siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 2975   4015   4773  
Biltr, Sidirect 460   623   736   854   893   1404   1492   1494   2063   2108   2260   2276   2280   2374   2536   2890   2891   2900   2901   2903  
2929   2939   2946   2965   2966   3050   3095   3656   3659   3874   3876   3888   3912   3915   4028   4320   4386   4478   4492   4522  
4524   4528   4532   4537   4539   4544   4561   4572   4596   4601   4630   4639   4673   4675   4678   4703   4706   4753   4757  
Biltr, Rnaxs 1   2   3   5   280   281   282   283   284   285   313   314   318   323   333   334   335   356   364   365  
374   384   397   398   402   431   432   433   435   436   437   438   440   441   444   445   446   458   459   491  
492   503   504   505   533   544   564   570   592   598   599   602   603   604   607   608   609   610   611   612  
617   625   627   630   631   653   657   666   691   737   749   750   758   781   782   788   789   798   800   801  
812   815   838   839   843   845   873   874   875   876   877   882   883   892   982   990   1016   1017   1018   1020  
1023   1051   1052   1053   1054   1056   1057   1062   1063   1071   1076   1083   1120   1131   1177   1212   1213   1219   1223   1238  
1239   1241   1242   1245   1248   1249   1306   1307   1311   1354   1357   1358   1402   1410   1411   1412   1413   1414   1416   1420  
1424   1425   1426   1460   1461   1553   1561   1572   1573   1574   1575   1577   1579   1653   1654   1655   1656   1657   1660   1661  
1662   1664   1665   1667   1673   1674   1675   1680   1681   1682   1693   1694   1765   1768   1773   1774   1775   1776   1777   1790  
1799   1800   1803   1804   1811   1812   1813   1858   1861   1899   1900   1901   1902   1905   1906   1907   1908   1912   1913   1914  
1916   1938   1942   1943   1944   1947   1948   1949   1950   1951   1952   1953   1954   1972   1973   1976   1977   1978   1983   1984  
1985   1986   1995   1996   1997   1998   2001   2047   2055   2056   2057   2059   2060   2061   2062   2109   2110   2130   2134   2139  
2140   2148   2269   2278   2279   2283   2329   2330   2331   2332   2367   2368   2369   2370   2371   2372   2377   2378   2398   2481  
2482   2486   2500   2501   2514   2515   2520   2521   2522   2523   2524   2525   2539   2545   2546   2554   2566   2586   2587   2590  
2591   2592   2593   2594   2595   2596   2597   2598   2599   2604   2605   2610   2611   2612   2613   2614   2615   2618   2651   2681  
2682   2683   2684   2689   2691   2692   2693   2694   2695   2733   2753   2754   2810   2811   2812   2865   2866   2869   2872   2874  
2875   2912   2913   2922   2923   2924   2925   2931   2955   2960   2961   2969   2970   2971   2972   2973   2974   2976   2980   2981  
2994   3014   3015   3020   3021   3022   3028   3029   3030   3034   3047   3051   3066   3091   3105   3109   3137   3138   3141   3142  
3143   3144   3145   3146   3147   3148   3153   3155   3156   3158   3160   3161   3164   3166   3168   3170   3171   3172   3173   3175  
3194   3196   3197   3198   3220   3221   3222   3223   3224   3225   3226   3227   3228   3229   3230   3231   3234   3257   3318   3319  
3379   3380   3381   3382   3383   3384   3385   3386   3387   3388   3389   3391   3392   3394   3458   3459   3498   3512   3519   3520  
3525   3526   3527   3530   3531   3532   3533   3534   3535   3536   3537   3538   3540   3541   3542   3545   3546   3547   3548   3606  
3608   3632   3643   3644   3645   3646   3647   3649   3650   3651   3652   3653   3654   3655   3657   3658   3683   3698   3706   3708  
3720   3781   3782   3783   3784   3785   3786   3787   3788   3789   3790   3791   3792   3806   3812   3813   3816   3817   3818   3825  
3826   3827   3852   3875   3897   3911   3943   3944   3945   3951   3955   3958   3959   3963   3964   3966   3967   3970   3990   3991  
3992   3993   3994   4014   4016   4017   4020   4021   4022   4024   4099   4100   4101   4107   4108   4109   4110   4111   4112   4218  
4219   4270   4271   4301   4304   4307   4308   4309   4310   4311   4315   4316   4339   4369   4372   4373   4374   4376   4378   4381  
4382   4383   4389   4392   4393   4413   4416   4444   4445   4451   4455   4456   4457   4458   4459   4480   4482   4484   4485   4486  
4490   4491   4495   4509   4516   4565   4566   4568   4569   4571   4578   4587   4588   4589   4591   4652   4658   4659   4660   4662  
4664   4665   4690   4691   4724   4725   4726   4727   4728   4729   4731   4737   4768   4771   4772   4775   4784   4787   4791   4792  
4798   4800   4804   4805   4810  
Biltr, Ernai, Rnaxs 312   3648  
Biltr, Ernai 522   1437   3082   4156   4632  
Biltr, Rnaxs, Sidirect 658   1130   1355   1356   1417   1666   1668   2131   2270   2271   2537   2547   2864   2926   2927   2936   2937   2956   2968   3023  
3024   3033   3092   3093   3106   3107   3154   3157   3159   3162   3167   3169   3232   3233   3390   3393   3611   3793   3910   4013  
4023   4025   4166   4317   4375   4379   4388   4438   4481   4487   4508   4517   4567   4570   4663   4730   4732   4733   4767   4769  
4776   4777   4799   4806  


Target Position: 4486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486GGAUCUCUUUUUAUUUAAA101.0926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6414504GGATCTCTTTTTATTTAAATTTAAATAAAAAGAGATCC0.110700.016200.870701.000001.000001.00000


Target Position: 3197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197UGCUUCUGCUCAUUACUAC67.76732674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843215TGCTTCTGCTCATTACTACGTAGTAATGAGCAGAAGCA0.108300.095000.672400.500000.956500.75000


Target Position: 2047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2047GUACAACGACCCAACCCAA92.7301124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262065GTACAACGACCCAACCCAATTGGGTTGGGTCGTTGTAC0.449800.331900.534500.750001.000001.00000


Target Position: 2057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057CCAACCCAAGAAUCUAUCA82.7129753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852075CCAACCCAAGAATCTATCATGATAGATTCTTGGGTTGG0.383200.178800.620700.750001.000001.00000


Target Position: 749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749AGAGAAACAGGAUGGCUGA84.0704638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999767AGAGAAACAGGATGGCTGATCAGCCATCCTGTTTCTCT0.131900.003100.500000.500001.000001.00000


Target Position: 4028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4028CAUUAAUGUUUAUUUAGCU86.7724430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4026-4048TTCATTAATGTTTATTTAGCTCTAGCUAAAUAAACAUUAAUGAACAUUAAUGUUUAUUUAGCUCUU13.6-1.822


Target Position: 2270, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2270GGAAUUCUUGCUUUGCUAA92.3341139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5302288GGAATTCTTGCTTTGCTAATTAGCAAAGCAAGAATTCC0.431700.026700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2268-2290GAGGAATTCTTGCTTTGCTAATTUUAGCAAAGCAAGAAUUCCUCGGAAUUCUUGCUUUGCUAAUUU19.714.823


Target Position: 3951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3951GGCUUCCCUCUUUCAUCUC65.68432930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5673969GGCTTCCCTCTTTCATCTCGAGATGAAAGAGGGAAGCC0.606800.023800.689700.750000.994600.75000


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CACGGUAACCGAUCAGAAU86.5699453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728892CACGGTAACCGATCAGAATATTCTGATCGGTTACCGTG0.132600.011200.784500.750001.000001.00000


Target Position: 4804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804UUGUUAAACCAUAAAAAAA81.2874907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6704822TTGTTAAACCATAAAAAAATTTTTTTATGGTTTAACAA0.453100.083600.646600.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615CUCGUGUUUGACUAUGAAG71.79252067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452633CTCGTGTTTGACTATGAAGCTTCATAGTCAAACACGAG0.120700.023900.672400.500001.000001.00000


Target Position: 3498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498GGAUUACAGACAUGAGCCA91.9284158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653516GGATTACAGACATGAGCCATGGCTCATGTCTGTAATCC0.111400.028100.525900.750000.907600.62500


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610CUCUGCUCGUGUUUGACUA86.8357427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992628CTCTGCTCGTGTTTGACTATAGTCAAACACGAGCAGAG0.141200.008400.637900.750001.000001.00000


Target Position: 4664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4664AGAAUGUCACUGUAGUUUU82.9915734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3944682AGAATGTCACTGTAGTTTTAAAACTACAGTGACATTCT0.544600.047800.724100.750001.000001.00000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492ACCGCCCCCCGCCCCAUCA53.97034133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989510ACCGCCCCCCGCCCCATCATGATGGGGCGGGGGGCGGT0.072200.003700.629300.500000.907600.87500


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944CAAAGCCUCAGGUCAUAAA89.915247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161962CAAAGCCTCAGGTCATAAATTTATGACCTGAGGCTTTG0.093200.022400.646600.750001.000001.00000


Target Position: 3390, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3390CAUGACUAAUUUUUUAAAU84.3762605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4893408CATGACTAATTTTTTAAATATTTAAAAAATTAGTCATG0.761700.226400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3388-3410CGCATGACTAATTTTTTAAATATAUUUAAAAAAUUAGUCAUGCGCAUGACUAAUUUUUUAAAUAUU-9.120.311


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803CGUACACAGCCCUAAUCAU91.6354172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071821CGTACACAGCCCTAATCATATGATTAGGGCTGTGTACG0.230900.055500.620701.000001.000001.00000


Target Position: 4320, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4320GAUGUCUACAGAAAAUGCU77.32431349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4318-4340ATGATGTCTACAGAAAATGCTGGAGCAUUUUCUGUAGACAUCAUGAUGUCUACAGAAAAUGCUGGU14.020.322


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412GUGAACAACGAUGGCAUUU69.10322478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801430GTGAACAACGATGGCATTTAAATGCCATCGTTGTTCAC0.038700.013600.793100.750001.000001.00000


Target Position: 4392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4392AUUCAAAAUUCCAAAUUUU77.9291279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9114410ATTCAAAATTCCAAATTTTAAAATTTGGAATTTTGAAT0.088200.076500.508600.500001.000001.00000


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838CGGGAAUGCAGUUGAGGAU82.0117823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984856CGGGAATGCAGTTGAGGATATCCTCAACTGCATTCCCG0.038400.005300.732801.000001.000001.00000


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914CUCGAACUAUAUUCUUCUG74.33741741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921932CTCGAACTATATTCTTCTGCAGAAGAATATAGTTCGAG0.038700.029800.525900.500000.983700.62500


Target Position: 3379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3379GCACCACUACGCAUGACUA99.382412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513397GCACCACTACGCATGACTATAGTCATGCGTAGTGGTGC0.134400.041500.681001.000000.983700.75000


Target Position: 3876, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3876CUUUUAGGGUAAGAAGUUU78.18451252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3874-3896CTCTTTTAGGGTAAGAAGTTTGTAAACUUCUUACCCUAAAAGAGCUUUUAGGGUAAGAAGUUUGUU17.711.032


Target Position: 4376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4376ACAGAAAACCGAGAAUAUU77.76621300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4624394ACAGAAAACCGAGAATATTAATATTCTCGGTTTTCTGT0.266800.077700.698300.750000.989100.62500


Target Position: 3093, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093CAGAUUUUCUUAAGGAAUU81.2593909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033111CAGATTTTCTTAAGGAATTAATTCCTTAAGAAAATCTG0.051200.011200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3091-3113TGCAGATTTTCTTAAGGAATTTTAAUUCCUUAAGAAAAUCUGCACAGAUUUUCUUAAGGAAUUUUU18.75.322


Target Position: 3194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194GUGUGCUUCUGCUCAUUAC76.67761420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583212GTGTGCTTCTGCTCATTACGTAATGAGCAGAAGCACAC0.338100.003900.612100.500000.956501.00000


Target Position: 2271, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271GAAUUCUUGCUUUGCUAAU81.0815929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632289GAATTCTTGCTTTGCTAATATTAGCAAAGCAAGAATTC0.421800.035500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2269-2291AGGAATTCTTGCTTTGCTAATTCAUUAGCAAAGCAAGAAUUCCUGAAUUCUUGCUUUGCUAAUUCU19.75.322


Target Position: 2131, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2131CAUGGAUAACCAGAAUAAA95.756144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752149CATGGATAACCAGAATAAATTTATTCTGGTTATCCATG0.245100.033400.655200.750000.907600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2129-2151CTCATGGATAACCAGAATAAAGAUUUAUUCUGGUUAUCCAUGAGCAUGGAUAACCAGAAUAAAGAU6.921.222


Target Position: 2754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2754GAGGCGGCGAGGACGACUA84.7391580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102772GAGGCGGCGAGGACGACTATAGTCGTCCTCGCCGCCTC0.210000.005100.637900.750001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CAACGAUGGCAUUUUGAAA95.738846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461435CAACGATGGCATTTTGAAATTTCAAAATGCCATCGTTG0.226000.025200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1415-1437AACAACGATGGCATTTTGAAAACUUUCAAAAUGCCAUCGUUGUUCAACGAUGGCAUUUUGAAAACU7.721.122


Target Position: 1947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947AGCCUCAGGUCAUAAACAU80.7824955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851965AGCCTCAGGTCATAAACATATGTTTATGACCTGAGGCT0.141700.013400.698300.750001.000001.00000


Target Position: 4588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4588UCAACCCUGCAAUCACUUU66.73072801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3924606TCAACCCTGCAATCACTTTAAAGTGATTGCAGGGTTGA0.192100.094900.724100.750001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544CACAUUUCCCAACUCCUCU75.49461586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890562CACATTTCCCAACTCCTCTAGAGGAGTTGGGAAATGTG0.053100.015700.569000.500001.000001.00000


Target Position: 3092, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092GCAGAUUUUCUUAAGGAAU82.8984741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053110GCAGATTTTCTTAAGGAATATTCCTTAAGAAAATCTGC0.072800.012700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3090-3112TTGCAGATTTTCTTAAGGAATTTAUUCCUUAAGAAAAUCUGCAAGCAGAUUUUCUUAAGGAAUUUU19.912.022


Target Position: 2966, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2966GACUUAUUUCUUAAAGCUU86.2055475

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2964-2986TCGACTTATTTCTTAAAGCTTTTAAGCUUUAAGAAAUAAGUCGAGACUUAUUUCUUAAAGCUUUUU18.34.631


Target Position: 4166, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4166GGCAAUUUAGCAAACUGAU83.6277674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9144184GGCAATTTAGCAAACTGATATCAGTTTGCTAAATTGCC0.156400.005000.819001.000000.951100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4164-4186CTGGCAATTTAGCAAACTGATGCAUCAGUUUGCUAAAUUGCCAGGGCAAUUUAGCAAACUGAUGCU19.214.033


Target Position: 2280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280CUUUGCUAAUUCUGAUUCU78.66671196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2278-2300TGCTTTGCTAATTCTGATTCTGCAGAAUCAGAAUUAGCAAAGCACUUUGCUAAUUCUGAUUCUGCU20.419.722


Target Position: 4753, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4753CUGAGAAAAGUAUUCUCAA94.204883

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4751-4773AGCTGAGAAAAGTATTCTCAAAGUUGAGAAUACUUUUCUCAGCUCUGAGAAAAGUAUUCUCAAAGU20.420.401


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876CGGUAACCGAUCAGAAUGA86.4957459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517894CGGTAACCGATCAGAATGATCATTCTGATCGGTTACCG0.143200.031900.689700.750001.000001.00000


Target Position: 4451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4451AGUUGAGGGGUAGGGGGUA74.44151725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794469AGTTGAGGGGTAGGGGGTATACCCCCTACCCCTCAACT0.236500.135200.525900.750001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691CUACAGCAUCACUGGCCAA90.0298244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921709CTACAGCATCACTGGCCAATTGGCCAGTGATGCTGTAG0.052400.004800.525900.750000.902200.87500


Target Position: 4372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4372GUGCACAGAAAACCGAGAA81.9296833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6114390GTGCACAGAAAACCGAGAATTCTCGGTTTTCTGTGCAC0.269800.051000.620700.750000.989101.00000


Target Position: 2554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2554UAUUGAUGAAAAUCUGAAA87.5151379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862572TATTGATGAAAATCTGAAATTTCAGATTTTCATCAATA0.421100.035200.543100.500001.000001.00000


Target Position: 4310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4310UGCUUUUGAUGAUGUCUAC69.67112400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8524328TGCTTTTGATGATGTCTACGTAGACATCATCAAAAGCA0.063000.006500.672400.500001.000001.00000


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160UUGUUUUGUGUAUAUAAUU71.73942079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033178TTGTTTTGTGTATATAATTAATTATATACACAAAACAA0.141200.110300.637900.500001.000001.00000


Target Position: 3155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155UUCUGUUGUUUUGUGUAUA76.35921473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773173TTCTGTTGTTTTGTGTATATATACACAAAACAACAGAA0.201400.072900.629300.500001.000001.00000


Target Position: 736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736CUUUAUUAUUGAAAGAGAA94.359477

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
734-756GTCTTTATTATTGAAAGAGAAACUUCUCUUUCAAUAAUAAAGACCUUUAUUAUUGAAAGAGAAACU19.1-7.522


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665ACACAUUUAUGGAACAGAA93.489896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221683ACACATTTATGGAACAGAATTCTGTTCCATAAATGTGT0.598300.133600.534500.750001.000001.00000


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213CACAGUCACUGACACCAAC78.4121218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271231CACAGTCACTGACACCAACGTTGGTGTCAGTGACTGTG0.500400.109200.646600.500000.978301.00000


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604AUGAUUCUCUGCUCGUGUU75.58621569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572622ATGATTCTCTGCTCGTGTTAACACGAGCAGAGAATCAT0.041700.020900.508600.500001.000001.00000


Target Position: 2269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269AGGAAUUCUUGCUUUGCUA87.9158359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722287AGGAATTCTTGCTTTGCTATAGCAAAGCAAGAATTCCT0.408100.014000.672400.750001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953AGGUCAUAAACAUCAUUGA87.0541410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151971AGGTCATAAACATCATTGATCAATGATGTTTATGACCT0.053300.009000.620700.500001.000001.00000


Target Position: 2981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2981GCUUUUUUUUUUUUCCCAU77.871289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6492999GCTTTTTTTTTTTTCCCATATGGGAAAAAAAAAAAAGC0.201100.015600.698301.000001.000001.00000


Target Position: 3792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3792UCCAUGUUUUAAUAUCAAC63.75593143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673810TCCATGTTTTAATATCAACGTTGATATTAAAACATGGA0.574600.442100.724100.500000.956500.62500


Target Position: 3225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225UCCCUCUGCCUUUUUUUUU58.0553799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4503243TCCCTCTGCCTTTTTTTTTAAAAAAAAAGGCAGAGGGA0.255700.114100.870700.750001.000001.00000


Target Position: 3050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050CAGAAGAACAACUUUAGCA91.1977191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3048-3070TCCAGAAGAACAACTTTAGCATCUGCUAAAGUUGUUCUUCUGGACAGAAGAACAACUUUAGCAUCU18.319.132


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978CCUUCCUCCCAAUACAUCU76.59221429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941996CCTTCCTCCCAATACATCTAGATGTATTGGGAGGAAGG0.477100.409500.620700.750001.000001.00000


Target Position: 4728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4728GGGUGGAAAAGGAAAACAA95.172756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5194746GGGTGGAAAAGGAAAACAATTGTTTTCCTTTTCCACCC0.149300.027700.844801.000001.000001.00000


