAG0.189100.009700.577600.500001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UGAUGUCUCCAAGAUUAAU79.82071358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700967TGATGTCTCCAAGATTAATATTAATCTTGGAGACATCA0.145600.017100.715500.750001.000001.00000


Target Position: 150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
150AGGAAUCAGCAUUCAGUCA84.6724785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860168AGGAATCAGCATTCAGTCATGACTGAATGCTGATTCCT0.258700.028700.620700.500000.940200.75000


Target Position: 2984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2984CAACUAACACUGUUACUCU92.2425228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2982-3004GGCAACTAACACTGTTACTCTTAAGAGUAACAGUGUUAGUUGCCCAACUAACACUGUUACUCUUAU21.412.933


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773GUGUUGAUGGACAGGAUAU85.7194687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641791GTGTTGATGGACAGGATATATATCCTGTCCATCAACAC0.105000.008400.750000.750001.000001.00000


Target Position: 4658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4658CAAACUGCCUGUGAAUAUA93.5763173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894676CAAACTGCCTGTGAATATATATATTCACAGGCAGTTTG0.182800.139300.603400.750001.000001.00000


Target Position: 4301, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4301GUUUAGAUAUGACAUUUAU91.9416246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7734319GTTTAGATATGACATTTATATAAATGTCATATCTAAAC0.100400.033700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4299-4321TTGTTTAGATATGACATTTATTCAUAAAUGUCAUAUCUAAACAAGUUUAGAUAUGACAUUUAUUCU6.96.922


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151GGAAUCAGCAUUCAGUCAA89.2918414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293169GGAATCAGCATTCAGTCAATTGACTGAATGCTGATTCC0.252700.130000.724101.000000.940200.62500


Target Position: 1223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223GGACAAAAGAAAGAACUUG75.3231958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861241GGACAAAAGAAAGAACTTGCAAGTTCTTTCTTTTGTCC0.182400.038000.724100.750001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGAAAAGAAACCAACUGUC74.73062032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948520GGAAAAGAAACCAACTGTCGACAGTTGGTTTCTTTTCC0.207700.018200.551700.750001.000001.00000


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464CCUUUGAUUGACAGCUACA88.9658435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923482CCTTTGATTGACAGCTACATGTAGCTGTCAATCAAAGG0.292200.024200.637900.750001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443GGAGGAGCAAAGAAGAAGA91.6459265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568461GGAGGAGCAAAGAAGAAGATCTTCTTCTTTGCTCCTCC0.380800.101600.646600.750001.000001.00000


Target Position: 2673, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673GUAACUUGUUUUCACUAUU84.1392838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582691GTAACTTGTTTTCACTATTAATAGTGAAAACAAGTTAC0.156900.042600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2671-2693TAGTAACTTGTTTTCACTATTGTAAUAGUGAAAACAAGUUACUAGUAACUUGUUUUCACUAUUGUU20.311.822


Target Position: 4606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4606AUAAAGUGUCUAUAAUAAA91.0034303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9534624ATAAAGTGTCTATAATAAATTTATTATAGACACTTTAT0.763000.118900.543100.500001.000001.00000


Target Position: 4679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4679UUCUCUCAAUUGGAAUAUU69.90842705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8744697TTCTCTCAATTGGAATATTAATATTCCAATTGAGAGAA0.073800.036600.663800.500001.000001.00000


Target Position: 3409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3409CUAUGCCAAAGCCAAAAUA83.1319955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6613427CTATGCCAAAGCCAAAATATATTTTGGCTTTGGCATAG0.378200.051600.629300.750000.940201.00000


Target Position: 2271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271AGAAAGGCAUUUACUUCAA86.9316589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412289AGAAAGGCATTTACTTCAATTGAAGTAAATGCCTTTCT0.196900.052900.577600.750001.000001.00000


Target Position: 4462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4462AACUGCAUUAUAAAUUUUA83.2499940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8224480AACTGCATTATAAATTTTATAAAATTTATAATGCAGTT0.212700.016700.612100.500001.000001.00000


Target Position: 4517, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4517GUAAUUUUGUUUAUAUUUU81.99341086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9514535GTAATTTTGTTTATATTTTAAAATATAAACAAAATTAC0.103700.008800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4515-4537GTGTAATTTTGTTTATATTTTCCAAAAUAUAAACAAAAUUACACGUAAUUUUGUUUAUAUUUUCCU-8.0-9.711


Target Position: 3192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192AGGUACCAUACAGAAACUC60.47793851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823210AGGTACCATACAGAAACTCGAGTTTCTGTATGGTACCT0.083700.022600.534500.500001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842AGACAAAUACACAAAAUUA99.337730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352860AGACAAATACACAAAATTATAATTTTGTGTATTTGTCT0.851000.534200.689700.750001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571CCAGAUAAUAUUAAGGGAA89.7517385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231589CCAGATAATATTAAGGGAATTCCCTTAATATTATCTGG0.298100.044700.672401.000001.000001.00000


Target Position: 982, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982CAAAAUUGGAAUGUUCUUU75.26891963

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
980-1002GACAAAATTGGAATGTTCTTTCAAAAGAACAUUCCAAUUUUGUCCAAAAUUGGAAUGUUCUUUCAU19.2-3.322


Target Position: 4670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4670GAAUAUAUCUUCUCUCAAU100.8319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6274688GAATATATCTTCTCTCAATATTGAGAGAAGATATATTC0.201100.067500.663800.750001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775GUUGAUGGACAGGAUAUUA91.753259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441793GTTGATGGACAGGATATTATAATATCCTGTCCATCAAC0.272000.018800.612100.750001.000001.00000


Target Position: 1539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1539GUAUUGACAGCUAUUCGAA94.3307140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1537-1559AAGTATTGACAGCTATTCGAAGAUUCGAAUAGCUGUCAAUACUUGUAUUGACAGCUAUUCGAAGAU17.916.132


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565CACAAACCAGAUAAUAUUA95.324108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521583CACAAACCAGATAATATTATAATATTATCTGGTTTGTG0.580000.233900.758600.750001.000001.00000


Target Position: 4760, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4760GUUAAGCAGUUUAAAUAAU83.8748865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6304778GTTAAGCAGTTTAAATAATATTATTTAAACTGCTTAAC0.446200.042300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4758-4780TGGTTAAGCAGTTTAAATAATTCAUUAUUUAAACUGCUUAACCAGUUAAGCAGUUUAAAUAAUUCU-7.519.722


Target Position: 4456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4456AGUUUAAACUGCAUUAUAA100.56223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274474AGTTTAAACTGCATTATAATTATAATGCAGTTTAAACT0.066000.017500.672400.750001.000001.00000


Target Position: 4678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4678CUUCUCUCAAUUGGAAUAU68.72082853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9444696CTTCTCTCAATTGGAATATATATTCCAATTGAGAGAAG0.064100.027600.594800.750001.000001.00000


Target Position: 2341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341UGAUGAAUCCAAAAGUGAA93.0901183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312359TGATGAATCCAAAAGTGAATTCACTTTTGGATTCATCA0.352400.054900.551700.750001.000001.00000


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031AGGAGUUGUUGAAAUGAAA92.5175213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753049AGGAGTTGTTGAAATGAAATTTCATTTCAACAACTCCT0.254400.011000.844800.750001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233CAUUGUGGAGAAAGGAAAU85.1943739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932251CATTGTGGAGAAAGGAAATATTTCCTTTCTCCACAATG0.321000.013900.646600.750001.000001.00000


Target Position: 3434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3434GCCCACAUCAUCAUGAUCA85.5257708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103452GCCCACATCATCATGATCATGATCATGATGATGTGGGC0.108200.067900.775900.750000.978300.75000


Target Position: 2348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2348UCCAAAAGUGAAAUUGAUG61.78463703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852366TCCAAAAGTGAAATTGATGCATCAATTTCACTTTTGGA0.229200.137200.715500.500000.989100.62500


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260UAGAAGAAGCUAAAAGAAU76.56411786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8851278TAGAAGAAGCTAAAAGAATATTCTTTTAGCTTCTTCTA0.092800.032100.663800.500001.000001.00000


Target Position: 1027, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027GUUUAUAGUAGGAUUUACA93.8006159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1025-1047GGGTTTATAGTAGGATTTACACGUGUAAAUCCUACUAUAAACCCGUUUAUAGUAGGAUUUACACGU10.0-2.332


Target Position: 3157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3157GCAGAAGUUUGAACAUAUG81.34351160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103175GCAGAAGTTTGAACATATGCATATGTTCAAACTTCTGC0.260900.086000.698300.750001.000001.00000


Target Position: 4545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4545ACUGUAACUGACUGCCUUG70.40072645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9644563ACTGTAACTGACTGCCTTGCAAGGCAGTCAGTTACAGT0.060000.021800.560300.500001.000001.00000


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394GAUCCAGUCUAAUAAGAAA105.8643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4492412GATCCAGTCTAATAAGAAATTTCTTATTAGACTGGATC0.217500.034200.681000.750001.000001.00000


Target Position: 4560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4560CUUGCUAAAAGAUUAUAGA86.5772614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4558-4580GCCTTGCTAAAAGATTATAGAAGUCUAUAAUCUUUUAGCAAGGCCUUGCUAAAAGAUUAUAGAAGU-2.719.722


