siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai 14   587   820   1211   1397  
Biltr, Sidirect 364  
Biltr, Rnaxs, Sidirect 529   537   539   1434  
Biltr, Rnaxs 88   89   90   128   129   135   136   137   151   152   153   154   162   163   166   167   168   171   172   176  
181   182   183   184   207   208   213   215   219   220   221   222   224   225   227   228   250   251   252   253  
254   255   257   258   261   262   263   281   282   284   285   286   287   288   290   291   320   331   332   334  
335   339   360   361   362   404   405   406   407   415   416   417   418   430   432   433   469   470   471   472  
480   494   524   525   527   528   530   531   534   535   536   538   560   575   579   665   666   679   680   681  
682   686   687   689   740   742   745   768   772   773   775   776   777   783   785   786   787   788   794   795  
861   862   867   876   879   907   908   909   931   932   933   1021   1022   1053   1055   1091   1117   1118   1119   1120  
1125   1126   1127   1130   1131   1132   1136   1137   1138   1139   1140   1141   1142   1143   1144   1150   1151   1152   1153   1155  
1187   1188   1199   1217   1218   1219   1286   1287   1290   1327   1328   1329   1406   1407   1420   1424   1425   1427   1428   1429  
1430   1431   1432   1433   1435   1436   1437  
Biltr, Ernai, Rnaxs 431   526   934   1289   1426  


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140GCCUGCCACCUCCCACUCC56.20521078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401158GCCTGCCACCTCCCACTCCGGAGTGGGAGGTGGCAGGC0.520400.128000.629300.500000.989100.87500


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406CGGUUGCGGCUGGAGGAAG62.274837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144424CGGTTGCGGCTGGAGGAAGCTTCCTCCAGCCGCAACCG0.046200.004200.775900.750001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155CUCCUGAAGAUCCAUCUCU74.0232383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871173CTCCTGAAGATCCATCTCTAGAGATGGATCTTCAGGAG0.015100.012100.586200.500000.972800.62500


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CUGCCACCUCCCACUCCUG66.2509674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921160CTGCCACCTCCCACTCCTGCAGGAGTGGGAGGTGGCAG0.474500.152800.500000.500000.989100.75000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GCUGUCUCCAUCCCUGAGC52.72071208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731138GCTGTCTCCATCCCTGAGCGCTCAGGGATGGAGACAGC0.028100.005100.500000.500000.934800.62500


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406GACUGGAAUUAAAACCUUU90.610732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951424GACTGGAATTAAAACCTTTAAAGGTTTTAATTCCAGTC0.084400.001000.819000.750000.951100.87500


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534GAUCAGGAAUAAGUACGAA97.55823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164552GATCAGGAATAAGTACGAATTCGTACTTATTCCTGATC0.537800.187400.508600.750001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432CUCUGGAAAAAAAAAAAAA84.7912108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911450CTCTGGAAAAAAAAAAAAATTTTTTTTTTTTTCCAGAG0.988600.022200.810300.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CCCAGCAAGAGGAAGAAGG55.51461107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192760CCCAGCAAGAGGAAGAAGGCCTTCTTCCTCTTGCTGGG0.013400.005600.646600.500000.951100.75000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219UGGGGAGGAGGAAGAGAGU66.0964679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161237TGGGGAGGAGGAAGAGAGTACTCTCTTCCTCCTCCCCA0.527200.365200.637900.500001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528GGAUGUGAUCAGGAAUAAG84.7469109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51546GGATGTGATCAGGAATAAGCTTATTCCTGATCACATCC0.486800.051000.732800.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286GAGAUGGAUGAUGAGGACU77.3758283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116304GAGATGGATGATGAGGACTAGTCCTCATCATCCATCTC0.215100.166600.603400.500001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689GGGAUGACAAACUGCACGC64.5611748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180707GGGATGACAAACTGCACGCGCGTGCAGTTTGTCATCCC0.019600.004500.569000.500001.000001.00000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GGUUGCGGCUGGAGGAAGU75.4067338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139425GGTTGCGGCTGGAGGAAGTACTTCCTCCAGCCGCAACC0.125900.003800.646600.750001.000001.00000


Target Position: 431, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431CUGAGAGAGCCCCUGAAUA88.033653

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_243119CTGAGAGAGCCCCTGAATA1/1/0/094.96BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66108733..66108751(-)00BRMS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149449CTGAGAGAGCCCCTGAATATATTCAGGGGCTCTCTCAG0.046300.002800.741400.750000.951100.75000


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527UGGAUGUGAUCAGGAAUAA83.0873143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70545TGGATGTGATCAGGAATAATTATTCCTGATCACATCCA0.480400.040200.810300.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776GCCCAUACAUCGUGUACAU88.862746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124794GCCCATACATCGTGTACATATGTACACGATGTATGGGC0.067900.068900.844801.000000.923900.75000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560UGCAGGGAGCCAAACAGCA73.4986399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166578TGCAGGGAGCCAAACAGCATGCTGTTTGGCTCCCTGCA0.058100.006300.500000.500000.923900.62500


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431ACUCUGGAAAAAAAAAAAA79.0665232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791449ACTCTGGAAAAAAAAAAAATTTTTTTTTTTTCCAGAGT0.987000.021400.706900.750001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129CCAGUCCCCGCGAGUCCAG58.20821011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126147CCAGTCCCCGCGAGTCCAGCTGGACTCGCGGGGACTGG0.095100.021800.560300.750000.913000.62500