Target Position: 4457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4457GGGGUAGGGGGUAGUGAGG59.81383621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9734475GGGGTAGGGGGTAGTGAGGCCTCACTACCCCCTACCCC0.110000.074700.646600.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GAAAAUAACAUAUCGGAUU83.1032714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881699GAAAATAACATATCGGATTAATCCGATATGTTATTTTC0.154100.124100.663800.750001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052GAGCUCCCUGACAAAAAUA90.7542214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481070GAGCTCCCTGACAAAAATATATTTTTGTCAGGGAGCTC0.567300.078600.767200.750001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306CACACUGAAAGUGACUGAU80.9096946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551324CACACTGAAAGTGACTGATATCAGTCACTTTCAGTGTG0.041900.008300.612100.750000.934800.75000


Target Position: 4516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4516ACUUUUGACAAUCAAAGAA82.63761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8314534ACTTTTGACAATCAAAGAATTCTTTGATTGTCAAAAGT0.177500.024200.534500.750000.951100.75000


Target Position: 3157, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3157CUGUUGUUUUGUGUAUAUA89.9147248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4093175CTGTTGTTTTGTGTATATATATATACACAAAACAACAG0.183700.082800.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3155-3177TTCTGTTGTTTTGTGTATATAATUAUAUACACAAAACAACAGAACUGUUGUUUUGUGUAUAUAAUU8.219.322


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750GAGAAACAGGAUGGCUGAA87.5825375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998768GAGAAACAGGATGGCTGAATTCAGCCATCCTGTTTCTC0.117800.003100.637900.750001.000001.00000


Target Position: 4508, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4508GAAUUUCAACUUUUGACAA94.728269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9694526GAATTTCAACTTTTGACAATTGTCAAAAGTTGAAATTC0.040000.012300.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4506-4528GTGAATTTCAACTTTTGACAATCUUGUCAAAAGUUGAAAUUCACGAAUUUCAACUUUUGACAAUCU20.57.422


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398AGGAGGCGGAGAAGAGGAC60.02143600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822416AGGAGGCGGAGAAGAGGACGTCCTCTTCTCCGCCTCCT0.137100.005700.525900.500001.000001.00000


Target Position: 4021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4021GUGUGUUCAUUAAUGUUUA94.839464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5974039GTGTGTTCATTAATGTTTATAAACATTAATGAACACAC0.122100.028000.758600.750001.000001.00000


Target Position: 4022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4022UGUGUUCAUUAAUGUUUAU79.93841052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6544040TGTGTTCATTAATGTTTATATAAACATTAATGAACACA0.108000.027200.663800.750001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657UCAAAUCCAACAAAGACAA75.9021530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716675TCAAATCCAACAAAGACAATTGTCTTTGTTGGATTTGA0.879400.577800.577600.750000.940200.75000


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998CCUUCACAGCAGAACUAAC78.94171168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5202016CCTTCACAGCAGAACTAACGTTAGTTCTGCTGTGAAGG0.522100.424600.698300.750000.983700.75000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666ACAAAGACAAAGAAGGCAA82.0892812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884684ACAAAGACAAAGAAGGCAATTGCCTTCTTTGTCTTTGT0.054500.051300.560300.750001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873UCACGGUAACCGAUCAGAA85.0072559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915891TCACGGTAACCGATCAGAATTCTGATCGGTTACCGTGA0.081500.004900.551700.750001.000001.00000


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249CAAUCCCACCACGUACAAG72.45851994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251267CAATCCCACCACGTACAAGCTTGTACGTGGTGGGATTG0.070000.021100.508600.500000.994600.62500


Target Position: 3198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198GCUUCUGCUCAUUACUACA94.566275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983216GCTTCTGCTCATTACTACATGTAGTAATGAGCAGAAGC0.097800.081900.646600.750001.000001.00000


Target Position: 4484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484UUGGAUCUCUUUUUAUUUA79.2181135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8584502TTGGATCTCTTTTTATTTATAAATAAAAAGAGATCCAA0.097400.009200.612100.500001.000001.00000


Target Position: 3645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645CUCCCACCAGCCUCCUUUU71.85832056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023663CTCCCACCAGCCTCCTTTTAAAAGGAGGCTGGTGGGAG0.148000.096800.810300.750001.000001.00000


Target Position: 3257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257GGUCUCAUUCUAUCGGCCA83.7604660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473275GGTCTCATTCTATCGGCCATGGCCGATAGAATGAGACC0.083100.063600.508600.750001.000001.00000


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110GAGCGGAACUAUGAAAAGU81.9031836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7214128GAGCGGAACTATGAAAAGTACTTTTCATAGTTCCGCTC0.282100.072000.603400.500001.000001.00000


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433GGACUCCACCUACAGAAAG72.98081927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331451GGACTCCACCTACAGAAAGCTTTCTGTAGGTGGAGTCC0.255200.143200.732800.750000.994600.62500


Target Position: 1986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1986CCAAUACAUCUCCCUUCAC70.95082190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682004CCAATACATCTCCCTTCACGTGAAGGGAGATGTATTGG0.294800.243300.551700.750001.000001.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522CGCCCUGCCAAUCCCGAUG56.85423898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152540CGCCCTGCCAATCCCGATGCATCGGGATTGGCAGGGCG0.070200.025300.767200.750001.000001.00000


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575CCAUCUUUGUGCCUCCUGA87.0731409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801593CCATCTTTGTGCCTCCTGATCAGGAGGCACAAAGATGG0.186200.005800.620700.750001.000001.00000


Target Position: 3990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3990GGGCAGCUAUCCAGUGACU83.5174687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9544008GGGCAGCTATCCAGTGACTAGTCACTGGATAGCTGCCC0.072300.004000.784500.750000.994600.62500


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374ACAGUCAAAAGGCCUCUAC60.06783594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946392ACAGTCAAAAGGCCTCTACGTAGAGGCCTTTTGACTGT0.043700.014100.525900.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280GGGCAGAGUGAAUUUUGAA97.328825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948298GGGCAGAGTGAATTTTGAATTCAAAATTCACTCTGCCC0.171400.004100.819001.000001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775GAGGAUUUUGAGCACGUGA86.5054458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551793GAGGATTTTGAGCACGTGATCACGTGCTCAAAATCCTC0.061900.035700.586200.500001.000001.00000


Target Position: 3232, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232GCCUUUUUUUUUUUUUUUA82.7555750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3193250GCCTTTTTTTTTTTTTTTATAAAAAAAAAAAAAAAGGC0.238400.131600.965501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3230-3252CTGCCTTTTTTTTTTTTTTTAAGUAAAAAAAAAAAAAAAGGCAGGCCUUUUUUUUUUUUUUUAAGU-11.39.500


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905UACCAGAACCUCGAACUAU74.81761674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821923TACCAGAACCTCGAACTATATAGTTCGAGGTTCTGGTA0.379000.051900.637900.500001.000001.00000


Target Position: 3706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3706GGUCUUAAACUCCUGGCCU77.57371320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183724GGTCTTAAACTCCTGGCCTAGGCCAGGAGTTTAAGACC0.069800.024700.508600.750001.000001.00000


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1AGUGGCGUCGGAACUGCAA78.55131208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76419AGTGGCGTCGGAACTGCAATTGCAGTTCCGACGCCACT0.128400.013900.560300.750001.000001.00000


Target Position: 4379, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4379GAAAACCGAGAAUAUUCAA91.4714181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8684397GAAAACCGAGAATATTCAATTGAATATTCTCGGTTTTC0.296600.182900.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4377-4399CAGAAAACCGAGAATATTCAAAAUUGAAUAUUCUCGGUUUUCUGGAAAACCGAGAAUAUUCAAAAU8.719.422


Target Position: 4678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4678GUUUUGAGUGUAUACAUGU81.7036860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4676-4698TAGTTTTGAGTGTATACATGTGTACAUGUAUACACUCAAAACUAGUUUUGAGUGUAUACAUGUGUU13.312.201


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954GGUCAUAAACAUCAUUGAU93.0146114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261972GGTCATAAACATCATTGATATCAATGATGTTTATGACC0.046600.009000.672401.000001.000001.00000


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618GUGUUUGACUAUGAAGGAA90.3097230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702636GTGTTTGACTATGAAGGAATTCCTTCATAGTCAAACAC0.039900.004700.620700.750001.000001.00000


Target Position: 3546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3546CCAUUUUUUAAGAGACAGU76.36121472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283564CCATTTTTTAAGAGACAGTACTGTCTCTTAAAAAATGG0.068200.058700.637900.750001.000001.00000


Target Position: 3970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3970CUGAGUAUGUAACUUGCAA92.6694128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473988CTGAGTATGTAACTTGCAATTGCAAGTTACATACTCAG0.063600.011300.637900.750001.000001.00000


Target Position: 3720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3720GGCCUCAAGCAAUCCUUCU74.96381651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7583738GGCCTCAAGCAATCCTTCTAGAAGGATTGCTTGAGGCC0.090900.010000.775900.750000.978300.62500


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285GAGUGAAUUUUGAAGAUUG86.8386426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958303GAGTGAATTTTGAAGATTGCAATCTTCAAAATTCACTC0.041600.026300.663800.500001.000001.00000


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787CAGCCUCCAUGUUUUAAUA95.749145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2113805CAGCCTCCATGTTTTAATATATTAAAACATGGAGGCTG0.680400.179200.741400.750001.000001.00000


Target Position: 4307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4307GCCUGCUUUUGAUGAUGUC70.62082251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8914325GCCTGCTTTTGATGATGTCGACATCATCAAAAGCAGGC0.103600.005600.681000.750001.000001.00000


Target Position: 1668, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668CAUUUAUGGAACAGAAAAU87.7265364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691686CATTTATGGAACAGAAAATATTTTCTGTTCCATAAATG0.756400.116400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1666-1688CACATTTATGGAACAGAAAATAAAUUUUCUGUUCCAUAAAUGUGCAUUUAUGGAACAGAAAAUAAU12.2-1.811


Target Position: 3224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224GUCCCUCUGCCUUUUUUUU73.20231894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4333242GTCCCTCTGCCTTTTTTTTAAAAAAAAGGCAGAGGGAC0.231400.119500.819000.750001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504CCCAUCAGGCCUCCGUUUC51.88214280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939522CCCATCAGGCCTCCGTTTCGAAACGGAGGCCTGATGGG0.167500.004300.819000.750000.934800.75000


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134GGAUAACCAGAAUAAAGAC84.1689626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7742152GGATAACCAGAATAAAGACGTCTTTATTCTGGTTATCC0.556400.045900.551700.750001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596CCCGCCUUAUGAUUCUCUG66.3932849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5762614CCCGCCTTATGATTCTCTGCAGAGAATCATAAGGCGGG0.167000.042100.706900.750001.000001.00000


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145GCUACUCUAGUUCUGUUGU76.50341445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783163GCTACTCTAGTTCTGTTGTACAACAGAACTAGAGTAGC0.247100.063600.646600.750001.000001.00000


Target Position: 3643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643UUCUCCCACCAGCCUCCUU56.98813890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9743661TTCTCCCACCAGCCTCCTTAAGGAGGCTGGTGGGAGAA0.113400.088100.534500.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781UCUGGAUAGAGAACGCAUU71.21252147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
869799TCTGGATAGAGAACGCATTAATGCGTTCTCTATCCAGA0.098400.006000.715500.750001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CUGCCCAGAAAAUGAAAAA81.3579900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704628CTGCCCAGAAAATGAAAAATTTTTCATTTTCTGGGCAG0.207300.012300.784500.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854GAUCCAAUGGAGAUUUUGA94.291379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
852-874AGGATCCAATGGAGATTTTGATCUCAAAAUCUCCAUUGGAUCCUGAUCCAAUGGAGAUUUUGAUCU7.420.123


Target Position: 4416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4416AGGAGCAAGAAGAAAAUGU71.66242089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9724434AGGAGCAAGAAGAAAATGTACATTTTCTTCTTGCTCCT0.039600.015100.637900.500001.000001.00000


Target Position: 4509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4509AAUUUCAACUUUUGACAAU77.66871310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984527AATTTCAACTTTTGACAATATTGTCAAAAGTTGAAATT0.040300.011000.500000.500001.000001.00000


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916CGAACUAUAUUCUUCUGUG85.1496549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811934CGAACTATATTCTTCTGTGCACAGAAGAATATAGTTCG0.038600.019800.500000.750000.983700.62500


Target Position: 3788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3788AGCCUCCAUGUUUUAAUAU74.94161658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1373806AGCCTCCATGTTTTAATATATATTAAAACATGGAGGCT0.722200.280000.810300.750001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432GGGACUCCACCUACAGAAA92.9709116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
243450GGGACTCCACCTACAGAAATTTCTGTAGGTGGAGTCCC0.300100.118200.991401.000000.972800.75000


Target Position: 2891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891GUUAGUGAUGCAGUUAGUA88.61314

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2889-2911TGGTTAGTGATGCAGTTAGTATAUACUAACUGCAUCACUAACCAGUUAGUGAUGCAGUUAGUAUAU17.620.333


Target Position: 4375, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4375CACAGAAAACCGAGAAUAU90.7996209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3194393CACAGAAAACCGAGAATATATATTCTCGGTTTTCTGTG0.267200.065600.750000.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4373-4395TGCACAGAAAACCGAGAATATTCAUAUUCUCGGUUUUCUGUGCACACAGAAAACCGAGAAUAUUCU16.019.232


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CCCCAUACCAGAACCUCGA74.88581664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191918CCCCATACCAGAACCTCGATCGAGGTTCTGGTATGGGG0.143100.045600.698300.750001.000001.00000


Target Position: 2060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2060ACCCAAGAAUCUAUCAUUU79.92111055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512078ACCCAAGAATCTATCATTTAAATGATAGATTCTTGGGT0.084200.069000.853400.750001.000001.00000


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333CCCUCGACACCCGAUUCAA83.7183665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806351CCCTCGACACCCGATTCAATTGAATCGGGTGTCGAGGG0.072500.019000.844801.000000.951100.87500


Target Position: 3538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538ACUCCCUGCCAUUUUUUAA80.01191047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3893556ACTCCCTGCCATTTTTTAATTAAAAAATGGCAGGGAGT0.629000.247600.672400.750001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242CGAUCUUCAAUCCCACCAC71.76862073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721260CGATCTTCAATCCCACCACGTGGTGGGATTGAAGATCG0.203200.015000.500000.750000.972800.62500


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675GGAACAGAAAAUAACAUAU93.104110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1681693GGAACAGAAAATAACATATATATGTTATTTTCTGTTCC0.385800.233100.827601.000001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646UCCCACCAGCCUCCUUUUU52.94074210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4763664TCCCACCAGCCTCCTTTTTAAAAAGGAGGCTGGTGGGA0.159300.092500.870700.750001.000001.00000


Target Position: 4567, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4567CAAGUGUUUUGGAGAAAAA94.966562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8494585CAAGTGTTTTGGAGAAAAATTTTTCTCCAAAACACTTG0.146600.006600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4565-4587CTCAAGTGTTTTGGAGAAAAAAAUUUUUCUCCAAAACACUUGAGCAAGUGUUUUGGAGAAAAAAAU14.817.802


Target Position: 2923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2923UCUCCACUUUAUAGCUCUA85.8786500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852941TCTCCACTTTATAGCTCTATAGAGCTATAAAGTGGAGA0.134800.039800.551700.750001.000001.00000


Target Position: 2975, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2975CUUAAAGCUUUUUUUUUUU74.64221695

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7297519CTTAAAGCTTTTTTTTTTT1/1/0/096.22CDH1NM_004360.31NANANANA00CDH1(0.002)&ITPRIPL2(0.007)&PUM1(0.007)>F2H5(0.007)&MXI1(0.029)>PBP8(0.029)&MRPL19(0.029)&CWF19L1(0.029)&SEH1L(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362993CTTAAAGCTTTTTTTTTTTAAAAAAAAAAAGCTTTAAG0.394000.099700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2973-2995TTCTTAAAGCTTTTTTTTTTTTCAAAAAAAAAAAGCUUUAAGAACUUAAAGCUUUUUUUUUUUUCU-11.313.710


Target Position: 3657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657UCCUUUUUAUUUUUUUGUA76.28111486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563675TCCTTTTTATTTTTTTGTATACAAAAAAATAAAAAGGA0.216900.175100.689700.750001.000001.00000


Target Position: 4480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4480UGAUUUGGAUCUCUUUUUA85.7756508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854498TGATTTGGATCTCTTTTTATAAAAAGAGATCCAAATCA0.052300.003400.689700.750001.000001.00000


Target Position: 4799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4799CAAUUUUGUUAAACCAUAA97.20528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6174817CAATTTTGTTAAACCATAATTATGGTTTAACAAAATTG0.355700.066900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4797-4819AACAATTTTGTTAAACCATAAAAUUAUGGUUUAACAAAAUUGUUCAAUUUUGUUAAACCAUAAAAU20.0-3.3


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906ACCAGAACCUCGAACUAUA91.8214162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191924ACCAGAACCTCGAACTATATATAGTTCGAGGTTCTGGT0.268800.024300.810300.750001.000001.00000


Target Position: 3644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3644UCUCCCACCAGCCUCCUUU60.18313580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663662TCTCCCACCAGCCTCCTTTAAAGGAGGCTGGTGGGAGA0.131300.094900.724100.750001.000001.00000


Target Position: 2811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2811GGAAAUGCAGAAAUCACGU79.16641141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742829GGAAATGCAGAAATCACGTACGTGATTTCTGCATTTCC0.057000.009900.594800.750001.000001.00000


Target Position: 4317, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4317GAUGAUGUCUACAGAAAAU95.759843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7704335GATGATGTCTACAGAAAATATTTTCTGTAGACATCATC0.082100.013600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4315-4337TTGATGATGTCTACAGAAAATGCAUUUUCUGUAGACAUCAUCAAGAUGAUGUCUACAGAAAAUGCU12.220.522


Target Position: 4537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4537GACUUUUGUUGAAAUAGCU86.0297486

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4535-4557AAGACTTTTGTTGAAATAGCTTTAGCUAUUUCAACAAAAGUCUUGACUUUUGUUGAAAUAGCUUUU13.610.321


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872GGGGAAAAAAAAGAGACUG68.54882560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092890GGGGAAAAAAAAGAGACTGCAGTCTCTTTTTTTTCCCC0.122000.005200.706900.750001.000001.00000


Target Position: 3024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024CAAAAGAUACCCAAAUUUU85.7473509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4593042CAAAAGATACCCAAATTTTAAAATTTGGGTATCTTTTG0.612700.218500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3022-3044TCCAAAAGATACCCAAATTTTAAAAAAUUUGGGUAUCUUUUGGACAAAAGAUACCCAAAUUUUAAU-3.35.321


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137AGAAGUCAGCUACUCUAGU77.53111328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893155AGAAGTCAGCTACTCTAGTACTAGAGTAGCTGACTTCT0.300700.010400.517200.500000.967400.75000


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605UGAUUCUCUGCUCGUGUUU66.30142864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452623TGATTCTCTGCTCGTGTTTAAACACGAGCAGAGAATCA0.043900.019000.724100.750001.000001.00000


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GUACACAGCCCUAAUCAUA92.6988125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861822GTACACAGCCCTAATCATATATGATTAGGGCTGTGTAC0.238800.046900.637900.750001.000001.00000


Target Position: 2965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2965CGACUUAUUUCUUAAAGCU87.1003404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2963-2985TTCGACTTATTTCTTAAAGCTTTAGCUUUAAGAAAUAAGUCGAACGACUUAUUUCUUAAAGCUUUU13.714.532


Target Position: 2684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GACAAAGACCAGGACUAUG76.25981489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562702GACAAAGACCAGGACTATGCATAGTCCTGGTCTTTGTC0.289300.204600.663800.500001.000001.00000