Target Position: 2654, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2654GAAACAAAACGACAGAAUA98.227844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6812672GAAACAAAACGACAGAATATATTCTGTCGTTTTGTTTC0.225400.089700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2652-2674CTGAAACAAAACGACAGAATAGTUAUUCUGUCGUUUUGUUUCAGGAAACAAAACGACAGAAUAGUU19.25.622


Target Position: 3896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3896UCACUGCCUAAUAAAUAUA82.20261062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153914TCACTGCCTAATAAATATATATATTTATTAGGCAGTGA0.715000.115000.681000.750001.000001.00000


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600CAGAAAUGUUCACUUCAGU83.6845889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521618CAGAAATGTTCACTTCAGTACTGAAGTGAACATTTCTG0.096400.037500.577600.500000.934800.62500


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618AAGAUUAUAGGGGUUUUUA82.22261059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952636AAGATTATAGGGGTTTTTATAAAAACCCCTATAATCTT0.055100.016500.603400.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449GCAAAGAAGAAGAACUUUU82.66621012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
447-469GAGCAAAGAAGAAGAACTTTTTTAAAAGUUCUUCUUCUUUGCUCGCAAAGAAGAAGAACUUUUUUU13.312.222


Target Position: 1629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629GAAAAGAAGUUAAGAUCUU88.1808493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1627-1649TCGAAAAGAAGTTAAGATCTTGAAAGAUCUUAACUUCUUUUCGAGAAAAGAAGUUAAGAUCUUGAU19.15.522


Target Position: 4356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4356AGGUAUCUGUUUAACAUUU83.2225945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7184374AGGTATCTGTTTAACATTTAAATGTTAAACAGATACCT0.200400.065900.844800.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864CACGAUAGCUGAAAACAUU90.0473365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321882CACGATAGCTGAAAACATTAATGTTTTCAGCTATCGTG0.081700.013900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1862-1884ACCACGATAGCTGAAAACATTCGAAUGUUUUCAGCUAUCGUGGUCACGAUAGCUGAAAACAUUCGU5.320.933


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948GGGACAGGAAUAAUUAUAU91.9046250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392966GGGACAGGAATAATTATATATATAATTATTCCTGTCCC0.140300.009200.948301.000001.000001.00000


Target Position: 4275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4275GAGAUGUUAAAUACUUUUU82.56051021

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4273-4295ATGAGATGTTAAATACTTTTTAAAAAAAGUAUUUAACAUCUCAUGAGAUGUUAAAUACUUUUUAAU4.919.231


Target Position: 3892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3892CGAGUCACUGCCUAAUAAA95.0874114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1563910CGAGTCACTGCCTAATAAATTTATTAGGCAGTGACTCG0.594900.121600.793101.000001.000001.00000


Target Position: 3442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3442CAUCAUGAUCAUUGAAAAA97.029465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5213460CATCATGATCATTGAAAAATTTTTCAATGATCATGATG0.313900.061700.655200.750001.000001.00000


Target Position: 4676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4676AUCUUCUCUCAAUUGGAAU70.78072587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274694ATCTTCTCTCAATTGGAATATTCCAATTGAGAGAAGAT0.068700.025800.672400.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511ACCAACUGUCAGUGUAUUU74.46332070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363529ACCAACTGTCAGTGTATTTAAATACACTGACAGTTGGT0.318800.069800.853400.750001.000001.00000


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268GCUAAAAGAAUUGGGAUAA84.4818800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461286GCTAAAAGAATTGGGATAATTATCCCAATTCTTTTAGC0.280600.082600.819001.000001.000001.00000


Target Position: 1500, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500CAGCUUAUGAAAUCUUCAA92.1031236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1498-1520AGCAGCTTATGAAATCTTCAAGAUUGAAGAUUUCAUAAGCUGCUCAGCUUAUGAAAUCUUCAAGAU20.418.332


Target Position: 4655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4655GUCCAAACUGCCUGUGAAU81.64741132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4444673GTCCAAACTGCCTGTGAATATTCACAGGCAGTTTGGAC0.191200.068900.810300.750001.000001.00000


Target Position: 475, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475GAACAAUAAAAGUGAAAAA97.792450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424493GAACAATAAAAGTGAAAAATTTTTCACTTTTATTGTTC0.323200.218100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
473-495CTGAACAATAAAAGTGAAAAAGAUUUUUCACUUUUAUUGUUCAGGAACAAUAAAAGUGAAAAAGAU14.96.912


Target Position: 1235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235GAACUUGAAAGGUACAACA93.0806185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1233-1255AAGAACTTGAAAGGTACAACAAAUGUUGUACCUUUCAAGUUCUUGAACUUGAAAGGUACAACAAAU21.519.223


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438GCAAUGGAGGAGCAAAGAA89.4036408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404456GCAATGGAGGAGCAAAGAATTCTTTGCTCCTCCATTGC0.202700.066400.681001.000001.000001.00000


Target Position: 3895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3895GUCACUGCCUAAUAAAUAU89.0488428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183913GTCACTGCCTAATAAATATATATTTATTAGGCAGTGAC0.723800.114700.775900.750001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551UGGCUUGACAAGUUGUAUA83.9216859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971569TGGCTTGACAAGTTGTATATATACAACTTGTCAAGCCA0.144600.008200.801700.750001.000001.00000


Target Position: 4331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4331AGCAAACACUUACAGAAUU79.7431367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6034349AGCAAACACTTACAGAATTAATTCTGTAAGTGTTTGCT0.381000.188000.844800.750000.972800.62500


Target Position: 96, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
96CAACGGAAGCCAGAACAUU81.15881176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846114CAACGGAAGCCAGAACATTAATGTTCTGGCTTCCGTTG0.079000.029700.637900.750001.000001.00000


Target Position: 4708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708UCUGCUUUAAAAAAGUUUU65.263313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5634726TCTGCTTTAAAAAAGTTTTAAAACTTTTTTAAAGCAGA0.353300.024600.724100.750001.000001.00000


Target Position: 4394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4394CUUCAGAGACUUCGUAAUU79.29621423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9724412CTTCAGAGACTTCGTAATTAATTACGAAGTCTCTGAAG0.080600.008200.629300.750001.000001.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418GUAUUCUUUUCUGUAUUAA89.1164424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711436GTATTCTTTTCTGTATTAATTAATACAGAAAAGAATAC0.312000.067800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1416-1438CTGTATTCTTTTCTGTATTAATTUUAAUACAGAAAAGAAUACAGGUAUUCUUUUCUGUAUUAAUUU8.56.911


Target Position: 701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
701AGAAGUGAUAUCAAUGAUA93.9262155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
590719AGAAGTGATATCAATGATATATCATTGATATCACTTCT0.188200.022900.681000.750001.000001.00000


Target Position: 4537, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4537CCAUUUGGACUGUAACUGA90.8821311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794555CCATTTGGACTGTAACTGATCAGTTACAGTCCAAATGG0.101000.010800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4535-4557TCCCATTTGGACTGTAACTGACTUCAGUUACAGUCCAAAUGGGACCAUUUGGACUGUAACUGACUU19.017.723


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319GCUGCUUUCCUGCUGAUCU78.75631497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491337GCTGCTTTCCTGCTGATCTAGATCAGCAGGAAAGCAGC0.063200.019000.629300.750000.945700.87500


Target Position: 4369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4369ACAUUUCCUCAGUCAAGUU80.56131257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8904387ACATTTCCTCAGTCAAGTTAACTTGACTGAGGAAATGT0.292500.068800.560300.750001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CCGCUGUUCGUUUCCUUUA80.66651242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426340CCGCTGTTCGTTTCCTTTATAAAGGAAACGAACAGCGG0.197200.106500.879301.000001.000001.00000


Target Position: 4544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4544GACUGUAACUGACUGCCUU90.7881315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8884562GACTGTAACTGACTGCCTTAAGGCAGTCAGTTACAGTC0.070800.027600.681000.750001.000001.00000


Target Position: 2505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CCUUUUGGAGGAUUAUGAA91.2638286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2503-2525TTCCTTTTGGAGGATTATGAAGCUUCAUAAUCCUCCAAAAGGAACCUUUUGGAGGAUUAUGAAGCU8.716.122


Target Position: 4441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4441GUGGAGAGAAAUCAUAGUU82.38451040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6014459GTGGAGAGAAATCATAGTTAACTATGATTTCTCTCCAC0.141300.039700.646600.750001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444GAGGAGCAAAGAAGAAGAA91.7413260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
645462GAGGAGCAAAGAAGAAGAATTCTTCTTCTTTGCTCCTC0.372300.101000.637900.750001.000001.00000


Target Position: 1406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406CAAGUACUCACUGUAUUCU81.1121184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1404-1426GACAAGTACTCACTGTATTCTTTAGAAUACAGUGAGUACUUGUCCAAGUACUCACUGUAUUCUUUU16.117.621


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621CCCAUCUCGAAAAGAAGUU67.18463058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671639CCCATCTCGAAAAGAAGTTAACTTCTTTTCGAGATGGG0.185700.082800.844801.000000.962000.75000


Target Position: 3035, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035GUUGUUGAAAUGAAAAUGU73.77642152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3033-3055GAGTTGTTGAAATGAAAATGTTGACAUUUUCAUUUCAACAACUCGUUGUUGAAAUGAAAAUGUUGU7.420.522


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269CUAAAAGAAUUGGGAUAAA87.5398543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371287CTAAAAGAATTGGGATAAATTTATCCCAATTCTTTTAG0.282200.090200.672400.750001.000001.00000


