siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 1637   2374   2520  
Biltr, Ernai 1335   1911  
Biltr, Rnaxs, Sidirect 1258   1772   1779   2071   2073   2171   2181   2197   2200   2201   2222   2242   2372   2385   2418   2433   2439   2463   2505   2507  
2518   2527   2528   2531   2544   2553   2565   2567  
Biltr, Ernai, Rnaxs 158   1901   2160  
Biltr, Rnaxs 56   57   68   69   70   71   72   74   75   79   80   81   82   113   114   115   116   117   118   124  
125   128   136   137   138   139   149   150   151   152   153   154   155   156   157   159   289   290   291   292  
313   314   317   318   320   354   355   408   415   429   431   480   489   551   559   569   570   571   575   576  
577   579   580   581   588   589   590   627   628   629   630   631   633   639   659   660   672   718   724   725  
730   731   732   733   734   735   736   737   738   739   740   741   742   744   745   746   784   785   786   817  
818   819   820   829   830   832   833   834   835   836   838   841   842   847   914   931   932   936   937   964  
967   968   969   970   972   973   974   975   976   981   983   984   989   990   991   1020   1098   1147   1153   1160  
1161   1165   1166   1167   1170   1179   1211   1212   1213   1215   1216   1218   1219   1220   1224   1225   1226   1227   1230   1231  
1244   1257   1259   1284   1308   1309   1310   1312   1317   1318   1319   1320   1342   1343   1344   1367   1395   1401   1402   1404  
1405   1406   1407   1408   1410   1411   1413   1414   1428   1429   1430   1431   1432   1433   1435   1436   1441   1442   1443   1444  
1445   1450   1451   1452   1462   1463   1464   1465   1466   1467   1469   1470   1471   1518   1519   1548   1549   1592   1593   1599  
1607   1608   1609   1610   1612   1613   1614   1615   1616   1617   1622   1623   1624   1625   1626   1633   1634   1635   1636   1638  
1640   1641   1644   1645   1646   1647   1648   1649   1650   1655   1658   1659   1660   1661   1662   1667   1668   1669   1731   1732  
1733   1738   1739   1745   1746   1751   1752   1767   1768   1769   1773   1775   1778   1780   1784   1785   1786   1788   1789   1799  
1800   1812   1813   1814   1815   1820   1833   1834   1835   1836   1837   1840   1841   1868   1895   1896   1897   1898   1899   1900  
1902   1903   1921   1931   1932   1933   1938   1939   1940   1946   1947   1948   1959   1960   1967   1968   1969   1970   1971   1972  
1978   1979   1982   1988   1989   1990   1991   2015   2033   2034   2035   2036   2042   2045   2069   2070   2072   2074   2078   2079  
2080   2083   2084   2092   2093   2094   2095   2096   2097   2111   2112   2113   2114   2115   2135   2136   2137   2140   2145   2148  
2149   2150   2151   2154   2155   2156   2157   2158   2159   2161   2162   2163   2167   2168   2169   2170   2176   2177   2178   2179  
2180   2182   2186   2187   2194   2195   2196   2199   2205   2208   2209   2212   2213   2219   2220   2221   2223   2226   2227   2233  
2234   2237   2238   2240   2241   2243   2244   2245   2251   2252   2255   2256   2261   2262   2263   2264   2265   2276   2300   2301  
2303   2320   2321   2322   2323   2324   2326   2327   2331   2335   2336   2345   2368   2369   2371   2373   2375   2380   2381   2382  
2386   2394   2395   2396   2414   2416   2417   2431   2432   2434   2435   2436   2437   2438   2445   2446   2450   2451   2459   2460  
2461   2462   2464   2465   2470   2483   2484   2485   2486   2487   2488   2489   2490   2491   2492   2493   2498   2499   2504   2506  
2508   2512   2513   2514   2515   2516   2517   2519   2521   2522   2523   2524   2525   2526   2529   2530   2532   2533   2534   2538  
2539   2541   2542   2543   2546   2551   2552   2554   2555   2556   2557   2558   2559   2560   2561   2562   2563   2564   2566   2568  
2569   2570   2571   2572   2573   2574   2575   2576   2577   2578   2579   2580   2581   2582   2583   2584   2585   2586   2587   2588  
2589   2590  
Biltr, Ernai, Sidirect 2109   2407  
Biltr, Sidirect 162   1334   2098   2190   2216   2360   2387   2409   2419   2428   2494  


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572AAAAAAAAAAAAAAAAAAA83.5835235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322590AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999300.997600.500000.500001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577AAAAAAAAAAAAAAAAAAA83.5835240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382595AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999500.998700.500000.500001.000001.00000


Target Position: 2238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2238GUUGCUUGUUGUUUGAGAA93.73241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5552256GTTGCTTGTTGTTTGAGAATTCTCAAACAACAAGCAAC0.024900.007200.474100.750001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237AGUUGCUUGUUGUUUGAGA82.6075287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362255AGTTGCTTGTTGTTTGAGATCTCAAACAACAAGCAACT0.024900.009400.482800.500001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636GGCAAGAAGACUGACAAAA87.1675156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1391654GGCAAGAAGACTGACAAAATTTTGTCAGTCTTCTTGCC0.272800.152901.000001.000001.000001.00000


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167CCACUCCCCCUCGCCCAUC49.2442232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911185CCACTCCCCCTCGCCCATCGATGGGCGAGGGGGAGTGG0.303000.297400.663800.750001.000001.00000


Target Position: 2487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2487CAGGAGCCAUAGGAAUAUC73.3955774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052505CAGGAGCCATAGGAATATCGATATTCCTATGGCTCCTG0.067300.002700.603400.500001.000001.00000


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570GCUCCGACCAGGCUACAUU81.1864364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424588GCTCCGACCAGGCTACATTAATGTAGCCTGGTCGGAGC0.065900.022500.844801.000000.983700.87500


Target Position: 2580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2580AAAAAAAAAAAAAAAAAAA83.5835243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002598AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.999000.500000.500001.000001.00000


Target Position: 1649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649ACAAAAAGUACCUGAUGAU82.1917310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021667ACAAAAAGTACCTGATGATATCATCAGGTACTTTTTGT0.074200.008200.525900.750001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225ACCCAUCGAGAAACUGCAC60.3071592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561243ACCCATCGAGAAACTGCACGTGCAGTTTCTCGATGGGT0.017000.001900.560300.500001.000001.00000


Target Position: 80, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
80CUCCCUUUAUCUCCUCCUU74.0076736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26198CTCCCTTTATCTCCTCCTTAAGGAGGAGATAAAGGGAG0.224700.248900.672400.750001.000001.00000


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541AAAGAAAAUAAAGUAAUAA88.6306119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732559AAAGAAAATAAAGTAATAATTATTACTTTATTTTCTTT0.163700.119400.465500.500001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639CCAUGUCUAUCCCCAGCCU77.2078558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512657CCATGTCTATCCCCAGCCTAGGCTGGGGATAGACATGG0.048700.042300.500000.750001.000001.00000


Target Position: 2140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140GGUAUGCAGUAACUUGGGU78.0662509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5652158GGTATGCAGTAACTTGGGTACCCAAGTTACTGCATACC0.015300.006500.500000.750001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319CAAUUCAAGUGAUCCGCAA91.029670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951337CAATTCAAGTGATCCGCAATTGCGGATCACTTGAATTG0.054800.037400.500000.750001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464ACUUUAGAGAGAGUAAAAU77.1831563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3032482ACTTTAGAGAGAGTAAAATATTTTACTCTCTCTAAAGT0.117700.061600.698300.750001.000001.00000


Target Position: 2520, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CUUUAAUGCUACAUUUUAA98.703413

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10252019CTTTAATGCTACATTTTAA1/0/1/093.44BAG3NM_004281.31NANANA10:121437280..121437298(+)00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942538CTTTAATGCTACATTTTAATTAAAATGTAGCATTAAAG0.198100.031900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2518-2540GACTTTAATGCTACATTTTAAAAUUAAAAUGUAGCAUUAAAGUCCUUUAAUGCUACAUUUUAAAAU-1.4-1.422


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199UGCUUUUCUUCUAUAUUCU75.1543671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722217TGCTTTTCTTCTATATTCTAGAATATAGAAGAAAAGCA0.132400.003600.629300.500001.000001.00000


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978GCGACUUCAAACCCCAGCA78.5392483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281996GCGACTTCAAACCCCAGCATGCTGGGGTTTGAAGTCGC0.217100.046600.569000.750001.000001.00000


Target Position: 2227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2227CAAAUAAAGAAGUUGCUUG76.0086625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402245CAAATAAAGAAGTTGCTTGCAAGCAACTTCTTTATTTG0.022000.003300.500000.500001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428UCCUCCCAGCCCUGGCCCU46.50952339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971446TCCTCCCAGCCCTGGCCCTAGGGCCAGGGCTGGGAGGA0.113600.011500.525900.500000.907601.00000


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431UCCCAGCCCUGGCCCUUCU53.59682029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291449TCCCAGCCCTGGCCCTTCTAGAAGGGCCAGGGCTGGGA0.095700.006100.646600.500000.907600.75000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342GUGGAUUCUAAACCUGUUU73.6649759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431360GTGGATTCTAAACCTGTTTAAACAGGTTTAGAATCCAC0.167000.001800.793100.750000.951100.75000


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326UUGUGCACUGUCUUUUGUA78.0365510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572344TTGTGCACTGTCTTTTGTATACAAAAGACAGTGCACAA0.151400.018100.465500.500001.000001.00000


Target Position: 150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
150CACGUCACCCCCGCCUUUA73.558765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320168CACGTCACCCCCGCCTTTATAAAGGCGGGGGTGACGTG0.111500.048600.758600.750000.907600.62500


Target Position: 2417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2417GCCAUUUUAAUGAGAUGAU80.2037401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632435GCCATTTTAATGAGATGATATCATCTCATTAAAATGGC0.015700.001200.819001.000001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786CCAGCCCCCAGCCUCCCAC50.48692174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435804CCAGCCCCCAGCCTCCCACGTGGGAGGCTGGGGGCTGG0.061100.012200.551700.750000.907600.75000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UCUUUUGUAGCUCUGGACU63.38221392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092354TCTTTTGTAGCTCTGGACTAGTCCAGAGCTACAAAAGA0.030300.019000.517200.500001.000001.00000


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128GACACUUCCACCCCUCUCU74.8873685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520146GACACTTCCACCCCTCTCTAGAGAGGGGTGGAAGTGTC0.091600.049300.594800.500001.000001.00000


Target Position: 972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
972GCCCUCCUUCCACCAAGCC49.30012228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531990GCCCTCCTTCCACCAAGCCGGCTTGGTGGAAGGAGGGC0.667900.119800.500000.500000.978300.62500


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725GCAUGCCAGAAACCACUCA82.5672289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345743GCATGCCAGAAACCACTCATGAGTGGTTTCTGGCATGC0.177400.012900.629300.750000.989100.62500


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257UGAAAACAAACCAGAAAGU67.61681126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211275TGAAAACAAACCAGAAAGTACTTTCTGGTTTGTTTTCA0.530800.493600.517200.500001.000001.00000


Target Position: 2582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582AAAAAAAAAAAAAAAAAAA83.5835245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932600AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UGGCAGCAGACAAGGGCAA71.2802892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561913TGGCAGCAGACAAGGGCAATTGCCCTTGTCTGCTGCCA0.175100.011600.698300.750001.000001.00000


Target Position: 2162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162GGCAAAACACUAAUAAAAG79.6187432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2442180GGCAAAACACTAATAAAAGCTTTTATTAGTGTTTTGCC0.371600.056900.862100.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813GGUCAAGUCCAGGUCUAUG78.6116476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741831GGTCAAGTCCAGGTCTATGCATAGACCTGGACTTGACC0.044100.010100.698300.750001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429CCUCCCAGCCCUGGCCCUU56.86341820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091447CCTCCCAGCCCTGGCCCTTAAGGGCCAGGGCTGGGAGG0.096900.007200.706901.000000.907601.00000


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GACUGCUCAUCCUCAUCCU84.3167214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549856GACTGCTCATCCTCATCCTAGGATGAGGATGAGCAGTC0.833200.147700.474100.500001.000001.00000


Target Position: 2154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2154UGGGUGGAGGCAAAACACU65.03871292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602172TGGGTGGAGGCAAAACACTAGTGTTTTGCCTCCACCCA0.143100.004200.637900.500001.000001.00000


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444CCUUCUGCUGUCCCCUCUU73.7893751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821462CCTTCTGCTGTCCCCTCTTAAGAGGGGACAGCAGAAGG0.125900.009100.706901.000001.000001.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292AGACCCCAACCCAGCAUGA74.8618686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453310AGACCCCAACCCAGCATGATCATGCTGGGTTGGGGTCT0.138400.106400.500000.500001.000001.00000


Target Position: 2528, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528CUACAUUUUAAAAAAAGAA87.8232140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162546CTACATTTTAAAAAAAGAATTCTTTTTTTAAAATGTAG0.277900.115100.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2526-2548TGCTACATTTTAAAAAAAGAAAAUUCUUUUUUUAAAAUGUAGCACUACAUUUUAAAAAAAGAAAAU5.56.911


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309GGACACAUCCCAAUUCAAG77.7516525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461327GGACACATCCCAATTCAAGCTTGAATTGGGATGTGTCC0.258700.146500.732800.750000.989100.62500


Target Position: 2543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543AGAAAAUAAAGUAAUAAUA92.943746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2862561AGAAAATAAAGTAATAATATATTATTACTTTATTTTCT0.186300.134800.681000.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CCUCUGACUGCUCAUCCUC68.07431096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390851CCTCTGACTGCTCATCCTCGAGGATGAGCAGTCAGAGG0.320600.064400.534500.750000.978300.87500


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303CCCCCACCACCUGUUAGCU66.64181187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2462321CCCCCACCACCTGTTAGCTAGCTAACAGGTGGTGGGGG0.435500.033500.637900.750000.989100.62500


Target Position: 1979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979CGACUUCAAACCCCAGCAG67.3041150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361997CGACTTCAAACCCCAGCAGCTGCTGGGGTTTGAAGTCG0.164000.029100.508600.750001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549GCUCCCCCAAAACAUCCAG60.33961590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221567GCTCCCCCAAAACATCCAGCTGGATGTTTTGGGGGAGC0.026300.021600.569000.750000.945700.62500


Target Position: 2109, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109CUUUAAGUCAGUUGGUUUU76.1536616

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3210919CTTTAAGTCAGTTGGTTTT1/0/1/097.75BAG3NM_004281.31NANANA10:121436869..121436887(+)00BAG3(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2107-2129GACTTTAAGTCAGTTGGTTTTTAAAAACCAACUGACUUAAAGUCCUUUAAGUCAGUUGGUUUUUAU18.84.922


Target Position: 1991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1991CCAGCAGCAUGACAGACAC77.196562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562009CCAGCAGCATGACAGACACGTGTCTGTCATGCTGCTGG0.382300.071000.551700.750001.000001.00000


Target Position: 1778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1778UGGAAAAACUUGAACAGAA89.565997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221796TGGAAAAACTTGAACAGAATTCTGTTCAAGTTTTTCCA0.208100.152900.672400.750001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071GUGCUUUAGGGAAUUUUAA86.3728179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212089GTGCTTTAGGGAATTTTAATTAAAATTCCCTAAAGCAC0.239700.002300.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2069-2091GTGTGCTTTAGGGAATTTTAAGTUUAAAAUUCCCUAAAGCACACGUGCUUUAGGGAAUUUUAAGUU-9.719.722


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661UGAUGAUCGAAGAGUAUUU81.2882359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531679TGATGATCGAAGAGTATTTAAATACTCTTCGATCATCA0.017300.002500.724100.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571AAAAAAAAAAAAAAAAAAA83.5835234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822589AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999300.997300.500000.500001.000001.00000