Target Position: 3781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3781UGUGCCCAGCCUCCAUGUU62.6923263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463799TGTGCCCAGCCTCCATGTTAACATGGAGGCTGGGCACA0.311000.032000.560300.750001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875ACGGUAACCGAUCAGAAUG64.36893074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
667893ACGGTAACCGATCAGAATGCATTCTGATCGGTTACCGT0.135200.021300.620700.500001.000001.00000


Target Position: 4374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4374GCACAGAAAACCGAGAAUA87.6413372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3434392GCACAGAAAACCGAGAATATATTCTCGGTTTTCTGTGC0.253100.059800.810301.000000.989100.87500


Target Position: 4485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4485UGGAUCUCUUUUUAUUUAA80.959941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7074503TGGATCTCTTTTTATTTAATTAAATAAAAAGAGATCCA0.103000.012100.810300.750001.000001.00000


Target Position: 3959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3959UCUUUCAUCUCCUGAGUAU76.47161452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273977TCTTTCATCTCCTGAGTATATACTCAGGAGATGAAAGA0.089100.066700.681000.750000.972801.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411AGUGAACAACGAUGGCAUU80.1421027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961429AGTGAACAACGATGGCATTAATGCCATCGTTGTTCACT0.036700.010400.698300.750001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815UUCUCUCACGCUGUGUCAU65.1362990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963833TTCTCTCACGCTGTGTCATATGACACAGCGTGAGAGAA0.040900.007600.517200.500001.000001.00000


Target Position: 4544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4544GUUGAAAUAGCUUUACUGU80.669974

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4542-4564TTGTTGAAATAGCTTTACTGTTTACAGUAAAGCUAUUUCAACAAGUUGAAAUAGCUUUACUGUUUU11.87.402


Target Position: 4724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4724UUGGGGGUGGAAAAGGAAA65.89072909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794742TTGGGGGTGGAAAAGGAAATTTCCTTTTCCACCCCCAA0.173500.010700.646600.500001.000001.00000


Target Position: 1790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790GUGAAGAACAGCACGUACA86.729433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781808GTGAAGAACAGCACGTACATGTACGTGCTGTTCTTCAC0.080300.020300.586200.500001.000001.00000


Target Position: 3650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3650ACCAGCCUCCUUUUUAUUU66.17862880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4203668ACCAGCCTCCTTTTTATTTAAATAAAAAGGAGGCTGGT0.346600.108000.853400.750001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CCAGGAGCCAGACACAUUU80.3111016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811672CCAGGAGCCAGACACATTTAAATGTGTCTGGCTCCTGG0.497100.050400.844801.000001.000001.00000


Target Position: 4591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4591ACCCUGCAAUCACUUUUUG61.09783470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9014609ACCCTGCAATCACTTTTTGCAAAAAGTGATTGCAGGGT0.205700.096700.706900.500001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CCCGCCCUGCCAAUCCCGA61.44093423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662538CCCGCCCTGCCAATCCCGATCGGGATTGGCAGGGCGGG0.082700.011100.698300.750001.000001.00000


Target Position: 3512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3512AGCCACUGCACCUGCCCAG57.73193832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783530AGCCACTGCACCTGCCCAGCTGGGCAGGTGCAGTGGCT0.056200.006400.569000.500000.918500.62500


Target Position: 3648, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648CCACCAGCCUCCUUUUUAU86.2478474

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1364819CCACCAGCCTCCTTTTTAT1/1/0/0100.00CDH1NM_004360.31NANANA16:68868276..68868294(+)00CDH1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2603666CCACCAGCCTCCTTTTTATATAAAAAGGAGGCTGGTGG0.286800.103700.801701.000001.000001.00000


Target Position: 4308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4308CCUGCUUUUGAUGAUGUCU73.35381876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8584326CCTGCTTTTGATGATGTCTAGACATCATCAAAAGCAGG0.106800.006400.620700.750001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248UCAAUCCCACCACGUACAA70.30622297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171266TCAATCCCACCACGTACAATTGTACGTGGTGGGATTGA0.271400.056100.577600.750001.000001.00000


Target Position: 2695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2695GGACUAUGACUACUUGAAC82.0515820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132713GGACTATGACTACTTGAACGTTCAAGTAGTCATAGTCC0.093600.046600.724100.750001.000001.00000


Target Position: 4771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4771AAGAUGCAUUUUUAUAAAU81.0059934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6654789AAGATGCATTTTTATAAATATTTATAAAAATGCATCTT0.412700.211200.629300.500001.000001.00000


Target Position: 4023, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023GUGUUCAUUAAUGUUUAUU73.57681842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7204041GTGTTCATTAATGTTTATTAATAAACATTAATGAACAC0.091200.024400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4021-4043GTGTGTTCATTAATGTTTATTTAAAUAAACAUUAAUGAACACACGUGUUCAUUAAUGUUUAUUUAU6.920.512


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976GACCUUCCUCCCAAUACAU85.2992538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581994GACCTTCCTCCCAATACATATGTATTGGGAGGAAGGTC0.520800.057600.663800.750001.000001.00000


Target Position: 4528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4528CAAAGAAAAGACUUUUGUU89.2615280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4526-4548ATCAAAGAAAAGACTTTTGTTGAAACAAAAGUCUUUUCUUUGAUCAAAGAAAAGACUUUUGUUGAU10.35.512


Target Position: 4675, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4675GUAGUUUUGAGUGUAUACA83.4903690

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4673-4695CTGTAGTTTTGAGTGTATACATGUGUAUACACUCAAAACUACAGGUAGUUUUGAGUGUAUACAUGU15.84.902


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491CACCGCCCCCCGCCCCAUC45.95174572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995509CACCGCCCCCCGCCCCATCGATGGGGCGGGGGGCGGTG0.065700.003200.612100.500000.907601.00000


Target Position: 3994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3994AGCUAUCCAGUGACUUGUU79.10061146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6364012AGCTATCCAGTGACTTGTTAACAAGTCACTGGATAGCT0.336300.017000.706900.750000.994601.00000


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612GCCCAGAAAAUGAAAAAGG61.64113395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
896630GCCCAGAAAATGAAAAAGGCCTTTTTCATTTTCTGGGC0.119800.005400.655200.500001.000001.00000


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597CCGCCUUAUGAUUCUCUGC61.94983351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442615CCGCCTTATGATTCTCTGCGCAGAGAATCATAAGGCGG0.298600.037800.560300.500001.000001.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245UCUUCAAUCCCACCACGUA81.655868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901263TCTTCAATCCCACCACGTATACGTGGTGGGATTGAAGA0.286300.041800.543100.750001.000001.00000


Target Position: 1355, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1355GCUGUAUACACCAUAUUGA92.1274147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821373GCTGTATACACCATATTGATCAATATGGTGTATACAGC0.102400.067100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1353-1375AGGCTGTATACACCATATTGAATUCAAUAUGGUGUAUACAGCCUGCUGUAUACACCAUAUUGAAUU5.613.123


Target Position: 2926, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2926CCACUUUAUAGCUCUAAUA94.283380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552944CCACTTTATAGCTCTAATATATTAGAGCTATAAAGTGG0.083900.044600.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2924-2946CTCCACTTTATAGCTCTAATAAGUAUUAGAGCUAUAAAGUGGAGCCACUUUAUAGCUCUAAUAAGU11.611.832


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545UGGAAAUUUUAUUGAUGAA87.0137411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222563TGGAAATTTTATTGATGAATTCATCAATAAAATTTCCA0.047800.019300.672400.750001.000001.00000


Target Position: 4810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4810AACCAUAAAAAAAAAAAAA81.1671922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9234828AACCATAAAAAAAAAAAAATTTTTTTTTTTTTATGGTT0.961100.441300.646600.500001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653CAGAUCAAAUCCAACAAAG76.58361432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863671CAGATCAAATCCAACAAAGCTTTGTTGGATTTGATCTG0.672300.490000.646600.500001.000001.00000


Target Position: 3233, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3233CCUUUUUUUUUUUUUUUAA84.275618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4293251CCTTTTTTTTTTTTTTTAATTAAAAAAAAAAAAAAAGG0.176000.100200.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3231-3253TGCCTTTTTTTTTTTTTTTAAGAUUAAAAAAAAAAAAAAAGGCACCUUUUUUUUUUUUUUUAAGAU-9.1-5.900


Target Position: 3384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3384ACUACGCAUGACUAAUUUU79.84771066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4893402ACTACGCATGACTAATTTTAAAATTAGTCATGCGTAGT0.435300.101500.706900.750001.000001.00000


Target Position: 2130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130UCAUGGAUAACCAGAAUAA86.8448424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5312148TCATGGATAACCAGAATAATTATTCTGGTTATCCATGA0.195500.026500.689700.750000.902200.62500


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737UUUAUUAUUGAAAGAGAAA76.41611465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974755TTTATTATTGAAAGAGAAATTTCTCTTTCAATAATAAA0.188500.078900.500000.500001.000001.00000


Target Position: 3161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3161UGUUUUGUGUAUAUAAUUU80.6598976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5983179TGTTTTGTGTATATAATTTAAATTATATACACAAAACA0.139000.104200.706900.750001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313ACAAAGGACAGCCUAUUUU72.64821970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772331ACAAAGGACAGCCTATTTTAAAATAGGCTGTCCTTTGT0.094400.009500.706900.750000.983701.00000


Target Position: 2961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2961GUUUCGACUUAUUUCUUAA96.846432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192979GTTTCGACTTATTTCTTAATTAAGAAATAAGTCGAAAC0.179700.084300.612100.750001.000001.00000


Target Position: 3964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3964CAUCUCCUGAGUAUGUAAC69.96182347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303982CATCTCCTGAGTATGTAACGTTACATACTCAGGAGATG0.169100.026100.508600.500001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617GAAAAUGAAAAAGGCCCAU72.53231990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
892635GAAAATGAAAAAGGCCCATATGGGCCTTTTTCATTTTC0.081300.065500.517200.750001.000001.00000


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229UCUGCCUUUUUUUUUUUUU60.85683501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2233247TCTGCCTTTTTTTTTTTTTAAAAAAAAAAAAAGGCAGA0.723400.107500.724100.750001.000001.00000


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500GAGUGUCCCCCGGUAUCUU80.5456990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472518GAGTGTCCCCCGGTATCTTAAGATACCGGGGGACACTC0.043300.005600.672400.750000.962000.62500


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284AGAGUGAAUUUUGAAGAUU78.99821159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925302AGAGTGAATTTTGAAGATTAATCTTCAAAATTCACTCT0.046700.040200.715500.750001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365GGUGUGAUUACAGUCAAAA92.073149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708383GGTGTGATTACAGTCAAAATTTTGACTGTAATCACACC0.103500.012100.853401.000001.000001.00000


Target Position: 3162, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3162GUUUUGUGUAUAUAAUUUU82.5813767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5693180GTTTTGTGTATATAATTTTAAAATTATATACACAAAAC0.130300.102300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3160-3182TTGTTTTGTGTATATAATTTTTTAAAAUUAUAUACACAAAACAAGUUUUGUGUAUAUAAUUUUUUU-10.312.221


Target Position: 3143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143CAGCUACUCUAGUUCUGUU94.434276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5433161CAGCTACTCTAGTTCTGTTAACAGAACTAGAGTAGCTG0.182900.038500.637900.750001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693UCGGAUUUGGAGAGACACU67.14822749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501711TCGGATTTGGAGAGACACTAGTGTCTCTCCAAATCCGA0.235100.064900.586200.500001.000001.00000


Target Position: 3391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3391AUGACUAAUUUUUUAAAUA87.7089365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593409ATGACTAATTTTTTAAATATATTTAAAAAATTAGTCAT0.759600.431000.612100.500001.000001.00000


Target Position: 3030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030AUACCCAAAUUUUAAUAUU75.99831521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8203048ATACCCAAATTTTAATATTAATATTAAAATTTGGGTAT0.718900.508500.534500.500001.000001.00000


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319CCUCCCAGGCUCAAGCUAU78.35471231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563337CCTCCCAGGCTCAAGCTATATAGCTTGAGCCTGGGAGG0.083300.003900.801701.000000.978300.62500


Target Position: 4776, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776GCAUUUUUAUAAAUUUUAU89.2515282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1204794GCATTTTTATAAATTTTATATAAAATTTATAAAAATGC0.482200.286400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4774-4796ATGCATTTTTATAAATTTTATTAAUAAAAUUUAUAAAAAUGCAUGCAUUUUUAUAAAUUUUAUUAU-9.7-3.302


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GCCAGACACAUUUAUGGAA90.4982222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611678GCCAGACACATTTATGGAATTCCATAAATGTGTCTGGC0.164300.145900.827601.000001.000001.00000


Target Position: 3220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220GUGUGUCCCUCUGCCUUUU75.33521604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673238GTGTGTCCCTCTGCCTTTTAAAAGGCAGAGGGACACAC0.153500.006100.793100.750001.000001.00000


Target Position: 3793, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3793CCAUGUUUUAAUAUCAACU82.0885813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5483811CCATGTTTTAATATCAACTAGTTGATATTAAAACATGG0.554200.457500.637900.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3791-3813CTCCATGTTTTAATATCAACTCTAGUUGAUAUUAAAACAUGGAGCCAUGUUUUAAUAUCAACUCUU16.112.121


Target Position: 4660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4660GUAGAGAAUGUCACUGUAG79.23981128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9214678GTAGAGAATGTCACTGTAGCTACAGTGACATTCTCTAC0.126200.014200.508600.500001.000001.00000


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367CCCGGGACAACGUUUAUUA84.6982583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642385CCCGGGACAACGTTTATTATAATAAACGTTGTCCCGGG0.106000.003900.956901.000001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076ACCAUUAACAGGAACACAG66.48052834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811094ACCATTAACAGGAACACAGCTGTGTTCCTGTTAATGGT0.088600.013500.569000.500000.994600.75000


Target Position: 4568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4568AAGUGUUUUGGAGAAAAAA83.0717719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874586AAGTGTTTTGGAGAAAAAATTTTTTCTCCAAAACACTT0.161500.005700.637900.500001.000001.00000


Target Position: 3153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153AGUUCUGUUGUUUUGUGUA88.3435332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543171AGTTCTGTTGTTTTGTGTATACACAAAACAACAGAACT0.214300.035300.525900.750001.000001.00000


Target Position: 4524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4524CAAUCAAAGAAAAGACUUU87.1003405

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4522-4544GACAATCAAAGAAAAGACTTTTGAAAGUCUUUUCUUUGAUUGUCCAAUCAAAGAAAAGACUUUUGU17.77.412


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658CCUUUUUAUUUUUUUGUAC69.56382414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5683676CCTTTTTATTTTTTTGTACGTACAAAAAAATAAAAAGG0.163000.127000.663800.750001.000001.00000


Target Position: 3955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3955UCCCUCUUUCAUCUCCUGA65.90532906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7383973TCCCTCTTTCATCTCCTGATCAGGAGATGAAAGAGGGA0.114700.086800.646600.500000.983700.62500


Target Position: 3172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3172UAUAAUUUUUUAAAAAAAA85.296540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893190TATAATTTTTTAAAAAAAATTTTTTTTAAAAAATTATA0.135000.040500.543100.500001.000001.00000


Target Position: 3826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3826CAGUUGCUUUGCCCAAGAU84.0878636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6563844CAGTTGCTTTGCCCAAGATATCTTGGGCAAAGCAACTG0.144700.025400.603400.750001.000001.00000


Target Position: 3047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047UUCCAGAAGAACAACUUUA76.15761503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003065TTCCAGAAGAACAACTTTATAAAGTTGTTCTTCTGGAA0.271200.176300.637900.500001.000001.00000


Target Position: 4639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4639CUAUAUCGAAUAUAGUUCU82.7505751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4637-4659AGCTATATCGAATATAGTTCTGTAGAACUAUAUUCGAUAUAGCUCUAUAUCGAAUAUAGUUCUGUU14.510.302


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385CUACGCAUGACUAAUUUUU75.83361539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3913403CTACGCATGACTAATTTTTAAAAATTAGTCATGCGTAG0.483200.113900.672400.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238CCUCCGAUCUUCAAUCCCA88.0818349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691256CCTCCGATCTTCAATCCCATGGGATTGAAGATCGGAGG0.139800.026000.500000.750000.972800.87500


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282GCAGAGUGAAUUUUGAAGA84.8362575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572300GCAGAGTGAATTTTGAAGATCTTCAAAATTCACTCTGC0.129700.094400.629300.750001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440ACCUACAGAAAGUUUUCCA77.5931318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917458ACCTACAGAAAGTTTTCCATGGAAAACTTTCTGTAGGT0.367000.177000.508600.500000.967400.62500


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843AUGCAGUUGAGGAUCCAAU74.36021739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821861ATGCAGTTGAGGATCCAATATTGGATCCTCAACTGCAT0.098800.009100.646600.500001.000001.00000


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788AGAGAACGCAUUGCCACAU73.61831833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734806AGAGAACGCATTGCCACATATGTGGCAATGCGTTCTCT0.428200.024200.569000.750001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445CAGAAAGUUUUCCACCAAA93.416799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238463CAGAAAGTTTTCCACCAAATTTGGTGGAAAACTTTCTG0.419900.280800.784500.750000.967400.62500


Target Position: 4490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4490CUCUUUUUAUUUAAAUGUG70.32762295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964508CTCTTTTTATTTAAATGTGCACATTTAAATAAAAAGAG0.129300.029400.517200.500001.000001.00000


Target Position: 2974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2974UCUUAAAGCUUUUUUUUUU72.94071932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4062992TCTTAAAGCTTTTTTTTTTAAAAAAAAAAGCTTTAAGA0.250500.095300.724100.750001.000001.00000


Target Position: 4459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4459GGUAGGGGGUAGUGAGGAU88.5562317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434477GGTAGGGGGTAGTGAGGATATCCTCACTACCCCCTACC0.044400.036200.672401.000001.000001.00000


Target Position: 4219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4219UGAAAAUUCUGGAAGGAAU79.84271068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9174237TGAAAATTCTGGAAGGAATATTCCTTCCAGAATTTTCA0.056900.004900.715500.750001.000001.00000


Target Position: 3533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3533CCCCAACUCCCUGCCAUUU66.34152857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2023551CCCCAACTCCCTGCCATTTAAATGGCAGGGAGTTGGGG0.347400.250700.991401.000001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952CAGGUCAUAAACAUCAUUG73.91141788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681970CAGGTCATAAACATCATTGCAATGATGTTTATGACCTG0.058500.010800.637900.500001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949CCUCAGGUCAUAAACAUCA86.1142479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701967CCTCAGGTCATAAACATCATGATGTTTATGACCTGAGG0.138300.009700.620700.750001.000001.00000


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109AUUUUGUCUCACUUUUAAA85.6094520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273127ATTTTGTCTCACTTTTAAATTTAAAAGTGAGACAAAAT0.096900.010400.508600.500001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053AGCUCCCUGACAAAAAUAU74.43561728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3601071AGCTCCCTGACAAAAATATATATTTTTGTCAGGGAGCT0.210200.063600.810300.750001.000001.00000


Target Position: 4673, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4673CUGUAGUUUUGAGUGUAUA90.3301228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4671-4693CACTGTAGTTTTGAGTGTATACAUAUACACUCAAAACUACAGUGCUGUAGUUUUGAGUGUAUACAU19.019.002


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570UCAGAAGACAGAAGAGAGA76.93141392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963588TCAGAAGACAGAAGAGAGATCTCTCTTCTGTCTTCTGA0.120600.016800.500000.500001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154GUUCUGUUGUUUUGUGUAU81.4506890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6553172GTTCTGTTGTTTTGTGTATATACACAAAACAACAGAAC0.221500.074900.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3152-3174TAGTTCTGTTGTTTTGTGTATATAUACACAAAACAACAGAACUAGUUCUGUUGUUUUGUGUAUAUU20.419.222