Target Position: 628, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628GGUGUUUGGAGAAAUGACA88.4485471

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
626-648CTGGTGTTTGGAGAAATGACAGAUGUCAUUUCUCCAAACACCAGGGUGUUUGGAGAAAUGACAGAU14.819.322


Target Position: 4656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4656UCCAAACUGCCUGUGAAUA71.99152408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4774674TCCAAACTGCCTGTGAATATATTCACAGGCAGTTTGGA0.184100.082000.827600.750001.000001.00000


Target Position: 2514, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514GGAUUAUGAAGCUAAAUUU94.1142149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3022532GGATTATGAAGCTAAATTTAAATTTAGCTTCATAATCC0.248000.102800.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2512-2534GAGGATTATGAAGCTAAATTTAAAAAUUUAGCUUCAUAAUCCUCGGAUUAUGAAGCUAAAUUUAAU-4.38.723


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391GAAUAUUCUAUUGGACAAG73.61072183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851409GAATATTCTATTGGACAAGCTTGTCCAATAGAATATTC0.097100.070200.534500.500001.000001.00000


Target Position: 3463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463CCCUUUGAUUGACAGCUAC70.8842572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183481CCCTTTGATTGACAGCTACGTAGCTGTCAATCAAAGGG0.247500.020800.810300.750001.000001.00000


Target Position: 1120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GAUACUAUCUUCAUUUACU93.9899152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1118-1140AAGATACTATCTTCATTTACTGAAGUAAAUGAAGAUAGUAUCUUGAUACUAUCUUCAUUUACUGAU6.96.123


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230AGAAAGAACUUGAAAGGUA92.9471196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501248AGAAAGAACTTGAAAGGTATACCTTTCAAGTTCTTTCT0.232000.122900.543100.750001.000001.00000


Target Position: 2652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652CUGAAACAAAACGACAGAA84.2957822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402670CTGAAACAAAACGACAGAATTCTGTCGTTTTGTTTCAG0.137100.075700.612100.750001.000001.00000


Target Position: 2604, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604CAAUAAUAUUUUCAAAGAU92.9003198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2602-2624TGCAATAATATTTTCAAAGATTAAUCUUUGAAAAUAUUAUUGCACAAUAAUAUUUUCAAAGAUUAU20.4-8.021


Target Position: 4395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4395UUCAGAGACUUCGUAAUUA80.29371290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8594413TTCAGAGACTTCGTAATTATAATTACGAAGTCTCTGAA0.278600.011400.637900.500001.000001.00000


Target Position: 4299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4299UUGUUUAGAUAUGACAUUU72.73422317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7824317TTGTTTAGATATGACATTTAAATGTCATATCTAAACAA0.147700.042800.646600.500001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572CAGAUAAUAUUAAGGGAAA95.870295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691590CAGATAATATTAAGGGAAATTTCCCTTAATATTATCTG0.059100.043200.784500.750001.000001.00000


Target Position: 2270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2270GAGAAAGGCAUUUACUUCA90.1542351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402288GAGAAAGGCATTTACTTCATGAAGTAAATGCCTTTCTC0.185100.052700.586200.500001.000001.00000


Target Position: 69, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
69AGGAAGCAACCAGAUAAAA82.49961033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
40787AGGAAGCAACCAGATAAAATTTTATCTGGTTGCTTCCT0.819900.042700.844800.750000.962000.75000


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431GGGGACCGCAAUGGAGGAG55.9264247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703449GGGGACCGCAATGGAGGAGCTCCTCCATTGCGGTCCCC0.109700.018000.681000.750001.000001.00000


Target Position: 4666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4666CUGUGAAUAUAUCUUCUCU89.9262373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8864684CTGTGAATATATCTTCTCTAGAGAAGATATATTCACAG0.133100.057800.560300.500000.967400.87500


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263CAUGAAAGAGAAAGGCAUU85.0934749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442281CATGAAAGAGAAAGGCATTAATGCCTTTCTCTTTCATG0.345700.085100.646600.750001.000001.00000


Target Position: 3070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070GAAAGAUAAGAAAGAACUA99.703328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090CTGAAAGATAAGAAAGAACTAGAUAGUUCUUUCUUAUCUUUCAGGAAAGAUAAGAAAGAACUAGAU17.76.922


Target Position: 1416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416CUGUAUUCUUUUCUGUAUU81.26441167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481434CTGTATTCTTTTCTGTATTAATACAGAAAAGAATACAG0.249800.051300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1414-1436CACTGTATTCTTTTCTGTATTAAAAUACAGAAAAGAAUACAGUGCUGUAUUCUUUUCUGUAUUAAU20.316.121


Target Position: 4580, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4580GUAGCAAAAAGUAUUGAAA93.0531188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5904598GTAGCAAAAAGTATTGAAATTTCAATACTTTTTGCTAC0.344000.040500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4578-4600AAGTAGCAAAAAGTATTGAAATGUUUCAAUACUUUUUGCUACUUGUAGCAAAAAGUAUUGAAAUGU8.919.722


Target Position: 1502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502GCUUAUGAAAUCUUCAAGA87.9525508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1500-1522CAGCTTATGAAATCTTCAAGATAUCUUGAAGAUUUCAUAAGCUGGCUUAUGAAAUCUUCAAGAUAU16.613.422


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904ACCAUGGAUGAGAUUGAGA78.27861562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291922ACCATGGATGAGATTGAGATCTCAATCTCATCCATGGT0.128100.012500.629300.500001.000001.00000


Target Position: 1280, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280GGGAUAAAGAAAGCUAUUA90.1139356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451298GGGATAAAGAAAGCTATTATAATAGCTTTCTTTATCCC0.160000.161800.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1278-1300TTGGGATAAAGAAAGCTATTACAUAAUAGCUUUCUUUAUCCCAAGGGAUAAAGAAAGCUAUUACAU18.315.523


Target Position: 2826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826GGUUUGAUGACCCUAAAAA93.1525182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2642844GGTTTGATGACCCTAAAAATTTTTAGGGTCATCAAACC0.293800.057100.853401.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2824-2846TTGGTTTGATGACCCTAAAAACAUUUUUAGGGUCAUCAAACCAAGGUUUGAUGACCCUAAAAACAU11.014.813


Target Position: 2561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561GUAUUUUGUGCCAUUAUAA95.3642107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2559-2581GTGTATTTTGTGCCATTATAAATUUAUAAUGGCACAAAAUACACGUAUUUUGUGCCAUUAUAAAUU0.0-1.412


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662GCAGGAAAUUUAGAAGAUC75.35311949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446680GCAGGAAATTTAGAAGATCGATCTTCTAAATTTCCTGC0.280500.062300.672400.750001.000001.00000


Target Position: 2402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402CUAAUAAGAAAAAGAUCAA91.4319276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2400-2422GTCTAATAAGAAAAAGATCAACTUUGAUCUUUUUCUUAUUAGACCUAAUAAGAAAAAGAUCAACUU20.4-2.322


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267AGCUAAAAGAAUUGGGAUA84.2579828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211285AGCTAAAAGAATTGGGATATATCCCAATTCTTTTAGCT0.272900.048600.810300.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214GAGGAAAGCACACAUCUUU86.7991604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3253232GAGGAAAGCACACATCTTTAAAGATGTGTGCTTTCCTC0.329000.099200.810300.750001.000001.00000


Target Position: 3436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3436CCACAUCAUCAUGAUCAUU84.2518829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933454CCACATCATCATGATCATTAATGATCATGATGATGTGG0.090000.058200.836201.000000.978301.00000


Target Position: 3499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3499GCCGAACACAUUGGAAGGA72.55122335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413517GCCGAACACATTGGAAGGATCCTTCCAATGTGTTCGGC0.064300.016800.629300.750001.000001.00000


Target Position: 3873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3873CCAACAUACAUGCCUUCAU81.98761087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783891CCAACATACATGCCTTCATATGAAGGCATGTATGTTGG0.117700.036700.689701.000001.000001.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245GGUACAACAAAAAUUUAGA91.03301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631263GGTACAACAAAAATTTAGATCTAAATTTTTGTTGTACC0.198200.141600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1243-1265AAGGTACAACAAAAATTTAGAAGUCUAAAUUUUUGUUGUACCUUGGUACAACAAAAAUUUAGAAGU-4.321.522


Target Position: 643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GACAGAUAUCUUUGCAAAU89.9927370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
641-663ATGACAGATATCTTTGCAAATGCAUUUGCAAAGAUAUCUGUCAUGACAGAUAUCUUUGCAAAUGCU20.020.322


Target Position: 4485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4485AGAAUUAAAGUAGAUUUUA85.9442660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3474503AGAATTAAAGTAGATTTTATAAAATCTACTTTAATTCT0.286500.080500.689700.750001.000001.00000


Target Position: 4402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4402ACUUCGUAAUUAAAGGAAC66.94513090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8914420ACTTCGTAATTAAAGGAACGTTCCTTTAATTACGAAGT0.415400.052400.560300.500000.989100.62500


Target Position: 4702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4702AUAACUUCUGCUUUAAAAA82.8768986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9524720ATAACTTCTGCTTTAAAAATTTTTAAAGCAGAAGTTAT0.233400.009900.543100.500001.000001.00000


Target Position: 4446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446GAGAAAUCAUAGUUUAAAC85.1032746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984464GAGAAATCATAGTTTAAACGTTTAAACTATGATTTCTC0.054700.018800.663800.500001.000001.00000