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153GUCACCCCCGCCUUUAAUU67.16251162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
386171GTCACCCCCGCCTTTAATTAATTAAAGGCGGGGGTGAC0.081600.080800.810300.750001.000001.00000


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118GCUAUUUCCAGACACUUCC62.71151443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546136GCTATTTCCAGACACTTCCGGAAGTGTCTGGAAATAGC0.368100.275900.482800.500001.000001.00000


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078AGGGAAUUUUAAGUUGCAU76.6581593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972096AGGGAATTTTAAGTTGCATATGCAACTTAAAATTCCCT0.076700.009900.689700.750001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155CACCCCCGCCUUUAAUUCA77.1001571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551173CACCCCCGCCTTTAATTCATGAATTAAAGGCGGGGGTG0.092800.055500.569000.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCCAGAAGACGCACUACCC67.11751163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451007CCCAGAAGACGCACTACCCGGGTAGTGCGTCTTCTGGG0.237900.056200.500000.500001.000001.00000


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513UGGAUGACUUUAAUGCUAC67.68871117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542531TGGATGACTTTAATGCTACGTAGCATTAAAGTCATCCA0.051500.025300.663800.500001.000001.00000


Target Position: 1990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1990CCCAGCAGCAUGACAGACA81.5999343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1422008CCCAGCAGCATGACAGACATGTCTGTCATGCTGCTGGG0.304900.077400.784500.750001.000001.00000


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969CCAGCCCUCCUUCCACCAA75.959631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142987CCAGCCCTCCTTCCACCAATTGGTGGAAGGAGGGCTGG0.358400.162500.698301.000001.000001.00000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523UAAUGCUACAUUUUAAAAA80.9155379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612541TAATGCTACATTTTAAAAATTTTTAAAATGTAGCATTA0.311800.051800.534500.500001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194AAUGAUGCUUUUCUUCUAU80.5972391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5752212AATGATGCTTTTCTTCTATATAGAAGAAAAGCATCATT0.011900.003200.465500.500001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220CCAUGACCCAUCGAGAAAC68.13121089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601238CCATGACCCATCGAGAAACGTTTCTCGATGGGTCATGG0.015900.002800.698300.750001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640AGAAGACUGACAAAAAGUA91.293464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081658AGAAGACTGACAAAAAGTATACTTTTTGTCAGTCTTCT0.071400.030500.543100.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GCCCAGCCCCCAGCCUCCC39.83742495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463802GCCCAGCCCCCAGCCTCCCGGGAGGCTGGGGGCTGGGC0.057100.007700.508600.500000.907601.00000


Target Position: 81, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
81UCCCUUUAUCUCCUCCUUC54.97931934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48699TCCCTTTATCTCCTCCTTCGAAGGAGGAGATAAAGGGA0.210900.233700.698300.500001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841UGCUCAUCCUCAUCCUCCU74.0902730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435859TGCTCATCCTCATCCTCCTAGGAGGATGAGGATGAGCA0.617300.139500.508600.500001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UAACUCAAAAAAAAAAAAA75.4373657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922580TAACTCAAAAAAAAAAAAATTTTTTTTTTTTTGAGTTA0.997100.956400.534500.500001.000001.00000


Target Position: 57, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
57GUUUCUAGCCGGCCAGUUG69.2711012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50375GTTTCTAGCCGGCCAGTTGCAACTGGCCGGCTAGAAAC0.037700.002800.500000.500000.902200.87500


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491AGCCAUAGGAAUAUCUGUA89.3754103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292509AGCCATAGGAATATCTGTATACAGATATTCCTATGGCT0.024200.005200.672400.750001.000001.00000


Target Position: 2395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395UGAAACAUUUAUCAGAAAU76.1876614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352413TGAAACATTTATCAGAAATATTTCTGATAAATGTTTCA0.022500.008500.715500.750001.000001.00000


Target Position: 2244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2244UGUUGUUUGAGAAGUUUAA82.6454284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692262TGTTGTTTGAGAAGTTTAATTAAACTTCTCAAACAACA0.126700.010300.672400.750001.000001.00000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745CCAGAUAAACAGUGUGGAC76.0876620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413763CCAGATAAACAGTGTGGACGTCCACACTGTTTATCTGG0.082200.020700.525900.750001.000001.00000


Target Position: 2588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2588AAAAAAAAAAAAAAAAAAA83.5835251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4472606AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999500.500000.500001.000001.00000


Target Position: 2187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187AAAGGAAAAUGAUGCUUUU82.5415291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592205AAAGGAAAATGATGCTTTTAAAAGCATCATTTTCCTTT0.107600.014200.500000.500001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042CCUGUAAAAAUCAGACUCG69.5209992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3542060CCTGTAAAAATCAGACTCGCGAGTCTGATTTTTACAGG0.114600.027400.551700.500000.956500.62500


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70CAGUUGCUACCUCCCUUUA87.282153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27488CAGTTGCTACCTCCCTTTATAAAGGGAGGTAGCAACTG0.820500.456400.750000.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899AGCAGACAAGGGCAAGAAA86.6068170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911917AGCAGACAAGGGCAAGAAATTTCTTGCCCTTGTCTGCT0.225400.062000.853400.750001.000001.00000


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967GCCCAGCCCUCCUUCCACC58.58761711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495985GCCCAGCCCTCCTTCCACCGGTGGAAGGAGGGCTGGGC0.318900.164900.646600.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744GCCAGAUAAACAGUGUGGA79.3979440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402762GCCAGATAAACAGTGTGGATCCACACTGTTTATCTGGC0.073600.012200.629300.750001.000001.00000


Target Position: 2419, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419CAUUUUAAUGAGAUGAUUU89.4517101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2417-2439GCCATTTTAATGAGATGATTTTCAAAUCAUCUCAUUAAAAUGGCCAUUUUAAUGAGAUGAUUUUCU16.2-9.722


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GACAACUUUGAAGGCAAGA73.9892737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641642GACAACTTTGAAGGCAAGATCTTGCCTTCAAAGTTGTC0.111100.027100.594800.500001.000001.00000


Target Position: 2322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322GUGGUUGUGCACUGUCUUU81.4696351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002340GTGGTTGTGCACTGTCTTTAAAGACAGTGCACAACCAC0.164400.002900.793100.750001.000001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516AUGACUUUAAUGCUACAUU73.7276754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742534ATGACTTTAATGCTACATTAATGTAGCATTAAAGTCAT0.082600.025600.646600.500001.000001.00000


Target Position: 2114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2114AGUCAGUUGGUUUUUAUUA86.575172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4062132AGTCAGTTGGTTTTTATTATAATAAAAACCAACTGACT0.162400.007400.672400.750001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GAAGAUCCCCACACAGAAA96.377626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751951GAAGATCCCCACACAGAAATTTCTGTGTGGGGATCTTC0.697100.516400.672400.750000.967400.62500


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937AUACACGAGCAGAACGUUA81.5132350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427955ATACACGAGCAGAACGTTATAACGTTCTGCTCGTGTAT0.177600.056600.508600.500000.956500.75000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518AGCUACACCUCCAAAACCA83.2401266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751536AGCTACACCTCCAAAACCATGGTTTTGGAGGTGTAGCT0.106500.050800.508600.500001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284CCCAGUUGGACCAGAACUC63.55081375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961302CCCAGTTGGACCAGAACTCGAGTTCTGGTCCAACTGGG0.301800.008200.681000.750000.907600.62500


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170ACUAAUAAAAGGGCUAAAA78.4373488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2272188ACTAATAAAAGGGCTAAAATTTTAGCCCTTTTATTAGT0.166700.124300.706900.750001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599GGUACAGGGGCUGGAGCAG65.54721255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381617GGTACAGGGGCTGGAGCAGCTGCTCCAGCCCCTGTACC0.022800.001900.569000.750001.000001.00000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433CCAGCCCUGGCCCUUCUGC47.22342317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401451CCAGCCCTGGCCCTTCTGCGCAGAAGGGCCAGGGCTGG0.084300.004500.491400.500000.934800.75000


Target Position: 2261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261AACCCCGUUGCUUGUUGUU63.52311379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4482279AACCCCGTTGCTTGTTGTTAACAACAAGCAACGGGGTT0.506300.017400.500000.500001.000001.00000


Target Position: 2160, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160GAGGCAAAACACUAAUAAA104.4481

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4216019GAGGCAAAACACTAATAAA1/0/1/097.75BAG3NM_004281.31NANANA10:121436920..121436938(+)00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2582178GAGGCAAAACACTAATAAATTTATTAGTGTTTTGCCTC0.149200.027600.810300.750001.000001.00000


Target Position: 2222, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2222CUGUACAAAUAAAGAAGUU81.7929335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662240CTGTACAAATAAAGAAGTTAACTTCTTTATTTGTACAG0.047300.007300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2220-2242CTCTGTACAAATAAAGAAGTTGCAACUUCUUUAUUUGUACAGAGCUGUACAAAUAAAGAAGUUGCU17.720.422


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868UGCAGGCAAUCAUGGAGAU75.0849677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661886TGCAGGCAATCATGGAGATATCTCCATGATTGCCTGCA0.035200.001200.672400.750001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230UCGAGAAACUGCACCUGUU77.6949529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691248TCGAGAAACTGCACCTGTTAACAGGTGCAGTTTCTCGA0.052800.001200.646600.750001.000001.00000


Target Position: 2581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581AAAAAAAAAAAAAAAAAAA83.5835244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392599AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999000.500000.500001.000001.00000


Target Position: 2531, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531CAUUUUAAAAAAAGAAAAU81.0699370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2452549CATTTTAAAAAAAGAAAATATTTTCTTTTTTTAAAATG0.200100.166800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2529-2551TACATTTTAAAAAAAGAAAATAAAUUUUCUUUUUUUAAAAUGUACAUUUUAAAAAAAGAAAAUAAU5.5-9.700


Target Position: 75, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
75GCUACCUCCCUUUAUCUCC62.46881459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53993GCTACCTCCCTTTATCTCCGGAGATAAAGGGAGGTAGC0.293900.262200.482800.500001.000001.00000


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647UGACAAAAAGUACCUGAUG66.01851223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871665TGACAAAAAGTACCTGATGCATCAGGTACTTTTTGTCA0.105600.009600.569000.500001.000001.00000


Target Position: 1959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959GCCAGAAGCCACAGCAGCA89.794394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571977GCCAGAAGCCACAGCAGCATGCTGCTGTGGCTTCTGGC0.050400.011400.646600.750000.929300.62500


Target Position: 2323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2323UGGUUGUGCACUGUCUUUU67.69211116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152341TGGTTGTGCACTGTCTTTTAAAAGACAGTGCACAACCA0.291400.006900.844800.750001.000001.00000


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243UUGUUGUUUGAGAAGUUUA77.7353527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942261TTGTTGTTTGAGAAGTTTATAAACTTCTCAAACAACAA0.099300.009100.612100.500001.000001.00000


Target Position: 1785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1785ACUUGAACAGAAAGCCAUU78.7866468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781803ACTTGAACAGAAAGCCATTAATGGCTTTCTGTTCAAGT0.135300.050600.698300.750001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407CCCUGCUCCAGUUCCUUGU64.53371318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891425CCCTGCTCCAGTTCCTTGTACAAGGAACTGGAGCAGGG0.431400.099200.784500.750000.978300.75000


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830CUGCCUCUGACUGCUCAUC60.12111601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552848CTGCCTCTGACTGCTCATCGATGAGCAGTCAGAGGCAG0.155200.025800.603400.500000.956500.75000


Target Position: 2576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576AAAAAAAAAAAAAAAAAAA83.5835239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852594AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999500.998600.500000.500001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735AACCACUCAGCCAGAUAAA81.2959357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447753AACCACTCAGCCAGATAAATTTATCTGGCTGAGTGGTT0.146200.052800.646600.500001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GCAUGCAUUUCAGAGACUU82.2158308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2622111GCATGCATTTCAGAGACTTAAGTCTCTGAAATGCATGC0.186200.026900.715501.000001.000001.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442GCCCUUCUGCUGUCCCCUC61.35011528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591460GCCCTTCTGCTGTCCCCTCGAGGGGACAGCAGAAGGGC0.016900.010300.689700.750001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GCCUCUGACUGCUCAUCCU84.7668202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196850GCCTCTGACTGCTCATCCTAGGATGAGCAGTCAGAGGC0.293700.056600.655200.750000.978300.75000


Target Position: 2168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168ACACUAAUAAAAGGGCUAA80.5073394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2362186ACACTAATAAAAGGGCTAATTAGCCCTTTTATTAGTGT0.162000.053200.672400.750001.000001.00000


Target Position: 2451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451AUUAAAAUACCUGACUUUA81.4357353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502469ATTAAAATACCTGACTTTATAAAGTCAGGTATTTTAAT0.098800.062600.474100.500001.000001.00000


Target Position: 2553, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2553GUAAUAAUAUAACUCAAAA99.75816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2602571GTAATAATATAACTCAAAATTTTGAGTTATATTATTAC0.959000.606300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2551-2573AAGTAATAATATAACTCAAAAAAUUUUGAGUUAUAUUAUUACUUGUAAUAAUAUAACUCAAAAAAU19.2-8.021


Target Position: 2488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2488AGGAGCCAUAGGAAUAUCU74.5491707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992506AGGAGCCATAGGAATATCTAGATATTCCTATGGCTCCT0.045000.013500.620700.500001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732AGAAACCACUCAGCCAGAU72.9869796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368750AGAAACCACTCAGCCAGATATCTGGCTGAGTGGTTTCT0.160800.082400.543100.750001.000001.00000


Target Position: 2486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2486CCAGGAGCCAUAGGAAUAU77.4634541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5242504CCAGGAGCCATAGGAATATATATTCCTATGGCTCCTGG0.069400.002200.801701.000001.000001.00000


Target Position: 1911, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1911CAAGAAAAAUGCUGGAAAU90.235386

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1191119CAAGAAAAATGCTGGAAAT1/0/1/0100.00BAG3NM_004281.31NANANA10:121436671..121436689(+)00BAG3(0.002)


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396GAAACAUUUAUCAGAAAUG78.9184461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452414GAAACATTTATCAGAAATGCATTTCTGATAAATGTTTC0.019200.003200.517200.500001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464CCCCAAGAGUGUGGCUACA79.281444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681482CCCCAAGAGTGTGGCTACATGTAGCCACACTCTTGGGG0.046600.010600.784500.750000.913000.75000


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GGCCCUUCUGCUGUCCCCU65.94171229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701459GGCCCTTCTGCTGTCCCCTAGGGGACAGCAGAAGGGCC0.013500.011100.655200.750000.978300.75000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308UGGACACAUCCCAAUUCAA87.2688155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1351326TGGACACATCCCAATTCAATTGAATTGGGATGTGTCCA0.648300.181000.698300.750000.913000.62500


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345GCUCUGGACUGGAGGGGUA87.152157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732363GCTCTGGACTGGAGGGGTATACCCCTCCAGTCCAGAGC0.012200.001300.672401.000000.989100.62500


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095AUGCAUUUCAGAGACUUUA77.2177556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992113ATGCATTTCAGAGACTTTATAAAGTCTCTGAAATGCAT0.060600.002900.620700.500001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179AGGGCUAAAAAGGAAAAUG62.83121433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692197AGGGCTAAAAAGGAAAATGCATTTTCCTTTTTAGCCCT0.324400.068200.689700.500001.000001.00000


Target Position: 569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
569AGCUCCGACCAGGCUACAU70.9646911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458587AGCTCCGACCAGGCTACATATGTAGCCTGGTCGGAGCT0.050300.024400.698300.750000.918500.62500


Target Position: 2380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380CCCAUCACAUAAAUAUGAA91.589259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3492398CCCATCACATAAATATGAATTCATATTTATGTGATGGG0.184700.012400.819001.000000.907600.62500