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862CAGAAGAGAAAAUCGGAUG71.2814486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167880CAGAAGAGAAAATCGGATGCATCCGATTTTCTCTTCTG0.079400.015600.629300.500001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055CCUCCUCUGCCCUCCUCGA76.4502304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1341073CCTCCTCTGCCCTCCTCGATCGAGGAGGGCAGAGGAGG0.057700.025000.551700.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CGCCCAGCAAGAGGAAGAA81.8648171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155758CGCCCAGCAAGAGGAAGAATTCTTCCTCTTGCTGGGCG0.035800.011600.750001.000000.940200.75000


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118CUGCUGUCUCCAUCCCUGA79.7521219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881136CTGCTGTCTCCATCCCTGATCAGGGATGGAGACAGCAG0.041600.004300.560300.500001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908GGGGACCCUCAGAGCAGCU72.8901418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184926GGGGACCCTCAGAGCAGCTAGCTGCTCTGAGGGTCCCC0.016100.004100.637900.750000.962001.00000


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131CCCUGAGCCGCCUGCCACC55.88721094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1681149CCCTGAGCCGCCTGCCACCGGTGGCAGGCGGCTCAGGG0.180800.032300.637900.500000.934800.87500


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420CCUUUCCUGGGACUCUGGA70.8995502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911438CCTTTCCTGGGACTCTGGATCCAGAGTCCCAGGAAAGG0.036600.001100.474100.750000.940200.62500


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119UGCUGUCUCCAUCCCUGAG63.9691771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791137TGCTGTCTCCATCCCTGAGCTCAGGGATGGAGACAGCA0.026700.004200.543100.500000.945700.62500


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GCCCUCCCACUCCAUCUGG53.64671163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791040GCCCTCCCACTCCATCTGGCCAGATGGAGTGGGAGGGC0.019800.011100.655200.500000.902200.62500


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GCGGCAGCCAGACAGAGUC67.0916645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101269GCGGCAGCCAGACAGAGTCGACTCTGTCTGGCTGCCGC0.197500.017100.603400.750000.978300.62500


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153UGUCCAGCCUCCAAGCAAA86.174179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
157171TGTCCAGCCTCCAAGCAAATTTGCTTGGAGGCTGGACA0.426400.002500.706900.750000.929300.87500


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263CAGAGUCAGAAGAGGAGAG75.8038320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189281CAGAGTCAGAAGAGGAGAGCTCTCCTCTTCTGACTCTG0.050700.014300.474100.500001.000001.00000


Target Position: 1328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328GCUGGAUCUGGAGGCAAGA79.3569227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801346GCTGGATCTGGAGGCAAGATCTTGCCTCCAGATCCAGC0.147100.001600.629300.750001.000001.00000


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861UCAGAAGAGAAAAUCGGAU71.9341457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144879TCAGAAGAGAAAATCGGATATCCGATTTTCTCTTCTGA0.161000.025700.543100.750001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879UGGACCUUGACCCUGCUGU56.8731057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184897TGGACCTTGACCCTGCTGTACAGCAGGGTCAAGGTCCA0.017300.002300.637900.500000.945700.62500


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418GAGGAAGUGGGGGCUGAGA77.5053279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189436GAGGAAGTGGGGGCTGAGATCTCAGCCCCCACTTCCTC0.014800.002500.586200.500001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137GCCGCCUGCCACCUCCCAC57.91171021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1101155GCCGCCTGCCACCTCCCACGTGGGAGGTGGCAGGCGGC0.748100.094800.706900.750000.978300.62500


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130UCCCUGAGCCGCCUGCCAC50.80611258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861148TCCCTGAGCCGCCTGCCACGTGGCAGGCGGCTCAGGGA0.161400.030600.577600.500000.934800.75000


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907GGGGGACCCUCAGAGCAGC60.336914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166925GGGGGACCCTCAGAGCAGCGCTGCTCTGAGGGTCCCCC0.025300.004800.637900.500000.923900.62500


Target Position: 225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
225GGAGGAAGAGAGUGAGGAG85.593688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122243GGAGGAAGAGAGTGAGGAGCTCCTCACTCTCTTCCTCC0.545600.440800.560300.750001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362CGGAGCUAAAGGAGAAGUU77.8143259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120380CGGAGCTAAAGGAGAAGTTAACTTCTCCTTTAGCTCCG0.168400.006400.767201.000001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494UUCAGGUGGCAGGGAUCUA69.1987570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188512TTCAGGTGGCAGGGATCTATAGATCCCTGCCACCTGAA0.015000.002400.500000.500001.000001.00000


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334GAGAUGCUGGACCUAGAGA87.105365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177352GAGATGCTGGACCTAGAGATCTCTAGGTCCAGCATCTC0.375200.001600.586200.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137CGCGAGUCCAGAUGCCUGU71.7032469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175155CGCGAGTCCAGATGCCTGTACAGGCATCTGGACTCGCG0.020700.002700.715500.750000.907600.62500


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680CUGAAUGGUGGGAUGACAA88.466951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164698CTGAATGGTGGGATGACAATTGTCATCCCACCATTCAG0.388000.002200.637900.750001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432UGAGAGAGCCCCUGAAUAC69.5231561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140450TGAGAGAGCCCCTGAATACGTATTCAGGGGCTCTCTCA0.060000.003700.543100.500000.951100.62500