Target Position: 2922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922CUCUCCACUUUAUAGCUCU78.41811216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8982940CTCTCCACTTTATAGCTCTAGAGCTATAAAGTGGAGAG0.150400.038800.586200.500001.000001.00000


Target Position: 2279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2279GCUUUGCUAAUUCUGAUUC65.8952908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3532297GCTTTGCTAATTCTGATTCGAATCAGAATTAGCAAAGC0.293300.150100.681000.750001.000001.00000


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283UGCUAAUUCUGAUUCUGCU78.40761220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682301TGCTAATTCTGATTCTGCTAGCAGAATCAGAATTAGCA0.073100.070500.500000.500001.000001.00000


Target Position: 4025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4025GUUCAUUAAUGUUUAUUUA95.597149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8134043GTTCATTAATGTTTATTTATAAATAAACATTAATGAAC0.070700.021700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4023-4045GTGTTCATTAATGTTTATTTAGCUAAAUAAACAUUAAUGAACACGUUCAUUAAUGUUUAUUUAGCU-9.78.922


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CUCUUCUCUCACGCUGUGU65.54862941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
987830CTCTTCTCTCACGCTGTGTACACAGCGTGAGAGAAGAG0.051300.003300.603400.500001.000001.00000


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234CUUUUUUUUUUUUUUUAAG64.98493008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793252CTTTTTTTTTTTTTTTAAGCTTAAAAAAAAAAAAAAAG0.160700.085500.500000.500001.000001.00000


Target Position: 3021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3021GUCCAAAAGAUACCCAAAU76.21931495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4713039GTCCAAAAGATACCCAAATATTTGGGTATCTTTTGGAC0.550300.196900.810300.750001.000001.00000


Target Position: 4706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4706GAUAAUUGUGUAUUUUCUU86.7492431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4704-4726CTGATAATTGTGTATTTTCTTTGAAGAAAAUACACAAUUAUCAGGAUAAUUGUGUAUUUUCUUUGU5.3-1.801


Target Position: 2140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140CCAGAAUAAAGACCAAGUG70.9462191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882158CCAGAATAAAGACCAAGTGCACTTGGTCTTTATTCTGG0.248000.105800.551700.750001.000001.00000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397UCAUAACCCACAGAUCCAU70.2232311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942415TCATAACCCACAGATCCATATGGATCTGTGGGTTATGA0.046600.004300.569000.750000.989100.87500


Target Position: 2931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931UUAUAGCUCUAAUAAGUUU78.34411232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832949TTATAGCTCTAATAAGTTTAAACTTATTAGAGCTATAA0.086700.034600.534500.500001.000001.00000


Target Position: 3649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3649CACCAGCCUCCUUUUUAUU78.46151213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5473667CACCAGCCTCCTTTTTATTAATAAAAAGGAGGCTGGTG0.343700.105200.784500.750001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169GUAUAUAAUUUUUUAAAAA98.304617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5073187GTATATAATTTTTTAAAAATTTTTAAAAAATTATATAC0.146700.055500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3167-3189GTGTATATAATTTTTTAAAAAAAUUUUUAAAAAAUUAUAUACACGUAUAUAAUUUUUUAAAAAAAU-9.1-5.911


Target Position: 4566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4566UCAAGUGUUUUGGAGAAAA78.57441206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7394584TCAAGTGTTTTGGAGAAAATTTTCTCCAAAACACTTGA0.158500.010600.724100.750001.000001.00000


Target Position: 4316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4316UGAUGAUGUCUACAGAAAA93.525195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7174334TGATGATGTCTACAGAAAATTTTCTGTAGACATCATCA0.093100.012800.724100.750001.000001.00000


Target Position: 3992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3992GCAGCUAUCCAGUGACUUG81.6948861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304010GCAGCTATCCAGTGACTTGCAAGTCACTGGATAGCTGC0.089200.011100.706900.750000.994600.87500


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GGCAGAGUGAAUUUUGAAG75.73941553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627299GGCAGAGTGAATTTTGAAGCTTCAAAATTCACTCTGCC0.151700.052500.862100.750001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547GAAAUUUUAUUGAUGAAAA97.075330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122565GAAATTTTATTGATGAAAATTTTCATCAATAAAATTTC0.071100.024000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2545-2567TGGAAATTTTATTGATGAAAATCUUUUCAUCAAUAAAAUUUCCAGAAAUUUUAUUGAUGAAAAUCU16.3-12.011


Target Position: 2890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890GGUUAGUGAUGCAGUUAGU88.8964297

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2888-2910CTGGTTAGTGATGCAGTTAGTATACUAACUGCAUCACUAACCAGGGUUAGUGAUGCAGUUAGUAUU16.419.033


Target Position: 658, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658CAAAUCCAACAAAGACAAA88.1146344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487676CAAATCCAACAAAGACAAATTTGTCTTTGTTGGATTTG0.268500.196700.646600.750000.940200.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
656-678ATCAAATCCAACAAAGACAAAGAUUUGUCUUUGUUGGAUUUGAUCAAAUCCAACAAAGACAAAGAU19.220.121


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798UUGCCACAUACACUCUCUU68.1822621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926816TTGCCACATACACTCTCTTAAGAGAGTGTATGTGGCAA0.306800.141500.508600.500001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083ACAGGAACACAGGAGUCAU81.656866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711101ACAGGAACACAGGAGTCATATGACTCCTGTGTTCCTGT0.039700.005300.551700.750000.989100.75000


Target Position: 4014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4014UGAGUAAGUGUGUUCAUUA93.3346103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8264032TGAGTAAGTGTGTTCATTATAATGAACACACTTACTCA0.573000.007100.689700.750001.000001.00000


Target Position: 4737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4737AGGAAAACAAUUCAAGCUG63.65363150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9384755AGGAAAACAATTCAAGCTGCAGCTTGAATTGTTTTCCT0.045300.010400.560300.500001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168UGUAUAUAAUUUUUUAAAA88.7136304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5743186TGTATATAATTTTTTAAAATTTTAAAAAATTATATACA0.129600.060800.706900.750001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GCAGUUGAGGAUCCAAUGG62.8513248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924863GCAGTTGAGGATCCAATGGCCATTGGATCCTCAACTGC0.105600.006200.508600.500001.000001.00000


Target Position: 3393, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3393GACUAAUUUUUUAAAUAUU91.204190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043411GACTAATTTTTTAAATATTAATATTTAAAAAATTAGTC0.695600.443100.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3391-3413ATGACTAATTTTTTAAATATTTGAAUAUUUAAAAAAUUAGUCAUGACUAAUUUUUUAAAUAUUUGU-8.04.611


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925UCCACUUUAUAGCUCUAAU77.22241357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392943TCCACTTTATAGCTCTAATATTAGAGCTATAAAGTGGA0.111200.044000.862100.750001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608AGCUGCCCAGAAAAUGAAA80.4669999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
751626AGCTGCCCAGAAAATGAAATTTCATTTTCTGGGCAGCT0.290900.010300.853400.750001.000001.00000


Target Position: 3525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3525GCCCAGCUCCCCAACUCCC55.63374004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293543GCCCAGCTCCCCAACTCCCGGGAGTTGGGGAGCTGGGC0.390700.028200.508600.500000.902200.87500


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607CAGCUGCCCAGAAAAUGAA87.9366358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765625CAGCTGCCCAGAAAATGAATTCATTTTCTGGGCAGCTG0.308700.009800.612100.750001.000001.00000


Target Position: 3708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3708UCUUAAACUCCUGGCCUCA71.3522125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613726TCTTAAACTCCTGGCCTCATGAGGCCAGGAGTTTAAGA0.073600.042600.500000.500001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533GCAGAAUUGCUCACAUUUC75.68541558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
696551GCAGAATTGCTCACATTTCGAAATGTGAGCAATTCTGC0.435100.012600.681000.750000.967400.62500


Target Position: 4492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4492CUUUUUAUUUAAAUGUGAA91.7782165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4490-4512CTCTTTTTATTTAAATGTGAATTUUCACAUUUAAAUAAAAAGAGCUUUUUAUUUAAAUGUGAAUUU20.5-9.722


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902CCAUACCAGAACCUCGAAC64.10883102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981920CCATACCAGAACCTCGAACGTTCGAGGTTCTGGTATGG0.361500.047300.698300.750001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368CCGGGACAACGUUUAUUAC73.11031908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442386CCGGGACAACGTTTATTACGTAATAAACGTTGTCCCGG0.096000.004200.732800.750001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667ACAUUUAUGGAACAGAAAA85.3533534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801685ACATTTATGGAACAGAAAATTTTCTGTTCCATAAATGT0.761100.121700.706900.750001.000001.00000


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996UCCCUUCACAGCAGAACUA75.54121581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222014TCCCTTCACAGCAGAACTATAGTTCTGCTGTGAAGGGA0.516600.196400.698300.750000.983700.87500


Target Position: 2929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929CUUUAUAGCUCUAAUAAGU84.478598

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2927-2949CACTTTATAGCTCTAATAAGTTTACUUAUUAGAGCUAUAAAGUGCUUUAUAGCUCUAAUAAGUUUU-2.3-2.312


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335CUCGACACCCGAUUCAAAG65.31112975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806353CTCGACACCCGATTCAAAGCTTTGAATCGGGTGTCGAG0.166700.008100.672400.500000.951100.62500


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228CUCUGCCUUUUUUUUUUUU70.3452291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4653246CTCTGCCTTTTTTTTTTTTAAAAAAAAAAAAGGCAGAG0.719000.092800.810300.750001.000001.00000


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653CCCAGGAGCCAGACACAUU82.6656758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151671CCCAGGAGCCAGACACATTAATGTGTCTGGCTCCTGGG0.603700.011700.982801.000001.000001.00000


Target Position: 4703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4703GCUGAUAAUUGUGUAUUUU85.5838521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4701-4723GTGCTGATAATTGTGTATTTTCTAAAAUACACAAUUAUCAGCACGCUGAUAAUUGUGUAUUUUCUU6.913.401


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664GACACAUUUAUGGAACAGA86.9784413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901682GACACATTTATGGAACAGATCTGTTCCATAAATGTGTC0.197800.140900.594800.500001.000001.00000


Target Position: 4727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4727GGGGUGGAAAAGGAAAACA79.73711078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5864745GGGGTGGAAAAGGAAAACATGTTTTCCTTTTCCACCCC0.144000.022400.784500.750001.000001.00000


Target Position: 3782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3782GUGCCCAGCCUCCAUGUUU73.50621854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4373800GTGCCCAGCCTCCATGTTTAAACATGGAGGCTGGGCAC0.378700.041500.793100.750001.000001.00000


Target Position: 4539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4539CUUUUGUUGAAAUAGCUUU75.05261638

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4537-4559GACTTTTGTTGAAATAGCTTTACAAAGCUAUUUCAACAAAAGUCCUUUUGUUGAAAUAGCUUUACU18.35.612


Target Position: 4478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4478CUUGAUUUGGAUCUCUUUU74.98061648

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4476-4498ATCTTGATTTGGATCTCTTTTTAAAAAGAGAUCCAAAUCAAGAUCUUGAUUUGGAUCUCUUUUUAU19.17.422


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147UACUCUAGUUCUGUUGUUU75.74171552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973165TACTCTAGTTCTGTTGTTTAAACAACAGAACTAGAGTA0.337700.094500.681000.500001.000001.00000


Target Position: 4757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4757GAAAAGUAUUCUCAAAGAU91.0356201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4755-4777GAGAAAAGTATTCTCAAAGATGCAUCUUUGAGAAUACUUUUCUCGAAAAGUAUUCUCAAAGAUGCU20.44.903


Target Position: 2515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515UCUUCCCCGCCCUGCCAAU56.90033897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2452533TCTTCCCCGCCCTGCCAATATTGGCAGGGCGGGGAAGA0.363300.089700.715500.750001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CUGGAUAGAGAACGCAUUG68.56652557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926800CTGGATAGAGAACGCATTGCAATGCGTTCTCTATCCAG0.300000.005800.637900.500001.000001.00000


Target Position: 2108, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108GACUACAAAAUCAAUCUCA91.1571192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2106-2128GTGACTACAAAATCAATCTCAAGUGAGAUUGAUUUUGUAGUCACGACUACAAAAUCAAUCUCAAGU20.419.022


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812CCCUAAUCAUAGCUACAGA92.8837119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411830CCCTAATCATAGCTACAGATCTGTAGCTATGATTAGGG0.291400.068500.767200.750000.978300.75000


Target Position: 3651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651CCAGCCUCCUUUUUAUUUU75.80571543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1993669CCAGCCTCCTTTTTATTTTAAAATAAAAAGGAGGCTGG0.352000.108900.844801.000001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681UCAGACAAAGACCAGGACU64.94963010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342699TCAGACAAAGACCAGGACTAGTCCTGGTCTTTGTCTGA0.330500.072400.517200.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364UGGUGUGAUUACAGUCAAA93.0402112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807382TGGTGTGATTACAGTCAAATTTGACTGTAATCACACCA0.175800.008100.844800.750001.000001.00000


Target Position: 3537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3537AACUCCCUGCCAUUUUUUA77.88841288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303555AACTCCCTGCCATTTTTTATAAAAAATGGCAGGGAGTT0.698700.257800.612100.500001.000001.00000


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131AGAGUUUCCCUACGUAUAC67.66122686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021149AGAGTTTCCCTACGTATACGTATACGTAGGGAAACTCT0.245300.072200.543100.500001.000001.00000


Target Position: 4572, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4572GUUUUGGAGAAAAAAAUCA81.6802864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4570-4592GTGTTTTGGAGAAAAAAATCAACUGAUUUUUUUCUCCAAAACACGUUUUGGAGAAAAAAAUCAACU0.420.101


Target Position: 2936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2936GCUCUAAUAAGUUUGUGUU85.2649544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522954GCTCTAATAAGTTTGTGTTAACACAAACTTATTAGAGC0.084100.016200.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2934-2956TAGCTCTAATAAGTTTGTGTTAGAACACAAACUUAUUAGAGCUAGCUCUAAUAAGUUUGUGUUAGU19.311.623


Target Position: 4491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4491UCUUUUUAUUUAAAUGUGA75.15711624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9844509TCTTTTTATTTAAATGTGATCACATTTAAATAAAAAGA0.275300.033600.500000.500001.000001.00000


Target Position: 3164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3164UUUGUGUAUAUAAUUUUUU65.47752953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623182TTTGTGTATATAATTTTTTAAAAAATTATATACACAAA0.113300.097300.500000.500001.000001.00000


Target Position: 3790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3790CCUCCAUGUUUUAAUAUCA94.145485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053808CCTCCATGTTTTAATATCATGATATTAAAACATGGAGG0.596400.322400.620700.750001.000001.00000


Target Position: 1656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1656AGGAGCCAGACACAUUUAU73.3271878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6311674AGGAGCCAGACACATTTATATAAATGTGTCTGGCTCCT0.203500.017500.801700.750001.000001.00000


Target Position: 4732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4732GGAAAAGGAAAACAAUUCA89.1644286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4614750GGAAAAGGAAAACAATTCATGAATTGTTTTCCTTTTCC0.240900.050400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4730-4752GTGGAAAAGGAAAACAATTCAAGUGAAUUGUUUUCCUUUUCCACGGAAAAGGAAAACAAUUCAAGU14.818.701


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816CUCCUGAAUUCAGUUGCUU73.78911806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503834CTCCTGAATTCAGTTGCTTAAGCAACTGAATTCAGGAG0.062600.013800.672400.750000.907600.87500


Target Position: 4100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4100GCCAAAGACAGAGCGGAAC59.42353661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6744118GCCAAAGACAGAGCGGAACGTTCCGCTCTGTCTTTGGC0.103100.047500.853400.750000.983700.62500


Target Position: 3082, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082CCAGCACCUUGCAGAUUUU84.7748579

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5308219CCAGCACCTTGCAGATTTT1/1/0/097.21CDH1NM_004360.31NANANA16:68867711..68867729(+)00CDH1(0.002)


Target Position: 1063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063CAAAAAUAUGUUCACCAUU83.3997701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381081CAAAAATATGTTCACCATTAATGGTGAACATATTTTTG0.138800.064400.637900.750000.972800.62500


Target Position: 4024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024UGUUCAUUAAUGUUUAUUU79.54081096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7924042TGTTCATTAATGTTTATTTAAATAAACATTAATGAACA0.076400.022300.706900.750001.000001.00000


Target Position: 3014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3014UGGUGAUGUCCAAAAGAUA90.6728218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8483032TGGTGATGTCCAAAAGATATATCTTTTGGACATCACCA0.219500.006600.801700.750000.956500.62500


Target Position: 1404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404CAAAUCCAGUGAACAACGA80.19951025

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1402-1424CACAAATCCAGTGAACAACGATGUCGUUGUUCACUGGAUUUGUGCAAAUCCAGUGAACAACGAUGU19.820.132


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283CAGAGUGAAUUUUGAAGAU88.9939294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760301CAGAGTGAATTTTGAAGATATCTTCAAAATTCACTCTG0.083200.083100.603400.750001.000001.00000


Target Position: 2, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2GUGGCGUCGGAACUGCAAA82.2766795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56820GTGGCGTCGGAACTGCAAATTTGCAGTTCCGACGCCAC0.139300.023800.793100.750001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913CUUUAUACUCUCUCCACUU84.911569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832931CTTTATACTCTCTCCACTTAAGTGGAGAGAGTATAAAG0.261400.073300.500000.750001.000001.00000


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166UGUGUAUAUAAUUUUUUAA87.3157389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5953184TGTGTATATAATTTTTTAATTAAAAAATTATATACACA0.122300.077600.672400.750001.000001.00000


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356GGCACAGAUGGUGUGAUUA92.1315146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
987374GGCACAGATGGTGTGATTATAATCACACCATCTGTGCC0.038100.019600.965501.000000.923900.75000


Target Position: 3380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3380CACCACUACGCAUGACUAA89.8641249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083398CACCACTACGCATGACTAATTAGTCATGCGTAGTGGTG0.155300.052600.758600.750000.983700.75000


Target Position: 4769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4769CAAAGAUGCAUUUUUAUAA96.43537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6304787CAAAGATGCATTTTTATAATTATAAAAATGCATCTTTG0.481600.225300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4767-4789CTCAAAGATGCATTTTTATAAATUUAUAAAAAUGCAUCUUUGAGCAAAGAUGCAUUUUUAUAAAUU-7.512.002


Target Position: 4444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4444GGGGGUUAGUUGAGGGGUA87.6667370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1704462GGGGGTTAGTTGAGGGGTATACCCCTCAACTAACCCCC0.656900.112500.810301.000001.000001.00000


Target Position: 4658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4658GUGUAGAGAAUGUCACUGU83.1874710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7104676GTGTAGAGAATGTCACTGTACAGTGACATTCTCTACAC0.158800.012000.586200.500001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231UGCCUUUUUUUUUUUUUUU63.76253140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2103249TGCCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGGCA0.928700.121800.853400.750001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812GAAAUGCAGAAAUCACGUU82.1677806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192830GAAATGCAGAAATCACGTTAACGTGATTTCTGCATTTC0.048700.007000.525900.750001.000001.00000


Target Position: 4456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4456AGGGGUAGGGGGUAGUGAG68.21132613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8184474AGGGGTAGGGGGTAGTGAGCTCACTACCCCCTACCCCT0.136500.092900.534500.500001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602CCCAUCAGCUGCCCAGAAA81.7419856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428620CCCATCAGCTGCCCAGAAATTTCTGGGCAGCTGATGGG0.176200.098900.991401.000001.000001.00000