Target Position: 69, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
69CCAGUUGCUACCUCCCUUU75.056679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9087CCAGTTGCTACCTCCCTTTAAAGGGAGGTAGCAACTGG0.785900.134100.844801.000001.000001.00000


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159GGAGGCAAAACACUAAUAA92.940647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2062177GGAGGCAAAACACTAATAATTATTAGTGTTTTGCCTCC0.249900.044000.836201.000001.000001.00000


Target Position: 2485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2485GCCAGGAGCCAUAGGAAUA88.8162113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232503GCCAGGAGCCATAGGAATATATTCCTATGGCTCCTGGC0.070600.002200.956901.000001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072UGCUUUAGGGAAUUUUAAG64.45521321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782090TGCTTTAGGGAATTTTAAGCTTAAAATTCCCTAAAGCA0.218300.085600.715500.500001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847UCCUCAUCCUCCUCGGCCA71.6728864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518865TCCTCATCCTCCTCGGCCATGGCCGAGGAGGATGAGGA0.080800.089800.525900.500000.934800.87500


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555AAUAAUAUAACUCAAAAAA86.725167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372573AATAATATAACTCAAAAAATTTTTTGAGTTATATTATT0.961800.629100.508600.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182GCUAAAAAGGAAAAUGAUG72.9725797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072200GCTAAAAAGGAAAATGATGCATCATTTTCCTTTTTAGC0.116800.035700.698300.750001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573AAAAAAAAAAAAAAAAAAA83.5835236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772591AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999400.998100.500000.500001.000001.00000


Target Position: 1946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1946CAGAAACCCAGCAGCCAGA81.241360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151964CAGAAACCCAGCAGCCAGATCTGGCTGCTGGGTTTCTG0.061300.048300.560300.500000.967400.87500


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151ACUUGGGUGGAGGCAAAAC57.56631774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962169ACTTGGGTGGAGGCAAAACGTTTTGCCTCCACCCAAGT0.054900.003000.560300.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411GCUCCAGUUCCUUGUCCUC70.7695920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691429GCTCCAGTTCCTTGTCCTCGAGGACAAGGAACTGGAGC0.466500.173500.543100.750001.000001.00000


Target Position: 2584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584AAAAAAAAAAAAAAAAAAA83.5835247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632602AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999200.500000.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211CUCAGCAGCCCAUGACCCA76.7382591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661229CTCAGCAGCCCATGACCCATGGGTCATGGGCTGCTGAG0.162800.020000.465500.500000.945700.75000


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585AAAAAAAAAAAAAAAAAAA83.5835248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612603AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999300.500000.500001.000001.00000


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72GUUGCUACCUCCCUUUAUC71.6543869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56490GTTGCTACCTCCCTTTATCGATAAAGGGAGGTAGCAAC0.373700.276200.465500.500001.000001.00000


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195AUGAUGCUUUUCUUCUAUA86.5217175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272213ATGATGCTTTTCTTCTATATATAGAAGAAAAGCATCAT0.028300.003400.612100.500001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658ACCUGAUGAUCGAAGAGUA94.863232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441676ACCTGATGATCGAAGAGTATACTCTTCGATCATCAGGT0.019600.009600.672400.750001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622UAGACAACUUUGAAGGCAA86.7244168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041640TAGACAACTTTGAAGGCAATTGCCTTCAAAGTTGTCTA0.194600.021900.525900.500001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669GAAGAGUAUUUGACCAAAG82.3202301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801687GAAGAGTATTTGACCAAAGCTTTGGTCAAATACTCTTC0.162300.014400.534500.500001.000001.00000


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157CCCCCGCCUUUAAUUCAUA82.753280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354175CCCCCGCCTTTAATTCATATATGAATTAAAGGCGGGGG0.095100.033600.948301.000001.000001.00000


Target Position: 2463, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463GACUUUAGAGAGAGUAAAA100.5454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3042481GACTTTAGAGAGAGTAAAATTTTACTCTCTCTAAAGTC0.117700.060800.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2461-2483CTGACTTTAGAGAGAGTAAAATGUUUUACUCUCUCUAAAGUCAGGACUUUAGAGAGAGUAAAAUGU14.69.821


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834CUCUGACUGCUCAUCCUCA91.475960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351852CTCTGACTGCTCATCCTCATGAGGATGAGCAGTCAGAG0.383800.072700.586200.500000.978301.00000


Target Position: 71, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
71AGUUGCUACCUCCCUUUAU76.9742576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
21489AGTTGCTACCTCCCTTTATATAAAGGGAGGTAGCAACT0.608100.379300.663800.750001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463CCCCCAAGAGUGUGGCUAC68.87611040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901481CCCCCAAGAGTGTGGCTACGTAGCCACACTCTTGGGGG0.038300.007600.810300.750000.913000.87500


Target Position: 2276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276UGUUCUGCAGCCCUGUCUA80.9686376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742294TGTTCTGCAGCCCTGTCTATAGACAGGGCTGCAGAACA0.220000.001100.534500.750001.000001.00000


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514GGAUGACUUUAAUGCUACA102.0222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3962532GGATGACTTTAATGCTACATGTAGCATTAAAGTCATCC0.076900.023700.663800.750001.000001.00000


Target Position: 2462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2462UGACUUUAGAGAGAGUAAA80.9305378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3362480TGACTTTAGAGAGAGTAAATTTACTCTCTCTAAAGTCA0.103600.025000.724100.750001.000001.00000


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252GAGAAGUUUAACCCCGUUG66.50271193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202270GAGAAGTTTAACCCCGTTGCAACGGGGTTAAACTTCTC0.094100.011300.663800.500000.902200.75000


Target Position: 2163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2163GCAAAACACUAAUAAAAGG73.7166755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532181GCAAAACACTAATAAAAGGCCTTTTATTAGTGTTTTGC0.341700.076700.508600.500001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313GCCGCCACCCACUCGCCCA71.943855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486331GCCGCCACCCACTCGCCCATGGGCGAGTGGGTGGCGGC0.039300.006100.655200.750000.902200.75000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566UCAAAAAAAAAAAAAAAAA74.8393688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1692584TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.998900.992400.724100.750001.000001.00000


Target Position: 2240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2240UGCUUGUUGUUUGAGAAGU62.91951427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042258TGCTTGTTGTTTGAGAAGTACTTCTCAAACAACAAGCA0.032300.006900.646600.500001.000001.00000


Target Position: 2300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2300GCACCCCCACCACCUGUUA78.4994486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1782318GCACCCCCACCACCTGTTATAACAGGTGGTGGGGGTGC0.210300.064600.819001.000001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938UCCCCACACAGAAACCCAG57.37521787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501956TCCCCACACAGAAACCCAGCTGGGTTTCTGTGTGGGGA0.175100.105800.586200.500001.000001.00000


Target Position: 2251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2251UGAGAAGUUUAACCCCGUU73.3607778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3252269TGAGAAGTTTAACCCCGTTAACGGGGTTAAACTTCTCA0.255900.015000.577600.750000.902200.75000


Target Position: 2171, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171CUAAUAAAAGGGCUAAAAA90.104289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912189CTAATAAAAGGGCTAAAAATTTTTAGCCCTTTTATTAG0.128000.090800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2169-2191CACTAATAAAAGGGCTAAAAAGGUUUUUAGCCCUUUUAUUAGUGCUAAUAAAAGGGCUAAAAAGGU13.7-7.522


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154UCACCCCCGCCUUUAAUUC48.57372259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356172TCACCCCCGCCTTTAATTCGAATTAAAGGCGGGGGTGA0.094700.068100.551700.500001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575GACCAGGCUACAUUCCCAU81.0232372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276593GACCAGGCTACATTCCCATATGGGAATGTAGCCTGGTC0.487800.023900.663800.750000.934800.75000


Target Position: 2084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084UUUUAAGUUGCAUGCAUUU66.73751181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812102TTTTAAGTTGCATGCATTTAAATGCATGCAACTTAAAA0.150200.018300.500000.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094CAUGCAUUUCAGAGACUUU90.757176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172112CATGCATTTCAGAGACTTTAAAGTCTCTGAAATGCATG0.093400.006900.655200.750001.000001.00000


Target Position: 2157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157GUGGAGGCAAAACACUAAU76.9334577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572175GTGGAGGCAAAACACTAATATTAGTGTTTTGCCTCCAC0.224800.028200.784500.750001.000001.00000


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452UGUCCCCUCUUCCCCCAAG53.0252056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281470TGTCCCCTCTTCCCCCAAGCTTGGGGGAAGAGGGGACA0.024200.017100.569000.500001.000001.00000


Target Position: 2034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2034GCCUCUGCCCUGUAAAAAU83.9351221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752052GCCTCTGCCCTGTAAAAATATTTTTACAGGGCAGAGGC0.161300.003500.991401.000001.000001.00000


Target Position: 2439, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439CUUCAUCUCAUAAUUAAAA88.8174112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3202457CTTCATCTCATAATTAAAATTTTAATTATGAGATGAAG0.506100.015500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2437-2459TTCTTCATCTCATAATTAAAATAUUUUAAUUAUGAGAUGAAGAACUUCAUCUCAUAAUUAAAAUAU-9.720.422


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312CACAUCCCAAUUCAAGUGA73.7138756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891330CACATCCCAATTCAAGTGATCACTTGAATTGGGATGTG0.080000.067300.569000.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672CCGAACUGAGGCGGCAGCA69.0041034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508690CCGAACTGAGGCGGCAGCATGCTGCCGCCTCAGTTCGG0.030800.005600.560300.750000.902200.62500


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578AAAAAAAAAAAAAAAAAAA83.5835241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5662596AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.998800.500000.500001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612GAGCAGGCUGUAGACAACU77.8759518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041630GAGCAGGCTGTAGACAACTAGTTGTCTACAGCCTGCTC0.073000.002800.603400.500000.907600.62500


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255AAGUUUAACCCCGUUGCUU68.7221050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762273AAGTTTAACCCCGTTGCTTAAGCAACGGGGTTAAACTT0.071800.015500.500000.500001.000001.00000


Target Position: 2226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2226ACAAAUAAAGAAGUUGCUU70.0395954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392244ACAAATAAAGAAGTTGCTTAAGCAACTTCTTTATTTGT0.022000.003800.569000.750001.000001.00000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571CUCCGACCAGGCUACAUUC69.3171009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441589CTCCGACCAGGCTACATTCGAATGTAGCCTGGTCGGAG0.402900.020900.637900.500000.983700.75000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480CCCCAAGGAGACUCCAUCC62.78831437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552498CCCCAAGGAGACTCCATCCGGATGGAGTCTCCTTGGGG0.203400.001400.620700.500000.934800.62500


Target Position: 2518, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518GACUUUAAUGCUACAUUUU85.864184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342536GACTTTAATGCTACATTTTAAAATGTAGCATTAAAGTC0.103900.029400.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2516-2538ATGACTTTAATGCTACATTTTAAAAAAUGUAGCAUUAAAGUCAUGACUUUAAUGCUACAUUUUAAU6.94.922


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414GUUGCCAUUUUAAUGAGAU81.2187361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622432GTTGCCATTTTAATGAGATATCTCATTAAAATGGCAAC0.016900.001900.465500.750001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506UGUAUGUUGGAUGACUUUA78.3888489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522524TGTATGTTGGATGACTTTATAAAGTCATCCAACATACA0.140000.012100.672400.750001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371AGUCAAUUACCCAUCACAU87.2776154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3652389AGTCAATTACCCATCACATATGTGATGGGTAATTGACT0.092400.036000.551700.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258GAAAACAAACCAGAAAGUA87.68146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241276GAAAACAAACCAGAAAGTATACTTTCTGGTTTGTTTTC0.539600.501600.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1256-1278CTGAAAACAAACCAGAAAGTAAGUACUUUCUGGUUUGUUUUCAGGAAAACAAACCAGAAAGUAAGU17.75.622


Target Position: 2554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554UAAUAAUAUAACUCAAAAA91.727355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962572TAATAATATAACTCAAAAATTTTTGAGTTATATTATTA0.959000.610200.534500.500001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CACCCUUUCCAUGUCUAUC68.10871092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572649CACCCTTTCCATGTCTATCGATAGACATGGAAAGGGTG0.107600.049100.612100.500001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579AGGCUACAUUCCCAUUCCU75.9947627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450597AGGCTACATTCCCATTCCTAGGAATGGGAATGTAGCCT0.308100.073000.500000.500000.934800.75000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UCCAGUUCCUUGUCCUCCU65.02571293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641431TCCAGTTCCTTGTCCTCCTAGGAGGACAAGGAACTGGA0.484700.180500.525900.500001.000001.00000


Target Position: 2519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2519ACUUUAAUGCUACAUUUUA87.112158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2462537ACTTTAATGCTACATTTTATAAAATGTAGCATTAAAGT0.206600.030500.672400.750001.000001.00000


Target Position: 2033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033AGCCUCUGCCCUGUAAAAA75.4715654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4802051AGCCTCTGCCCTGTAAAAATTTTTACAGGGCAGAGGCT0.147100.003400.853400.750000.934800.62500


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525AUGCUACAUUUUAAAAAAA85.0254195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432543ATGCTACATTTTAAAAAAATTTTTTTAAAATGTAGCAT0.301200.070900.655200.500001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902AGACAAGGGCAAGAAAAAU78.7185472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631920AGACAAGGGCAAGAAAAATATTTTTCTTGCCCTTGTCT0.174400.026700.715500.750001.000001.00000


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769AGACCAUCUUGGAAAAACU84.986197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451787AGACCATCTTGGAAAAACTAGTTTTTCCAAGATGGTCT0.115100.001600.517200.500000.989100.87500


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739ACUCAGCCAGAUAAACAGU72.2801837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
472757ACTCAGCCAGATAAACAGTACTGTTTATCTGGCTGAGT0.099100.044200.500000.500001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079GGGAAUUUUAAGUUGCAUG73.5442766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182097GGGAATTTTAAGTTGCATGCATGCAACTTAAAATTCCC0.068600.048300.836200.750001.000001.00000


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219ACUCUGUACAAAUAAAGAA87.9436135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652237ACTCTGTACAAATAAAGAATTCTTTATTTGTACAGAGT0.047500.006800.534500.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593GGAGAAGGUACAGGGGCUG63.90531355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551611GGAGAAGGTACAGGGGCTGCAGCCCCTGTACCTTCTCC0.017200.014500.586200.750001.000001.00000


Target Position: 2245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2245GUUGUUUGAGAAGUUUAAC65.74211239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562263GTTGTTTGAGAAGTTTAACGTTAAACTTCTCAAACAAC0.161700.012700.500000.500001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169CACUAAUAAAAGGGCUAAA87.7323144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852187CACTAATAAAAGGGCTAAATTTAGCCCTTTTATTAGTG0.154600.056900.793100.750001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259AAAACAAACCAGAAAGUAA94.177936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581277AAAACAAACCAGAAAGTAATTACTTTCTGGTTTGTTTT0.546200.508500.465500.500001.000001.00000


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450GCUGUCCCCUCUUCCCCCA72.1749845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521468GCTGTCCCCTCTTCCCCCATGGGGGAAGAGGGGACAGC0.053000.006500.508600.750001.000001.00000


Target Position: 2587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587AAAAAAAAAAAAAAAAAAA83.5835250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142605AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999500.500000.500001.000001.00000


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116AGGCUAUUUCCAGACACUU75.9618630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256134AGGCTATTTCCAGACACTTAAGTGTCTGGAAATAGCCT0.310700.295900.706900.750000.978300.75000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CUUUAGGGAAUUUUAAGUU76.3987605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5312092CTTTAGGGAATTTTAAGTTAACTTAAAATTCCCTAAAG0.192800.087600.491400.750001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153AGCAGCACGCCACUCCACU67.60881129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341171AGCAGCACGCCACTCCACTAGTGGAGTGGCGTGCTGCT0.283800.014900.646600.500000.902200.62500