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88CGGGCAGCUCUCAGGGAAU79.5699222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160106CGGGCAGCTCTCAGGGAATATTCCCTGAGAGCTGCCCG0.028700.008800.905201.000001.000001.00000


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218CCUCUUGCUGAUGUUGGAU74.8704358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731236CCTCTTGCTGATGTTGGATATCCAACATCAGCAAGAGG0.073300.001800.663801.000001.000001.00000


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228GGAAGAGAGUGAGGAGGAG77.5642277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124246GGAAGAGAGTGAGGAGGAGCTCCTCCTCACTCTCTTCC0.487000.424200.560300.750001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429GGACUCUGGAAAAAAAAAA88.428452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851447GGACTCTGGAAAAAAAAAATTTTTTTTTTCCAGAGTCC0.245400.020600.870701.000001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437GAAAAAAAAAAAAAAAAAA89.083544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571455GAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTC0.996400.255300.672400.750001.000001.00000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250AGCGGCAGCCAGACAGAGU70.3448530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189268AGCGGCAGCCAGACAGAGTACTCTGTCTGGCTGCCGCT0.200700.017100.646600.500000.945700.62500


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909GGGACCCUCAGAGCAGCUG59.2352958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195927GGGACCCTCAGAGCAGCTGCAGCTGCTCTGAGGGTCCC0.012200.001800.706900.750000.962000.87500


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579CCUGGAGAGUGAGAAGCUG71.7739466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192597CCTGGAGAGTGAGAAGCTGCAGCTTCTCACTCTCCAGG0.074900.001100.560300.750001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GGCCCAUACAUCGUGUACA86.966569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
113793GGCCCATACATCGTGTACATGTACACGATGTATGGGCC0.085800.080000.793100.750000.923900.62500


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407ACUGGAAUUAAAACCUUUC63.7878781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1541425ACTGGAATTAAAACCTTTCGAAAGGTTTTAATTCCAGT0.047800.004700.534500.500000.951100.87500


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UGCAGCGGAGCCUCAAGAU68.9111577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122488TGCAGCGGAGCCTCAAGATATCTTGAGGCTCCGCTGCA0.072900.017500.672400.750000.918500.75000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286ACUCUGAGUCAGACGUGAU84.2531119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1511304ACTCTGAGTCAGACGTGATATCACGTCTGACTCAGAGT0.043700.002900.525900.750000.918500.75000


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154GUCCAGCCUCCAAGCAAAG64.5134750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185172GTCCAGCCTCCAAGCAAAGCTTTGCTTGGAGGCTGGAC0.465100.002600.681000.500000.929301.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GUGGGAUGACAAACUGCAC73.8089394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176705GTGGGATGACAAACTGCACGTGCAGTTTGTCATCCCAC0.054800.003300.500000.500001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255CAGCCAGACAGAGUCAGAA92.707716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98273CAGCCAGACAGAGTCAGAATTCTGACTCTGTCTGGCTG0.268200.021100.612100.750000.972800.62500


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665GCCUGGACCUCAGCUCUGA82.6526153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173683GCCTGGACCTCAGCTCTGATCAGAGCTGAGGTCCAGGC0.021000.002000.775900.750000.923900.75000


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360CUCGGAGCUAAAGGAGAAG60.9948892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160378CTCGGAGCTAAAGGAGAAGCTTCTCCTTTAGCTCCGAG0.212400.008000.672400.500001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151CCCACUCCUGAAGAUCCAU73.9868384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1081169CCCACTCCTGAAGATCCATATGGATCTTCAGGAGTGGG0.096200.077800.836201.000001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436GGAAAAAAAAAAAAAAAAA90.192234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431454GGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCC0.995000.084300.870701.000001.000001.00000


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288GAUGGAUGAUGAGGACUAU94.25819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86306GATGGATGATGAGGACTATATAGTCCTCATCATCCATC0.257200.146800.637900.750001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469CUGCAGCGGAGCCUCAAGA75.108349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127487CTGCAGCGGAGCCTCAAGATCTTGAGGCTCCGCTGCAG0.337000.004900.560300.500000.907600.62500


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187ACAGAGAAGACAGCCGAAG59.1903961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1291205ACAGAGAAGACAGCCGAAGCTTCGGCTGTCTTCTCTGT0.105500.007200.569000.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CUCUUGCUGAUGUUGGAUG65.5053710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1561237CTCTTGCTGATGTTGGATGCATCCAACATCAGCAAGAG0.037900.002500.655200.500001.000001.00000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415CUGGAGGAAGUGGGGGCUG50.0931273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179433CTGGAGGAAGTGGGGGCTGCAGCCCCCACTTCCTCCAG0.026900.001600.500000.500001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125CUCCAUCCCUGAGCCGCCU59.4976949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931143CTCCATCCCTGAGCCGCCTAGGCGGCTCAGGGATGGAG0.048100.016300.465500.500000.994600.62500


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176CAGAAGAGAUGGAAGCAGA94.170410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183194CAGAAGAGATGGAAGCAGATCTGCTTCCATCTCTTCTG0.048800.031600.560300.500001.000001.00000


Target Position: 1426, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426CUGGGACUCUGGAAAAAAA93.846811

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1142619CTGGGACTCTGGAAAAAAA1/1/0/097.21BRMS1NM_015399.3+NM_001024957.11+0NANANANA00BRMS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691444CTGGGACTCTGGAAAAAAATTTTTTTCCAGAGTCCCAG0.021800.004200.784500.750001.000001.00000