Target Position: 3817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3817UCCUGAAUUCAGUUGCUUU77.89811285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7973835TCCTGAATTCAGTTGCTTTAAAGCAACTGAATTCAGGA0.074400.014000.870700.750000.907600.75000


Target Position: 3175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175AAUUUUUUAAAAAAAAUUU74.45271723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143193AATTTTTTAAAAAAAATTTAAATTTTTTTTAAAAAATT0.139300.050900.508600.500001.000001.00000


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632GGCUCAAGCAGUUCUCCCA90.4908224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4423650GGCTCAAGCAGTTCTCCCATGGGAGAACTGCTTGAGCC0.389800.092500.655200.750001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062ACAAAAAUAUGUUCACCAU84.5279592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001080ACAAAAATATGTTCACCATATGGTGAACATATTTTTGT0.073700.067500.551700.750000.989100.62500


Target Position: 4565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4565CUCAAGUGUUUUGGAGAAA80.44651002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7644583CTCAAGTGTTTTGGAGAAATTTCTCCAAAACACTTGAG0.160900.009800.810300.750001.000001.00000


Target Position: 2976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976UUAAAGCUUUUUUUUUUUU61.91943357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342994TTAAAGCTTTTTTTTTTTTAAAAAAAAAAAAGCTTTAA0.455800.101400.534500.500001.000001.00000


Target Position: 2971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2971AUUUCUUAAAGCUUUUUUU71.15342156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482989ATTTCTTAAAGCTTTTTTTAAAAAAAGCTTTAAGAAAT0.216300.123200.508600.500001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CCCCAUCUUUGUGCCUCCU65.24042982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411591CCCCATCTTTGTGCCTCCTAGGAGGCACAAAGATGGGG0.148000.006700.646600.750001.000001.00000


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661CCAGACACAUUUAUGGAAC69.91972354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731679CCAGACACATTTATGGAACGTTCCATAAATGTGTCTGG0.160200.142500.698300.750001.000001.00000


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653AGCCUCCUUUUUAUUUUUU68.89922510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6493671AGCCTCCTTTTTATTTTTTAAAAAATAAAAAGGAGGCT0.353900.133600.853400.750001.000001.00000


Target Position: 3196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3196GUGCUUCUGCUCAUUACUA91.6402170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613214GTGCTTCTGCTCATTACTATAGTAATGAGCAGAAGCAC0.170700.003900.620700.750000.956500.75000


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372GACAACGUUUAUUACUAUG75.83271540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762390GACAACGTTTATTACTATGCATAGTAATAAACGTTGTC0.098400.045200.663800.500001.000001.00000


Target Position: 4301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4301CCAAGUGCCUGCUUUUGAU85.4675526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984319CCAAGTGCCTGCTTTTGATATCAAAAGCAGGCACTTGG0.036500.007400.663801.000001.000001.00000


Target Position: 4445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4445GGGGUUAGUUGAGGGGUAG69.33962444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1694463GGGGTTAGTTGAGGGGTAGCTACCCCTCAACTAACCCC0.652900.135300.819000.750001.000001.00000


Target Position: 3545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3545GCCAUUUUUUAAGAGACAG67.7862669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303563GCCATTTTTTAAGAGACAGCTGTCTCTTAAAAAATGGC0.067700.058600.715500.750001.000001.00000


Target Position: 3967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3967CUCCUGAGUAUGUAACUUG74.12841756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953985CTCCTGAGTATGTAACTTGCAAGTTACATACTCAGGAG0.088200.014900.663800.500001.000001.00000


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977ACCUUCCUCCCAAUACAUC58.85653723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591995ACCTTCCTCCCAATACATCGATGTATTGGGAGGAAGGT0.504700.103300.672400.500001.000001.00000


Target Position: 4806, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4806GUUAAACCAUAAAAAAAAA91.6218174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6334824GTTAAACCATAAAAAAAAATTTTTTTTTATGGTTTAAC0.463700.287600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4804-4826TTGTTAAACCATAAAAAAAAAAAUUUUUUUUUAUGGUUUAACAAGUUAAACCAUAAAAAAAAAAAU-11.314.01


Target Position: 2939, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939CUAAUAAGUUUGUGUUAGA91.0518200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2937-2959CTCTAATAAGTTTGTGTTAGAAAUCUAACACAAACUUAUUAGAGCUAAUAAGUUUGUGUUAGAAAU19.0-2.322


Target Position: 3383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3383CACUACGCAUGACUAAUUU83.4439695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2383401CACTACGCATGACTAATTTAAATTAGTCATGCGTAGTG0.434300.089400.793100.750001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458ACCAAAGUCACGCUGAAUA80.03141044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886476ACCAAAGTCACGCTGAATATATTCAGCGTGACTTTGGT0.054000.040000.810300.750001.000001.00000


Target Position: 4020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4020AGUGUGUUCAUUAAUGUUU76.15921502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5564038AGTGTGTTCATTAATGTTTAAACATTAATGAACACACT0.133100.031800.706900.750001.000001.00000


Target Position: 3963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3963UCAUCUCCUGAGUAUGUAA89.8514252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093981TCATCTCCTGAGTATGTAATTACATACTCAGGAGATGA0.094200.043400.689700.750001.000001.00000


Target Position: 5, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5GCGUCGGAACUGCAAAGCA86.3467467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74023GCGTCGGAACTGCAAAGCATGCTTTGCAGTTCCGACGC0.156400.026900.569000.750000.978300.62500


Target Position: 3387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3387ACGCAUGACUAAUUUUUUA87.255394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5493405ACGCATGACTAATTTTTTATAAAAAATTAGTCATGCGT0.753400.142300.741400.750001.000001.00000


Target Position: 2946, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2946GUUUGUGUUAGAAAAGUUU80.6478980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2944-2966AAGTTTGTGTTAGAAAAGTTTCGAAACUUUUCUAACACAAACUUGUUUGUGUUAGAAAAGUUUCGU3.219.322


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420CGAUGGCAUUUUGAAAACA88.0987348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931438CGATGGCATTTTGAAAACATGTTTTCAAAATGCCATCG0.262000.027000.586200.750001.000001.00000


Target Position: 2973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2973UUCUUAAAGCUUUUUUUUU64.65263042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062991TTCTTAAAGCTTTTTTTTTAAAAAAAAAGCTTTAAGAA0.185300.092800.672400.500001.000001.00000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765GCUGGACAGGGAGGAUUUU74.96061652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941783GCTGGACAGGGAGGATTTTAAAATCCTCCCTGTCCAGC0.109700.003200.853401.000001.000001.00000


Target Position: 3107, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107GAAUUUUGUCUCACUUUUA97.545124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6743125GAATTTTGTCTCACTTTTATAAAAGTGAGACAAAATTC0.131900.013900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3105-3127AGGAATTTTGTCTCACTTTTAAAUAAAAGUGAGACAAAAUUCCUGAAUUUUGUCUCACUUUUAAAU10.3-3.322


Target Position: 2903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GUUAGUAUAGCUUUAUACU86.296469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2901-2923CAGTTAGTATAGCTTTATACTCTAGUAUAAAGCUAUACUAACUGGUUAGUAUAGCUUUAUACUCUU1.46.322


Target Position: 2937, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937CUCUAAUAAGUUUGUGUUA88.4613322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562955CTCTAATAAGTTTGTGTTATAACACAAACTTATTAGAG0.041800.008500.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2935-2957AGCTCTAATAAGTTTGTGTTAGAUAACACAAACUUAUUAGAGCUCUCUAAUAAGUUUGUGUUAGAU19.38.423


Target Position: 3386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386UACGCAUGACUAAUUUUUU75.01911640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663404TACGCATGACTAATTTTTTAAAAAATTAGTCATGCGTA0.752300.129000.681000.500001.000001.00000


Target Position: 4386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4386GAGAAUAUUCAAAAUUCCA93.1979108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4384-4406CCGAGAATATTCAAAATTCCAAAUGGAAUUUUGAAUAUUCUCGGGAGAAUAUUCAAAAUUCCAAAU14.26.622


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018CGCCAUCGCUUACACCAUC70.55112261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681036CGCCATCGCTTACACCATCGATGGTGTAAGCGATGGCG0.827300.279600.741400.750000.913000.75000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801CCACAUACACUCUCUUCUC76.43361460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829819CCACATACACTCTCTTCTCGAGAAGAGAGTGTATGTGG0.109700.015000.534500.750001.000001.00000


Target Position: 4304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4304AGUGCCUGCUUUUGAUGAU78.27731235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9264322AGTGCCTGCTTTTGATGATATCATCAAAAGCAGGCACT0.082600.004600.525900.750001.000001.00000


Target Position: 4652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4652AGUUCUGUGUAGAGAAUGU83.3217706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9994670AGTTCTGTGTAGAGAATGTACATTCTCTACACAGAACT0.117000.007000.500000.500000.989100.62500


Target Position: 460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460CAAAGUCACGCUGAAUACA86.8483423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
458-480ACCAAAGTCACGCTGAATACAGTUGUAUUCAGCGUGACUUUGGUCAAAGUCACGCUGAAUACAGUU16.119.233


Target Position: 4109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4109AGAGCGGAACUAUGAAAAG71.75122077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604127AGAGCGGAACTATGAAAAGCTTTTCATAGTTCCGCTCT0.386600.098500.586200.500001.000001.00000


Target Position: 2689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689AGACCAGGACUAUGACUAC78.60471201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722707AGACCAGGACTATGACTACGTAGTCATAGTCCTGGTCT0.102000.074200.543100.500001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311UGAAAGUGACUGAUGCUGA83.071720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641329TGAAAGTGACTGATGCTGATCAGCATCAGTCACTTTCA0.098600.020400.500000.500001.000001.00000


Target Position: 3943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3943CCUUUAAUGGCUUCCCUCU74.50511716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563961CCTTTAATGGCTTCCCTCTAGAGGGAAGCCATTAAAGG0.061700.010900.620700.750000.923900.87500


Target Position: 3532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3532UCCCCAACUCCCUGCCAUU65.71312927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923550TCCCCAACTCCCTGCCATTAATGGCAGGGAGTTGGGGA0.359600.257900.862100.750001.000001.00000


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GGCUGUAUACACCAUAUUG85.0923554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721372GGCTGTATACACCATATTGCAATATGGTGTATACAGCC0.103300.076400.853400.750000.962000.62500


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173AUAAUUUUUUAAAAAAAAU78.18921251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163191ATAATTTTTTAAAAAAAATATTTTTTTTAAAAAATTAT0.141100.041100.534500.500001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505CCAUCAGGCCUCCGUUUCU75.93261527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933523CCATCAGGCCTCCGTTTCTAGAAACGGAGGCCTGATGG0.143200.004500.620700.750000.972801.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332GGUCAAAGAGCCCUUACUG78.14491256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342350GGTCAAAGAGCCCTTACTGCAGTAAGGGCTCTTTGACC0.067400.049900.569000.750001.000001.00000


Target Position: 3536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3536CAACUCCCUGCCAUUUUUU74.61031701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5013554CAACTCCCTGCCATTTTTTAAAAAATGGCAGGGAGTTG0.581500.265100.646600.750001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564CUGGCCUCAGAAGACAGAA79.44431107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884582CTGGCCTCAGAAGACAGAATTCTGTCTTCTGAGGCCAG0.111100.005700.612100.750000.918500.87500


Target Position: 4108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4108CAGAGCGGAACUAUGAAAA86.5725451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2884126CAGAGCGGAACTATGAAAATTTTCATAGTTCCGCTCTG0.262100.092400.784500.750001.000001.00000


Target Position: 4522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4522GACAAUCAAAGAAAAGACU79.52241098

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4520-4542TTGACAATCAAAGAAAAGACTTTAGUCUUUUCUUUGAUUGUCAAGACAAUCAAAGAAAAGACUUUU13.320.501


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054GCUCCCUGACAAAAAUAUG72.93861933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651072GCTCCCTGACAAAAATATGCATATTTTTGTCAGGGAGC0.104700.042500.698300.750001.000001.00000


Target Position: 3227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227CCUCUGCCUUUUUUUUUUU74.121760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1983245CCTCTGCCTTTTTTTTTTTAAAAAAAAAAAGGCAGAGG0.715100.100900.844801.000001.000001.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593AGCCCCGCCUUAUGAUUCU65.62862936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752611AGCCCCGCCTTATGATTCTAGAATCATAAGGCGGGGCT0.321400.084000.629300.500001.000001.00000


Target Position: 2592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592CAGCCCCGCCUUAUGAUUC62.27233306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762610CAGCCCCGCCTTATGATTCGAATCATAAGGCGGGGCTG0.369400.045700.612100.500000.994600.62500


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017CCGCCAUCGCUUACACCAU78.43811215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341035CCGCCATCGCTTACACCATATGGTGTAAGCGATGGCGG0.814200.091200.758601.000000.913000.75000


Target Position: 3827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3827AGUUGCUUUGCCCAAGAUA81.9949824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6993845AGTTGCTTTGCCCAAGATATATCTTGGGCAAAGCAACT0.101500.012500.663800.750001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436CUCCACCUACAGAAAGUUU76.22231493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286454CTCCACCTACAGAAAGTTTAAACTTTCTGTAGGTGGAG0.292800.153800.810300.750000.962000.75000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799AGCACGUACACAGCCCUAA78.63481200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741817AGCACGTACACAGCCCTAATTAGGGCTGTGTACGTGCT0.081000.020700.819000.750000.940200.62500


Target Position: 4601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4601CACUUUUUGGAAUUGUCUU78.89731171

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4599-4621ATCACTTTTTGGAATTGTCTTGAAAGACAAUUCCAAAAAGUGAUCACUUUUUGGAAUUGUCUUGAU19.23.203


Target Position: 4662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662AGAGAAUGUCACUGUAGUU89.8127255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7144680AGAGAATGTCACTGTAGTTAACTACAGTGACATTCTCT0.138000.047400.577600.750001.000001.00000


Target Position: 3656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656CUCCUUUUUAUUUUUUUGU64.18373091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3654-3676GCCTCCTTTTTATTTTTTTGTACACAAAAAAAUAAAAAGGAGGCCUCCUUUUUAUUUUUUUGUACU-2.918.721


Target Position: 2595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595CCCCGCCUUAUGAUUCUCU68.14492626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572613CCCCGCCTTATGATTCTCTAGAGAATCATAAGGCGGGG0.237100.101900.767200.750001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789GAGAACGCAUUGCCACAUA89.8621250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253807GAGAACGCATTGCCACATATATGTGGCAATGCGTTCTC0.437400.084000.767200.750000.978300.62500


Target Position: 4388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4388GAAUAUUCAAAAUUCCAAA95.567950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4424406GAATATTCAAAATTCCAAATTTGGAATTTTGAATATTC0.321700.196200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4386-4408GAGAATATTCAAAATTCCAAATTUUUGGAAUUUUGAAUAUUCUCGAAUAUUCAAAAUUCCAAAUUU20.11.812


Target Position: 4773, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4773GAUGCAUUUUUAUAAAUUU91.9579157

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8477319GATGCATTTTTATAAATTT1/1/0/096.22CDH1NM_004360.31NANANA16:68869402..68869420(+)00CDH1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6074791GATGCATTTTTATAAATTTAAATTTATAAAAATGCATC0.497100.196200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4771-4793AAGATGCATTTTTATAAATTTTAAAAUUUAUAAAAAUGCAUCUUGAUGCAUUUUUAUAAAUUUUAU-10.319.902


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592GGUUAUUCCUCCCAUCAGC70.07822330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978610GGTTATTCCTCCCATCAGCGCTGATGGGAGGAATAACC0.582200.544100.500000.500001.000001.00000


Target Position: 4787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4787AAUUUUAUUAAACAAUUUU75.131630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9234805AATTTTATTAAACAATTTTAAAATTGTTTAATAAAATT0.168200.112600.508600.500001.000001.00000


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398CAUAACCCACAGAUCCAUU82.3098791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982416CATAACCCACAGATCCATTAATGGATCTGTGGGTTATG0.038800.003500.646600.750000.989100.87500


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662CAGACACAUUUAUGGAACA93.535194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771680CAGACACATTTATGGAACATGTTCCATAAATGTGTCTG0.173000.146500.577600.500001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GGUAACCGAUCAGAAUGAC71.8192061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834895GGTAACCGATCAGAATGACGTCATTCTGATCGGTTACC0.171700.042200.534500.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861GACACUUCUGCUGAUCCUG70.1512324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871879GACACTTCTGCTGATCCTGCAGGATCAGCAGAAGTGTC0.112000.030500.534500.500000.983700.62500


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171AUAUAAUUUUUUAAAAAAA91.4804180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533189ATATAATTTTTTAAAAAAATTTTTTTAAAAAATTATAT0.133900.044900.543100.500001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369CGGGACAACGUUUAUUACU75.99291522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002387CGGGACAACGTTTATTACTAGTAATAAACGTTGTCCCG0.146800.005300.706900.750001.000001.00000


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431UGGGACUCCACCUACAGAA78.23091244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
659449TGGGACTCCACCTACAGAATTCTGTAGGTGGAGTCCCA0.327900.014500.672400.750000.945700.62500


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599CCUCCCAUCAGCUGCCCAG62.20973317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753617CCTCCCATCAGCTGCCCAGCTGGGCAGCTGATGGGAGG0.142100.075700.560300.750001.000001.00000


Target Position: 2912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2912GCUUUAUACUCUCUCCACU86.3945465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4742930GCTTTATACTCTCTCCACTAGTGGAGAGAGTATAAAGC0.245000.062600.646600.750001.000001.00000


Target Position: 4665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4665GAAUGUCACUGUAGUUUUG83.5726678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8514683GAATGTCACTGTAGTTTTGCAAAACTACAGTGACATTC0.436500.028900.525900.500001.000001.00000


Target Position: 4016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4016AGUAAGUGUGUUCAUUAAU81.0844928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6084034AGTAAGTGTGTTCATTAATATTAATGAACACACTTACT0.184700.020500.698300.750001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951UCAGGUCAUAAACAUCAUU73.43171865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851969TCAGGTCATAAACATCATTAATGATGTTTATGACCTGA0.078700.015700.715500.750001.000001.00000


Target Position: 4487, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4487GAUCUCUUUUUAUUUAAAU86.9407417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6304505GATCTCTTTTTATTTAAATATTTAAATAAAAAGAGATC0.112900.018400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4485-4507TGGATCTCTTTTTATTTAAATGTAUUUAAAUAAAAAGAGAUCCAGAUCUCUUUUUAUUUAAAUGUU-9.719.122


Target Position: 3091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3091UGCAGAUUUUCUUAAGGAA86.6557442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573109TGCAGATTTTCTTAAGGAATTCCTTAAGAAAATCTGCA0.061600.010100.681000.750001.000001.00000


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858AGGGACACUUCUGCUGAUC59.85923617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641876AGGGACACTTCTGCTGATCGATCAGCAGAAGTGTCCCT0.091500.006200.663800.500000.983701.00000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692CCAGGACUAUGACUACUUG81.8432843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462710CCAGGACTATGACTACTTGCAAGTAGTCATAGTCCTGG0.086000.050300.698300.750001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426CAUUUUGAAAACAGCAAAG71.5342104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9191444CATTTTGAAAACAGCAAAGCTTTGCTGTTTTCAAAATG0.159700.062700.517200.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402ACCCACAGAUCCAUUUCUU74.72341686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755420ACCCACAGATCCATTTCTTAAGAAATGGATCTGTGGGT0.121200.010000.715500.750001.000001.00000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553GUGCUGGAUGUGAAUGAAG73.29851883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801571GTGCTGGATGTGAATGAAGCTTCATTCACATCCAGCAC0.168200.003500.655200.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057CCCUGACAAAAAUAUGUUC70.85492207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771075CCCTGACAAAAATATGTTCGAACATATTTTTGTCAGGG0.080400.023400.819000.750000.978300.62500