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139CCCUCUCUGGCCACGUCAC64.0261348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294157CCCTCTCTGGCCACGTCACGTGACGTGGCCAGAGAGGG0.323000.020600.698300.750000.972800.75000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GAUGCAGCGAUUCCGAACU74.1861726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554678GATGCAGCGATTCCGAACTAGTTCGGAATCGCTGCATC0.068600.003900.474100.500000.994600.62500


Target Position: 2538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2538AAAAAAGAAAAUAAAGUAA86.3341180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712556AAAAAAGAAAATAAAGTAATTACTTTATTTTCTTTTTT0.142400.111600.465500.500001.000001.00000


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176AAAAGGGCUAAAAAGGAAA78.0875505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4712194AAAAGGGCTAAAAAGGAAATTTCCTTTTTAGCCCTTTT0.364000.069600.500000.500001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975CUCCUUCCACCAAGCCCAG58.58461712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410993CTCCTTCCACCAAGCCCAGCTGGGCTTGGTGGAAGGAG0.117600.091600.525900.500000.989100.87500


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069GUGUGCUUUAGGGAAUUUU72.3645833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512087GTGTGCTTTAGGGAATTTTAAAATTCCCTAAAGCACAC0.133700.001400.793100.750001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461CUGACUUUAGAGAGAGUAA92.855448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3422479CTGACTTTAGAGAGAGTAATTACTCTCTCTAAAGTCAG0.099200.024000.750000.750001.000001.00000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492GCCAUAGGAAUAUCUGUAU84.329213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502510GCCATAGGAATATCTGTATATACAGATATTCCTATGGC0.018200.003200.956901.000001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CCCAUUCCUGUGCUCCAUG63.00591418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563607CCCATTCCTGTGCTCCATGCATGGAGCACAGGAATGGG0.015700.002400.836200.750001.000001.00000


Target Position: 2234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2234AGAAGUUGCUUGUUGUUUG74.6594703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322252AGAAGTTGCTTGTTGTTTGCAAACAACAAGCAACTTCT0.051200.002000.577600.500001.000001.00000


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499GAAUAUCUGUAUGUUGGAU90.125588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182517GAATATCTGTATGTTGGATATCCAACATACAGATATTC0.044400.004900.491400.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070UGUGCUUUAGGGAAUUUUA83.0053273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5262088TGTGCTTTAGGGAATTTTATAAAATTCCCTAAAGCACA0.114500.002100.672400.750001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180GGGCUAAAAAGGAAAAUGA89.0266110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2402198GGGCTAAAAAGGAAAATGATCATTTTCCTTTTTAGCCC0.355600.059700.767200.750001.000001.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265CCGUUGCUUGUUGUUCUGC54.38411974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552283CCGTTGCTTGTTGTTCTGCGCAGAACAACAAGCAACGG0.051200.005200.560300.500000.994600.75000


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564ACUCAAAAAAAAAAAAAAA81.9196327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2182582ACTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAGT0.998200.989000.706900.750001.000001.00000


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608GCUGGAGCAGGCUGUAGAC75.4953652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301626GCTGGAGCAGGCTGTAGACGTCTACAGCCTGCTCCAGC0.064300.013600.534500.750001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548GGCUCCCCCAAAACAUCCA75.7277640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181566GGCTCCCCCAAAACATCCATGGATGTTTTGGGGGAGCC0.263000.015800.655200.750001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406CCCCUGCUCCAGUUCCUUG66.0181224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621424CCCCTGCTCCAGTTCCTTGCAAGGAACTGGAGCAGGGG0.235300.103100.844800.750000.978300.87500


Target Position: 2428, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428GAGAUGAUUUUCUUCAUCU90.314584

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2426-2448ATGAGATGATTTTCTTCATCTCAAGAUGAAGAAAAUCAUCUCAUGAGAUGAUUUUCUUCAUCUCAU20.420.421


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459ACCUGACUUUAGAGAGAGU78.7825469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3852477ACCTGACTTTAGAGAGAGTACTCTCTCTAAAGTCAGGT0.087300.008900.646600.500001.000001.00000


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317CCCAAUUCAAGUGAUCCGC49.3812224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761335CCCAATTCAAGTGATCCGCGCGGATCACTTGAATTGGG0.041900.044300.569000.500001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200GCUUUUCUUCUAUAUUCUU85.2007191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642218GCTTTTCTTCTATATTCTTAAGAATATAGAAGAAAAGC0.146300.004000.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2198-2220ATGCTTTTCTTCTATATTCTTACAAGAAUAUAGAAGAAAAGCAUGCUUUUCUUCUAUAUUCUUACU6.610.321


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982CUUCAAACCCCAGCAGCAU72.3754831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432000CTTCAAACCCCAGCAGCATATGCTGCTGGGGTTTGAAG0.146800.040200.482800.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CAGCCAGAUAAACAGUGUG74.7787694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570760CAGCCAGATAAACAGTGTGCACACTGTTTATCTGGCTG0.057900.001200.491400.500001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775UCUUGGAAAAACUUGAACA78.2814497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711793TCTTGGAAAAACTTGAACATGTTCAAGTTTTTCCAAGA0.174000.003600.517200.500001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512UUGGAUGACUUUAAUGCUA77.427544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562530TTGGATGACTTTAATGCTATAGCATTAAAGTCATCCAA0.048200.010800.474100.500001.000001.00000


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115GAGGCUAUUUCCAGACACU88.6237120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371133GAGGCTATTTCCAGACACTAGTGTCTGGAAATAGCCTC0.321100.084600.603400.500000.978300.75000


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641GAAGACUGACAAAAAGUAC77.2922546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261659GAAGACTGACAAAAAGTACGTACTTTTTGTCAGTCTTC0.071600.024000.491400.500001.000001.00000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415CCCUUCUUCGUGGACCACA72.6302817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498433CCCTTCTTCGTGGACCACATGTGGTCCACGAAGAAGGG0.034700.020500.784500.750000.956500.75000


Target Position: 1443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443CCCUUCUGCUGUCCCCUCU67.18271160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751461CCCTTCTGCTGTCCCCTCTAGAGGGGACAGCAGAAGGG0.139500.009700.767200.750001.000001.00000


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446UCAUAAUUAAAAUACCUGA80.3551397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682464TCATAATTAAAATACCTGATCAGGTATTTTAATTATGA0.204100.050300.500000.500001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GGCAGCAGACAAGGGCAAG65.14961284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121914GGCAGCAGACAAGGGCAAGCTTGCCCTTGTCTGCTGCC0.183100.041100.862100.750001.000001.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445CUCAUAAUUAAAAUACCUG71.7081863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762463CTCATAATTAAAATACCTGCAGGTATTTTAATTATGAG0.304400.072000.525900.500001.000001.00000


Target Position: 2111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111UUAAGUCAGUUGGUUUUUA75.3477660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732129TTAAGTCAGTTGGTTTTTATAAAAACCAACTGACTTAA0.071200.001100.500000.500001.000001.00000


Target Position: 1940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940CCCACACAGAAACCCAGCA77.0419574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341958CCCACACAGAAACCCAGCATGCTGGGTTTCTGTGTGGG0.178900.127200.637900.750001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465CUUUAGAGAGAGUAAAAUG79.6959429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5382483CTTTAGAGAGAGTAAAATGCATTTTACTCTCTCTAAAG0.116700.048000.482800.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469AGAGUGUGGCUACAGAAGA82.5251292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571487AGAGTGTGGCTACAGAAGATCTTCTGTAGCCACACTCT0.027100.004100.500000.500001.000001.00000


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733UGCGUCAGGCCAGGAGAGA61.96231489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751751TGCGTCAGGCCAGGAGAGATCTCTCCTGGCCTGACGCA0.176000.001600.629300.500000.989100.75000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623AGACAACUUUGAAGGCAAG73.6857758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561641AGACAACTTTGAAGGCAAGCTTGCCTTCAAAGTTGTCT0.110800.021000.586200.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767UCAGACCAUCUUGGAAAAA70.0023958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461785TCAGACCATCTTGGAAAAATTTTTCCAAGATGGTCTGA0.026500.001600.724100.750000.989101.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405CCCCCUGCUCCAGUUCCUU65.90931231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1551423CCCCCTGCTCCAGTTCCTTAAGGAACTGGAGCAGGGGG0.242200.110700.853401.000000.978301.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196UGAUGCUUUUCUUCUAUAU80.9335377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022214TGATGCTTTTCTTCTATATATATAGAAGAAAAGCATCA0.033800.003300.681000.750001.000001.00000


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498GGAAUAUCUGUAUGUUGGA90.962572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932516GGAATATCTGTATGTTGGATCCAACATACAGATATTCC0.037100.004400.500000.750001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988ACCCCAGCAGCAUGACAGA76.3379609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172006ACCCCAGCAGCATGACAGATCTGTCATGCTGCTGGGGT0.318800.079300.629300.500001.000001.00000


Target Position: 2190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2190GGAAAAUGAUGCUUUUCUU92.489951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2188-2210AAGGAAAATGATGCTTTTCTTCTAAGAAAAGCAUCAUUUUCCUUGGAAAAUGAUGCUUUUCUUCUU10.37.412


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834CUCCAGCCCAGCAACCUUG60.96311552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681852CTCCAGCCCAGCAACCTTGCAAGGTTGCTGGGCTGGAG0.091200.031300.663800.500000.967400.87500


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226CCCAUCGAGAAACUGCACC50.80762155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381244CCCATCGAGAAACTGCACCGGTGCAGTTTCTCGATGGG0.022200.001900.637900.500001.000001.00000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898CAGCAGACAAGGGCAAGAA86.8044163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2871916CAGCAGACAAGGGCAAGAATTCTTGCCCTTGTCTGCTG0.203700.049500.612100.750001.000001.00000


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212UCAGCAGCCCAUGACCCAU67.85071108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291230TCAGCAGCCCATGACCCATATGGGTCATGGGCTGCTGA0.170400.022100.569000.750000.945700.87500


Target Position: 2208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208UCUAUAUUCUUACUCUGUA86.6991169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702226TCTATATTCTTACTCTGTATACAGAGTAAGAATATAGA0.197800.032400.543100.750001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817UCCCAGUCUCCAGCUGCCU53.36942037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533835TCCCAGTCTCCAGCTGCCTAGGCAGCTGGAGACTGGGA0.135300.006400.525900.500000.962000.75000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655AGUACCUGAUGAUCGAAGA83.6451227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401673AGTACCTGATGATCGAAGATCTTCGATCATCAGGTACT0.034000.025300.482800.500001.000001.00000


Target Position: 1836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1836CCAGCCCAGCAACCUUGAA78.8626464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181854CCAGCCCAGCAACCTTGAATTCAAGGTTGCTGGGCTGG0.196000.037500.672401.000000.967400.75000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264CCCGUUGCUUGUUGUUCUG65.07441290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772282CCCGTTGCTTGTTGTTCTGCAGAACAACAAGCAACGGG0.041500.007800.706900.750001.000001.00000


Target Position: 1772, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1772CCAUCUUGGAAAAACUUGA83.4204261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721790CCATCTTGGAAAAACTTGATCAAGTTTTTCCAAGATGG0.240500.001100.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1770-1792GACCATCTTGGAAAAACTTGAACUCAAGUUUUUCCAAGAUGGUCCCAUCUUGGAAAAACUUGAACU10.318.122


Target Position: 2098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098CAUUUCAGAGACUUUAAGU81.7331337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2096-2118TGCATTTCAGAGACTTTAAGTCAACUUAAAGUCUCUGAAAUGCACAUUUCAGAGACUUUAAGUCAU1.312.012


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CCGCCACCCACUCGCCCAU65.76291237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509332CCGCCACCCACTCGCCCATATGGGCGAGTGGGTGGCGG0.097400.002600.758601.000000.902200.75000


Target Position: 2115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2115GUCAGUUGGUUUUUAUUAG75.2243669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302133GTCAGTTGGTTTTTATTAGCTAATAAAAACCAACTGAC0.024100.003500.646600.500001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773CAUCUUGGAAAAACUUGAA89.097109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681791CATCTTGGAAAAACTTGAATTCAAGTTTTTCCAAGATG0.204500.001200.482800.750001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931CCGGUGAUACACGAGCAGA81.5395345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553949CCGGTGATACACGAGCAGATCTGCTCGTGTATCACCGG0.269000.001400.689700.750000.983700.75000


Target Position: 2494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494CAUAGGAAUAUCUGUAUGU84.7198204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2492-2514GCCATAGGAATATCTGTATGTTGACAUACAGAUAUUCCUAUGGCCAUAGGAAUAUCUGUAUGUUGU17.919.922


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343UGGAUUCUAAACCUGUUUC57.56631773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301361TGGATTCTAAACCTGTTTCGAAACAGGTTTAGAATCCA0.158500.021200.672400.500000.951100.75000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CCUCCCUUUAUCUCCUCCU67.76081114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
49697CCTCCCTTTATCTCCTCCTAGGAGGAGATAAAGGGAGG0.239000.264500.500000.750001.000001.00000


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213CAGCAGCCCAUGACCCAUC65.59061248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871231CAGCAGCCCATGACCCATCGATGGGTCATGGGCTGCTG0.186500.032800.603400.500000.945701.00000


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124UCCAGACACUUCCACCCCU65.78471236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508142TCCAGACACTTCCACCCCTAGGGGTGGAAGTGTCTGGA0.541600.088900.525900.500001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GCAGCCCAGCCCUCCUUCC54.60461959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542982GCAGCCCAGCCCTCCTTCCGGAAGGAGGGCTGGGCTGC0.322300.031700.482800.500000.978300.75000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724GGCAUGCCAGAAACCACUC66.66441186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334742GGCATGCCAGAAACCACTCGAGTGGTTTCTGGCATGCC0.188100.014000.689700.750000.983700.62500


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GCAGCCCAUGACCCAUCGA76.7333592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531233GCAGCCCATGACCCATCGATCGATGGGTCATGGGCTGC0.121700.021900.560300.750000.945700.75000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331CACUGUCUUUUGUAGCUCU87.886139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202349CACTGTCTTTTGTAGCTCTAGAGCTACAAAAGACAGTG0.112600.006600.569000.500001.000001.00000


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948GAAACCCAGCAGCCAGAAG68.57031063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781966GAAACCCAGCAGCCAGAAGCTTCTGGCTGCTGGGTTTC0.159500.034300.534500.500000.967400.75000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435UUUUCUUCAUCUCAUAAUU72.2666838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362453TTTTCTTCATCTCATAATTAATTATGAGATGAAGAAAA0.075400.007800.491400.500001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74UGCUACCUCCCUUUAUCUC58.49321717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36592TGCTACCTCCCTTTATCTCGAGATAAAGGGAGGTAGCA0.311100.274700.543100.500001.000001.00000


Target Position: 2241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2241GCUUGUUGUUUGAGAAGUU88.5889122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812259GCTTGTTGTTTGAGAAGTTAACTTCTCAAACAACAAGC0.040800.007000.706901.000001.000001.00000


Target Position: 2320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320CUGUGGUUGUGCACUGUCU81.991320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672338CTGTGGTTGTGCACTGTCTAGACAGTGCACAACCACAG0.047900.001200.560300.500000.940200.75000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490GAGCCAUAGGAAUAUCUGU86.9111160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5112508GAGCCATAGGAATATCTGTACAGATATTCCTATGGCTC0.029700.006500.603400.500001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615CAGGCUGUAGACAACUUUG77.2759548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531633CAGGCTGTAGACAACTTTGCAAAGTTGTCTACAGCCTG0.055500.004500.637900.500000.907600.87500


Target Position: 289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289GGCAGACCCCAACCCAGCA81.446352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210307GGCAGACCCCAACCCAGCATGCTGGGTTGGGGTCTGCC0.227000.143000.646600.750000.934800.62500