Target Position: 224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
224AGGAGGAAGAGAGUGAGGA75.4603335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188242AGGAGGAAGAGAGTGAGGATCCTCACTCTCTTCCTCCT0.590900.459000.474100.500001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480CCUCAAGAUUCGCAUUCAG76.4102307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170498CCTCAAGATTCGCATTCAGCTGAATGCGAATCTTGAGG0.037000.001900.560300.750001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575AGCACCUGGAGAGUGAGAA76.5581301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178593AGCACCTGGAGAGTGAGAATTCTCACTCTCCAGGTGCT0.117900.001600.681000.750000.923900.75000


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181GAGAUGGAAGCAGAGGGUG65.1302727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155199GAGATGGAAGCAGAGGGTGCACCCTCTGCTTCCATCTC0.112400.027400.517200.500001.000001.00000


Target Position: 820, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GACUGGACAGCCAUCAAAA98.3122

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1082019GACTGGACAGCCATCAAAA1/1/0/088.67BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66106194..66106212(-)00BRMS1(0.002)


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525UCUGGAUGUGAUCAGGAAU75.3589342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77543TCTGGATGTGATCAGGAATATTCCTGATCACATCCAGA0.343100.025900.715500.750000.907600.62500


Target Position: 1329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1329CUGGAUCUGGAGGCAAGAU73.9802386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811347CTGGATCTGGAGGCAAGATATCTTGCCTCCAGATCCAG0.146100.001500.603400.750001.000001.00000


Target Position: 1290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290UGAGUCAGACGUGAUUAUC62.4878825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661308TGAGTCAGACGTGATTATCGATAATCACGTCTGACTCA0.091700.002000.543100.500001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168CAAAGACACAGAAGAGAUG77.687269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193186CAAAGACACAGAAGAGATGCATCTCTTCTGTGTCTTTG0.186500.106900.491400.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425CCUGGGACUCUGGAAAAAA86.328575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1721443CCTGGGACTCTGGAAAAAATTTTTTCCAGAGTCCCAGG0.021200.003900.844801.000001.000001.00000


Target Position: 364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364GAGCUAAAGGAGAAGUUGU84.2088121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
362-384CGGAGCTAAAGGAGAAGTTGTTCACAACUUCUCCUUUAGCUCCGGAGCUAAAGGAGAAGUUGUUCU19.218.323


Target Position: 587, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GUGAGAAGCUGCUGCUCUA98.93251

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_558719GTGAGAAGCTGCTGCTCTA1/1/0/089.21BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66108322,66108438..66108341,66108436(-)00BRMS1(0.002)&FBXL18(0.029)


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327GGCUGGAUCUGGAGGCAAG78.7881237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941345GGCTGGATCTGGAGGCAAGCTTGCCTCCAGATCCAGCC0.012400.001700.862100.750001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681UGAAUGGUGGGAUGACAAA81.5941178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169699TGAATGGTGGGATGACAAATTTGTCATCCCACCATTCA0.480000.001900.724100.750001.000001.00000


Target Position: 934, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
934CACCCAGGAUUCUCGUCUU85.1108103

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_693419CACCCAGGATTCTCGTCTT1/1/0/089.21BRMS1NM_015399.3+NM_001024957.11+0NANANA11:66105289..66105307(-)00BRMS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144952CACCCAGGATTCTCGTCTTAAGACGAGAATCCTGGGTG0.066400.003000.655200.750000.945700.87500


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CAGCGGAGCCUCAAGAUUC74.5414366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150490CAGCGGAGCCTCAAGATTCGAATCTTGAGGCTCCGCTG0.100300.007200.612100.500000.994600.62500


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794UGCUUCAAGAGAUCGACAU70.2735535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187812TGCTTCAAGAGATCGACATATGTCGATCTCTTGAAGCA0.033800.001300.698300.750000.994600.87500


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745AGCAAGAGGAAGAAGGCAC63.4199792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193763AGCAAGAGGAAGAAGGCACGTGCCTTCTTCCTCTTGCT0.020100.001100.560300.500001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290UGGAUGAUGAGGACUAUGA79.4538226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176308TGGATGATGAGGACTATGATCATAGTCCTCATCATCCA0.241500.139600.620700.500001.000001.00000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433GAGAGAGCCCCUGAAUACA89.000345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143451GAGAGAGCCCCTGAATACATGTATTCAGGGGCTCTCTC0.119500.005000.603400.500000.978300.62500


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GGUUUCUGGCCCAUACAUC72.3944436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111786GGTTTCTGGCCCATACATCGATGTATGGGCCAGAAACC0.246100.009300.672400.750000.983700.75000


Target Position: 14, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14CUCUGCCUCCCGAAGAAAA81.4183184

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_81419CTCTGCCTCCCGAAGAAAA1/1/0/088.67BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66112551..66112569(-)00BRMS1(0.002)


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430GACUCUGGAAAAAAAAAAA92.439620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821448GACTCTGGAAAAAAAAAAATTTTTTTTTTTCCAGAGTC0.979300.020900.819000.750001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434CUGGAAAAAAAAAAAAAAA83.3621133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711452CTGGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCCAG0.990800.026100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1432-1454CTCTGGAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUCCAGAGCUGGAAAAAAAAAAAAAAAAAU-11.320.100


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213GAUGAAUGGGGAGGAGGAA85.88184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163231GATGAATGGGGAGGAGGAATTCCTCCTCCCCATTCATC0.495000.352600.508600.750001.000001.00000