Target Position: 2956, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956GAAAAGUUUCGACUUAUUU84.1381628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932974GAAAAGTTTCGACTTATTTAAATAAGTCGAAACTTTTC0.246700.021400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2954-2976TAGAAAAGTTTCGACTTATTTCTAAAUAAGUCGAAACUUUUCUAGAAAAGUUUCGACUUAUUUCUU4.63.222


Target Position: 3033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033CCCAAAUUUUAAUAUUCCA86.5943448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633051CCCAAATTTTAATATTCCATGGAATATTAAAATTTGGG0.773900.549700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3031-3053TACCCAAATTTTAATATTCCAGAUGGAAUAUUAAAAUUUGGGUACCCAAAUUUUAAUAUUCCAGAU15.411.332


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001UCACAGCAGAACUAACACA81.77850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882019TCACAGCAGAACTAACACATGTGTTAGTTCTGCTGTGA0.895600.474000.517200.500001.000001.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CAGGAGCCAGACACAUUUA92.9906115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841673CAGGAGCCAGACACATTTATAAATGTGTCTGGCTCCTG0.472700.050200.750000.750001.000001.00000


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614GCUCGUGUUUGACUAUGAA97.976320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712632GCTCGTGTTTGACTATGAATTCATAGTCAAACACGAGC0.126300.009600.681001.000001.000001.00000


Target Position: 3993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3993CAGCUAUCCAGUGACUUGU75.28911609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9914011CAGCTATCCAGTGACTTGTACAAGTCACTGGATAGCTG0.324000.014200.577600.500000.994601.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016GCCGCCAUCGCUUACACCA77.40061341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931034GCCGCCATCGCTTACACCATGGTGTAAGCGATGGCGGC0.728700.076200.655200.750000.913000.87500


Target Position: 2374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374CAACGUUUAUUACUAUGAU92.0305153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394GACAACGTTTATTACTATGATGAAUCAUAGUAAUAAACGUUGUCCAACGUUUAUUACUAUGAUGAU20.313.623


Target Position: 1657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657GGAGCCAGACACAUUUAUG81.5125883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221675GGAGCCAGACACATTTATGCATAAATGTGTCTGGCTCC0.176200.018600.715500.750001.000001.00000


Target Position: 2062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062CCAAGAAUCUAUCAUUUUG79.89351060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482080CCAAGAATCTATCATTTTGCAAAATGATAGATTCTTGG0.043200.032200.698300.750001.000001.00000


Target Position: 3944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3944CUUUAAUGGCUUCCCUCUU73.65961821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593962CTTTAATGGCTTCCCTCTTAAGAGGGAAGCCATTAAAG0.059300.010400.500000.750000.923901.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481ACGUUGCACCAACCCUCAU71.31622134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692499ACGTTGCACCAACCCTCATATGAGGGTTGGTGCAACGT0.195400.003700.620700.750000.923900.75000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CCACCUACAGAAAGUUUUC70.25762303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457456CCACCTACAGAAAGTTTTCGAAAACTTTCTGTAGGTGG0.359900.166100.672400.750000.962000.75000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574CCCAUCUUUGUGCCUCCUG56.28053947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661592CCCATCTTTGTGCCTCCTGCAGGAGGCACAAAGATGGG0.200500.006200.706900.750001.000001.00000


Target Position: 1942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942UCCAAAGCCUCAGGUCAUA72.91921935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531960TCCAAAGCCTCAGGTCATATATGACCTGAGGCTTTGGA0.062200.026800.827600.750000.994600.75000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170UAUAUAAUUUUUUAAAAAA91.7784164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913188TATATAATTTTTTAAAAAATTTTTTAAAAAATTATATA0.135200.049700.543100.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503CCCCAUCAGGCCUCCGUUU67.12652752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986521CCCCATCAGGCCTCCGTTTAAACGGAGGCCTGATGGGG0.178700.003400.991401.000000.934800.75000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444ACAGAAAGUUUUCCACCAA87.179399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762462ACAGAAAGTTTTCCACCAATTGGTGGAAAACTTTCTGT0.444900.240300.560300.750000.967400.75000


Target Position: 2537, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537GAUGAAAUUGGAAAUUUUA96.573436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732555GATGAAATTGGAAATTTTATAAAATTTCCAATTTCATC0.090700.005900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2535-2557CCGATGAAATTGGAAATTTTATTUAAAAUUUCCAAUUUCAUCGGGAUGAAAUUGGAAAUUUUAUUU-12.07.222


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3UGGCGUCGGAACUGCAAAG60.97523487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94721TGGCGTCGGAACTGCAAAGCTTTGCAGTTCCGACGCCA0.112100.027400.706900.500001.000001.00000


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525CCUGCCAAUCCCGAUGAAA79.24561127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402543CCTGCCAATCCCGATGAAATTTCATCGGGATTGGCAGG0.044900.016500.844801.000001.000001.00000


Target Position: 4596, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4596GCAAUCACUUUUUGGAAUU76.26641487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4594-4616CTGCAATCACTTTTTGGAATTGTAAUUCCAAAAAGUGAUUGCAGGCAAUCACUUUUUGGAAUUGUU20.120.502


Target Position: 3389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3389GCAUGACUAAUUUUUUAAA95.030161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823407GCATGACTAATTTTTTAAATTTAAAAAATTAGTCATGC0.759700.193600.853401.000001.000001.00000


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604CAUCAGCUGCCCAGAAAAU83.2449708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662622CATCAGCTGCCCAGAAAATATTTTCTGGGCAGCTGATG0.105200.028500.646600.750001.000001.00000


Target Position: 3966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3966UCUCCUGAGUAUGUAACUU73.35351877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6883984TCTCCTGAGTATGTAACTTAAGTTACATACTCAGGAGA0.115300.017600.586200.750001.000001.00000


Target Position: 4101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4101CCAAAGACAGAGCGGAACU73.70421815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6554119CCAAAGACAGAGCGGAACTAGTTCCGCTCTGTCTTTGG0.107500.051800.637900.750001.000001.00000


Target Position: 3051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051AGAAGAACAACUUUAGCAU83.9365647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193069AGAAGAACAACTTTAGCATATGCTAAAGTTGTTCTTCT0.241000.138900.569000.750001.000001.00000


Target Position: 4495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4495UUUAUUUAAAUGUGAAUUU64.50683057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9864513TTTATTTAAATGTGAATTTAAATTCACATTTAAATAAA0.198900.028300.500000.500001.000001.00000


Target Position: 2869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2869UCUGGGGAAAAAAAAGAGA67.92982655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892887TCTGGGGAAAAAAAAGAGATCTCTTTTTTTTCCCCAGA0.190900.005900.500000.500001.000001.00000


Target Position: 4309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4309CUGCUUUUGAUGAUGUCUA85.5573522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7574327CTGCTTTTGATGATGTCTATAGACATCATCAAAAGCAG0.114400.010000.612100.750001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425GCAUUUUGAAAACAGCAAA87.849361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171443GCATTTTGAAAACAGCAAATTTGCTGTTTTCAAAATGC0.180600.064700.853401.000001.000001.00000


Target Position: 3547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3547CAUUUUUUAAGAGACAGUU78.14881255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223565CATTTTTTAAGAGACAGTTAACTGTCTCTTAAAAAATG0.081600.058800.508600.750001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416ACAACGAUGGCAUUUUGAA83.8742654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441434ACAACGATGGCATTTTGAATTCAAAATGCCATCGTTGT0.150000.022700.534500.750001.000001.00000


Target Position: 2810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810GGGAAAUGCAGAAAUCACG72.13462028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782828GGGAAATGCAGAAATCACGCGTGATTTCTGCATTTCCC0.110500.013800.715500.500001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221UGUGUCCCUCUGCCUUUUU63.22653204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403239TGTGTCCCTCTGCCTTTTTAAAAAGGCAGAGGGACACA0.165500.006800.706900.750001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800GCCACAUACACUCUCUUCU79.32131119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272818GCCACATACACTCTCTTCTAGAAGAGAGTGTATGTGGC0.272700.129900.775900.750001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461CCAAGCAGCAGUACAUUCU76.59361428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361479CCAAGCAGCAGTACATTCTAGAATGTACTGCTGCTTGG0.087800.025600.620700.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GGCAUUUUGAAAACAGCAA84.571590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101442GGCATTTTGAAAACAGCAATTGCTGTTTTCAAAATGCC0.186000.045100.853401.000001.000001.00000


Target Position: 2378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378GUUUAUUACUAUGAUGAAG76.06451514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312396GTTTATTACTATGATGAAGCTTCATCATAGTAATAAAC0.154500.037100.508600.500001.000001.00000


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813UCACUCCUGAAUUCAGUUG55.30214026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863831TCACTCCTGAATTCAGTTGCAACTGAATTCAGGAGTGA0.038200.011700.577600.500000.907600.87500


Target Position: 3388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3388CGCAUGACUAAUUUUUUAA89.8601251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1013406CGCATGACTAATTTTTTAATTAAAAAATTAGTCATGCG0.753600.168800.887901.000001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627AAGGCCCAUUUCCUAAAAA79.3871112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
689645AAGGCCCATTTCCTAAAAATTTTTAGGAAATGGGCCTT0.657800.059600.637900.500000.962000.62500


Target Position: 3786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3786CCAGCCUCCAUGUUUUAAU76.49141450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1053804CCAGCCTCCATGTTTTAATATTAAAACATGGAGGCTGG0.600400.165500.836201.000001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938GGAAUCCAAAGCCUCAGGU69.61032407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921956GGAATCCAAAGCCTCAGGTACCTGAGGCTTTGGATTCC0.037100.027700.517200.750000.994600.75000


Target Position: 3095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095GAUUUUCUUAAGGAAUUUU80.13821029

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3093-3115CAGATTTTCTTAAGGAATTTTGTAAAAUUCCUUAAGAAAAUCUGGAUUUUCUUAAGGAAUUUUGUU14.25.322


Target Position: 4630, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4630CAGUUCAAGCUAUAUCGAA94.225881

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4628-4650GGCAGTTCAAGCTATATCGAATAUUCGAUAUAGCUUGAACUGCCCAGUUCAAGCUAUAUCGAAUAU17.819.203


Target Position: 4561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4561GUUUCUCAAGUGUUUUGGA81.9925825

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4559-4581CTGTTTCTCAAGTGTTTTGGAGAUCCAAAACACUUGAGAAACAGGUUUCUCAAGUGUUUUGGAGAU18.820.412


Target Position: 4393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4393UUCAAAAUUCCAAAUUUUU64.85153021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674411TTCAAAATTCCAAATTTTTAAAAATTTGGAATTTTGAA0.040100.020900.672400.500001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230CUGCCUUUUUUUUUUUUUU72.19292022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263248CTGCCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGGCAG0.742500.110600.784500.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733AGAAGCUGGCUGACAUGUA88.1105345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042751AGAAGCTGGCTGACATGTATACATGTCAGCCAGCTTCT0.228300.005200.543100.750001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446AGAAAGUUUUCCACCAAAG70.772221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
724464AGAAAGTTTTCCACCAAAGCTTTGGTGGAAAACTTTCT0.437000.259900.586200.500000.994601.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GCCCAUUUCCUAAAAACCU72.79231954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
600648GCCCATTTCCTAAAAACCTAGGTTTTTAGGAAATGGGC0.121800.041900.655200.750001.000001.00000


Target Position: 3683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3683GGUCUUGCUAUGUUGCCCA86.1071480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553701GGTCTTGCTATGTTGCCCATGGGCAACATAGCAAGACC0.060800.011000.508600.750000.951100.87500


Target Position: 3698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3698CCCAAGCUGGUCUUAAACU72.99321925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8443716CCCAAGCTGGTCTTAAACTAGTTTAAGACCAGCTTGGG0.178100.006700.784500.750000.940200.62500


Target Position: 2968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968CUUAUUUCUUAAAGCUUUU76.49361449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142986CTTATTTCTTAAAGCTTTTAAAAGCTTTAAGAAATAAG0.220500.120200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2966-2988GACTTATTTCTTAAAGCTTTTTTAAAAGCUUUAAGAAAUAAGUCCUUAUUUCUUAAAGCUUUUUUU17.02.111


Target Position: 4389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4389AAUAUUCAAAAUUCCAAAU74.20331749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964407AATATTCAAAATTCCAAATATTTGGAATTTTGAATATT0.199100.152300.500000.500001.000001.00000


Target Position: 2900, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900GCAGUUAGUAUAGCUUUAU82.8917742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2898-2920ATGCAGTTAGTATAGCTTTATACAUAAAGCUAUACUAACUGCAUGCAGUUAGUAUAGCUUUAUACU18.316.423


Target Position: 3148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148ACUCUAGUUCUGUUGUUUU80.31571014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2733166ACTCTAGTTCTGTTGTTTTAAAACAACAGAACTAGAGT0.415100.108600.706900.750001.000001.00000


Target Position: 3897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897GUCUUUGUCUGGCCACAUC70.68742238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303915GTCTTTGTCTGGCCACATCGATGTGGCCAGACAAAGAC0.046500.006400.637900.500000.962000.75000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577AUCUUUGUGCCUCCUGAAA74.39921735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941595ATCTTTGTGCCTCCTGAAATTTCAGGAGGCACAAAGAT0.127700.005900.681000.500001.000001.00000


Target Position: 623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GAAAAAGGCCCAUUUCCUA91.6224173

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
621-643ATGAAAAAGGCCCATTTCCTAAAUAGGAAAUGGGCCUUUUUCAUGAAAAAGGCCCAUUUCCUAAAU18.79.532


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955AGAAAAGUUUCGACUUAUU83.726663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582973AGAAAAGTTTCGACTTATTAATAAGTCGAAACTTTTCT0.187600.024300.715500.750001.000001.00000


Target Position: 2691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2691ACCAGGACUAUGACUACUU76.07561512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652709ACCAGGACTATGACTACTTAAGTAGTCATAGTCCTGGT0.082900.039200.715500.750001.000001.00000


Target Position: 3318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318UCCUCCCAGGCUCAAGCUA65.65552933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9363336TCCTCCCAGGCTCAAGCTATAGCTTGAGCCTGGGAGGA0.056100.004400.698300.750000.956500.62500


Target Position: 3611, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3611CACUGUAACCUCAAACUCU89.077288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453629CACTGTAACCTCAAACTCTAGAGTTTGAGGTTACAGTG0.236500.034000.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3609-3631CTCACTGTAACCTCAAACTCTGGAGAGUUUGAGGUUACAGUGAGCACUGUAACCUCAAACUCUGGU19.219.002


Target Position: 3542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542CCUGCCAUUUUUUAAGAGA80.6505978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123560CCTGCCATTTTTTAAGAGATCTCTTAAAAAATGGCAGG0.118200.072900.620700.750001.000001.00000


Target Position: 4589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4589CAACCCUGCAAUCACUUUU76.15961501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4764607CAACCCTGCAATCACTTTTAAAAGTGATTGCAGGGTTG0.194300.088400.646600.750001.000001.00000


Target Position: 3852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3852CUCUGAUGCAGAAAUUAUU84.3283611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833870CTCTGATGCAGAAATTATTAATAATTTCTGCATCAGAG0.054600.006900.801700.750000.907600.62500


Target Position: 3530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3530GCUCCCCAACUCCCUGCCA71.63252092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123548GCTCCCCAACTCCCTGCCATGGCAGGGAGTTGGGGAGC0.340000.060300.508600.750001.000001.00000


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907CCAGAACCUCGAACUAUAU87.5409377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6201925CCAGAACCTCGAACTATATATATAGTTCGAGGTTCTGG0.210100.018800.801701.000001.000001.00000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331UGGUCAAAGAGCCCUUACU70.58812258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852349TGGTCAAAGAGCCCTTACTAGTAAGGGCTCTTTGACCA0.071200.056100.637900.500000.951100.75000


Target Position: 3783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3783UGCCCAGCCUCCAUGUUUU72.2582015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3753801TGCCCAGCCTCCATGTTTTAAAACATGGAGGCTGGGCA0.419800.051100.853400.750001.000001.00000


Target Position: 2276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276CUUGCUUUGCUAAUUCUGA81.1852919

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2274-2296TTCTTGCTTTGCTAATTCTGATTUCAGAAUUAGCAAAGCAAGAACUUGCUUUGCUAAUUCUGAUUU12.018.621


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594GCCCCGCCUUAUGAUUCUC61.41573427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3432612GCCCCGCCTTATGATTCTCGAGAATCATAAGGCGGGGC0.254000.099700.689700.750001.000001.00000


Target Position: 4218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4218CUGAAAAUUCUGGAAGGAA85.6943512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8764236CTGAAAATTCTGGAAGGAATTCCTTCCAGAATTTTCAG0.056700.006500.612100.750001.000001.00000


Target Position: 3608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3608GCUCACUGUAACCUCAAAC69.78862377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763626GCTCACTGTAACCTCAAACGTTTGAGGTTACAGTGAGC0.194800.003600.706900.750001.000001.00000


Target Position: 2864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864GAGUUUCUGGGGAAAAAAA91.9842156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602882GAGTTTCTGGGGAAAAAAATTTTTTTCCCCAGAAACTC0.299800.003900.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884ATGAGTTTCTGGGGAAAAAAAAGUUUUUUUCCCCAGAAACUCAUGAGUUUCUGGGGAAAAAAAAGU0.717.701


Target Position: 3825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3825UCAGUUGCUUUGCCCAAGA69.70182397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753843TCAGTTGCTTTGCCCAAGATCTTGGGCAAAGCAACTGA0.143500.018100.500000.500001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CCGAUCAGAAUGACAACAA86.732432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
725900CCGATCAGAATGACAACAATTGTTGTCATTCTGATCGG0.292400.011200.767201.000001.000001.00000


Target Position: 4383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383ACCGAGAAUAUUCAAAAUU70.5872259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3204401ACCGAGAATATTCAAAATTAATTTTGAATATTCTCGGT0.517900.190700.844800.750001.000001.00000


Target Position: 4339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4339GGCUGAGCUGAACACAUUU88.2296336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5934357GGCTGAGCTGAACACATTTAAATGTGTTCAGCTCAGCC0.123000.041601.000001.000001.000001.00000


Target Position: 3392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392UGACUAAUUUUUUAAAUAU85.6485516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3603410TGACTAATTTTTTAAATATATATTTAAAAAATTAGTCA0.763500.437500.681000.750001.000001.00000


Target Position: 2598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598CGCCUUAUGAUUCUCUGCU74.12611757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762616CGCCTTATGATTCTCTGCTAGCAGAGAATCATAAGGCG0.080900.049700.569000.750001.000001.00000


Target Position: 2972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972UUUCUUAAAGCUUUUUUUU62.8033250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772990TTTCTTAAAGCTTTTTTTTAAAAAAAAGCTTTAAGAAA0.177000.095500.500000.500001.000001.00000


Target Position: 3534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534CCCAACUCCCUGCCAUUUU65.52582945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1143552CCCAACTCCCTGCCATTTTAAAATGGCAGGGAGTTGGG0.471700.282000.991401.000001.000001.00000


Target Position: 3394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3394ACUAAUUUUUUAAAUAUUU77.15241365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5903412ACTAATTTTTTAAATATTTAAATATTTAAAAAATTAGT0.288100.277600.706900.750001.000001.00000


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212UCACAGUCACUGACACCAA86.2868472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051230TCACAGTCACTGACACCAATTGGTGTCAGTGACTGTGA0.387700.089500.577600.750000.978301.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CCUACAGAAAGUUUUCCAC70.59082257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771459CCTACAGAAAGTTTTCCACGTGGAAAACTTTCTGTAGG0.386300.185500.551700.750000.967400.75000


Target Position: 3912, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912CAUCUUGACUAGGUAUUGU82.7758749