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394AUGAAACAUUUAUCAGAAA86.7624166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5202412ATGAAACATTTATCAGAAATTTCTGATAAATGTTTCAT0.026400.014100.655200.500000.972800.62500


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785CCCAGCCCCCAGCCUCCCA61.44111526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438803CCCAGCCCCCAGCCTCCCATGGGAGGCTGGGGGCTGGG0.058900.010900.646600.750000.907600.87500


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517UGACUUUAAUGCUACAUUU83.0129272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3912535TGACTTTAATGCTACATTTAAATGTAGCATTAAAGTCA0.078400.025400.724100.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431AUGAUUUUCUUCAUCUCAU78.9432458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5642449ATGATTTTCTTCATCTCATATGAGATGAAGAAAATCAT0.015600.004500.500000.500000.972800.75000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617GGCUGUAGACAACUUUGAA100.3495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361635GGCTGTAGACAACTTTGAATTCAAAGTTGTCTACAGCC0.068800.005800.827601.000000.907600.62500


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526UGCUACAUUUUAAAAAAAG64.45531320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022544TGCTACATTTTAAAAAAAGCTTTTTTTAAAATGTAGCA0.805200.088800.715500.500001.000001.00000


Target Position: 2409, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409GAAAUGUUGCCAUUUUAAU84.9416199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2407-2429CAGAAATGTTGCCATTTTAATGAAUUAAAAUGGCAACAUUUCUGGAAAUGUUGCCAUUUUAAUGAU-9.75.312


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145GCAGUAACUUGGGUGGAGG65.40971262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672163GCAGTAACTTGGGTGGAGGCCTCCACCCAAGTTACTGC0.015000.002100.508600.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730CCAGAAACCACUCAGCCAG68.91461037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352748CCAGAAACCACTCAGCCAGCTGGCTGAGTGGTTTCTGG0.122600.103500.560300.750001.000001.00000


Target Position: 2387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387CAUAAAUAUGAAACAUUUA96.752423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2385-2407CACATAAATATGAAACATTTATCUAAAUGUUUCAUAUUUAUGUGCAUAAAUAUGAAACAUUUAUCU5.3-8.012


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437UUCUUCAUCUCAUAAUUAA82.2875304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672455TTCTTCATCTCATAATTAATTAATTATGAGATGAAGAA0.166300.009800.637900.500001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583AAAAAAAAAAAAAAAAAAA83.5835246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782601AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999200.500000.500001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644GACUGACAAAAAGUACCUG74.8606687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491662GACTGACAAAAAGTACCTGCAGGTACTTTTTGTCAGTC0.053800.015200.534500.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CAGAAGACGCACUACCCAG77.7884524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721009CAGAAGACGCACTACCCAGCTGGGTAGTGCGTCTTCTG0.044400.005900.500000.500001.000001.00000


Target Position: 158, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158CCCCGCCUUUAAUUCAUAA84.5377209

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_915819CCCCGCCTTTAATTCATAA1/0/1/093.71BAG3NM_004281.31NANANA10:121411039..121411057(+)00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379176CCCCGCCTTTAATTCATAATTATGAATTAAAGGCGGGG0.084900.022700.956901.000001.000001.00000


Target Position: 113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113AGGAGGCUAUUUCCAGACA81.2076362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568131AGGAGGCTATTTCCAGACATGTCTGGAAATAGCCTCCT0.354300.001700.637900.500000.923900.62500


Target Position: 429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429CCACAACAGCCGCACCACU77.4682540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443447CCACAACAGCCGCACCACTAGTGGTGCGGCTGTTGTGG0.056400.029800.637900.750000.967400.62500


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829GCUGCCUCUGACUGCUCAU80.9858374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314847GCTGCCTCTGACTGCTCATATGAGCAGTCAGAGGCAGC0.138700.016700.698301.000000.929300.62500


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835UCUGACUGCUCAUCCUCAU73.3912775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334853TCTGACTGCTCATCCTCATATGAGGATGAGCAGTCAGA0.513300.084800.569000.750000.978300.87500


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835UCCAGCCCAGCAACCUUGA59.46931651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051853TCCAGCCCAGCAACCTTGATCAAGGTTGCTGGGCTGGA0.189700.035500.646600.500000.967400.87500


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GAGUGUGGCUACAGAAGAG87.6134148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431488GAGTGTGGCTACAGAAGAGCTCTTCTGTAGCCACACTC0.020400.003500.500000.500001.000001.00000


Target Position: 2515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515GAUGACUUUAAUGCUACAU78.288495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132533GATGACTTTAATGCTACATATGTAGCATTAAAGTCATC0.070300.024700.525900.750001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438UCUUCAUCUCAUAAUUAAA89.4496102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3552456TCTTCATCTCATAATTAAATTTAATTATGAGATGAAGA0.220500.012000.724100.750001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179GCCCAUCCGUGUGCACACC58.7251699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651197GCCCATCCGTGTGCACACCGGTGTGCACACGGATGGGC0.039900.004000.646600.500000.923900.62500


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161GCCACUCCACUCCCCCUCG57.43131784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361179GCCACTCCACTCCCCCTCGCGAGGGGGAGTGGAGTGGC0.327400.228900.706900.500001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969ACAGCAGCAGCGACUUCAA86.884161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841987ACAGCAGCAGCGACTTCAATTGAAGTCGCTGCTGCTGT0.422000.003300.560300.750000.929300.87500


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820CAGUCUCCAGCUGCCUCUG66.26681209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507838CAGTCTCCAGCTGCCTCTGCAGAGGCAGCTGGAGACTG0.038500.002700.500000.500000.923900.62500


Target Position: 1901, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CAGACAAGGGCAAGAAAAA91.921354

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7190119CAGACAAGGGCAAGAAAAA1/0/1/094.96BAG3NM_004281.31NANANA10:121436661..121436679(+)|5:110719864..110719882(+)00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041919CAGACAAGGGCAAGAAAAATTTTTCTTGCCCTTGTCTG0.518600.143800.784500.750001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718CUGCGGGGCAUGCCAGAAA76.8324587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494736CTGCGGGGCATGCCAGAAATTTCTGGCATGCCCCGCAG0.236200.003100.784500.750000.978300.62500


Target Position: 2158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158UGGAGGCAAAACACUAAUA81.9877321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2262176TGGAGGCAAAACACTAATATATTAGTGTTTTGCCTCCA0.232000.034700.801700.750001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939CCCCACACAGAAACCCAGC52.16912096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181957CCCCACACAGAAACCCAGCGCTGGGTTTCTGTGTGGGG0.171200.107700.637900.500001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414CCAGUUCCUUGUCCUCCUC65.16171282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001432CCAGTTCCTTGTCCTCCTCGAGGAGGACAAGGAACTGG0.655300.188000.534500.750001.000001.00000


Target Position: 1147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147GCCAGGAGCAGCACGCCAC66.14881216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561165GCCAGGAGCAGCACGCCACGTGGCGTGCTGCTCCTGGC0.076200.001300.706900.750000.929300.75000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551GCCACCCUGUGUACCCCCA73.8973743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483569GCCACCCTGTGTACCCCCATGGGGGTACACAGGGTGGC0.039400.008300.655200.750000.972800.75000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151ACGUCACCCCCGCCUUUAA78.0789506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340169ACGTCACCCCCGCCTTTAATTAAAGGCGGGGGTGACGT0.099600.043900.741400.750000.929300.62500


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GCACCCUUUCCAUGUCUAU81.6287342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295648GCACCCTTTCCATGTCTATATAGACATGGAAAGGGTGC0.125100.030400.810301.000001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588UCCCAUUCCUGUGCUCCAU63.58911373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549606TCCCATTCCTGTGCTCCATATGGAGCACAGGAATGGGA0.018500.003200.715500.750001.000001.00000


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931CAGAAGAUCCCCACACAGA89.2706107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431949CAGAAGATCCCCACACAGATCTGTGTGGGGATCTTCTG0.583600.509700.560300.500000.983700.62500


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628GUGCACCCUUUCCAUGUCU71.6595868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
573646GTGCACCCTTTCCATGTCTAGACATGGAAAGGGTGCAC0.144400.026400.569000.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645ACUGACAAAAAGUACCUGA78.1637503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451663ACTGACAAAAAGTACCTGATCAGGTACTTTTTGTCAGT0.053100.016100.482800.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634AAGGCAAGAAGACUGACAA88.0067133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281652AAGGCAAGAAGACTGACAATTGTCAGTCTTCTTGCCTT0.302400.076500.491400.500001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972GCAGCAGCGACUUCAAACC65.08021287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801990GCAGCAGCGACTTCAAACCGGTTTGAAGTCGCTGCTGC0.496100.007300.500000.500000.989100.75000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CCAGUCUCCAGCUGCCUCU69.9145965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435837CCAGTCTCCAGCTGCCTCTAGAGGCAGCTGGAGACTGG0.128900.005900.620700.750000.962000.62500


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575AAAAAAAAAAAAAAAAAAA83.5835238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542593AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999500.998400.500000.500001.000001.00000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320CCCACUCGCCCAUGAUGCA79.7935420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485338CCCACTCGCCCATGATGCATGCATCATGGGCGAGTGGG0.039300.021000.637900.750000.967400.62500


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117GGCUAUUUCCAGACACUUC78.2566499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247135GGCTATTTCCAGACACTTCGAAGTGTCTGGAAATAGCC0.293500.280100.827600.750001.000001.00000


Target Position: 2539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539AAAAAGAAAAUAAAGUAAU77.1206567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232557AAAAAGAAAATAAAGTAATATTACTTTATTTTCTTTTT0.157800.112900.491400.500001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559GUGUACCCCCAGCUCCGAC62.78021438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551577GTGTACCCCCAGCTCCGACGTCGGAGCTGGGGGTACAC0.178500.012800.474100.500001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732GUGCGUCAGGCCAGGAGAG67.41031139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501750GTGCGTCAGGCCAGGAGAGCTCTCCTGGCCTGACGCAC0.062200.001500.482800.500000.989100.75000


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GGGGGUACAUCUCCAUUCC69.5614989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493932GGGGGTACATCTCCATTCCGGAATGGAGATGTACCCCC0.201600.003100.620700.500000.994600.75000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960CCAGAAGCCACAGCAGCAG63.31461397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101978CCAGAAGCCACAGCAGCAGCTGCTGCTGTGGCTTCTGG0.029700.006100.560300.750000.929300.75000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746CAGAUAAACAGUGUGGACA85.5027187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535764CAGATAAACAGTGTGGACATGTCCACACTGTTTATCTG0.094500.029000.577600.500001.000001.00000


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780GAAAAACUUGAACAGAAAG76.3185610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841798GAAAAACTTGAACAGAAAGCTTTCTGTTCAAGTTTTTC0.214900.126700.534500.500001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659CCUGAUGAUCGAAGAGUAU85.6537186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481677CCTGATGATCGAAGAGTATATACTCTTCGATCATCAGG0.018700.005400.801701.000001.000001.00000


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576ACCAGGCUACAUUCCCAUU71.7772860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297594ACCAGGCTACATTCCCATTAATGGGAATGTAGCCTGGT0.520400.019700.844800.750000.934800.87500


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCAGAAGACGCACUACCCA85.0316194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061008CCAGAAGACGCACTACCCATGGGTAGTGCGTCTTCTGG0.809600.068000.500000.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GACCCAUCGAGAAACUGCA88.1908132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721242GACCCATCGAGAAACTGCATGCAGTTTCTCGATGGGTC0.012400.001600.465500.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408CGGCUGGCCCUUCUUCGUG62.05171486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514426CGGCTGGCCCTTCTTCGTGCACGAAGAAGGGCCAGCCG0.027400.002700.620700.750000.934800.75000


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355GGUGACCGCGACCCUUUGC55.95511865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525373GGTGACCGCGACCCTTTGCGCAAAGGGTCGCGGTCACC0.025500.002200.500000.500000.940200.75000


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971AGCAGCAGCGACUUCAAAC67.621125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111989AGCAGCAGCGACTTCAAACGTTTGAAGTCGCTGCTGCT0.488800.007100.706900.500000.929300.75000


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244CUGUUUCCCAGCCUGAAAA80.5122392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401262CTGTTTCCCAGCCTGAAAATTTTCAGGCTGGGAAACAG0.129600.001900.784500.750000.934800.62500


Target Position: 2262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262ACCCCGUUGCUUGUUGUUC50.72542161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372280ACCCCGTTGCTTGTTGTTCGAACAACAAGCAACGGGGT0.505500.013900.681000.500001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733GAAACCACUCAGCCAGAUA92.591850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261751GAAACCACTCAGCCAGATATATCTGGCTGAGTGGTTTC0.149700.072300.629300.750001.000001.00000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045GUAAAAAUCAGACUCGGAA89.1172108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432063GTAAAAATCAGACTCGGAATTCCGAGTCTGATTTTTAC0.184500.065600.508600.750001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186AAAAGGAAAAUGAUGCUUU76.1266617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752204AAAAGGAAAATGATGCTTTAAAGCATCATTTTCCTTTT0.095400.011300.500000.500001.000001.00000


Target Position: 2216, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2216CUUACUCUGUACAAAUAAA96.880920

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2214-2236TTCTTACTCTGTACAAATAAAGAUUUAUUUGUACAGAGUAAGAACUUACUCUGUACAAAUAAAGAU-1.418.922


Target Position: 2212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212UAUUCUUACUCUGUACAAA87.9593134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232230TATTCTTACTCTGTACAAATTTGTACAGAGTAAGAATA0.089200.013300.543100.500001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745GGAGAGACGGUGUCAGGAA95.965829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611763GGAGAGACGGTGTCAGGAATTCCTGACACCGTCTCTCC0.015800.002500.698301.000000.978301.00000


Target Position: 1789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789GAACAGAAAGCCAUUGAUG78.9034462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181807GAACAGAAAGCCATTGATGCATCAATGGCTTTCTGTTC0.069700.029200.517200.500001.000001.00000


Target Position: 2565, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565CUCAAAAAAAAAAAAAAAA81.5223347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1552583CTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAG0.998700.991800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2563-2585AACTCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGAGUUCUCAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 1947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947AGAAACCCAGCAGCCAGAA72.719814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591965AGAAACCCAGCAGCCAGAATTCTGGCTGCTGGGTTTCT0.181400.051000.551700.750000.967400.87500


Target Position: 162, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GCCUUUAAUUCAUAAAGGU80.3703395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
160-182CCGCCTTTAATTCATAAAGGTGCACCUUUAUGAAUUAAAGGCGGGCCUUUAAUUCAUAAAGGUGCU10.911.033


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546AAAUAAAGUAAUAAUAUAA98.907812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672564AAATAAAGTAATAATATAATTATATTATTACTTTATTT0.617300.157100.465500.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318CACCCACUCGCCCAUGAUG69.5523990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526336CACCCACTCGCCCATGATGCATCATGGGCGAGTGGGTG0.024900.013000.637900.500000.967400.62500


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434AUUUUCUUCAUCUCAUAAU72.7574811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212452ATTTTCTTCATCTCATAATATTATGAGATGAAGAAAAT0.047100.006900.500000.500001.000001.00000


Target Position: 2073, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073GCUUUAGGGAAUUUUAAGU76.117618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2082091GCTTTAGGGAATTTTAAGTACTTAAAATTCCCTAAAGC0.202900.086700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2071-2093GTGCTTTAGGGAATTTTAAGTTGACUUAAAAUUCCCUAAAGCACGCUUUAGGGAAUUUUAAGUUGU-3.815.832


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310GACACAUCCCAAUUCAAGU83.3082263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761328GACACATCCCAATTCAAGTACTTGAATTGGGATGTGTC0.256200.189800.612100.500001.000001.00000