Target Position: 4758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4758UGGUUAAGCAGUUUAAAUA87.5511541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5324776TGGTTAAGCAGTTTAAATATATTTAAACTGCTTAACCA0.479700.049100.801700.750001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124CUAUCUUCAUUUACUGAUA95.1346113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721142CTATCTTCATTTACTGATATATCAGTAAATGAAGATAG0.151000.030600.629300.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1122-1144TACTATCTTCATTTACTGATAAAUAUCAGUAAAUGAAGAUAGUACUAUCUUCAUUUACUGAUAAAU20.316.022


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107AGAAAGCGAAGCAGUGGUU73.48172195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882125AGAAAGCGAAGCAGTGGTTAACCACTGCTTCGCTTTCT0.056500.008600.577600.750001.000001.00000


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945CAGAUGAUGUCUCCAAGAU88.2373488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761963CAGATGATGTCTCCAAGATATCTTGGAGACATCATCTG0.144300.024300.603400.750001.000001.00000


Target Position: 1564, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564GCACAAACCAGAUAAUAUU89.5699395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601582GCACAAACCAGATAATATTAATATTATCTGGTTTGTGC0.571400.230800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1562-1584GGGCACAAACCAGATAATATTAAAAUAUUAUCUGGUUUGUGCCCGCACAAACCAGAUAAUAUUAAU-8.619.322


Target Position: 3033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033GAGUUGUUGAAAUGAAAAU84.956761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053051GAGTTGTTGAAATGAAAATATTTTCATTTCAACAACTC0.140900.024200.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3031-3053AGGAGTTGTTGAAATGAAAATGTAUUUUCAUUUCAACAACUCCUGAGUUGUUGAAAUGAAAAUGUU7.417.812


Target Position: 3997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3997GCCUCAUAUUUUGCUUUUG68.92232826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6204015GCCTCATATTTTGCTTTTGCAAAAGCAAAATATGAGGC0.200300.036700.853400.750001.000001.00000


Target Position: 4336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4336ACACUUACAGAAUUAUGAA92.0656238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9864354ACACTTACAGAATTATGAATTCATAATTCTGTAAGTGT0.187100.110700.534500.750001.000001.00000


Target Position: 4681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4681CUCUCAAUUGGAAUAUUGU80.39951274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4679-4701TTCTCTCAATTGGAATATTGTAGACAAUAUUCCAAUUGAGAGAACUCUCAAUUGGAAUAUUGUAGU-1.820.422


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513AGGAUUAUGAAGCUAAAUU79.01111463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6462531AGGATTATGAAGCTAAATTAATTTAGCTTCATAATCCT0.241700.102500.836200.750001.000001.00000


Target Position: 1943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1943GCCUAUGACUUUAUCAUGA90.9565306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281961GCCTATGACTTTATCATGATCATGATAAAGTCATAGGC0.271200.020400.775900.750000.923900.75000


Target Position: 4818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4818CCAUCUGGCUUCAUUCUUC76.90551734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6024836CCATCTGGCTTCATTCTTCGAAGAATGAAGCCAGATGG0.171800.021900.672400.750001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400GUCUAAUAAGAAAAAGAUC74.25192087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082418GTCTAATAAGAAAAAGATCGATCTTTTTCTTATTAGAC0.106700.045400.637900.500001.000001.00000


Target Position: 2666, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2666CAGAAUAGUAACUUGUUUU87.2996559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2664-2686GACAGAATAGTAACTTGTTTTCAAAAACAAGUUACUAUUCUGUCCAGAAUAGUAACUUGUUUUCAU10.311.622


Target Position: 3872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3872GCCAACAUACAUGCCUUCA77.6951639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7213890GCCAACATACATGCCTTCATGAAGGCATGTATGTTGGC0.105200.031700.775900.750000.989100.62500


Target Position: 4610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4610AGUGUCUAUAAUAAAACUA87.2305564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9934628AGTGTCTATAATAAAACTATAGTTTTATTATAGACACT0.693900.564700.534500.750000.940200.62500


Target Position: 4603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4603UGCAUAAAGUGUCUAUAAU82.44421038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2004621TGCATAAAGTGTCTATAATATTATAGACACTTTATGCA0.669700.121900.844800.750001.000001.00000


Target Position: 4333, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4333CAAACACUUACAGAAUUAU85.267733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7784351CAAACACTTACAGAATTATATAATTCTGTAAGTGTTTG0.241300.115000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4331-4353AGCAAACACTTACAGAATTATGAAUAAUUCUGUAAGUGUUUGCUCAAACACUUACAGAAUUAUGAU6.917.822


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516CUGUCAGUGUAUUUUCAAU90.4342338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453534CTGTCAGTGTATTTTCAATATTGAAAATACACTGACAG0.189000.051800.775900.750001.000001.00000


Target Position: 1222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1222AGGACAAAAGAAAGAACUU80.26761296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631240AGGACAAAAGAAAGAACTTAAGTTCTTTCTTTTGTCCT0.187500.032900.706900.750001.000001.00000


Target Position: 2275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275AGGCAUUUACUUCAAACUU76.34471812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942293AGGCATTTACTTCAAACTTAAGTTTGAAGTAAATGCCT0.070000.011900.706900.750001.000001.00000


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542GCCUUAUUUUGUUGUUGGU76.17821833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572560GCCTTATTTTGTTGTTGGTACCAACAACAAAATAAGGC0.076100.045500.646600.750001.000001.00000


Target Position: 4405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4405UCGUAAUUAAAGGAACAGA73.25552240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8534423TCGTAATTAAAGGAACAGATCTGTTCCTTTAATTACGA0.287600.124800.569000.500001.000001.00000


Target Position: 4324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4324AGUUAAAAGCAAACACUUA93.0615187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7044342AGTTAAAAGCAAACACTTATAAGTGTTTGCTTTTAACT0.305400.126400.672400.750000.989100.62500


Target Position: 3893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3893GAGUCACUGCCUAAUAAAU93.6776166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783911GAGTCACTGCCTAATAAATATTTATTAGGCAGTGACTC0.599800.115500.801700.750001.000001.00000


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594CCAGCAUUUGCAAUAAUAU87.5741538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122612CCAGCATTTGCAATAATATATATTATTGCAAATGCTGG0.453400.050800.801701.000000.972800.87500


Target Position: 682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682GAUGUCAAACAUCACUAAU87.7201526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
680-702CTGATGTCAAACATCACTAATAGAUUAGUGAUGUUUGACAUCAGGAUGUCAAACAUCACUAAUAGU20.320.522


Target Position: 4690, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4690GGAAUAUUGUAGAUAACUU97.66554

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4688-4710TTGGAATATTGTAGATAACTTCTAAGUUAUCUACAAUAUUCCAAGGAAUAUUGUAGAUAACUUCUU14.51.821


Target Position: 1475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475GAAGCAUUUGCAAAUGCAA93.9894153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1473-1495TTGAAGCATTTGCAAATGCAAGAUUGCAUUUGCAAAUGCUUCAAGAAGCAUUUGCAAAUGCAAGAU20.018.522


Target Position: 804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804CUUACAUUCAGGUUUCAUU82.8101996

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
802-824TGCTTACATTCAGGTTTCATTTTAAUGAAACCUGAAUGUAAGCACUUACAUUCAGGUUUCAUUUUU14.86.922


Target Position: 2986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2986ACUAACACUGUUACUCUUA82.08581076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673004ACTAACACTGTTACTCTTATAAGAGTAACAGTGTTAGT0.070000.008300.672400.750001.000001.00000


Target Position: 3501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3501CGAACACAUUGGAAGGAAA98.498241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333519CGAACACATTGGAAGGAAATTTCCTTCCAATGTGTTCG0.081600.016600.793101.000001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281GGAUAAAGAAAGCUAUUAC85.2577735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441299GGATAAAGAAAGCTATTACGTAATAGCTTTCTTTATCC0.129900.132000.689700.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336GCAGCUGAUGAAUCCAAAA93.403177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822354GCAGCTGATGAATCCAAAATTTTGGATTCATCAGCTGC0.125000.014200.853401.000001.000001.00000


Target Position: 2699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2699GCCCUUGGAAUUAUUUCUU73.50442191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932717GCCCTTGGAATTATTTCTTAAGAAATAATTCCAAGGGC0.537200.010500.862101.000001.000001.00000


Target Position: 4590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4590GUAUUGAAAUGUUUGCAUA96.731276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4588-4610AAGTATTGAAATGTTTGCATAAAUAUGCAAACAUUUCAAUACUUGUAUUGAAAUGUUUGCAUAAAU20.08.922


Target Position: 3432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3432CAGCCCACAUCAUCAUGAU88.0322500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023450CAGCCCACATCATCATGATATCATGATGATGTGGGCTG0.087900.061500.603400.750001.000001.00000


Target Position: 1957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957CAUGAAACUGCCUCAUAAA98.233943

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1955-1977ATCATGAAACTGCCTCATAAATTUUUAUGAGGCAGUUUCAUGAUCAUGAAACUGCCUCAUAAAUUU13.414.821


Target Position: 360, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360GAGUAUCUUCUUCCAAAAU87.3561555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343378GAGTATCTTCTTCCAAAATATTTTGGAAGAAGATACTC0.259500.107200.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
358-380CGGAGTATCTTCTTCCAAAATTTAUUUUGGAAGAAGAUACUCCGGAGUAUCUUCUUCCAAAAUUUU20.118.922