Target Position: 171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171AGACACAGAAGAGAUGGAA84.1925123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138189AGACACAGAAGAGATGGAATTCCATCTCTTCTGTGTCT0.093500.067700.551700.750001.000001.00000


Target Position: 1211, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211GCCACAUCCUCUUGCUGAU84.8839106

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7121119GCCACATCCTCTTGCTGAT1/1/0/089.21BRMS1NM_001024957.1+NM_015399.31+1NANANANA00BRMS1(0.002)


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284CCGAGAUGGAUGAUGAGGA84.623113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139302CCGAGATGGATGATGAGGATCCTCATCATCCATCTCGG0.378200.193800.543100.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162UCCAAGCAAAGACACAGAA74.5026367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
52180TCCAAGCAAAGACACAGAATTCTGTGTCTTTGCTTGGA0.618700.389800.698300.750001.000001.00000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152CUGUCCAGCCUCCAAGCAA83.8652127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168170CTGTCCAGCCTCCAAGCAATTGCTTGGAGGCTGGACAG0.029600.001900.637900.750000.929300.75000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785UCGUGUACAUGCUUCAAGA85.0576104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190803TCGTGTACATGCTTCAAGATCTTGAAGCATGTACACGA0.014800.004800.569000.500001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258CCAGACAGAGUCAGAAGAG74.8193361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146276CCAGACAGAGTCAGAAGAGCTCTTCTGACTCTGTCTGG0.089600.027200.534500.750000.978300.87500


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531UGUGAUCAGGAAUAAGUAC68.3911604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158549TGTGATCAGGAATAAGTACGTACTTATTCCTGATCACA0.508800.150200.525900.500001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404UGCGGUUGCGGCUGGAGGA67.0337651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185422TGCGGTTGCGGCTGGAGGATCCTCCAGCCGCAACCGCA0.021600.001800.482800.500000.956500.75000


Target Position: 1397, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GAUUCCAAGGACUGGAAUU82.3107160

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4139719GATTCCAAGGACTGGAATT1/1/0/091.46BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66104826..66104844(-)00BRMS1(0.002)


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183GAUGGAAGCAGAGGGUGAU82.7274150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174201GATGGAAGCAGAGGGTGATATCACCCTCTGCTTCCATC0.040600.006900.500000.750001.000001.00000


Target Position: 1289, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289CUGAGUCAGACGUGAUUAU83.3718132

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3128919CTGAGTCAGACGTGATTAT1/1/0/091.46BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66104934..66104952(-)00BRMS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601307CTGAGTCAGACGTGATTATATAATCACGTCTGACTCAG0.122800.002300.741400.750001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331AGUGAGAUGCUGGACCUAG70.9471497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152349AGTGAGATGCTGGACCTAGCTAGGTCCAGCATCTCACT0.182700.002600.534500.500001.000001.00000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184AUGGAAGCAGAGGGUGAUU66.1024678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177202ATGGAAGCAGAGGGTGATTAATCACCCTCTGCTTCCAT0.020400.002900.646600.500001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220GGGGAGGAGGAAGAGAGUG66.0297683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50238GGGGAGGAGGAAGAGAGTGCACTCTCTTCCTCCTCCCC0.627700.415800.698300.750001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UCUGGCCCAUACAUCGUGU64.4129756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172790TCTGGCCCATACATCGTGTACACGATGTATGGGCCAGA0.108300.019200.517200.500001.000001.00000


Target Position: 287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
287AGAUGGAUGAUGAGGACUA91.672225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136305AGATGGATGATGAGGACTATAGTCCTCATCATCCATCT0.220100.157500.551700.750001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933GCACCCAGGAUUCUCGUCU70.7371511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104951GCACCCAGGATTCTCGTCTAGACGAGAATCCTGGGTGC0.453700.012100.629300.750000.945700.87500


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150UCCCACUCCUGAAGAUCCA69.3982566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741168TCCCACTCCTGAAGATCCATGGATCTTCAGGAGTGGGA0.351700.268400.525900.500000.994600.62500


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091CCGUGGAGCUGACCUGACC66.2104675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361109CCGTGGAGCTGACCTGACCGGTCAGGTCAGCTCCACGG0.289400.012100.560300.500000.945701.00000


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471GCAGCGGAGCCUCAAGAUU77.722265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114489GCAGCGGAGCCTCAAGATTAATCTTGAGGCTCCGCTGC0.085400.012000.844801.000000.994600.75000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257GCCAGACAGAGUCAGAAGA84.2518120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
106275GCCAGACAGAGTCAGAAGATCTTCTGACTCTGTCTGGC0.252800.209100.775900.750000.972800.62500


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144GCCACCUCCCACUCCUGAA83.307135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
421162GCCACCTCCCACTCCTGAATTCAGGAGTGGGAGGTGGC0.431100.345800.827601.000001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262ACAGAGUCAGAAGAGGAGA75.12348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184280ACAGAGTCAGAAGAGGAGATCTCCTCTTCTGACTCTGT0.200700.040800.482800.500001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430GCUGAGAGAGCCCCUGAAU80.696197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176448GCTGAGAGAGCCCCTGAATATTCAGGGGCTCTCTCAGC0.026700.001700.844801.000000.951100.87500