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739AGGCCAGGAGAGACGGUGU71.5718875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701757AGGCCAGGAGAGACGGTGTACACCGTCTCTCCTGGCCT0.093100.003800.637900.500000.902200.75000


Target Position: 2372, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372GUCAAUUACCCAUCACAUA91.020971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852390GTCAATTACCCATCACATATATGTGATGGGTAATTGAC0.129900.036600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2370-2392GAGTCAATTACCCATCACATAAAUAUGUGAUGGGUAAUUGACUCGUCAAUUACCCAUCACAUAAAU20.58.932


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563AACUCAAAAAAAAAAAAAA84.7921200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3232581AACTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAGTT0.997900.959700.646600.500001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646CUGACAAAAAGUACCUGAU82.1111315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791664CTGACAAAAAGTACCTGATATCAGGTACTTTTTGTCAG0.041000.012700.603400.750001.000001.00000


Target Position: 1989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1989CCCCAGCAGCAUGACAGAC63.51571380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1672007CCCCAGCAGCATGACAGACGTCTGTCATGCTGCTGGGG0.315100.078400.672400.750001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483GUGCCAGGAGCCAUAGGAA90.713178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222501GTGCCAGGAGCCATAGGAATTCCTATGGCTCCTGGCAC0.095500.002300.620700.750000.945700.75000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842GCUCAUCCUCAUCCUCCUC68.40271074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371860GCTCATCCTCATCCTCCTCGAGGAGGATGAGGATGAGC0.613000.161400.543100.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327UGUGCACUGUCUUUUGUAG72.0093851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272345TGTGCACTGTCTTTTGTAGCTACAAAAGACAGTGCACA0.073000.013500.534500.500001.000001.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367AGCCCCCACCUCCCUCUGA65.27251272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691385AGCCCCCACCTCCCTCTGATCAGAGGGAGGTGGGGGCT0.014000.001200.629300.500001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635AGGCAAGAAGACUGACAAA92.855149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891653AGGCAAGAAGACTGACAAATTTGTCAGTCTTCTTGCCT0.300200.084900.844800.750001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GUAACCCAGCAGCACCGUA83.6908226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832033GTAACCCAGCAGCACCGTATACGGTGCTGCTGGGTTAC0.061300.004700.500000.750000.907600.75000


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579AAAAAAAAAAAAAAAAAAA83.5835242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662597AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.998900.500000.500001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GUCAAGUCCAGGUCUAUGA82.7681278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821832GTCAAGTCCAGGTCTATGATCATAGACCTGGACTTGAC0.046400.009000.594800.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137ACCCCUCUCUGGCCACGUC58.93831687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377155ACCCCTCTCTGGCCACGTCGACGTGGCCAGAGAGGGGT0.123100.017000.534500.500000.940200.62500


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586AAAAAAAAAAAAAAAAAAA83.5835249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862604AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999400.500000.500001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68GCCAGUUGCUACCUCCCUU80.748385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10786GCCAGTTGCTACCTCCCTTAAGGGAGGTAGCAACTGGC0.816300.111600.862101.000001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779GGAAAAACUUGAACAGAAA99.75467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1681797GGAAAAACTTGAACAGAAATTTCTGTTCAAGTTTTTCC0.224000.141700.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1777-1799TTGGAAAAACTTGAACAGAAAGCUUUCUGUUCAAGUUUUUCCAAGGAAAAACUUGAACAGAAAGCU19.28.722


Target Position: 149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
149CCACGUCACCCCCGCCUUU70.4361929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296167CCACGTCACCCCCGCCTTTAAAGGCGGGGGTGACGTGG0.123400.054000.844801.000000.907600.75000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404UCCCCCUGCUCCAGUUCCU56.26291848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011422TCCCCCTGCTCCAGTTCCTAGGAACTGGAGCAGGGGGA0.235400.115500.525900.500000.978301.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471AGUGUGGCUACAGAAGAGA75.4794653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371489AGTGTGGCTACAGAAGAGATCTCTTCTGTAGCCACACT0.023100.003900.482800.500001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589AAAAAAAAAAAAAAAAAAA83.5835252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222607AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999600.500000.500001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344GGAUUCUAAACCUGUUUCC65.52141256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641362GGATTCTAAACCTGTTTCCGGAAACAGGTTTAGAATCC0.151200.023700.500000.500001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897GCAGCAGACAAGGGCAAGA80.2915399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681915GCAGCAGACAAGGGCAAGATCTTGCCCTTGTCTGCTGC0.191600.041000.629300.750001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020GGAGUACCAGACCCACCAG76.7502590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151038GGAGTACCAGACCCACCAGCTGGTGGGTCTGGTACTCC0.085000.002400.586200.750000.951100.62500


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627GGUGCACCCUUUCCAUGUC72.5693822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394645GGTGCACCCTTTCCATGTCGACATGGAAAGGGTGCACC0.178000.026600.534500.750000.983700.75000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177AAAGGGCUAAAAAGGAAAA78.2841496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792195AAAGGGCTAAAAAGGAAAATTTTCCTTTTTAGCCCTTT0.378400.064600.500000.500001.000001.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522UUAAUGCUACAUUUUAAAA78.5784479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4452540TTAATGCTACATTTTAAAATTTTAAAATGTAGCATTAA0.262000.055000.534500.500001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318CCAAUUCAAGUGAUCCGCA83.7569225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251336CCAATTCAAGTGATCCGCATGCGGATCACTTGAATTGG0.039400.040900.491400.750001.000001.00000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56AGUUUCUAGCCGGCCAGUU65.0781288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50174AGTTTCTAGCCGGCCAGTTAACTGGCCGGCTAGAAACT0.077000.002800.560300.750000.902200.75000


Target Position: 2450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450AAUUAAAAUACCUGACUUU82.4829295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5132468AATTAAAATACCTGACTTTAAAGTCAGGTATTTTAATT0.111800.074000.508600.500001.000001.00000


Target Position: 1633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633GAAGGCAAGAAGACUGACA88.7296117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751651GAAGGCAAGAAGACTGACATGTCAGTCTTCTTGCCTTC0.264200.063600.465500.500001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968CACAGCAGCAGCGACUUCA82.1109316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851986CACAGCAGCAGCGACTTCATGAAGTCGCTGCTGCTGTG0.069600.003200.569000.500000.929301.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CGAGAAACUGCACCUGUUU82.5784288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541249CGAGAAACTGCACCTGTTTAAACAGGTGCAGTTTCTCG0.111900.001300.793101.000001.000001.00000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973CCCUCCUUCCACCAAGCCC512149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459991CCCTCCTTCCACCAAGCCCGGGCTTGGTGGAAGGAGGG0.656800.112200.500000.500000.978300.62500


Target Position: 114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
114GGAGGCUAUUUCCAGACAC74.898684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520132GGAGGCTATTTCCAGACACGTGTCTGGAAATAGCCTCC0.333300.002300.577600.750000.978300.87500


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590AAAAAAAAAAAAAAAAAAA83.5835253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372608AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999600.500000.500001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135UGCUUGGUAUGCAGUAACU74.4549717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792153TGCTTGGTATGCAGTAACTAGTTACTGCATACCAAGCA0.109700.004300.646600.500000.967400.62500


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436GCCCUGGCCCUUCUGCUGU62.66011445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641454GCCCTGGCCCTTCTGCTGTACAGCAGAAGGGCCAGGGC0.026600.001200.793100.750000.978300.87500


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256AGUUUAACCCCGUUGCUUG69.5706988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632274AGTTTAACCCCGTTGCTTGCAAGCAACGGGGTTAAACT0.047900.044900.560300.500001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138CCCCUCUCUGGCCACGUCA71.5789873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298156CCCCTCTCTGGCCACGTCATGACGTGGCCAGAGAGGGG0.323900.019000.767200.750000.962000.75000


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613AGCAGGCUGUAGACAACUU81.9802323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561631AGCAGGCTGTAGACAACTTAAGTTGTCTACAGCCTGCT0.073600.004400.715500.750000.907600.75000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159CCCGCCUUUAAUUCAUAAA78.525484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385177CCCGCCTTTAATTCATAAATTTATGAATTAAAGGCGGG0.081600.012100.991401.000001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580GGCUACAUUCCCAUUCCUG73.1603789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478598GGCTACATTCCCATTCCTGCAGGAATGGGAATGTAGCC0.041400.016700.715500.750001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815UCAAGUCCAGGUCUAUGAA81.6489340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901833TCAAGTCCAGGTCTATGAATTCATAGACCTGGACTTGA0.114300.008500.551700.750001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768CAGACCAUCUUGGAAAAAC69.7789973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661786CAGACCATCTTGGAAAAACGTTTTTCCAAGATGGTCTG0.015100.005300.637900.500000.989101.00000


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165CUCCACUCCCCCUCGCCCA65.4241261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701183CTCCACTCCCCCTCGCCCATGGGCGAGGGGGAGTGGAG0.317500.256900.465500.500001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UUUAAAAAAAGAAAAUAAA75.8931633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672552TTTAAAAAAAGAAAATAAATTTATTTTCTTTTTTTAAA0.151400.130400.500000.500001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CUCAGCCAGAUAAACAGUG62.31891466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505758CTCAGCCAGATAAACAGTGCACTGTTTATCTGGCTGAG0.067300.007700.517200.500001.000001.00000


Target Position: 2385, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2385CACAUAAAUAUGAAACAUU88.2807130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922403CACATAAATATGAAACATTAATGTTTCATATTTATGTG0.078300.075100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2383-2405ATCACATAAATATGAAACATTTAAAUGUUUCAUAUUUAUGUGAUCACAUAAAUAUGAAACAUUUAU14.86.921


Target Position: 2556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556AUAAUAUAACUCAAAAAAA89.486999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852574ATAATATAACTCAAAAAAATTTTTTTGAGTTATATTAT0.990900.714400.543100.500001.000001.00000


Target Position: 2324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2324GGUUGUGCACUGUCUUUUG80.1058410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3232342GGTTGTGCACTGTCTTTTGCAAAAGACAGTGCACAACC0.138300.015400.706900.750001.000001.00000


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395GGUGAAAGUUCCCCCUGCU81.2884358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911413GGTGAAAGTTCCCCCTGCTAGCAGGGGGAACTTTCACC0.269200.029000.500000.750000.989100.87500


Target Position: 2381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2381CCAUCACAUAAAUAUGAAA97.86316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922399CCATCACATAAATATGAAATTTCATATTTATGTGATGG0.150200.008400.844801.000000.907600.62500


Target Position: 2552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552AGUAAUAAUAUAACUCAAA91.722556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1722570AGTAATAATATAACTCAAATTTGAGTTATATTATTACT0.956700.375400.706900.750001.000001.00000


Target Position: 1637, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637GCAAGAAGACUGACAAAAA100.9413

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6163719GCAAGAAGACTGACAAAAA1/0/1/094.96BAG3NM_004281.31NANANANA00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781655GCAAGAAGACTGACAAAAATTTTTGTCAGTCTTCTTGC0.085000.051100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1635-1657AGGCAAGAAGACTGACAAAAAGTUUUUUGUCAGUCUUCUUGCCUGCAAGAAGACUGACAAAAAGUU14.916.622


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650CAAAAAGUACCUGAUGAUC70.8435918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631668CAAAAAGTACCTGATGATCGATCATCAGGTACTTTTTG0.064300.008400.465500.500001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489GACUCCAUCCUCUGCCAAU85.0174196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336507GACTCCATCCTCTGCCAATATTGGCAGAGGATGGAGTC0.104100.013900.810300.750001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625ACAACUUUGAAGGCAAGAA77.9721514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831643ACAACTTTGAAGGCAAGAATTCTTGCCTTCAAAGTTGT0.105500.020300.534500.750001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233AAGAAGUUGCUUGUUGUUU68.0941094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342251AAGAAGTTGCTTGTTGTTTAAACAACAAGCAACTTCTT0.070800.002000.637900.500001.000001.00000


Target Position: 1166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166UCCACUCCCCCUCGCCCAU53.89532009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401184TCCACTCCCCCTCGCCCATATGGGCGAGGGGGAGTGGA0.308600.306100.715500.750001.000001.00000


Target Position: 82, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
82CCCUUUAUCUCCUCCUUCC65.43711259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409100CCCTTTATCTCCTCCTTCCGGAAGGAGGAGATAAAGGG0.198900.219200.620700.500001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373UCAAUUACCCAUCACAUAA83.1312269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262391TCAATTACCCATCACATAATTATGTGATGGGTAATTGA0.107500.027500.689700.750001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156ACCCCCGCCUUUAAUUCAU64.01911349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346174ACCCCCGCCTTTAATTCATATGAATTAAAGGCGGGGGT0.097200.044700.698300.750001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970CAGCAGCAGCGACUUCAAA91.036269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781988CAGCAGCAGCGACTTCAAATTTGAAGTCGCTGCTGCTG0.485900.003400.784500.750000.929300.75000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752CGGUGUCAGGAAGGUUCAG68.50921066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751770CGGTGTCAGGAAGGTTCAGCTGAACCTTCCTGACACCG0.031000.001000.629300.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504UCUGUAUGUUGGAUGACUU80.0019413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4042522TCTGTATGTTGGATGACTTAAGTCATCCAACATACAGA0.090400.007500.586200.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GGCUAAAAAGGAAAAUGAU89.697695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972199GGCTAAAAAGGAAAATGATATCATTTTCCTTTTTAGCC0.359900.321400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2179-2201AGGGCTAAAAAGGAAAATGATGCAUCAUUUUCCUUUUUAGCCCUGGCUAAAAAGGAAAAUGAUGCU7.413.722


Target Position: 2416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416UGCCAUUUUAAUGAGAUGA69.32031008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592434TGCCATTTTAATGAGATGATCATCTCATTAAAATGGCA0.018100.001300.629300.500001.000001.00000


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532AUUUUAAAAAAAGAAAAUA77.2564550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742550ATTTTAAAAAAAGAAAATATATTTTCTTTTTTTAAAAT0.184700.160800.465500.500001.000001.00000


Target Position: 1401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1401AGUUCCCCCUGCUCCAGUU73.4243772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421419AGTTCCCCCTGCTCCAGTTAACTGGAGCAGGGGGAACT0.141000.098400.560300.750000.978300.75000


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936GAUACACGAGCAGAACGUU85.1882192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379954GATACACGAGCAGAACGTTAACGTTCTGCTCGTGTATC0.174500.054300.534500.750000.956500.62500


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467CAAGAGUGUGGCUACAGAA99.68828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481485CAAGAGTGTGGCTACAGAATTCTGTAGCCACACTCTTG0.118800.017800.474100.750001.000001.00000


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263CCCCGUUGCUUGUUGUUCU76.7918589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3652281CCCCGTTGCTTGTTGTTCTAGAACAACAAGCAACGGGG0.515000.010800.767200.750001.000001.00000


Target Position: 2036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036CUCUGCCCUGUAAAAAUCA78.9776455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712054CTCTGCCCTGTAAAAATCATGATTTTTACAGGGCAGAG0.125800.002700.586200.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967CCACAGCAGCAGCGACUUC69.01181032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971985CCACAGCAGCAGCGACTTCGAAGTCGCTGCTGCTGTGG0.053200.003000.672400.750000.918500.62500


Target Position: 1466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466CCAAGAGUGUGGCUACAGA91.933653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251484CCAAGAGTGTGGCTACAGATCTGTAGCCACACTCTTGG0.065500.014600.620700.750000.978300.62500


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CACUCAGCCAGAUAAACAG79.344441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431756CACTCAGCCAGATAAACAGCTGTTTATCTGGCTGAGTG0.103600.053300.508600.500001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317CCACCCACUCGCCCAUGAU76.041622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437335CCACCCACTCGCCCATGATATCATGGGCGAGTGGGTGG0.060600.013400.663801.000000.967400.62500