Target Position: 2592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592AACCAGCAUUUGCAAUAAU79.07541453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7742610AACCAGCATTTGCAATAATATTATTGCAAATGCTGGTT0.145100.021000.637900.500000.972801.00000


Target Position: 1628, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628CGAAAAGAAGUUAAGAUCU82.8304993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691646CGAAAAGAAGTTAAGATCTAGATCTTAACTTCTTTTCG0.085200.036100.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1626-1648CTCGAAAAGAAGTTAAGATCTTGAGAUCUUAACUUCUUUUCGAGCGAAAAGAAGUUAAGAUCUUGU16.014.832


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615CAGUUACCCAUCUCGAAAA91.4916272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651633CAGTTACCCATCTCGAAAATTTTCGAGATGGGTAACTG0.229600.058600.784500.750001.000001.00000


Target Position: 4576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4576AGAAGUAGCAAAAAGUAUU82.63991015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7374594AGAAGTAGCAAAAAGTATTAATACTTTTTGCTACTTCT0.259500.043300.715500.750001.000001.00000


Target Position: 1215, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215CAUUUGGAGGACAAAAGAA93.5967172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1213-1235TGCATTTGGAGGACAAAAGAAAGUUCUUUUGUCCUCCAAAUGCACAUUUGGAGGACAAAAGAAAGU12.220.122


Target Position: 2395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395AUCCAGUCUAAUAAGAAAA80.95321206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272413ATCCAGTCTAATAAGAAAATTTTCTTATTAGACTGGAT0.238200.056500.681000.500001.000001.00000


Target Position: 3024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024CAAUAGCAGGAGUUGUUGA90.3503344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3022-3044TGCAATAGCAGGAGTTGTTGAAAUCAACAACUCCUGCUAUUGCACAAUAGCAGGAGUUGUUGAAAU19.319.722


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515ACUGUCAGUGUAUUUUCAA84.0541846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915533ACTGTCAGTGTATTTTCAATTGAAAATACACTGACAGT0.302900.080700.560300.750001.000001.00000


Target Position: 28, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28GAUUAGAGAUCAUUUCUCA103.10110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
26-48AAGATTAGAGATCATTTCTCATTUGAGAAAUGAUCUCUAAUCUUGAUUAGAGAUCAUUUCUCAUUU14.811.623


Target Position: 3902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902CCUAAUAAAUAUAGCACUA96.54879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4713920CCTAATAAATATAGCACTATAGTGCTATATTTATTAGG0.500700.479500.672401.000001.000001.00000


Target Position: 4486, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486GAAUUAAAGUAGAUUUUAA107.382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6744504GAATTAAAGTAGATTTTAATTAAAATCTACTTTAATTC0.287500.083500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4484-4506CAGAATTAAAGTAGATTTTAAAAUUAAAAUCUACUUUAAUUCUGGAAUUAAAGUAGAUUUUAAAAU2.1-9.722


Target Position: 4536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4536CCCAUUUGGACUGUAACUG60.02343895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7734554CCCATTTGGACTGTAACTGCAGTTACAGTCCAAATGGG0.139700.014300.706900.750000.962000.75000


Target Position: 4700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4700AGAUAACUUCUGCUUUAAA94.4338138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9974718AGATAACTTCTGCTTTAAATTTAAAGCAGAAGTTATCT0.094000.007500.724100.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238CUUGAAAGGUACAACAAAA96.295385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351256CTTGAAAGGTACAACAAAATTTTGTTGTACCTTTCAAG0.571200.201300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1236-1258AACTTGAAAGGTACAACAAAAATUUUUGUUGUACCUUUCAAGUUCUUGAAAGGUACAACAAAAAUU12.212.222


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232UCAUUGUGGAGAAAGGAAA77.47371668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3862250TCATTGTGGAGAAAGGAAATTTCCTTTCTCCACAATGA0.787900.040800.724100.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UGAAUGGCCUUAUUUUGUU72.51572341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512554TGAATGGCCTTATTTTGTTAACAAAATAAGGCCATTCA0.217800.012600.577600.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769UCACCAAGCGGCUCCGAUA80.33611284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5192787TCACCAAGCGGCTCCGATATATCGGAGCCGCTTGGTGA0.167800.032100.681000.750000.907600.75000


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261AGAAGAAGCUAAAAGAAUU88.8887443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411279AGAAGAAGCTAAAAGAATTAATTCTTTTAGCTTCTTCT0.101500.032000.715500.750001.000001.00000


Target Position: 3255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255AGGCAAUGAUGUAUUUUUC73.85872140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8413273AGGCAATGATGTATTTTTCGAAAAATACATCATTGCCT0.080200.028600.672400.500001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187GUCUUGGCAGCAAUUAGAA87.1889568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331205GTCTTGGCAGCAATTAGAATTCTAATTGCTGCCAAGAC0.100300.009500.646600.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CAUCUCGAAAAGAAGUUAA88.7811447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201641CATCTCGAAAAGAAGTTAATTAACTTCTTTTCGAGATG0.154300.045500.620700.750000.989100.75000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417UGUAUUCUUUUCUGUAUUA87.1657570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491435TGTATTCTTTTCTGTATTATAATACAGAAAAGAATACA0.275800.061200.672400.750001.000001.00000


Target Position: 1959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959UGAAACUGCCUCAUAAAUU74.31352082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861977TGAAACTGCCTCATAAATTAATTTATGAGGCAGTTTCA0.091900.059000.715500.750001.000001.00000


Target Position: 3511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511GGAAGGAAAUGUCACAUUU91.0647297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803529GGAAGGAAATGTCACATTTAAATGTGACATTTCCTTCC0.057100.030900.870701.000001.000001.00000


Target Position: 3443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3443AUCAUGAUCAUUGAAAAAA75.5061926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553461ATCATGATCATTGAAAAAATTTTTTCAATGATCATGAT0.322600.061900.681000.500001.000001.00000


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644UGAUGAUCCUGAAACAAAA94.3801139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212662TGATGATCCTGAAACAAAATTTTGTTTCAGGATCATCA0.300500.028800.724100.750001.000001.00000


Target Position: 3066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066CACUGAAAGAUAAGAAAGA89.5299401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086AGCACTGAAAGATAAGAAAGAACUCUUUCUUAUCUUUCAGUGCUCACUGAAAGAUAAGAAAGAACU10.319.222


Target Position: 4615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4615CUAUAAUAAAACUAAACUU88.4253475

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4613-4635GTCTATAATAAAACTAAACTTTCAAGUUUAGUUUUAUUAUAGACCUAUAAUAAAACUAAACUUUCU9.8-5.912


Target Position: 3429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3429CAGCAGCCCACAUCAUCAU82.37511042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6693447CAGCAGCCCACATCATCATATGATGATGTGGGCTGCTG0.329900.175600.629300.750001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397CCAGUCUAAUAAGAAAAAG70.41622641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702415CCAGTCTAATAAGAAAAAGCTTTTTCTTATTAGACTGG0.094600.033900.706900.750001.000001.00000


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771ACCAAGCGGCUCCGAUACA71.24772512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352789ACCAAGCGGCTCCGATACATGTATCGGAGCCGCTTGGT0.084100.012300.646600.500000.918500.62500


Target Position: 3333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3333AGGAUGUUCUGUUAGUAUU83.8152872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5783351AGGATGTTCTGTTAGTATTAATACTAACAGAACATCCT0.148200.024400.836200.750001.000001.00000


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903CUAAUAAAUAUAGCACUAA90.4077340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6393921CTAATAAATATAGCACTAATTAGTGCTATATTTATTAG0.475400.487500.637900.750001.000001.00000


Target Position: 3450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3450UCAUUGAAAAAACCCCUUU63.70553503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8353468TCATTGAAAAAACCCCTTTAAAGGGGTTTTTTCAATGA0.081500.044700.724100.750001.000001.00000


Target Position: 4471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4471AUAAAUUUUAUAACAGAAU73.29982231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9924489ATAAATTTTATAACAGAATATTCTGTTATAAAATTTAT0.193200.078800.534500.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132CUGUUUCGCAGUUUCUCGA78.19131573

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
130-152ACCTGTTTCGCAGTTTCTCGAGGUCGAGAAACUGCGAAACAGGUCUGUUUCGCAGUUUCUCGAGGU21.021.123


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130UCAUUUACUGAUAAAGAAC66.07613198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471148TCATTTACTGATAAAGAACGTTCTTTATCAGTAAATGA0.063800.024900.577600.500001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732GCUGAUGCAGAGGCUCUAU81.63351134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691750GCTGATGCAGAGGCTCTATATAGAGCCTCTGCATCAGC0.096600.014400.810301.000000.956500.75000


Target Position: 3034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034AGUUGUUGAAAUGAAAAUG67.24673052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183052AGTTGTTGAAATGAAAATGCATTTTCATTTCAACAACT0.131300.065300.551700.500001.000001.00000


Target Position: 2057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057CGCAACCCCAAGAUCCUCC55.52964283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212075CGCAACCCCAAGATCCTCCGGAGGATCTTGGGGTTGCG0.154100.055900.551700.500001.000001.00000


Target Position: 4712, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4712CUUUAAAAAAGUUUUCUUU78.59421516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6324730CTTTAAAAAAGTTTTCTTTAAAGAAAACTTTTTTAAAG0.154700.069700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4710-4732TGCTTTAAAAAAGTTTTCTTTAAAAAGAAAACUUUUUUAAAGCACUUUAAAAAAGUUUUCUUUAAU5.5-9.111