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3910-3932CACATCTTGACTAGGTATTGTCTACAAUACCUAGUCAAGAUGUGCAUCUUGACUAGGUAUUGUCUU20.020.422


Target Position: 522, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522CUGGAAUCCAAGCAGAAUU76.34921476

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1052219CTGGAATCCAAGCAGAATT1/1/0/094.96CDH1NM_004360.31NANANANA00CDH1(0.002)


Target Position: 2055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055ACCCAACCCAAGAAUCUAU76.08491510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252073ACCCAACCCAAGAATCTATATAGATTCTTGGGTTGGGT0.235500.068600.810300.750001.000001.00000


Target Position: 2970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2970UAUUUCUUAAAGCUUUUUU65.0443002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332988TATTTCTTAAAGCTTTTTTAAAAAAGCTTTAAGAAATA0.251600.146600.543100.500001.000001.00000


Target Position: 3915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3915CUUGACUAGGUAUUGUCUA84.3435610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3913-3935ATCTTGACTAGGTATTGTCTACTUAGACAAUACCUAGUCAAGAUCUUGACUAGGUAUUGUCUACUU19.220.333


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177AGGUGAGGGGUUAAGCACA83.4184699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411195AGGTGAGGGGTTAAGCACATGTGCTTAACCCCTCACCT0.160500.006100.637900.500001.000001.00000


Target Position: 3015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3015GGUGAUGUCCAAAAGAUAC79.36641117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693033GGTGATGTCCAAAAGATACGTATCTTTTGGACATCACC0.232700.009700.672400.750001.000001.00000


Target Position: 2611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611UCUGCUCGUGUUUGACUAU74.03641770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082629TCTGCTCGTGTTTGACTATATAGTCAAACACGAGCAGA0.162200.007900.681000.750001.000001.00000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811GCCCUAAUCAUAGCUACAG69.00742495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161829GCCCTAATCATAGCTACAGCTGTAGCTATGATTAGGGC0.302200.057300.715500.750000.956500.62500


Target Position: 3791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3791CUCCAUGUUUUAAUAUCAA91.1445195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4223809CTCCATGTTTTAATATCAATTGATATTAAAACATGGAG0.582000.359600.663800.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899CCCCCAUACCAGAACCUCG66.62052820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621917CCCCCATACCAGAACCTCGCGAGGTTCTGGTATGGGGG0.059500.044500.698300.500001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682CAGACAAAGACCAGGACUA92.5631131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312700CAGACAAAGACCAGGACTATAGTCCTGGTCTTTGTCTG0.333400.133300.612100.750001.000001.00000


Target Position: 3156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3156UCUGUUGUUUUGUGUAUAU77.11811370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3913174TCTGTTGTTTTGTGTATATATATACACAAAACAACAGA0.211800.075300.681000.750001.000001.00000


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329GGUGGUCAAAGAGCCCUUA84.9627567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382347GGTGGTCAAAGAGCCCTTATAAGGGCTCTTTGACCACC0.103000.004300.819001.000000.951100.75000


Target Position: 4111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4111AGCGGAACUAUGAAAAGUG71.36462123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7434129AGCGGAACTATGAAAAGTGCACTTTTCATAGTTCCGCT0.096200.020500.560300.500001.000001.00000


Target Position: 4571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4571UGUUUUGGAGAAAAAAAUC61.90883361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8594589TGTTTTGGAGAAAAAAATCGATTTTTTTCTCCAAAACA0.651600.011300.525900.500001.000001.00000


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377CGUUUAUUACUAUGAUGAA100.1059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632395CGTTTATTACTATGATGAATTCATCATAGTAATAAACG0.150800.026800.603401.000001.000001.00000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061CCCAAGAAUCUAUCAUUUU81.1396926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722079CCCAAGAATCTATCATTTTAAAATGATAGATTCTTGGG0.057100.044700.991401.000001.000001.00000


Target Position: 2994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2994UCCCAUCACUCUUUACAUG65.45982956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9133012TCCCATCACTCTTTACATGCATGTAAAGAGTGATGGGA0.102200.017200.715500.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546GGAAAUUUUAUUGAUGAAA86.6347444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772564GGAAATTTTATTGATGAAATTTCATCAATAAAATTTCC0.056400.022500.870701.000001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146CUACUCUAGUUCUGUUGUU80.45791001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663164CTACTCTAGTTCTGTTGTTAACAACAGAACTAGAGTAG0.324400.076600.525900.750001.000001.00000


Target Position: 3531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3531CUCCCCAACUCCCUGCCAU69.77272381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4473549CTCCCCAACTCCCTGCCATATGGCAGGGAGTTGGGGAG0.374500.271400.655200.750001.000001.00000


Target Position: 2260, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2260GAUUCUUGGAGGAAUUCUU86.5395454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2258-2280GGGATTCTTGGAGGAATTCTTGCAAGAAUUCCUCCAAGAAUCCCGAUUCUUGGAGGAAUUCUUGCU14.812.022


Target Position: 4458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4458GGGUAGGGGGUAGUGAGGA76.88241396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7114476GGGTAGGGGGTAGTGAGGATCCTCACTACCCCCTACCC0.093900.067300.620700.750001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020CCAUCGCUUACACCAUCCU73.14871898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661038CCATCGCTTACACCATCCTAGGATGGTGTAAGCGATGG0.238600.078300.500000.750000.945700.62500


Target Position: 2693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693CAGGACUAUGACUACUUGA89.4903271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452711CAGGACTATGACTACTTGATCAAGTAGTCATAGTCCTG0.086100.050600.560300.500001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435ACUCCACCUACAGAAAGUU72.38022006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765453ACTCCACCTACAGAAAGTTAACTTTCTGTAGGTGGAGT0.310600.168400.560300.750000.962000.62500


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056UCCCUGACAAAAAUAUGUU68.2412609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531074TCCCTGACAAAAATATGTTAACATATTTTTGTCAGGGA0.084000.026500.724100.750000.983700.62500


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948GCCUCAGGUCAUAAACAUC78.69541191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201966GCCTCAGGTCATAAACATCGATGTTTATGACCTGAGGC0.145600.011500.819000.750001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773GGGAGGAUUUUGAGCACGU80.08551034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7241791GGGAGGATTTTGAGCACGTACGTGCTCAAAATCCTCCC0.089900.029200.715500.750001.000001.00000


Target Position: 1437, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437CAGCAAAGGGCUUGGAUUU78.03421270

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3143719CAGCAAAGGGCTTGGATTT1/1/0/097.75CDH1NM_004360.31NANANA16:68847391,68849418..68847398,68849428(+)00CDH1(0.002)


Target Position: 3540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3540UCCCUGCCAUUUUUUAAGA67.75352675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243558TCCCTGCCATTTTTTAAGATCTTAAAAAATGGCAGGGA0.189000.108700.646600.500001.000001.00000


Target Position: 1494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494CGAAUGUGGUACCUUUUGA88.7529303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1492-1514GACGAATGTGGTACCTTTTGAGGUCAAAAGGUACCACAUUCGUCCGAAUGUGGUACCUUUUGAGGU16.120.533


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892UGACAACAAGCCCGAAUUC61.20773453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769910TGACAACAAGCCCGAATTCGAATTCGGGCTTGTTGTCA0.131000.079600.551700.500000.902200.62500


Target Position: 4777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4777CAUUUUUAUAAAUUUUAUU83.3637703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4824795CATTTTTATAAATTTTATTAATAAAATTTATAAAAATG0.448800.276600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4775-4797TGCATTTTTATAAATTTTATTAAAAUAAAAUUUAUAAAAAUGCACAUUUUUAUAAAUUUUAUUAAU-10.3-9.701


Target Position: 2651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651GCUAGUCUGAGCUCCCUGA85.2632545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072669GCTAGTCTGAGCTCCCTGATCAGGGAGCTCAGACTAGC0.094700.014400.629300.750000.983700.62500


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774GGAGGAUUUUGAGCACGUG77.38581344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911792GGAGGATTTTGAGCACGTGCACGTGCTCAAAATCCTCC0.076600.033100.577600.750001.000001.00000


Target Position: 4373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4373UGCACAGAAAACCGAGAAU71.18822152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4484391TGCACAGAAAACCGAGAATATTCTCGGTTTTCTGTGCA0.261100.055100.844800.750000.989101.00000


Target Position: 3806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3806UCAACUCUCACUCCUGAAU68.7962524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7493824TCAACTCTCACTCCTGAATATTCAGGAGTGAGAGTTGA0.084500.035400.715500.750000.972800.75000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523GCCCUGCCAAUCCCGAUGA69.17972466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232541GCCCTGCCAATCCCGATGATCATCGGGATTGGCAGGGC0.090600.024400.775900.750001.000001.00000


Target Position: 4107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4107ACAGAGCGGAACUAUGAAA85.8066506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3634125ACAGAGCGGAACTATGAAATTTCATAGTTCCGCTCTGT0.209000.084600.706900.750001.000001.00000


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241CCGAUCUUCAAUCCCACCA70.75882222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291259CCGATCTTCAATCCCACCATGGTGGGATTGAAGATCGG0.231500.019400.569000.750000.972800.75000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307ACACUGAAAGUGACUGAUG70.12192325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531325ACACTGAAAGTGACTGATGCATCAGTCACTTTCAGTGT0.041900.009900.551700.500000.934800.62500


Target Position: 4729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4729GGUGGAAAAGGAAAACAAU90.7022216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5854747GGTGGAAAAGGAAAACAATATTGTTTTCCTTTTCCACC0.126700.030800.844801.000001.000001.00000


Target Position: 1130, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130GAGAGUUUCCCUACGUAUA94.756665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431148GAGAGTTTCCCTACGTATATATACGTAGGGAAACTCTC0.240100.068700.767200.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1128-1150GAGAGAGTTTCCCTACGTATACCUAUACGUAGGGAAACUCUCUCGAGAGUUUCCCUACGUAUACCU16.217.723


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591ACAGCCCCGCCUUAUGAUU64.79533030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422609ACAGCCCCGCCTTATGATTAATCATAAGGCGGGGCTGT0.361000.025500.698300.750000.994600.75000


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222GUGUCCCUCUGCCUUUUUU76.35621475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023240GTGTCCCTCTGCCTTTTTTAAAAAAGGCAGAGGGACAC0.175400.030600.793100.750001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995CUCCCUUCACAGCAGAACU74.74281683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652013CTCCCTTCACAGCAGAACTAGTTCTGCTGTGAAGGGAG0.490000.191300.603400.500000.951100.62500


Target Position: 3527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3527CCAGCUCCCCAACUCCCUG62.63273273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633545CCAGCTCCCCAACTCCCTGCAGGGAGTTGGGGAGCTGG0.354000.032000.560300.750000.902200.75000


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674UGGAACAGAAAAUAACAUA82.6332760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701692TGGAACAGAAAATAACATATATGTTATTTTCTGTTCCA0.514400.296100.801700.750001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GCUGGACCGAGAGAGUUUC64.81573027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241138GCTGGACCGAGAGAGTTTCGAAACTCTCTCGGTCCAGC0.104800.007100.681000.750001.000001.00000


Target Position: 3023, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3023CCAAAAGAUACCCAAAUUU78.63641199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823041CCAAAAGATACCCAAATTTAAATTTGGGTATCTTTTGG0.599300.210000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3021-3043GTCCAAAAGATACCCAAATTTTAAAAUUUGGGUAUCUUUUGGACCCAAAAGAUACCCAAAUUUUAU11.312.222


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908CAGAACCUCGAACUAUAUU79.841069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441926CAGAACCTCGAACTATATTAATATAGTTCGAGGTTCTG0.170100.041600.775900.750001.000001.00000


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984UCCCAAUACAUCUCCCUUC57.18953874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8482002TCCCAATACATCTCCCTTCGAAGGGAGATGTATTGGGA0.279100.256000.698300.500001.000001.00000


Target Position: 1943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1943CCAAAGCCUCAGGUCAUAA87.0865407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461961CCAAAGCCTCAGGTCATAATTATGACCTGAGGCTTTGG0.063600.024400.810301.000001.000001.00000


Target Position: 4413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4413CUUAGGAGCAAGAAGAAAA90.1724239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6874431CTTAGGAGCAAGAAGAAAATTTTCTTCTTGCTCCTAAG0.099900.030400.637900.750001.000001.00000


Target Position: 2694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694AGGACUAUGACUACUUGAA89.4847272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412712AGGACTATGACTACTTGAATTCAAGTAGTCATAGTCCT0.087000.050400.672400.750001.000001.00000


Target Position: 2901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901CAGUUAGUAUAGCUUUAUA104.1473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2899-2921TGCAGTTAGTATAGCTTTATACTUAUAAAGCUAUACUAACUGCACAGUUAGUAUAGCUUUAUACUU13.617.633


Target Position: 4775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4775UGCAUUUUUAUAAAUUUUA75.74411551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5824793TGCATTTTTATAAATTTTATAAAATTTATAAAAATGCA0.509100.308700.819000.750001.000001.00000


Target Position: 4156, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4156CAUUGAGCCUGGCAAUUUA97.750122

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6415619CATTGAGCCTGGCAATTTA1/1/0/097.21CDH1NM_004360.31NANANA16:68868784..68868802(+)00CDH1(0.002)


Target Position: 4381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4381AAACCGAGAAUAUUCAAAA88.1683341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674399AAACCGAGAATATTCAAAATTTTGAATATTCTCGGTTT0.520500.174000.500000.500001.000001.00000


Target Position: 4455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4455GAGGGGUAGGGGGUAGUGA78.94871167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6814473GAGGGGTAGGGGGTAGTGATCACTACCCCCTACCCCTC0.174100.107000.586200.500001.000001.00000


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611UGCCCAGAAAAUGAAAAAG57.76563827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939629TGCCCAGAAAATGAAAAAGCTTTTTCATTTTCTGGGCA0.133200.005800.715500.500001.000001.00000


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105AGGAAUUUUGUCUCACUUU78.57421207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623123AGGAATTTTGTCTCACTTTAAAGTGAGACAAAATTCCT0.128900.015500.844800.750001.000001.00000


Target Position: 3519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519GCACCUGCCCAGCUCCCCA79.80481074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413537GCACCTGCCCAGCTCCCCATGGGGAGCTGGGCAGGTGC0.129400.040800.508600.750001.000001.00000


Target Position: 4578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4578GAGAAAAAAAUCAACCCUG74.46961719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8504596GAGAAAAAAATCAACCCTGCAGGGTTGATTTTTTTCTC0.137400.058900.525900.500001.000001.00000


Target Position: 3655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655CCUCCUUUUUAUUUUUUUG70.62212250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183673CCTCCTTTTTATTTTTTTGCAAAAAAATAAAAAGGAGG0.250200.102500.698300.750001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402CACAAAUCCAGUGAACAAC68.66852541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931420CACAAATCCAGTGAACAACGTTGTTCACTGGATTTGTG0.220800.063200.646600.500000.972800.62500


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590CACAGCCCCGCCUUAUGAU75.67831559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382608CACAGCCCCGCCTTATGATATCATAAGGCGGGGCTGTG0.360700.023200.612100.750000.994600.87500


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524CCCUGCCAAUCCCGAUGAA80.7966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562542CCCTGCCAATCCCGATGAATTCATCGGGATTGGCAGGG0.083900.021000.819001.000001.000001.00000


Target Position: 1997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997CCCUUCACAGCAGAACUAA82.3264788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862015CCCTTCACAGCAGAACTAATTAGTTCTGCTGTGAAGGG0.524900.274200.956901.000000.983700.87500


Target Position: 1358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GUAUACACCAUAUUGAAUG72.59161978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581376GTATACACCATATTGAATGCATTCAATATGGTGTATAC0.156100.039900.525900.500001.000001.00000


Target Position: 4311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4311GCUUUUGAUGAUGUCUACA86.3973464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8604329GCTTTTGATGATGTCTACATGTAGACATCATCAAAAGC0.060200.007600.646600.750001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UGAACAACGAUGGCAUUUU68.96792500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171431TGAACAACGATGGCATTTTAAAATGCCATCGTTGTTCA0.049400.015900.724100.750001.000001.00000


Target Position: 2874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2874GGAAAAAAAAGAGACUGGU75.65511560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002892GGAAAAAAAAGAGACTGGTACCAGTCTCTTTTTTTTCC0.098600.027600.517200.750001.000001.00000


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138GAAGUCAGCUACUCUAGUU92.9375118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673156GAAGTCAGCTACTCTAGTTAACTAGAGTAGCTGACTTC0.309700.016500.525900.750000.967400.62500


Target Position: 3459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459GCUCAAGUGAUCCUCCCAU81.5573879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6563477GCTCAAGTGATCCTCCCATATGGGAGGATCACTTGAGC0.107400.032100.698301.000000.972801.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647CCCACCAGCCUCCUUUUUA78.6891192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4243665CCCACCAGCCTCCTTTTTATAAAAAGGAGGCTGGTGGG0.177500.094500.956901.000001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680AGAAAAUAACAUAUCGGAU85.255546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961698AGAAAATAACATATCGGATATCCGATATGTTATTTTCT0.188600.162100.543100.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813CCUAAUCAUAGCUACAGAC75.73831555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8821831CCTAATCATAGCTACAGACGTCTGTAGCTATGATTAGG0.285800.147700.525900.750000.978300.62500


Target Position: 2753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2753GGAGGCGGCGAGGACGACU70.01112341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732771GGAGGCGGCGAGGACGACTAGTCGTCCTCGCCGCCTCC0.141800.003700.663800.750001.000001.00000


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652CAGCCUCCUUUUUAUUUUU81.6051874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1953670CAGCCTCCTTTTTATTTTTAAAAATAAAAAGGAGGCTG0.355100.119100.784500.750001.000001.00000


Target Position: 3144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144AGCUACUCUAGUUCUGUUG64.86923020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393162AGCTACTCTAGTTCTGTTGCAACAGAACTAGAGTAGCT0.195600.051400.706900.500001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613UGCUCGUGUUUGACUAUGA83.6601669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852631TGCTCGTGTTTGACTATGATCATAGTCAAACACGAGCA0.149200.005700.629300.500001.000001.00000


Target Position: 2969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2969UUAUUUCUUAAAGCUUUUU58.94513716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382987TTATTTCTTAAAGCTTTTTAAAAAGCTTTAAGAAATAA0.239100.133800.534500.500001.000001.00000


Target Position: 3028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3028AGAUACCCAAAUUUUAAUA84.9874562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4723046AGATACCCAAATTTTAATATATTAAAATTTGGGTATCT0.751800.467400.681000.750001.000001.00000


Target Position: 3789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3789GCCUCCAUGUUUUAAUAUC71.89872049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3653807GCCTCCATGTTTTAATATCGATATTAAAACATGGAGGC0.666400.266200.819000.750001.000001.00000


Target Position: 3654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654GCCUCCUUUUUAUUUUUUU75.60361567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1933672GCCTCCTTTTTATTTTTTTAAAAAAATAAAAAGGAGGC0.355600.150901.000001.000001.000001.00000


Target Position: 2063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063CAAGAAUCUAUCAUUUUGA90.835207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2061-2083CCCAAGAATCTATCATTTTGAAGUCAAAAUGAUAGAUUCUUGGGCAAGAAUCUAUCAUUUUGAAGU4.214.823


Target Position: 3106, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106GGAAUUUUGUCUCACUUUU84.4644599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623124GGAATTTTGTCTCACTTTTAAAAGTGAGACAAAATTCC0.130900.014500.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3104-3126AAGGAATTTTGTCTCACTTTTAAAAAAGUGAGACAAAAUUCCUUGGAAUUUUGUCUCACUUUUAAU19.20.412


Target Position: 4099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4099AGCCAAAGACAGAGCGGAA88.1487342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6274117AGCCAAAGACAGAGCGGAATTCCGCTCTGTCTTTGGCT0.113700.047500.681000.750000.923900.62500