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489GGAGCCAUAGGAAUAUCUG77.6922530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882507GGAGCCATAGGAATATCTGCAGATATTCCTATGGCTCC0.039100.009500.586200.750001.000001.00000


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083AUUUUAAGUUGCAUGCAUU80.9053381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872101ATTTTAAGTTGCATGCATTAATGCATGCAACTTAAAAT0.104600.018200.500000.500001.000001.00000


Target Position: 1932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1932AGAAGAUCCCCACACAGAA91.075167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611950AGAAGATCCCCACACAGAATTCTGTGTGGGGATCTTCT0.694000.513000.551700.750000.972800.62500


Target Position: 2113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113AAGUCAGUUGGUUUUUAUU80.9703375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582131AAGTCAGTTGGTTTTTATTAATAAAAACCAACTGACTT0.159600.004300.629300.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CCCAUGACCCAUCGAGAAA82.092317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991237CCCATGACCCATCGAGAAATTTCTCGATGGGTCATGGG0.034300.019000.991401.000000.962000.75000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CGCCACUCCACUCCCCCUC51.63332119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851178CGCCACTCCACTCCCCCTCGAGGGGGAGTGGAGTGGCG0.413600.239000.612100.750001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220CUCUGUACAAAUAAAGAAG73.9659739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002238CTCTGTACAAATAAAGAAGCTTCTTTATTTGTACAGAG0.034100.004600.672400.500001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569AAAAAAAAAAAAAAAAAAA83.5835232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292587AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999200.995900.500000.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430CUCCCAGCCCUGGCCCUUC50.69612163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251448CTCCCAGCCCTGGCCCTTCGAAGGGCCAGGGCTGGGAG0.093300.006400.637900.500000.907600.87500


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CCACUCAGCCAGAUAAACA90.235785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
269755CCACTCAGCCAGATAAACATGTTTATCTGGCTGAGTGG0.140000.034400.637900.750001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CCAGCAACCUUGAAGCAGA89.4673100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881859CCAGCAACCTTGAAGCAGATCTGCTTCAAGGTTGCTGG0.128900.050700.620700.750000.983700.75000


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614GCAGGCUGUAGACAACUUU80.511393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771632GCAGGCTGTAGACAACTTTAAAGTTGTCTACAGCCTGC0.058700.003500.853401.000000.907600.87500


Target Position: 1408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1408CCUGCUCCAGUUCCUUGUC61.65121516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151426CCTGCTCCAGTTCCTTGTCGACAAGGAACTGGAGCAGG0.437900.099200.525900.750000.978300.62500


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629UGCACCCUUUCCAUGUCUA77.8989517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287647TGCACCCTTTCCATGTCTATAGACATGGAAAGGGTGCA0.129500.030800.681000.750001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592UGGAGAAGGUACAGGGGCU71.0974906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621610TGGAGAAGGTACAGGGGCTAGCCCCTGTACCTTCTCCA0.022700.002600.491400.500001.000001.00000


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410UGCUCCAGUUCCUUGUCCU70.5984927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491428TGCTCCAGTTCCTTGTCCTAGGACAAGGAACTGGAGCA0.465800.109400.508600.500001.000001.00000


Target Position: 2301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301CACCCCCACCACCUGUUAG65.38611263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4382319CACCCCCACCACCTGTTAGCTAACAGGTGGTGGGGGTG0.175500.055100.620700.500001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433GAUUUUCUUCAUCUCAUAA98.379915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072451GATTTTCTTCATCTCATAATTATGAGATGAAGAAAATC0.030900.006100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2431-2453ATGATTTTCTTCATCTCATAATTUUAUGAGAUGAAGAAAAUCAUGAUUUUCUUCAUCUCAUAAUUU21.45.321


Target Position: 2507, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507GUAUGUUGGAUGACUUUAA94.55135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382525GTATGTTGGATGACTTTAATTAAAGTCATCCAACATAC0.150300.013800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2505-2527CTGTATGTTGGATGACTTTAATGUUAAAGUCAUCCAACAUACAGGUAUGUUGGAUGACUUUAAUGU14.613.522


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976UCCUUCCACCAAGCCCAGA56.76111824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398994TCCTTCCACCAAGCCCAGATCTGGGCTTGGTGGAAGGA0.106900.089500.646600.500000.989100.75000


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542AAGAAAAUAAAGUAAUAAU86.5368174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142560AAGAAAATAAAGTAATAATATTATTACTTTATTTTCTT0.166400.125800.629300.500001.000001.00000


Target Position: 2112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2112UAAGUCAGUUGGUUUUUAU79.552434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222130TAAGTCAGTTGGTTTTTATATAAAAACCAACTGACTTA0.138500.002400.491400.500001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092UGCAUGCAUUUCAGAGACU71.5963871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452110TGCATGCATTTCAGAGACTAGTCTCTGAAATGCATGCA0.261500.041300.646600.500001.000001.00000


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149UAACUUGGGUGGAGGCAAA80.613390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532167TAACTTGGGTGGAGGCAAATTTGCCTCCACCCAAGTTA0.701400.003100.534500.500001.000001.00000


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731UGUGCGUCAGGCCAGGAGA71.5855872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411749TGTGCGTCAGGCCAGGAGATCTCCTGGCCTGACGCACA0.268500.001800.482800.500000.989100.87500


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508UAUGUUGGAUGACUUUAAU78.7744470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372526TATGTTGGATGACTTTAATATTAAAGTCATCCAACATA0.100900.005700.534500.500001.000001.00000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CCCAGUCUCCAGCUGCCUC63.67681369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428836CCCAGTCTCCAGCTGCCTCGAGGCAGCTGGAGACTGGG0.128500.006100.681000.750000.962000.75000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462UCCCCCAAGAGUGUGGCUA60.37991583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031480TCCCCCAAGAGTGTGGCTATAGCCACACTCTTGGGGGA0.032400.006600.698300.750000.913000.87500


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667UCGAAGAGUAUUUGACCAA78.1513504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881685TCGAAGAGTATTTGACCAATTGGTCAAATACTCTTCGA0.080400.009800.646600.750001.000001.00000


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577CCAGGCUACAUUCCCAUUC58.82551693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286595CCAGGCTACATTCCCATTCGAATGGGAATGTAGCCTGG0.404800.021500.672400.750000.934800.87500


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218GCCCAUGACCCAUCGAGAA86.5092177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941236GCCCATGACCCATCGAGAATTCTCGATGGGTCATGGGC0.037100.018900.827601.000000.951100.62500


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607GGCUGGAGCAGGCUGUAGA87.4253152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791625GGCTGGAGCAGGCTGTAGATCTACAGCCTGCTCCAGCC0.066100.003400.775900.750001.000001.00000


Target Position: 2484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484UGCCAGGAGCCAUAGGAAU69.33341007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172502TGCCAGGAGCCATAGGAATATTCCTATGGCTCCTGGCA0.070400.002400.844800.750000.945700.62500


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368GGGAGUCAAUUACCCAUCA90.525880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832386GGGAGTCAATTACCCATCATGATGGGTAATTGACTCCC0.130600.029500.767200.750000.902200.62500


Target Position: 1820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820UCCAGGUCUAUGAACUCCA73.4366770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121838TCCAGGTCTATGAACTCCATGGAGTTCATAGACCTGGA0.204400.014300.525900.500001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833ACUCCAGCCCAGCAACCUU73.806748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491851ACTCCAGCCCAGCAACCTTAAGGTTGCTGGGCTGGAGT0.096700.032700.569000.750000.967400.75000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638CAAGAAGACUGACAAAAAG82.1694311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671656CAAGAAGACTGACAAAAAGCTTTTTGTCAGTCTTCTTG0.065300.034200.508600.500001.000001.00000


Target Position: 2374, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374CAAUUACCCAUCACAUAAA96.180127

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8237419CAATTACCCATCACATAAA1/0/1/094.96BAG3NM_004281.31NANANA10:121437134..121437152(+)00BAG3(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162392CAATTACCCATCACATAAATTTATGTGATGGGTAATTG0.112200.029500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394GTCAATTACCCATCACATAAATAUUUAUGUGAUGGGUAAUUGACCAAUUACCCAUCACAUAAAUAU13.513.923


Target Position: 2201, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2201CUUUUCUUCUAUAUUCUUA90.777175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672219CTTTTCTTCTATATTCTTATAAGAATATAGAAGAAAAG0.117000.003900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2199-2221TGCTTTTCTTCTATATTCTTACTUAAGAAUAUAGAAGAAAAGCACUUUUCUUCUAUAUUCUUACUU6.95.521


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521UUUAAUGCUACAUUUUAAA74.0582731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4912539TTTAATGCTACATTTTAAATTTAAAATGTAGCATTAAA0.221200.036600.500000.500001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983ACCAAGCCCAGAAGACGCA69.3841001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571001ACCAAGCCCAGAAGACGCATGCGTCTTCTGGGCTTGGT0.088000.030700.500000.500000.913000.87500


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610UGGAGCAGGCUGUAGACAA83.5613254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881628TGGAGCAGGCTGTAGACAATTGTCTACAGCCTGCTCCA0.130400.008500.698300.750001.000001.00000


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125CCAGACACUUCCACCCCUC65.57281251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387143CCAGACACTTCCACCCCTCGAGGGGTGGAAGTGTCTGG0.541300.076300.534500.750001.000001.00000


Target Position: 2557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2557UAAUAUAACUCAAAAAAAA91.387462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3812575TAATATAACTCAAAAAAAATTTTTTTTGAGTTATATTA0.993100.938700.534500.500001.000001.00000


Target Position: 2097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2097GCAUUUCAGAGACUUUAAG73.3992773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412115GCATTTCAGAGACTTTAAGCTTAAAGTCTCTGAAATGC0.021800.003100.715500.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098CCCGUUCAGGUCAUCUGUC64.97891295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421116CCCGTTCAGGTCATCTGTCGACAGATGACCTGAACGGG0.025100.001800.672400.750000.940200.75000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648GACAAAAAGUACCUGAUGA93.365443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321666GACAAAAAGTACCTGATGATCATCAGGTACTTTTTGTC0.096700.009700.594800.500001.000001.00000


Target Position: 2360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360GGUAGAUGGGGAGUCAAUU84.0585217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2358-2380GGGGTAGATGGGGAGTCAATTACAAUUGACUCCCCAUCUACCCCGGUAGAUGGGGAGUCAAUUACU19.220.333


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431ACAACAGCCGCACCACUAC64.06841343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569449ACAACAGCCGCACCACTACGTAGTGGTGCGGCTGTTGT0.087800.004100.525900.500000.923900.62500


Target Position: 2544, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544GAAAAUAAAGUAAUAAUAU93.821539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2662562GAAAATAAAGTAATAATATATATTATTACTTTATTTTC0.400100.144100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2542-2564AAGAAAATAAAGTAATAATATAAAUAUUAUUACUUUAUUUUCUUGAAAAUAAAGUAAUAAUAUAAU-8.0-9.721


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465CCCAAGAGUGUGGCUACAG65.72271240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481483CCCAAGAGTGTGGCTACAGCTGTAGCCACACTCTTGGG0.053900.011300.706900.750000.913000.62500


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223UGUACAAAUAAAGAAGUUG64.03971345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252241TGTACAAATAAAGAAGTTGCAACTTCTTTATTTGTACA0.048100.006000.560300.500001.000001.00000


Target Position: 2418, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418CCAUUUUAAUGAGAUGAUU82.2828306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712436CCATTTTAATGAGATGATTAATCATCTCATTAAAATGG0.012900.001300.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2416-2438TGCCATTTTAATGAGATGATTTTAAUCAUCUCAUUAAAAUGGCACCAUUUUAAUGAGAUGAUUUUU20.4-1.422


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903GACAAGGGCAAGAAAAAUG72.2108843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441921GACAAGGGCAAGAAAAATGCATTTTTCTTGCCCTTGTC0.035500.007100.663800.500001.000001.00000


Target Position: 2205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205UCUUCUAUAUUCUUACUCU82.939276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652223TCTTCTATATTCTTACTCTAGAGTAAGAATATAGAAGA0.064900.017900.500000.500001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932CGGUGAUACACGAGCAGAA97.759418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413950CGGTGATACACGAGCAGAATTCTGCTCGTGTATCACCG0.295100.007000.741401.000000.983700.87500


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968CCCAGCCCUCCUUCCACCA68.08431095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283986CCCAGCCCTCCTTCCACCATGGTGGAAGGAGGGCTGGG0.348500.165700.646600.750001.000001.00000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152CGUCACCCCCGCCUUUAAU73.0736794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369170CGTCACCCCCGCCTTTAATATTAAAGGCGGGGGTGACG0.091000.040300.767201.000001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096UGCAUUUCAGAGACUUUAA82.5625290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162114TGCATTTCAGAGACTTTAATTAAAGTCTCTGAAATGCA0.035600.002400.819000.750001.000001.00000


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524AAUGCUACAUUUUAAAAAA90.809574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102542AATGCTACATTTTAAAAAATTTTTTAAAATGTAGCATT0.317700.066300.508600.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GCUACACCUCCAAAACCAG75.3858659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571537GCTACACCTCCAAAACCAGCTGGTTTTGGAGGTGTAGC0.017000.014600.569000.750001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800CAUUGAUGUCCCAGGUCAA97.721619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541818CATTGATGTCCCAGGTCAATTGACCTGGGACATCAATG0.017200.002000.508600.750001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616AGGCUGUAGACAACUUUGA77.998513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471634AGGCTGTAGACAACTTTGATCAAAGTTGTCTACAGCCT0.079400.004900.620700.500000.907600.75000


Target Position: 2167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2167AACACUAAUAAAAGGGCUA79.8952417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522185AACACTAATAAAAGGGCTATAGCCCTTTTATTAGTGTT0.179900.062400.474100.500001.000001.00000


Target Position: 1335, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335CAAAGAGGUGGAUUCUAAA98.441414

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2133519CAAAGAGGTGGATTCTAAA1/0/1/097.75BAG3NM_004281.31NANANA10:121436095..121436113(+)00BAG3(0.002)


Target Position: 1334, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334GCAAAGAGGUGGAUUCUAA99.56989

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1332-1354CCGCAAAGAGGTGGATTCTAAACUUAGAAUCCACCUCUUUGCGGGCAAAGAGGUGGAUUCUAAACU16.016.623


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216CAGCCCAUGACCCAUCGAG66.50971191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531234CAGCCCATGACCCATCGAGCTCGATGGGTCATGGGCTG0.022400.017200.474100.500000.945700.62500


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432UGAUUUUCUUCAUCUCAUA89.955491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372450TGATTTTCTTCATCTCATATATGAGATGAAGAAAATCA0.022200.005300.681000.750000.972800.62500


Target Position: 2407, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407CAGAAAUGUUGCCAUUUUA96.108128

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5240719CAGAAATGTTGCCATTTTA1/0/1/097.21BAG3NM_004281.31NANANA10:121437167..121437185(+)00BAG3(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2405-2427ATCAGAAATGTTGCCATTTTAATUAAAAUGGCAACAUUUCUGAUCAGAAAUGUUGCCAUUUUAAUU11.312.012


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CCACCAAGCCCAGAAGACG64.51661319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434999CCACCAAGCCCAGAAGACGCGTCTTCTGGGCTTGGTGG0.073800.034700.569000.500000.913000.62500


Target Position: 2558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558AAUAUAACUCAAAAAAAAA91.068368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4342576AATATAACTCAAAAAAAAATTTTTTTTTGAGTTATATT0.993400.941300.508600.500001.000001.00000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561AUAACUCAAAAAAAAAAAA79.1974450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3642579ATAACTCAAAAAAAAAAAATTTTTTTTTTTTGAGTTAT0.996500.956100.543100.500001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CUGUAUGUUGGAUGACUUU82.135313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972523CTGTATGTTGGATGACTTTAAAGTCATCCAACATACAG0.145000.007900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2503-2525ATCTGTATGTTGGATGACTTTAAAAAGUCAUCCAACAUACAGAUCUGUAUGUUGGAUGACUUUAAU19.220.422