Target Position: 1214, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GCAUUUGGAGGACAAAAGA84.756773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631232GCATTTGGAGGACAAAAGATCTTTTGTCCTCCAAATGC0.168700.008400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1212-1234TTGCATTTGGAGGACAAAAGAAAUCUUUUGUCCUCCAAAUGCAAGCAUUUGGAGGACAAAAGAAAU10.317.722


Target Position: 2991, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991CACUGUUACUCUUAGCAAU92.4527215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793009CACTGTTACTCTTAGCAATATTGCTAAGAGTAACAGTG0.059000.008000.784500.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2989-3011AACACTGTTACTCTTAGCAATTGAUUGCUAAGAGUAACAGUGUUCACUGUUACUCUUAGCAAUUGU19.719.033


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901CUGGUUUGAUGUGCACGAU78.01951593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764919CTGGTTTGATGTGCACGATATCGTGCACATCAAACCAG0.202700.169200.603400.750001.000001.00000


Target Position: 4035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4035UGGAUACAGAAAGUGAAAA77.98631598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3824053TGGATACAGAAAGTGAAAATTTTCACTTTCTGTATCCA0.333100.041100.844800.750001.000001.00000


Target Position: 2476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2476GGCUCUGGAUGAAAGUAUA101.06518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502494GGCTCTGGATGAAAGTATATATACTTTCATCCAGAGCC0.553200.025400.956901.000001.000001.00000


Target Position: 3435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3435CCCACAUCAUCAUGAUCAU88.3715480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7263453CCCACATCATCATGATCATATGATCATGATGATGTGGG0.104900.062300.836201.000000.978300.87500


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704UGGAAUUAUUUCUUUUAUU77.57791657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3842722TGGAATTATTTCTTTTATTAATAAAAGAAATAATTCCA0.886300.040900.836200.750001.000001.00000


Target Position: 4397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4397CAGAGACUUCGUAAUUAAA99.121633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6864415CAGAGACTTCGTAATTAAATTTAATTACGAAGTCTCTG0.445400.017600.784500.750001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905CCAUGGAUGAGAUUGAGAA95.5519100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081923CCATGGATGAGATTGAGAATTCTCAATCTCATCCATGG0.159500.013300.672401.000001.000001.00000


Target Position: 3408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3408ACUAUGCCAAAGCCAAAAU69.05812816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3183426ACTATGCCAAAGCCAAAATATTTTGGCTTTGGCATAGT0.398300.049000.698300.750000.940201.00000


Target Position: 4280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4280GUUAAAUACUUUUUAAUAU89.8187379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4278-4300ATGTTAAATACTTTTTAATATTTAUAUUAAAAAGUAUUUAACAUGUUAAAUACUUUUUAAUAUUUU-7.5-7.512


Target Position: 1587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587GAAAUUUGGAAUUCAGAAA90.0716362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1585-1607GGGAAATTTGGAATTCAGAAATGUUUCUGAAUUCCAAAUUUCCCGAAAUUUGGAAUUCAGAAAUGU20.4-3.322


Target Position: 454, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454GAAGAAGAACUUUUUUAAA97.059164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
452-474AAGAAGAAGAACTTTTTTAAACTUUUAAAAAAGUUCUUCUUCUUGAAGAAGAACUUUUUUAAACUU-9.119.112


Target Position: 4437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4437UCAAGUGGAGAGAAAUCAU79.36121415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8564455TCAAGTGGAGAGAAATCATATGATTTCTCTCCACTTGA0.178800.035100.569000.750001.000001.00000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624UGCUGGUGUUUGGAGAAAU74.54062055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
902642TGCTGGTGTTTGGAGAAATATTTCTCCAAACACCAGCA0.076900.010100.844800.750001.000001.00000


Target Position: 1602, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602GAAAUGUUCACUUCAGUUA91.9367248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791620GAAATGTTCACTTCAGTTATAACTGAAGTGAACATTTC0.072900.023600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1600-1622CAGAAATGTTCACTTCAGTTACCUAACUGAAGUGAACAUUUCUGGAAAUGUUCACUUCAGUUACCU19.25.323


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512UCUUCAAGAUAAUUGAUAA94.5898132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391530TCTTCAAGATAATTGATAATTATCAATTATCTTGAAGA0.154400.012300.689700.750000.983700.75000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129UCCGAACCGUUGUUUCUUU68.78252845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203147TCCGAACCGTTGTTTCTTTAAAGAAACAACGGTTCGGA0.067100.028700.870700.750001.000001.00000


Target Position: 3523, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3523CACAUUUGGUGAAGUUGUA91.4011278

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3521-3543GTCACATTTGGTGAAGTTGTATTUACAACUUCACCAAAUGUGACCACAUUUGGUGAAGUUGUAUUU17.812.122


Target Position: 18, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18GAUUCCUAAAGAUUAGAGA88.608461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
16-38CAGATTCCTAAAGATTAGAGATCUCUCUAAUCUUUAGGAAUCUGGAUUCCUAAAGAUUAGAGAUCU11.619.932


Target Position: 4199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4199CUGGCACAGAAAGGCAUCU67.53483013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8894217CTGGCACAGAAAGGCATCTAGATGCCTTTCTGTGCCAG0.098100.014700.560300.500000.972800.62500


Target Position: 478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478CAAUAAAAGUGAAAAAGAU95.0763115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
476-498AACAATAAAAGTGAAAAAGATAAAUCUUUUUCACUUUUAUUGUUCAAUAAAAGUGAAAAAGAUAAU5.5-9.712


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321GCCGCUGUUCGUUUCCUUU76.56531785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369339GCCGCTGTTCGTTTCCTTTAAAGGAAACGAACAGCGGC0.216200.107001.000001.000001.000001.00000


Target Position: 1586, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586GGAAAUUUGGAAUUCAGAA94.14148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606AGGGAAATTTGGAATTCAGAAATUUCUGAAUUCCAAAUUUCCCUGGAAAUUUGGAAUUCAGAAAUU20.40.412


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251ACCCAGGCAAUGAUGUAUU70.4722632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4733269ACCCAGGCAATGATGTATTAATACATCATTGCCTGGGT0.184400.047200.844800.750001.000001.00000


Target Position: 4494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4494GUAGAUUUUAAAAGAUAAA90.5809328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4492-4514AAGTAGATTTTAAAAGATAAAATUUUAUCUUUUAAAAUCUACUUGUAGAUUUUAAAAGAUAAAAUU6.96.911


Target Position: 91, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
91AGGUGCAACGGAAGCCAGA75.15271979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960109AGGTGCAACGGAAGCCAGATCTGGCTTCCGTTGCACCT0.148000.016900.620700.500000.951101.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279UGGGAUAAAGAAAGCUAUU73.46242197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321297TGGGATAAAGAAAGCTATTAATAGCTTTCTTTATCCCA0.162900.164700.836200.750001.000001.00000


Target Position: 1241, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GAAAGGUACAACAAAAAUU87.3076558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861259GAAAGGTACAACAAAAATTAATTTTTGTTGTACCTTTC0.242700.105000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1239-1261TTGAAAGGTACAACAAAAATTTAAAUUUUUGUUGUACCUUUCAAGAAAGGUACAACAAAAAUUUAU-3.318.612


Target Position: 2974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2974CUAUGGUUGGCAACUAACA84.9194764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2972-2994ATCTATGGTTGGCAACTAACACTUGUUAGUUGCCAACCAUAGAUCUAUGGUUGGCAACUAACACUU12.920.033


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825UGGUUUGAUGACCCUAAAA81.10871187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362843TGGTTTGATGACCCTAAAATTTTAGGGTCATCAAACCA0.289200.036700.844800.750000.907600.62500


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774UGUUGAUGGACAGGAUAUU73.38692216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181792TGTTGATGGACAGGATATTAATATCCTGTCCATCAACA0.155400.013000.698300.750001.000001.00000


Target Position: 2595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595CAGCAUUUGCAAUAAUAUU86.8955594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322613CAGCATTTGCAATAATATTAATATTATTGCAAATGCTG0.606400.056200.775900.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2593-2615ACCAGCATTTGCAATAATATTTTAAUAUUAUUGCAAAUGCUGGUCAGCAUUUGCAAUAAUAUUUUU-8.618.522


Target Position: 3705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3705UUGAUGGCAAAGAAAUAAA74.59462046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393723TTGATGGCAAAGAAATAAATTTATTTCTTTGCCATCAA0.271200.053200.646600.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515UCAAGAUAAUUGAUAAUAA94.6354131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331533TCAAGATAATTGATAATAATTATTATCAATTATCTTGA0.162500.063100.689700.750001.000001.00000


Target Position: 3158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3158CAGAAGUUUGAACAUAUGU78.96651469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213176CAGAAGTTTGAACATATGTACATATGTTCAAACTTCTG0.258500.104100.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3156-3178AGCAGAAGTTTGAACATATGTATACAUAUGUUCAAACUUCUGCUCAGAAGUUUGAACAUAUGUAUU13.317.722


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975UUGGUGACAAAAUUGGAAU64.55163401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899993TTGGTGACAAAATTGGAATATTCCAATTTTGTCACCAA0.115400.014100.637900.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253CCAGGCAAUGAUGUAUUUU76.1831832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2653271CCAGGCAATGATGTATTTTAAAATACATCATTGCCTGG0.376200.057100.844801.000001.000001.00000