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CCAUCCCUGAGCCGCCUGC47.77981325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821145CCATCCCTGAGCCGCCTGCGCAGGCGGCTCAGGGATGG0.106800.021900.491400.500000.983700.75000


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CCGCCUGCCACCUCCCACU65.9068694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991156CCGCCTGCCACCTCCCACTAGTGGGAGGTGGCAGGCGG0.721400.106700.706900.750000.989100.75000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053CUCCUCCUCUGCCCUCCUC55.69021098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871071CTCCTCCTCTGCCCTCCTCGAGGAGGGCAGAGGAGGAG0.057900.035500.500000.500001.000001.00000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CAGAGAAGACAGCCGAAGU82.6004155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1511206CAGAGAAGACAGCCGAAGTACTTCGGCTGTCTTCTCTG0.099800.008200.577600.500001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167GCAAAGACACAGAAGAGAU91.249128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62185GCAAAGACACAGAAGAGATATCTCTTCTGTGTCTTTGC0.272900.155800.672401.000001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876GGAUGGACCUUGACCCUGC72.0323452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184894GGATGGACCTTGACCCTGCGCAGGGTCAAGGTCCATCC0.045200.001400.517200.500000.945700.87500


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931CUGCACCCAGGAUUCUCGU64.8845734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160949CTGCACCCAGGATTCTCGTACGAGAATCCTGGGTGCAG0.083300.005600.508600.500000.940200.62500


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139CGCCUGCCACCUCCCACUC58.6565991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961157CGCCTGCCACCTCCCACTCGAGTGGGAGGTGGCAGGCG0.536900.120200.612100.750000.989100.75000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126UCCAUCCCUGAGCCGCCUG41.38841403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951144TCCATCCCTGAGCCGCCTGCAGGCGGCTCAGGGATGGA0.056700.018700.586200.500001.000001.00000


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335AGAUGCUGGACCUAGAGAA89.347543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189353AGATGCTGGACCTAGAGAATTCTCTAGGTCCAGCATCT0.220900.001200.551700.750001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932UGCACCCAGGAUUCUCGUC52.78511204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147950TGCACCCAGGATTCTCGTCGACGAGAATCCTGGGTGCA0.445900.010000.534500.500000.945700.87500


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215UGAAUGGGGAGGAGGAAGA68.9298574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172233TGAATGGGGAGGAGGAAGATCTTCCTCCTCCCCATTCA0.556600.380600.500000.500001.000001.00000


Target Position: 208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
208GCUGAGAUGAAUGGGGAGG53.8391155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159226GCTGAGATGAATGGGGAGGCCTCCCCATTCATCTCAGC0.401500.269700.508600.500001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361UCGGAGCUAAAGGAGAAGU57.06721048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
133379TCGGAGCTAAAGGAGAAGTACTTCTCCTTTAGCTCCGA0.178000.008100.586200.500001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182AGAUGGAAGCAGAGGGUGA84.4727115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168200AGATGGAAGCAGAGGGTGATCACCCTCTGCTTCCATCT0.129100.028800.500000.500001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141CCUGCCACCUCCCACUCCU68.9227575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1671159CCTGCCACCTCCCACTCCTAGGAGTGGGAGGTGGCAGG0.550300.148000.500000.750000.989100.87500


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788UGUACAUGCUUCAAGAGAU86.002581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167806TGTACATGCTTCAAGAGATATCTCTTGAAGCATGTACA0.022600.001900.525900.750001.000001.00000


Target Position: 1152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152CCACUCCUGAAGAUCCAUC65.9949687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1481170CCACTCCTGAAGATCCATCGATGGATCTTCAGGAGTGG0.041900.037200.663800.750001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679UCUGAAUGGUGGGAUGACA77.6947266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171697TCTGAATGGTGGGATGACATGTCATCCCACCATTCAGA0.131700.001900.517200.500001.000001.00000


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136CCGCGAGUCCAGAUGCCUG71.8194464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130154CCGCGAGTCCAGATGCCTGCAGGCATCTGGACTCGCGG0.058900.013000.629300.750000.923900.62500


Target Position: 529, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529GAUGUGAUCAGGAAUAAGU85.208896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190547GATGTGATCAGGAATAAGTACTTATTCCTGATCACATC0.467400.078600.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
527-549TGGATGTGATCAGGAATAAGTACACUUAUUCCUGAUCACAUCCAGAUGUGAUCAGGAAUAAGUACU6.920.522


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GCGGUUGCGGCUGGAGGAA71.1751490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151423GCGGTTGCGGCTGGAGGAATTCCTCCAGCCGCAACCGC0.039400.003400.750001.000001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GGUGGGAUGACAAACUGCA89.880838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170704GGTGGGATGACAAACTGCATGCAGTTTGTCATCCCACC0.192400.002700.500000.750001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153CACUCCUGAAGAUCCAUCU78.1802251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631171CACTCCTGAAGATCCATCTAGATGGATCTTCAGGAGTG0.063300.026800.569000.500001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GUGUACAUGCUUCAAGAGA82.2365161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181805GTGTACATGCTTCAAGAGATCTCTTGAAGCATGTACAC0.018000.002200.569000.500001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339GCUGGACCUAGAGAAGCAG70.0828546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191357GCTGGACCTAGAGAAGCAGCTGCTTCTCTAGGTCCAGC0.014500.001200.569000.750001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GCUCCGAGAUGGAUGAUGA94.52537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183299GCTCCGAGATGGATGATGATCATCATCCATCTCGGAGC0.352300.001400.629300.750000.902200.75000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433UCUGGAAAAAAAAAAAAAA78.0018257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731451TCTGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCAGA0.989700.023900.724100.750001.000001.00000