Target Position: 633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633CCCUUUCCAUGUCUAUCCC61.77461507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488651CCCTTTCCATGTCTATCCCGGGATAGACATGGAAAGGG0.202900.062300.500000.500001.000001.00000


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137CUUGGUAUGCAGUAACUUG77.8084522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632155CTTGGTATGCAGTAACTTGCAAGTTACTGCATACCAAG0.247800.014000.491400.500001.000001.00000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840CCCAGCAACCUUGAAGCAG58.7481697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011858CCCAGCAACCTTGAAGCAGCTGCTTCAAGGTTGCTGGG0.119200.046500.706900.750000.983700.75000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148GUAACUUGGGUGGAGGCAA80.1789405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4912166GTAACTTGGGTGGAGGCAATTGCCTCCACCCAAGTTAC0.042100.003100.534500.750001.000001.00000


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136CACCCCUCUCUGGCCACGU61.02591547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505154CACCCCTCTCTGGCCACGTACGTGGCCAGAGAGGGGTG0.031800.015500.517200.500000.918500.62500


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568AAAAAAAAAAAAAAAAAAA83.5835231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892586AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999100.994800.500000.500001.000001.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493CCAUAGGAAUAUCUGUAUG79.2637446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5682511CCATAGGAATATCTGTATGCATACAGATATTCCTATGG0.014300.005500.689700.750001.000001.00000


Target Position: 2213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2213AUUCUUACUCUGUACAAAU81.8142333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702231ATTCTTACTCTGTACAAATATTTGTACAGAGTAAGAAT0.091700.011600.500000.500001.000001.00000


Target Position: 2155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2155GGGUGGAGGCAAAACACUA96.761322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3872173GGGTGGAGGCAAAACACTATAGTGTTTTGCCTCCACCC0.203900.008500.819001.000001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970CAGCCCUCCUUCCACCAAG66.88671171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
397988CAGCCCTCCTTCCACCAAGCTTGGTGGAAGGAGGGCTG0.339700.157700.646600.500000.983700.62500


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320AAUUCAAGUGAUCCGCAAA87.8155141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601338AATTCAAGTGATCCGCAAATTTGCGGATCACTTGAATT0.058100.034000.508600.500001.000001.00000


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837CAGCCCAGCAACCUUGAAG67.0151166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611855CAGCCCAGCAACCTTGAAGCTTCAAGGTTGCTGGGCTG0.095700.034000.646600.500000.967400.62500


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533UUUUAAAAAAAGAAAAUAA80.159408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602551TTTTAAAAAAAGAAAATAATTATTTTCTTTTTTTAAAA0.177900.156300.465500.500001.000001.00000


Target Position: 2551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2551AAGUAAUAAUAUAACUCAA99.164610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5192569AAGTAATAATATAACTCAATTGAGTTATATTATTACTT0.945400.191700.491400.500001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290GCAGACCCCAACCCAGCAU69.7949971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194308GCAGACCCCAACCCAGCATATGCTGGGTTGGGGTCTGC0.196200.126500.698301.000001.000001.00000


Target Position: 2221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2221UCUGUACAAAUAAAGAAGU65.68011243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872239TCTGTACAAATAAAGAAGTACTTCTTTATTTGTACAGA0.039100.005900.517200.500001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836CUGACUGCUCAUCCUCAUC68.18421086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326854CTGACTGCTCATCCTCATCGATGAGGATGAGCAGTCAG0.868200.115300.603400.500000.978300.75000


Target Position: 2560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560UAUAACUCAAAAAAAAAAA74.7335696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442578TATAACTCAAAAAAAAAAATTTTTTTTTTTGAGTTATA0.995500.954400.543100.500001.000001.00000


Target Position: 2382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2382CAUCACAUAAAUAUGAAAC73.0299795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4452400CATCACATAAATATGAAACGTTTCATATTTATGTGATG0.115500.005100.508600.500000.907600.62500


Target Position: 2197, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197GAUGCUUUUCUUCUAUAUU87.6251147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902215GATGCTTTTCTTCTATATTAATATAGAAGAAAAGCATC0.064900.003200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2195-2217ATGATGCTTTTCTTCTATATTCTAAUAUAGAAGAAAAGCAUCAUGAUGCUUUUCUUCUAUAUUCUU8.218.522


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741UCAGCCAGAUAAACAGUGU69.20541018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457759TCAGCCAGATAAACAGTGTACACTGTTTATCTGGCTGA0.055100.004300.517200.500001.000001.00000


Target Position: 2242, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2242CUUGUUGUUUGAGAAGUUU75.2856666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4052260CTTGTTGTTTGAGAAGTTTAAACTTCTCAAACAACAAG0.093200.007400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2240-2262TGCTTGTTGTTTGAGAAGTTTAAAAACUUCUCAAACAACAAGCACUUGUUGUUUGAGAAGUUUAAU17.719.322


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530ACAUUUUAAAAAAAGAAAA80.7163386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2482548ACATTTTAAAAAAAGAAAATTTTCTTTTTTTAAAATGT0.250600.162600.706900.750001.000001.00000


Target Position: 2470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470GAGAGAGUAAAAUGUGCCA90.169887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5682488GAGAGAGTAAAATGTGCCATGGCACATTTTACTCTCTC0.045400.010400.465500.500001.000001.00000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375AAUUACCCAUCACAUAAAU78.6342475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692393AATTACCCATCACATAAATATTTATGTGATGGGTAATT0.385800.034400.500000.500001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626CAACUUUGAAGGCAAGAAG72.7543812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291644CAACTTTGAAGGCAAGAAGCTTCTTGCCTTCAAAGTTG0.186200.017700.508600.500001.000001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451CUGUCCCCUCUUCCCCCAA71.2153895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801469CTGTCCCCTCTTCCCCCAATTGGGGGAAGAGGGGACAG0.041000.032200.637900.750001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746GAGAGACGGUGUCAGGAAG79.7437423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741764GAGAGACGGTGTCAGGAAGCTTCCTGACACCGTCTCTC0.011900.001300.672400.500000.978301.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659GGAUGCAGCGAUUCCGAAC72.8252807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555677GGATGCAGCGATTCCGAACGTTCGGAATCGCTGCATCC0.087200.001300.724100.750000.983700.62500


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734AAACCACUCAGCCAGAUAA89.3548104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569752AAACCACTCAGCCAGATAATTATCTGGCTGAGTGGTTT0.146800.062200.465500.500001.000001.00000


Target Position: 2527, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527GCUACAUUUUAAAAAAAGA90.574379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2562545GCTACATTTTAAAAAAAGATCTTTTTTTAAAATGTAGC0.301900.116500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2525-2547ATGCTACATTTTAAAAAAAGAAAUCUUUUUUUAAAAUGUAGCAUGCUACAUUUUAAAAAAAGAAAU-5.911.611


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529UACAUUUUAAAAAAAGAAA75.5855645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172547TACATTTTAAAAAAAGAAATTTCTTTTTTTAAAATGTA0.263600.130200.681000.500001.000001.00000


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445CUUCUGCUGUCCCCUCUUC63.87331359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591463CTTCTGCTGTCCCCTCTTCGAAGAGGGGACAGCAGAAG0.112100.008200.465500.500001.000001.00000


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460CCUGACUUUAGAGAGAGUA81.9647325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3812478CCTGACTTTAGAGAGAGTATACTCTCTCTAAAGTCAGG0.094300.009300.663801.000001.000001.00000


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CCUCUGCCCUGUAAAAAUC69.37251003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612053CCTCTGCCCTGTAAAAATCGATTTTTACAGGGCAGAGG0.077500.004100.663800.750001.000001.00000


Target Position: 2321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2321UGUGGUUGUGCACUGUCUU73.9066742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392339TGTGGTTGTGCACTGTCTTAAGACAGTGCACAACCACA0.105800.001900.569000.750000.940200.62500


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570AAAAAAAAAAAAAAAAAAA83.5835233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302588AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999200.996500.500000.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574AAAAAAAAAAAAAAAAAAA83.5835237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4512592AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999400.998300.500000.500001.000001.00000


Target Position: 1170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1170CUCCCCCUCGCCCAUCCGU52.63982079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171188CTCCCCCTCGCCCATCCGTACGGATGGGCGAGGGGGAG0.026600.016700.534500.500000.983700.75000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369GGAGUCAAUUACCCAUCAC77.227555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162387GGAGTCAATTACCCATCACGTGATGGGTAATTGACTCC0.139800.043100.577600.750000.923900.62500


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581GCUACAUUCCCAUUCCUGU80.1932402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492599GCTACATTCCCATTCCTGTACAGGAATGGGAATGTAGC0.037200.020900.646600.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609CUGGAGCAGGCUGUAGACA76.4993602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821627CTGGAGCAGGCTGTAGACATGTCTACAGCCTGCTCCAG0.083300.015500.577600.500001.000001.00000


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784AACUUGAACAGAAAGCCAU76.4103604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201802AACTTGAACAGAAAGCCATATGGCTTTCTGTTCAAGTT0.160200.054100.491400.500001.000001.00000


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788UGAACAGAAAGCCAUUGAU77.4553542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801806TGAACAGAAAGCCATTGATATCAATGGCTTTCTGTTCA0.084300.037700.543100.750001.000001.00000


Target Position: 2156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156GGUGGAGGCAAAACACUAA96.858321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3152174GGTGGAGGCAAAACACTAATTAGTGTTTTGCCTCCACC0.214900.016700.819001.000001.000001.00000


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435AGCCCUGGCCCUUCUGCUG57.26761800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601453AGCCCTGGCCCTTCTGCTGCAGCAGAAGGGCCAGGGCT0.027600.001300.569000.500000.956500.62500


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CAGACCCCAACCCAGCAUG60.2021598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452309CAGACCCCAACCCAGCATGCATGCTGGGTTGGGGTCTG0.145200.113400.629300.500001.000001.00000


Target Position: 354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
354CGGUGACCGCGACCCUUUG67.61161128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529372CGGTGACCGCGACCCTTTGCAAAGGGTCGCGGTCACCG0.026700.002100.767200.750000.934800.62500


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668CGAAGAGUAUUUGACCAAA95.341131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541686CGAAGAGTATTTGACCAAATTTGGTCAAATACTCTTCG0.100600.012100.793101.000001.000001.00000


Target Position: 2209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2209CUAUAUUCUUACUCUGUAC81.1763365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212227CTATATTCTTACTCTGTACGTACAGAGTAAGAATATAG0.134700.017200.491400.500001.000001.00000


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335GUCUUUUGUAGCUCUGGAC69.34911006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322353GTCTTTTGTAGCTCTGGACGTCCAGAGCTACAAAAGAC0.023000.002600.500000.500001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080GGAAUUUUAAGUUGCAUGC63.07041414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242098GGAATTTTAAGTTGCATGCGCATGCAACTTAAAATTCC0.068100.035700.517200.500001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984CCAAGCCCAGAAGACGCAC56.31571840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3601002CCAAGCCCAGAAGACGCACGTGCGTCTTCTGGGCTTGG0.095000.030100.551700.750000.913001.00000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CAGAAACCACUCAGCCAGA86.5755171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339749CAGAAACCACTCAGCCAGATCTGGCTGAGTGGTTTCTG0.136200.092500.560300.500001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CCAUUCCUGUGCUCCAUGA83.4345260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542608CCATTCCTGTGCTCCATGATCATGGAGCACAGGAATGG0.020400.002000.620700.750000.978300.62500


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660CUGAUGAUCGAAGAGUAUU77.2011560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461678CTGATGATCGAAGAGTATTAATACTCTTCGATCATCAG0.019100.003500.775900.750001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900GCAGACAAGGGCAAGAAAA87.7996143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1061918GCAGACAAGGGCAAGAAAATTTTCTTGCCCTTGTCTGC0.327900.137100.853401.000001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567CAAAAAAAAAAAAAAAAAA86.7759165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2192585CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.999000.994100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2565-2587CTCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGAGCAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559AUAUAACUCAAAAAAAAAA85.4721188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812577ATATAACTCAAAAAAAAAATTTTTTTTTTGAGTTATAT0.995000.945000.543100.500001.000001.00000


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738CAGGCCAGGAGAGACGGUG59.55381647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481756CAGGCCAGGAGAGACGGTGCACCGTCTCTCCTGGCCTG0.218400.004600.491400.500000.902200.87500


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812AGGUCAAGUCCAGGUCUAU82.7602279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281830AGGTCAAGTCCAGGTCTATATAGACCTGGACTTGACCT0.062400.002100.801700.750000.989100.75000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178AAGGGCUAAAAAGGAAAAU63.39931389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462196AAGGGCTAAAAAGGAAAATATTTTCCTTTTTAGCCCTT0.338100.069700.629300.500001.000001.00000


Target Position: 2386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2386ACAUAAAUAUGAAACAUUU87.9374136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3932404ACATAAATATGAAACATTTAAATGTTTCATATTTATGT0.077800.071700.706900.750001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150AACUUGGGUGGAGGCAAAA73.7684753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042168AACTTGGGTGGAGGCAAAATTTTGCCTCCACCCAAGTT0.690500.003000.646600.500001.000001.00000


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227CCAUCGAGAAACUGCACCU79.9788415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711245CCATCGAGAAACTGCACCTAGGTGCAGTTTCTCGATGG0.026300.001100.500000.750001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136GCUUGGUAUGCAGUAACUU81.3315356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022154GCTTGGTATGCAGTAACTTAAGTTACTGCATACCAAGC0.256200.007600.715501.000001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799CCAUUGAUGUCCCAGGUCA87.4439151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521817CCATTGATGTCCCAGGTCATGACCTGGGACATCAATGG0.017600.002000.620700.750001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974CCUCCUUCCACCAAGCCCA75.4468656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449992CCTCCTTCCACCAAGCCCATGGGCTTGGTGGAAGGAGG0.643600.102800.500000.750000.978300.62500


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402GUUCCCCCUGCUCCAGUUC53.94542004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471420GTTCCCCCTGCTCCAGTTCGAACTGGAGCAGGGGGAAC0.158900.108900.474100.500000.978300.87500


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751ACGGUGUCAGGAAGGUUCA74.0458734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701769ACGGTGTCAGGAAGGTTCATGAACCTTCCTGACACCGT0.049400.001600.551700.500001.000001.00000


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786CUUGAACAGAAAGCCAUUG61.29821532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171804CTTGAACAGAAAGCCATTGCAATGGCTTTCTGTTCAAG0.122200.048400.491400.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921GCUGGAAAUGCAGAAGAUC70.9697910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571939GCTGGAAATGCAGAAGATCGATCTTCTGCATTTCCAGC0.589100.001300.672400.750001.000001.00000


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662GAUGAUCGAAGAGUAUUUG74.2068724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471680GATGATCGAAGAGTATTTGCAAATACTCTTCGATCATC0.018800.002600.534500.500001.000001.00000


Target Position: 2161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161AGGCAAAACACUAAUAAAA89.494398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822179AGGCAAAACACTAATAAAATTTTATTAGTGTTTTGCCT0.132100.022000.844800.750001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432CCCAGCCCUGGCCCUUCUG49.43872222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491450CCCAGCCCTGGCCCTTCTGCAGAAGGGCCAGGGCTGGG0.090100.004700.706900.750000.907600.62500


Target Position: 2436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436UUUCUUCAUCUCAUAAUUA82.4907294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5612454TTTCTTCATCTCATAATTATAATTATGAGATGAAGAAA0.100600.008700.465500.500001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736ACCACUCAGCCAGAUAAAC59.76951631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459754ACCACTCAGCCAGATAAACGTTTATCTGGCTGAGTGGT0.144100.043900.706900.500001.000001.00000