Target Position: 4396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4396UCAGAGACUUCGUAAUUAA91.0514300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7614414TCAGAGACTTCGTAATTAATTAATTACGAAGTCTCTGA0.408000.014600.689700.750001.000001.00000


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653UGAAACAAAACGACAGAAU71.11512536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3272671TGAAACAAAACGACAGAATATTCTGTCGTTTTGTTTCA0.234800.099400.715500.750001.000001.00000


Target Position: 3510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3510UGGAAGGAAAUGUCACAUU72.65442327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583528TGGAAGGAAATGTCACATTAATGTGACATTTCCTTCCA0.125400.076400.836200.750001.000001.00000


Target Position: 2680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680GUUUUCACUAUUGUUUCUA79.04021459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2678-2700TTGTTTTCACTATTGTTTCTAGCUAGAAACAAUAGUGAAAACAAGUUUUCACUAUUGUUUCUAGCU19.214.922


Target Position: 3307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3307GGUGGCACAUAAACUCAUG78.91021476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803325GGTGGCACATAAACTCATGCATGAGTTTATGTGCCACC0.145400.014200.698300.750001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390GGAAUAUUCUAUUGGACAA100.49524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631408GGAATATTCTATTGGACAATTGTCCAATAGAATATTCC0.123800.097400.724101.000001.000001.00000


Target Position: 3258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3258CAAUGAUGUAUUUUUCCUA97.969248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3256-3278GGCAATGATGTATTTTTCCTATGUAGGAAAAAUACAUCAUUGCCCAAUGAUGUAUUUUUCCUAUGU18.713.621


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591CAACCAGCAUUUGCAAUAA91.9784241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532609CAACCAGCATTTGCAATAATTATTGCAAATGCTGGTTG0.123100.019700.612100.750000.972801.00000


Target Position: 4570, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4570GAUUAUAGAAGUAGCAAAA98.605240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9034588GATTATAGAAGTAGCAAAATTTTGCTACTTCTATAATC0.069200.024500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4568-4590AAGATTATAGAAGTAGCAAAAAGUUUUGCUACUUCUAUAAUCUUGAUUAUAGAAGUAGCAAAAAGU19.7-2.732


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601AGAAAUGUUCACUUCAGUU84.5632793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251619AGAAATGTTCACTTCAGTTAACTGAAGTGAACATTTCT0.095000.036000.577600.750000.934800.62500


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839GGAAGACAAAUACACAAAA96.55778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100857GGAAGACAAATACACAAAATTTTGTGTATTTGTCTTCC0.835300.465200.870701.000001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622CCAUCUCGAAAAGAAGUUA86.6468611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611640CCATCTCGAAAAGAAGTTATAACTTCTTTTCGAGATGG0.187000.077100.810301.000000.962000.62500


Target Position: 4442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4442UGGAGAGAAAUCAUAGUUU78.3851552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6104460TGGAGAGAAATCATAGTTTAAACTATGATTTCTCTCCA0.140000.043500.844800.750001.000001.00000


Target Position: 1795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795GACCAUAAAUGUAAGGUUU87.7829521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1793-1815AGGACCATAAATGTAAGGTTTCTAAACCUUACAUUUAUGGUCCUGACCAUAAAUGUAAGGUUUCUU18.620.033


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462CCCCUUUGAUUGACAGCUA87.4242549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6173480CCCCTTTGATTGACAGCTATAGCTGTCAATCAAAGGGG0.208000.021000.819001.000001.000001.00000


Target Position: 4306, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4306GAUAUGACAUUUAUUCAAA100.64721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6084324GATATGACATTTATTCAAATTTGAATAAATGTCATATC0.140100.042600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4304-4326TAGATATGACATTTATTCAAAGTUUUGAAUAAAUGUCAUAUCUAGAUAUGACAUUUAUUCAAAGUU8.916.022


Target Position: 3257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257GCAAUGAUGUAUUUUUCCU82.72181006

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3255-3277AGGCAATGATGTATTTTTCCTATAGGAAAAAUACAUCAUUGCCUGCAAUGAUGUAUUUUUCCUAUU14.313.632


Target Position: 73, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
73AGCAACCAGAUAAAAGAGA72.12692390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97191AGCAACCAGATAAAAGAGATCTCTTTTATCTGGTTGCT0.794900.025600.629300.500001.000001.00000


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474UGAACAAUAAAAGUGAAAA81.53381142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475492TGAACAATAAAAGTGAAAATTTTCACTTTTATTGTTCA0.328100.220600.724100.750001.000001.00000


Target Position: 3060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3060GACAAGCACUGAAAGAUAA98.417542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3873078GACAAGCACTGAAAGATAATTATCTTTCAGTGCTTGTC0.230900.080300.784500.750001.000001.00000


Target Position: 3433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3433AGCCCACAUCAUCAUGAUC70.18152675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673451AGCCCACATCATCATGATCGATCATGATGATGTGGGCT0.113300.072700.672400.500000.978300.62500


Target Position: 3189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189UGCAGGUACCAUACAGAAA84.5149797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6873207TGCAGGTACCATACAGAAATTTCTGTATGGTACCTGCA0.115100.036700.853400.750001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507UGAAAUCUUCAAGAUAAUU73.87962138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701525TGAAATCTTCAAGATAATTAATTATCTTGAAGATTTCA0.313900.032400.715500.750001.000001.00000


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213UGAGGAAAGCACACAUCUU82.8728987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083231TGAGGAAAGCACACATCTTAAGATGTGTGCTTTCCTCA0.372900.038300.586200.750001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836GCUGGAAGACAAAUACACA98.671839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544854GCTGGAAGACAAATACACATGTGTATTTGTCTTCCAGC0.806500.299700.646600.750001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UGGCAGCUGGAAGACAAAU68.24232922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361849TGGCAGCTGGAAGACAAATATTTGTCTTCCAGCTGCCA0.547800.051800.836200.750001.000001.00000


Target Position: 4457, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4457GUUUAAACUGCAUUAUAAA96.086589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9514475GTTTAAACTGCATTATAAATTTATAATGCAGTTTAAAC0.062700.014200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4455-4477TAGTTTAAACTGCATTATAAATTUUUAUAAUGCAGUUUAAACUAGUUUAAACUGCAUUAUAAAUUU-8.00.022


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731AGCUGAUGCAGAGGCUCUA83.7122886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891749AGCTGATGCAGAGGCTCTATAGAGCCTCTGCATCAGCT0.090800.014700.681000.750000.956500.75000


Target Position: 3055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055GUCUGGACAAGCACUGAAA91.2111289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313073GTCTGGACAAGCACTGAAATTTCAGTGCTTGTCCAGAC0.192200.026900.819000.750001.000001.00000


Target Position: 685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685GUCAAACAUCACUAAUAGA92.4364216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
683-705ATGTCAAACATCACTAATAGAAGUCUAUUAGUGAUGUUUGACAUGUCAAACAUCACUAAUAGAAGU2.820.532


Target Position: 3500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3500CCGAACACAUUGGAAGGAA81.71981122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9053518CCGAACACATTGGAAGGAATTCCTTCCAATGTGTTCGG0.068900.016700.741401.000001.000001.00000


Target Position: 2521, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521GAAGCUAAAUUUAACUGAA100.72420

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2519-2541ATGAAGCTAAATTTAACTGAATGUUCAGUUAAAUUUAGCUUCAUGAAGCUAAAUUUAACUGAAUGU20.318.322


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552GGCUUGACAAGUUGUAUAU87.8439514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897570GGCTTGACAAGTTGTATATATATACAACTTGTCAAGCC0.084700.010400.956901.000001.000001.00000


Target Position: 2272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2272GAAAGGCAUUUACUUCAAA95.57999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392290GAAAGGCATTTACTTCAAATTTGAAGTAAATGCCTTTC0.205900.054600.672400.750001.000001.00000


Target Position: 958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958CAAGAUUAAUGAAGGAAUU86.4751620

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978TCCAAGATTAATGAAGGAATTGGAAUUCCUUCAUUAAUCUUGGACAAGAUUAAUGAAGGAAUUGGU18.76.922


Target Position: 1128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128CUUCAUUUACUGAUAAAGA87.6518535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1126-1148ATCTTCATTTACTGATAAAGAACUCUUUAUCAGUAAAUGAAGAUCUUCAUUUACUGAUAAAGAACU6.97.422


Target Position: 3059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3059GGACAAGCACUGAAAGAUA101.73415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3173077GGACAAGCACTGAAAGATATATCTTTCAGTGCTTGTCC0.238900.068500.827601.000001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GGAGGACAAAAGAAAGAAC79.78381364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6141238GGAGGACAAAAGAAAGAACGTTCTTTCTTTTGTCCTCC0.222800.021400.724100.750001.000001.00000


Target Position: 4669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4669UGAAUAUAUCUUCUCUCAA88.9608437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464687TGAATATATCTTCTCTCAATTGAGAGAAGATATATTCA0.243600.063200.577600.750000.967400.62500


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252CCCAGGCAAUGAUGUAUUU80.80271227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3643270CCCAGGCAATGATGTATTTAAATACATCATTGCCTGGG0.218700.053200.991401.000001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596AGCAUUUGCAAUAAUAUUU75.74251895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2152614AGCATTTGCAATAATATTTAAATATTATTGCAAATGCT0.596400.067600.853400.750000.972800.75000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526GAUAAUAAGCCAAGUAUUG77.74431631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831544GATAATAAGCCAAGTATTGCAATACTTGGCTTATTATC0.285700.036100.534500.500001.000001.00000