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207UGCUGAGAUGAAUGGGGAG64.9772731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141225TGCTGAGATGAATGGGGAGCTCCCCATTCATCTCAGCA0.397400.101500.543100.500001.000001.00000


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128UCCAGUCCCCGCGAGUCCA62.6071819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170146TCCAGTCCCCGCGAGTCCATGGACTCGCGGGGACTGGA0.099000.026200.525900.500000.972800.87500


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285CGAGAUGGAUGAUGAGGAC80.164206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187303CGAGATGGATGATGAGGACGTCCTCATCATCCATCTCG0.231300.177500.474100.750001.000001.00000


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287CUCUGAGUCAGACGUGAUU79.2015229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621305CTCTGAGTCAGACGTGATTAATCACGTCTGACTCAGAG0.062300.002200.801700.750000.918500.62500


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253GGCAGCCAGACAGAGUCAG64.1759764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84271GGCAGCCAGACAGAGTCAGCTGACTCTGTCTGGCTGCC0.268600.020800.715500.750000.978300.75000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538AGGAAUAAGUACGAAUGUG72.213445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153556AGGAATAAGTACGAATGTGCACATTCGTACTTATTCCT0.397000.253800.551700.500001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163CCAAGCAAAGACACAGAAG72.2126446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105181CCAAGCAAAGACACAGAAGCTTCTGTGTCTTTGCTTGG0.356200.244700.706900.750001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GCUUCAAGAGAUCGACAUC77.612274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185813GCTTCAAGAGATCGACATCGATGTCGATCTCTTGAAGC0.016100.001400.672400.750000.967400.62500


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217UCCUCUUGCUGAUGUUGGA75.9728316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941235TCCTCTTGCTGATGTTGGATCCAACATCAGCAAGAGGA0.068300.001200.500000.500001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291GGAUGAUGAGGACUAUGAG88.727950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127309GGATGATGAGGACTATGAGCTCATAGTCCTCATCATCC0.128200.068900.560300.750001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CUGGCCCAUACAUCGUGUA78.6588239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104791CTGGCCCATACATCGTGTATACACGATGTATGGGCCAG0.103500.023700.603400.750001.000001.00000


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227AGGAAGAGAGUGAGGAGGA80.4223201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192245AGGAAGAGAGTGAGGAGGATCCTCCTCACTCTCTTCCT0.578500.446900.474100.500001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132CCUGAGCCGCCUGCCACCU58.9079980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751150CCTGAGCCGCCTGCCACCTAGGTGGCAGGCGGCTCAGG0.188700.035500.500000.750000.907600.62500


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416UGGAGGAAGUGGGGGCUGA67.5201632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180434TGGAGGAAGTGGGGGCTGATCAGCCCCCACTTCCTCCA0.020900.003400.620700.500001.000001.00000


Target Position: 166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166AGCAAAGACACAGAAGAGA76.5904299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171184AGCAAAGACACAGAAGAGATCTCTTCTGTGTCTTTGCT0.444500.300400.629300.500001.000001.00000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320GCGAGUGUGUCAGUGAGAU85.047105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182338GCGAGTGTGTCAGTGAGATATCTCACTGACACACTCGC0.053200.001400.741401.000001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786CGUGUACAUGCUUCAAGAG79.1091230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195804CGTGTACATGCTTCAAGAGCTCTTGAAGCATGTACACG0.013400.003000.465500.750001.000001.00000


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222GGAGGAGGAAGAGAGUGAG76.531302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123240GGAGGAGGAAGAGAGTGAGCTCACTCTCTTCCTCCTCC0.588300.430300.560300.750001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221GGGAGGAGGAAGAGAGUGA87.721758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
30239GGGAGGAGGAAGAGAGTGATCACTCTCTTCCTCCTCCC0.629300.430100.767200.750001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428GGGACUCUGGAAAAAAAAA91.433526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201446GGGACTCTGGAAAAAAAAATTTTTTTTTCCAGAGTCCC0.073600.020300.991401.000001.000001.00000


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282CUCCGAGAUGGAUGAUGAG73.8587392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169300CTCCGAGATGGATGATGAGCTCATCATCCATCTCGGAG0.445000.016400.500000.500000.902200.62500


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536UCAGGAAUAAGUACGAAUG65.229721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146554TCAGGAATAAGTACGAATGCATTCGTACTTATTCCTGA0.418700.279500.569000.500001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524GUCUGGAUGUGAUCAGGAA96.82675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89542GTCTGGATGTGATCAGGAATTCCTGATCACATCCAGAC0.315400.019400.646600.750000.907600.62500


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117GCUGCUGUCUCCAUCCCUG75.4962330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161135GCTGCTGTCTCCATCCCTGCAGGGATGGAGACAGCAGC0.661900.020900.569000.750001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682GAAUGGUGGGAUGACAAAC73.8346393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194700GAATGGTGGGATGACAAACGTTTGTCATCCCACCATTC0.388900.001000.525900.500001.000001.00000


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332GUGAGAUGCUGGACCUAGA92.755415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155350GTGAGATGCTGGACCTAGATCTAGGTCCAGCATCTCAC0.337600.002500.569000.500001.000001.00000