Target Position: 4277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4277GAUGUUAAAUACUUUUUAA103.2738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4275-4297GAGATGTTAAATACTTTTTAATAUUAAAAAGUAUUUAACAUCUCGAUGUUAAAUACUUUUUAAUAU-3.86.922


Target Position: 4779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4779UCCUGUUGUAUAUGUCUAU76.74821759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7134797TCCTGTTGTATATGTCTATATAGACATATACAACAGGA0.257800.020100.827600.750001.000001.00000


Target Position: 3407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3407GACUAUGCCAAAGCCAAAA83.6745890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343425GACTATGCCAAAGCCAAAATTTTGGCTTTGGCATAGTC0.400900.036100.819000.750000.940201.00000


Target Position: 2475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475AGGCUCUGGAUGAAAGUAU76.05141846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312493AGGCTCTGGATGAAAGTATATACTTTCATCCAGAGCCT0.271100.020400.801700.750001.000001.00000


Target Position: 851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851CACAAAAUUAGAAAACAGU79.45991402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
849-871TACACAAAATTAGAAAACAGTTTACUGUUUUCUAAUUUUGUGUACACAAAAUUAGAAAACAGUUUU10.35.312


Target Position: 3032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032GGAGUUGUUGAAAUGAAAA94.9477121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163050GGAGTTGTTGAAATGAAAATTTTCATTTCAACAACTCC0.276700.016500.870701.000001.000001.00000


Target Position: 2715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715CUUUUAUUACAUUUUUCCU75.47461932

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2713-2735TTCTTTTATTACATTTTTCCTTCAGGAAAAAUGUAAUAAAAGAACUUUUAUUACAUUUUUCCUUCU14.3-9.712


Target Position: 4300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4300UGUUUAGAUAUGACAUUUA88.684454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6214318TGTTTAGATATGACATTTATAAATGTCATATCTAAACA0.137600.045800.672400.750001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626CUCGAAAAGAAGUUAAGAU83.7075887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051644CTCGAAAAGAAGTTAAGATATCTTAACTTCTTTTCGAG0.139400.042100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1624-1646ATCTCGAAAAGAAGTTAAGATCTAUCUUAACUUCUUUUCGAGAUCUCGAAAAGAAGUUAAGAUCUU14.616.833


Target Position: 4438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4438CAAGUGGAGAGAAAUCAUA93.6226170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7634456CAAGTGGAGAGAAATCATATATGATTTCTCTCCACTTG0.159500.028000.603400.750001.000001.00000


Target Position: 1786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786GGAUAUUAGGACCAUAAAU93.1974181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1784-1806CAGGATATTAGGACCATAAATGTAUUUAUGGUCCUAAUAUCCUGGGAUAUUAGGACCAUAAAUGUU12.83.533


Target Position: 853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853CAAAAUUAGAAAACAGUUU79.03041460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
851-873CACAAAATTAGAAAACAGTTTTTAAACUGUUUUCUAAUUUUGUGCAAAAUUAGAAAACAGUUUUUU17.8-9.721


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013ACAUUUUUCACUGGGUUUA72.752313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661031ACATTTTTCACTGGGTTTATAAACCCAGTGAAAAATGT0.074600.012800.672400.750001.000001.00000


Target Position: 2620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620GAUUAUAGGGGUUUUUACA93.3808178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2618-2640AAGATTATAGGGGTTTTTACAAGUGUAAAAACCCCUAUAAUCUUGAUUAUAGGGGUUUUUACAAGU0.0-2.732


Target Position: 3441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3441UCAUCAUGAUCAUUGAAAA92.7695204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6963459TCATCATGATCATTGAAAATTTTCAATGATCATGATGA0.207600.062100.724100.750001.000001.00000


Target Position: 4564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4564CUAAAAGAUUAUAGAAGUA97.101161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4562-4584TGCTAAAAGATTATAGAAGTAGCUACUUCUAUAAUCUUUUAGCACUAAAAGAUUAUAGAAGUAGCU18.97.122


Target Position: 852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852ACAAAAUUAGAAAACAGUU77.59411652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894870ACAAAATTAGAAAACAGTTAACTGTTTTCTAATTTTGT0.084000.078400.560300.750001.000001.00000


Target Position: 3988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3988UGUUAGACAGCCUCAUAUU80.67321241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3134006TGTTAGACAGCCTCATATTAATATGAGGCTGTCTAACA0.454700.052900.698300.750001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829CCUGGCAGCUGGAAGACAA90.6933319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637847CCTGGCAGCTGGAAGACAATTGTCTTCCAGCTGCCAGG0.487800.019900.698301.000001.000001.00000


Target Position: 4357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4357GGUAUCUGUUUAACAUUUC73.94962122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8854375GGTATCTGTTTAACATTTCGAAATGTTAAACAGATACC0.173400.010700.681000.750001.000001.00000


Target Position: 865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865ACAGUUUUUUCAUGCUAUA86.5296617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998883ACAGTTTTTTCATGCTATATATAGCATGAAAAAACTGT0.093400.007500.663800.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894UGAAAAUGUCACCAUGGAU80.42281270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971912TGAAAATGTCACCATGGATATCCATGGTGACATTTTCA0.054800.011400.543100.750000.989101.00000


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344UGAAUCCAAAAGUGAAAUU68.3152914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062362TGAATCCAAAAGTGAAATTAATTTCACTTTTGGATTCA0.254500.029300.715500.750001.000001.00000


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838UGGAAGACAAAUACACAAA83.3706926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544856TGGAAGACAAATACACAAATTTGTGTATTTGTCTTCCA0.826700.451400.844800.750001.000001.00000


Target Position: 2255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GAUGAACUCAUGAAAGAGA92.7352206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2253-2275ATGATGAACTCATGAAAGAGAAAUCUCUUUCAUGAGUUCAUCAUGAUGAACUCAUGAAAGAGAAAU19.119.222


Target Position: 4269, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4269CUGUAUGAGAUGUUAAAUA93.6793165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9544287CTGTATGAGATGTTAAATATATTTAACATCTCATACAG0.062500.033800.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4267-4289GACTGTATGAGATGTTAAATACTUAUUUAACAUCUCAUACAGUCCUGUAUGAGAUGUUAAAUACUU-0.321.522


Target Position: 3058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3058UGGACAAGCACUGAAAGAU74.88372014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5013076TGGACAAGCACTGAAAGATATCTTTCAGTGCTTGTCCA0.185600.057400.663800.750001.000001.00000


Target Position: 1249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249CAACAAAAAUUUAGAAGAA97.978247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1247-1269TACAACAAAAATTTAGAAGAAGCUUCUUCUAAAUUUUUGUUGUACAACAAAAAUUUAGAAGAAGCU20.25.622


Target Position: 2512, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512GAGGAUUAUGAAGCUAAAU83.8723866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852530GAGGATTATGAAGCTAAATATTTAGCTTCATAATCCTC0.244600.014200.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2510-2532TGGAGGATTATGAAGCTAAATTTAUUUAGCUUCAUAAUCCUCCAGAGGAUUAUGAAGCUAAAUUUU18.319.922


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488GAAAAAGAUAAGAAGGAAA95.4626104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518506GAAAAAGATAAGAAGGAAATTTCCTTCTTATCTTTTTC0.168200.047700.672400.750001.000001.00000


Target Position: 1321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1321UGCUUUCCUGCUGAUCUAU69.97962697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511339TGCTTTCCTGCTGATCTATATAGATCAGCAGGAAAGCA0.309400.025300.810300.750000.945700.75000


Target Position: 4311, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4311GACAUUUAUUCAAAGUUAA95.913293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6984329GACATTTATTCAAAGTTAATTAACTTTGAATAAATGTC0.111900.040300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4309-4331ATGACATTTATTCAAAGTTAAAAUUAACUUUGAAUAAAUGUCAUGACAUUUAUUCAAAGUUAAAAU4.96.921


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GAGAUAGGCUGGUUUGAUG82.58371020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867911GAGATAGGCTGGTTTGATGCATCAAACCAGCCTATCTC0.356000.011200.655200.500001.000001.00000


Target Position: 3862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862AGCAAAGGAGGCCAACAUA85.5233710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553880AGCAAAGGAGGCCAACATATATGTTGGCCTCCTTTGCT0.076400.054000.810300.750001.000001.00000


Target Position: 2262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262UCAUGAAAGAGAAAGGCAU75.25891966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572280TCATGAAAGAGAAAGGCATATGCCTTTCTCTTTCATGA0.373900.097600.569000.750001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025GGGUUUAUAGUAGGAUUUA91.9381247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251043GGGTTTATAGTAGGATTTATAAATCCTACTATAAACCC0.066400.027900.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1023-1045CTGGGTTTATAGTAGGATTTACAUAAAUCCUACUAUAAACCCAGGGGUUUAUAGUAGGAUUUACAU18.713.932


Target Position: 4780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4780CCUGUUGUAUAUGUCUAUU83.351929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3264798CCTGTTGTATATGTCTATTAATAGACATATACAACAGG0.245000.047400.836201.000001.000001.00000


Target Position: 3254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254CAGGCAAUGAUGUAUUUUU86.6975609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053272CAGGCAATGATGTATTTTTAAAAATACATCATTGCCTG0.087500.023400.784500.750001.000001.00000