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252CGGCAGCCAGACAGAGUCA87.821556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93270CGGCAGCCAGACAGAGTCATGACTCTGTCTGGCTGCCG0.197400.017200.689700.750000.978300.62500


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135CCCGCGAGUCCAGAUGCCU66.0094686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135153CCCGCGAGTCCAGATGCCTAGGCATCTGGACTCGCGGG0.056300.012300.646600.750000.902200.62500


Target Position: 1435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435UGGAAAAAAAAAAAAAAAA77.2741284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561453TGGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCCA0.992300.039900.844800.750001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199GCCGAAGUCAAAGCCACAU73.1445411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901217GCCGAAGTCAAAGCCACATATGTGGCTTTGACTTCGGC0.155800.020500.844801.000000.994600.62500


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GGCCCUCCCACUCCAUCUG62.4761827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421039GGCCCTCCCACTCCATCTGCAGATGGAGTGGGAGGGCC0.047200.019800.715500.750001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CCUGGACCUCAGCUCUGAA93.081114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165684CCTGGACCTCAGCTCTGAATTCAGAGCTGAGGTCCAGG0.026200.002500.672401.000000.923900.62500


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151CCUGUCCAGCCUCCAAGCA72.5546428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186169CCTGTCCAGCCTCCAAGCATGCTTGGAGGCTGGACAGG0.016300.001300.491400.750000.929300.62500


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136AGCCGCCUGCCACCUCCCA63.3683796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621154AGCCGCCTGCCACCTCCCATGGGAGGTGGCAGGCGGCT0.766900.101100.508600.500000.929300.62500


Target Position: 90, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
90GGCAGCUCUCAGGGAAUCU73.1404412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186108GGCAGCTCTCAGGGAATCTAGATTCCCTGAGAGCTGCC0.015400.005100.775900.750001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537CAGGAAUAAGUACGAAUGU78.264244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178555CAGGAATAAGTACGAATGTACATTCGTACTTATTCCTG0.420700.248000.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
535-557ATCAGGAATAAGTACGAATGTGAACAUUCGUACUUAUUCCUGAUCAGGAAUAAGUACGAAUGUGAU21.119.933


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GAGAAAAUCGGAUGGACCU79.9386216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194885GAGAAAATCGGATGGACCTAGGTCCATCCGATTTTCTC0.077200.050400.465500.500000.967400.75000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254GCAGCCAGACAGAGUCAGA89.769840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86272GCAGCCAGACAGAGTCAGATCTGACTCTGTCTGGCTGC0.268900.021000.629300.750000.978300.87500


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143UGCCACCUCCCACUCCUGA65.4539711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1121161TGCCACCTCCCACTCCTGATCAGGAGTGGGAGGTGGCA0.451500.189400.629300.500000.989100.75000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261GACAGAGUCAGAAGAGGAG78.0218256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182279GACAGAGTCAGAAGAGGAGCTCCTCTTCTGACTCTGTC0.215500.045400.508600.500001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424UCCUGGGACUCUGGAAAAA73.5421398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761442TCCTGGGACTCTGGAAAAATTTTTCCAGAGTCCCAGGA0.020400.003800.870700.750000.972800.62500


Target Position: 539, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GGAAUAAGUACGAAUGUGA94.4998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71557GGAATAAGTACGAATGTGATCACATTCGTACTTATTCC0.465700.283100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
537-559CAGGAATAAGTACGAATGTGAGCUCACAUUCGUACUUAUUCCUGGGAAUAAGUACGAAUGUGAGCU20.56.933


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530AUGUGAUCAGGAAUAAGUA91.185229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191548ATGTGATCAGGAATAAGTATACTTATTCCTGATCACAT0.499900.149200.474100.500001.000001.00000


Target Position: 89, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89GGGCAGCUCUCAGGGAAUC65.2929716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168107GGGCAGCTCTCAGGGAATCGATTCCCTGAGAGCTGCCC0.022000.007900.810300.750001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535AUCAGGAAUAAGUACGAAU77.6924267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164553ATCAGGAATAAGTACGAATATTCGTACTTATTCCTGAT0.431900.262300.672400.500001.000001.00000


Target Position: 526, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
526CUGGAUGUGAUCAGGAAUA85.135899

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_952619CTGGATGTGATCAGGAATA1/1/0/088.67BRMS1NM_001024957.1+NM_015399.31+1NANANA11:66108479..66108497(-)00BRMS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88544CTGGATGTGATCAGGAATATATTCCTGATCACATCCAG0.347800.033400.741400.750000.972800.62500


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783CAUCGUGUACAUGCUUCAA91.719924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161801CATCGTGTACATGCTTCAATTGAAGCATGTACACGATG0.029300.009800.508600.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427UGGGACUCUGGAAAAAAAA75.9277319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571445TGGGACTCTGGAAAAAAAATTTTTTTTCCAGAGTCCCA0.033300.011500.844800.750001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CCCAUACAUCGUGUACAUG70.8554506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126795CCCATACATCGTGTACATGCATGTACACGATGTATGGG0.063400.063800.836200.750000.923900.75000


Target Position: 172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172GACACAGAAGAGAUGGAAG81.1409186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147190GACACAGAAGAGATGGAAGCTTCCATCTCTTCTGTGTC0.043100.023100.681000.500001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GGAGGAAGUGGGGGCUGAG71.6479473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170435GGAGGAAGTGGGGGCTGAGCTCAGCCCCCACTTCCTCC0.021800.003000.560300.750001.000001.00000