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482CGUUGCACCAACCCUCAUG68.60262553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932500CGTTGCACCAACCCTCATGCATGAGGGTTGGTGCAACG0.129800.003200.620700.750000.923900.62500


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501AGUGUCCCCCGGUAUCUUC61.53123410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052519AGTGTCCCCCGGTATCTTCGAAGATACCGGGGGACACT0.050700.024700.534500.500001.000001.00000


Target Position: 3167, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167GUGUAUAUAAUUUUUUAAA92.4227135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793185GTGTATATAATTTTTTAAATTTAAAAAATTATATACAC0.128800.068800.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3165-3187TTGTGTATATAATTTTTTAAAAAUUUAAAAAAUUAUAUACACAAGUGUAUAUAAUUUUUUAAAAAU-9.18.211


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561UGUGAAUGAAGCCCCCAUC59.11743700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501579TGTGAATGAAGCCCCCATCGATGGGGGCTTCATTCACA0.079100.022200.525900.500000.972800.62500


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603CCAUCAGCUGCCCAGAAAA89.6687262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400621CCATCAGCTGCCCAGAAAATTTTCTGGGCAGCTGATGG0.188400.110900.844801.000001.000001.00000


Target Position: 4690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4690UACAUGUGUGGGUGCUGAU74.79211676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9904708TACATGTGTGGGTGCTGATATCAGCACCCACACATGTA0.134200.023400.500000.500001.000001.00000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694CGGAUUUGGAGAGACACUG66.50322831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901712CGGATTTGGAGAGACACTGCAGTGTCTCTCCAAATCCG0.076900.008700.629300.750001.000001.00000


Target Position: 1579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1579CUUUGUGCCUCCUGAAAAG72.89161940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951597CTTTGTGCCTCCTGAAAAGCTTTTCAGGAGGCACAAAG0.051100.005200.500000.500001.000001.00000


Target Position: 3382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3382CCACUACGCAUGACUAAUU84.0781637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3583400CCACTACGCATGACTAATTAATTAGTCATGCGTAGTGG0.213100.077100.836201.000000.989100.62500


Target Position: 4800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4800AAUUUUGUUAAACCAUAAA81.7561853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9324818AATTTTGTTAAACCATAAATTTATGGTTTAACAAAATT0.392500.063300.508600.500001.000001.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148AAGACCAAGUGACCACCUU73.43961864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9712166AAGACCAAGTGACCACCTTAAGGTGGTCACTTGGTCTT0.051900.046200.500000.500000.989100.62500


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839GGGAAUGCAGUUGAGGAUC63.86153129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
869857GGGAATGCAGTTGAGGATCGATCCTCAACTGCATTCCC0.058400.006500.810300.750001.000001.00000


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GACAACAAGCCCGAAUUCA80.5113994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913ATGACAACAAGCCCGAATTCACCUGAAUUCGGGCUUGUUGUCAUGACAACAAGCCCGAAUUCACCU16.719.322


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CCCAUUUCCUAAAAACCUG66.66692812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882649CCCATTTCCTAAAAACCTGCAGGTTTTTAGGAAATGGG0.054800.019600.706900.750001.000001.00000


Target Position: 1666, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666CACAUUUAUGGAACAGAAA90.1496242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031684CACATTTATGGAACAGAAATTTCTGTTCCATAAATGTG0.770600.128000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1664-1686GACACATTTATGGAACAGAAAATUUUCUGUUCCAUAAAUGUGUCCACAUUUAUGGAACAGAAAAUU19.26.922


Target Position: 2587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2587CCCCACAGCCCCGCCUUAU62.33143301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7022605CCCCACAGCCCCGCCTTATATAAGGCGGGGCTGTGGGG0.199100.012400.948301.000000.994601.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109ACUACAAAAUCAAUCUCAA93.451998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542127ACTACAAAATCAATCTCAATTGAGATTGATTTTGTAGT0.315500.215200.560300.750001.000001.00000


Target Position: 4438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4438CCUAAAGGGGGUUAGUUGA79.4891105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5914456CCTAAAGGGGGTTAGTTGATCAACTAACCCCCTTTAGG0.190100.043900.620700.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4436-4458GCCCTAAAGGGGGTTAGTTGAGGUCAACUAACCCCCUUUAGGGCCCUAAAGGGGGUUAGUUGAGGU11.815.823


Target Position: 3541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3541CCCUGCCAUUUUUUAAGAG67.9082659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5293559CCCTGCCATTTTTTAAGAGCTCTTAAAAAATGGCAGGG0.140600.091900.681000.750001.000001.00000


Target Position: 2866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2866GUUUCUGGGGAAAAAAAAG68.78842526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652884GTTTCTGGGGAAAAAAAAGCTTTTTTTTCCCCAGAAAC0.118400.003800.508600.500001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323GCCUAUUUUUCCCUCGACA84.2184622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906341GCCTATTTTTCCCTCGACATGTCGAGGGAAAAATAGGC0.050600.010300.793100.750001.000001.00000


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370GGGACAACGUUUAUUACUA99.054913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732388GGGACAACGTTTATTACTATAGTAATAAACGTTGTCCC0.103200.070300.819001.000001.000001.00000


Target Position: 4517, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4517CUUUUGACAAUCAAAGAAA87.4406382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6234535CTTTTGACAATCAAAGAAATTTCTTTGATTGTCAAAAG0.178700.028700.637900.750000.951100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4515-4537AACTTTTGACAATCAAAGAAAAGUUUCUUUGAUUGUCAAAAGUUCUUUUGACAAUCAAAGAAAAGU12.214.912


Target Position: 3034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034CCAAAUUUUAAUAUUCCAG69.88462363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603052CCAAATTTTAATATTCCAGCTGGAATATTAAAATTTGG0.547700.455000.560300.750001.000001.00000


Target Position: 4532, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4532GAAAAGACUUUUGUUGAAA90.2654232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4530-4552AAGAAAAGACTTTTGTTGAAATAUUUCAACAAAAGUCUUUUCUUGAAAAGACUUUUGUUGAAAUAU20.513.321


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318GGACAGCCUAUUUUUCCCU76.3621471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884336GGACAGCCTATTTTTCCCTAGGGAAAAATAGGCTGTCC0.075000.005900.525900.750001.000001.00000


Target Position: 3520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3520CACCUGCCCAGCUCCCCAA79.22621131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4623538CACCTGCCCAGCTCCCCAATTGGGGAGCTGGGCAGGTG0.169000.045800.646600.750001.000001.00000


Target Position: 3911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3911ACAUCUUGACUAGGUAUUG67.67472683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623929ACATCTTGACTAGGTATTGCAATACCTAGTCAAGATGT0.041000.003900.560300.500001.000001.00000


Target Position: 4112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4112GCGGAACUAUGAAAAGUGG69.89762360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244130GCGGAACTATGAAAAGTGGCCACTTTTCATAGTTCCGC0.046800.007100.577600.500001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566UCUGAAAGCGGCUGAUACU72.22072018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422584TCTGAAAGCGGCTGATACTAGTATCAGCCGCTTTCAGA0.044500.022900.517200.500001.000001.00000


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110CUACAAAAUCAAUCUCAAG79.68671082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142128CTACAAAATCAATCTCAAGCTTGAGATTGATTTTGTAG0.303100.201300.534500.500001.000001.00000


Target Position: 3223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223UGUCCCUCUGCCUUUUUUU66.4382841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123241TGTCCCTCTGCCTTTTTTTAAAAAAAGGCAGAGGGACA0.219000.127300.706900.750001.000001.00000


Target Position: 4570, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4570GUGUUUUGGAGAAAAAAAU78.881173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624588GTGTTTTGGAGAAAAAAATATTTTTTTCTCCAAAACAC0.668900.006300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4568-4590AAGTGTTTTGGAGAAAAAAATCAAUUUUUUUCUCCAAAACACUUGUGUUUUGGAGAAAAAAAUCAU-11.312.201


Target Position: 4587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4587AUCAACCCUGCAAUCACUU63.48813171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8014605ATCAACCCTGCAATCACTTAAGTGATTGCAGGGTTGAT0.184400.097400.543100.500001.000001.00000


Target Position: 3874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3874CUCUUUUAGGGUAAGAAGU70.44882276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3872-3894GGCTCTTTTAGGGTAAGAAGTTTACUUCUUACCCUAAAAGAGCCCUCUUUUAGGGUAAGAAGUUUU11.77.132


Target Position: 4632, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4632GUUCAAGCUAUAUCGAAUA89.8465253

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4463219GTTCAAGCTATATCGAATA1/1/0/097.75CDH1NM_004360.31NANANA16:68869261..68869279(+)00CDH1(0.002)


Target Position: 3991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3991GGCAGCUAUCCAGUGACUU76.761408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7944009GGCAGCTATCCAGTGACTTAAGTCACTGGATAGCTGCC0.083200.008600.862101.000000.994600.75000


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924CUCCACUUUAUAGCUCUAA77.66241311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892942CTCCACTTTATAGCTCTAATTAGAGCTATAAAGTGGAG0.125100.039100.775900.750001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682AAAAUAACAUAUCGGAUUU79.16251142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871700AAAATAACATATCGGATTTAAATCCGATATGTTATTTT0.127700.084000.500000.500001.000001.00000


Target Position: 4270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4270AUCCGUGGUUUGUACUCAA86.685438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9204288ATCCGTGGTTTGTACTCAATTGAGTACAAACCACGGAT0.051300.004800.534500.500001.000001.00000


Target Position: 2865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865AGUUUCUGGGGAAAAAAAA79.88121062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172883AGTTTCTGGGGAAAAAAAATTTTTTTTCCCCAGAAACT0.137500.011600.706900.750001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598UCCUCCCAUCAGCUGCCCA65.32722971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857616TCCTCCCATCAGCTGCCCATGGGCAGCTGATGGGAGGA0.150600.071100.525900.500001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768GGACAGGGAGGAUUUUGAG77.79741296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311786GGACAGGGAGGATTTTGAGCTCAAAATCCTCCCTGTCC0.243900.004500.560300.750001.000001.00000


Target Position: 1356, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356CUGUAUACACCAUAUUGAA97.001931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451374CTGTATACACCATATTGAATTCAATATGGTGTATACAG0.110200.058800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1354-1376GGCTGTATACACCATATTGAATGUUCAAUAUGGUGUAUACAGCCCUGUAUACACCAUAUUGAAUGU8.715.833


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410CAGUGAACAACGAUGGCAU88.3712329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851428CAGTGAACAACGATGGCATATGCCATCGTTGTTCACTG0.038300.009900.629300.750001.000001.00000


Target Position: 3958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3958CUCUUUCAUCUCCUGAGUA88.2147338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903976CTCTTTCATCTCCTGAGTATACTCAGGAGATGAAAGAG0.098800.076900.629300.750000.972800.87500


Target Position: 4659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4659UGUAGAGAAUGUCACUGUA92.3499138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8694677TGTAGAGAATGTCACTGTATACAGTGACATTCTCTACA0.147700.013000.525900.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414GAACAACGAUGGCAUUUUG80.9666939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531432GAACAACGATGGCATTTTGCAAAATGCCATCGTTGTTC0.065300.017400.525900.500001.000001.00000


Target Position: 4378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4378AGAAAACCGAGAAUAUUCA84.4583600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9704396AGAAAACCGAGAATATTCATGAATATTCTCGGTTTTCT0.269200.187800.500000.500001.000001.00000


Target Position: 4481, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4481GAUUUGGAUCUCUUUUUAU91.1018196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9354499GATTTGGATCTCTTTTTATATAAAAAGAGATCCAAATC0.066700.004400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4479-4501TTGATTTGGATCTCTTTTTATTTAUAAAAAGAGAUCCAAAUCAAGAUUUGGAUCUCUUUUUAUUUU-3.820.122


Target Position: 2960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960AGUUUCGACUUAUUUCUUA87.8386362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022978AGTTTCGACTTATTTCTTATAAGAAATAAGTCGAAACT0.272700.068500.672400.750001.000001.00000


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066GCAUCAGAAGGUUCACCCA91.1497194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193084GCATCAGAAGGTTCACCCATGGGTGAACCTTCTGATGC0.057800.009700.508600.750000.929300.75000


Target Position: 3784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3784GCCCAGCCUCCAUGUUUUA83.07721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3393802GCCCAGCCTCCATGTTTTATAAAACATGGAGGCTGGGC0.539700.060700.965501.000001.000001.00000


Target Position: 4792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4792UAUUAAACAAUUUUGUUAA83.5501681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9834810TATTAAACAATTTTGTTAATTAACAAAATTGTTTAATA0.097000.078600.508600.500000.994600.75000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239CUCCGAUCUUCAAUCCCAC70.79542216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631257CTCCGATCTTCAATCCCACGTGGGATTGAAGATCGGAG0.269600.018900.517200.500000.972801.00000


Target Position: 3875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3875UCUUUUAGGGUAAGAAGUU69.52532418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643893TCTTTTAGGGTAAGAAGTTAACTTCTTACCCTAAAAGA0.059200.013000.577600.750001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572CCCCCAUCUUUGUGCCUCC61.26543445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201590CCCCCATCTTTGTGCCTCCGGAGGCACAAAGATGGGGG0.146800.007200.620700.500001.000001.00000


Target Position: 4382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4382AACCGAGAAUAUUCAAAAU84.4132602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8244400AACCGAGAATATTCAAAATATTTTGAATATTCTCGGTT0.517700.166000.637900.500001.000001.00000


Target Position: 2586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2586ACCCCACAGCCCCGCCUUA69.77262382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272604ACCCCACAGCCCCGCCTTATAAGGCGGGGCTGTGGGGT0.181400.011200.819000.750000.994600.87500


Target Position: 2486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2486GCACCAACCCUCAUGAGUG78.80331179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562504GCACCAACCCTCATGAGTGCACTCATGAGGGTTGGTGC0.109600.031700.560300.750000.902200.62500


Target Position: 3606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606UAGCUCACUGUAACCUCAA78.58841203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883624TAGCTCACTGTAACCTCAATTGAGGTTACAGTGAGCTA0.120300.003300.525900.500000.956500.62500


Target Position: 4015, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4015GAGUAAGUGUGUUCAUUAA104.4592

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2401519GAGTAAGTGTGTTCATTAA1/1/0/0100.00CDH1NM_004360.31NANANA16:68868643..68868661(+)00CDH1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7464033GAGTAAGTGTGTTCATTAATTAATGAACACACTTACTC0.171300.010400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4013-4035CTGAGTAAGTGTGTTCATTAATGUUAAUGAACACACUUACUCAGGAGUAAGUGUGUUCAUUAAUGU8.917.622


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CACUGACACCAACGAUAAU89.4202273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091237CACTGACACCAACGATAATATTATCGTTGGTGTCAGTG0.234900.104400.784500.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625AAAAGGCCCAUUUCCUAAA76.96791385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958643AAAAGGCCCATTTCCTAAATTTAGGAAATGGGCCTTTT0.594600.045300.500000.500000.962000.75000


Target Position: 2139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139ACCAGAAUAAAGACCAAGU71.94272046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882157ACCAGAATAAAGACCAAGTACTTGGTCTTTATTCTGGT0.324000.068400.646600.500001.000001.00000


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521CCGCCCUGCCAAUCCCGAU67.9882649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822539CCGCCCTGCCAATCCCGATATCGGGATTGGCAGGGCGG0.079000.030300.732801.000001.000001.00000


Target Position: 3812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812CUCACUCCUGAAUUCAGUU78.97241164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273830CTCACTCCTGAATTCAGTTAACTGAATTCAGGAGTGAG0.046600.012900.663800.750000.907600.75000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023UCGCUUACACCAUCCUCAG61.77943374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101041TCGCTTACACCATCCTCAGCTGAGGATGGTGTAAGCGA0.109000.071800.508600.500001.000001.00000


Target Position: 4730, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4730GUGGAAAAGGAAAACAAUU80.14041028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5404748GTGGAAAAGGAAAACAATTAATTGTTTTCCTTTTCCAC0.138200.036300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4728-4750GGGTGGAAAAGGAAAACAATTCAAAUUGUUUUCCUUUUCCACCCGUGGAAAAGGAAAACAAUUCAU5.320.101


Target Position: 2330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330GUGGUCAAAGAGCCCUUAC63.60363155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842348GTGGTCAAAGAGCCCTTACGTAAGGGCTCTTTGACCAC0.085800.006600.612100.500000.951100.75000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883CGAUCAGAAUGACAACAAG87.5153378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
837901CGATCAGAATGACAACAAGCTTGTTGTCATTCTGATCG0.245500.006900.655200.750001.000001.00000


Target Position: 4369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4369GGUGUGCACAGAAAACCGA85.4211530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7504387GGTGTGCACAGAAAACCGATCGGTTTTCTGTGCACACC0.399000.025100.560300.750000.989100.62500


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973GCAGACCUUCCUCCCAAUA82.0382822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421991GCAGACCTTCCTCCCAATATATTGGGAGGAAGGTCTGC0.699600.133000.810301.000000.972800.75000


Target Position: 1913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1913CCUCGAACUAUAUUCUUCU83.3295705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391931CCTCGAACTATATTCTTCTAGAAGAATATAGTTCGAGG0.404000.031300.620700.750000.983700.62500


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GCCAAGCAGCAGUACAUUC72.36112011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051478GCCAAGCAGCAGTACATTCGAATGTACTGCTGCTTGGC0.093400.008100.827600.750000.989100.62500


Target Position: 3159, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3159GUUGUUUUGUGUAUAUAAU87.4318385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5383177GTTGTTTTGTGTATATAATATTATATACACAAAACAAC0.152100.071100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3157-3179CTGTTGTTTTGTGTATATAATTTAUUAUAUACACAAAACAACAGGUUGUUUUGUGUAUAUAAUUUU-5.95.622


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CGGACGAUGAUGUGAACAC74.90241661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161008CGGACGATGATGTGAACACGTGTTCACATCATCGTCCG0.069400.004900.620700.750001.000001.00000


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514AUCUUCCCCGCCCUGCCAA61.5933405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172532ATCTTCCCCGCCCTGCCAATTGGCAGGGCGGGGAAGAT0.374500.089800.534500.500000.989100.62500


Target Position: 4805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4805UGUUAAACCAUAAAAAAAA83.8721655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5054823TGTTAAACCATAAAAAAAATTTTTTTTATGGTTTAACA0.455500.118600.706900.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536CGAUGAAAUUGGAAAUUUU95.097858

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2534-2556CCCGATGAAATTGGAAATTTTATAAAAUUUCCAAUUUCAUCGGGCGAUGAAAUUGGAAAUUUUAUU0.416.333


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985CCCAAUACAUCUCCCUUCA82.3136790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2632003CCCAATACATCTCCCTTCATGAAGGGAGATGTATTGGG0.285300.255700.767200.750001.000001.00000


Target Position: 3020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3020UGUCCAAAAGAUACCCAAA85.6869514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713038TGTCCAAAAGATACCCAAATTTGGGTATCTTTTGGACA0.566600.196300.706900.750001.000001.00000


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141GUCAGCUACUCUAGUUCUG70.29212298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113159GTCAGCTACTCTAGTTCTGCAGAACTAGAGTAGCTGAC0.132700.026300.534500.500001.000001.00000


Target Position: 3158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3158UGUUGUUUUGUGUAUAUAA91.4992178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4603176TGTTGTTTTGTGTATATAATTATATACACAAAACAACA0.164700.075400.672400.750001.000001.00000


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278UGCUUUGCUAAUUCUGAUU68.90492508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792296TGCTTTGCTAATTCTGATTAATCAGAATTAGCAAAGCA0.516100.271400.844800.750001.000001.00000


Target Position: 4726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4726GGGGGUGGAAAAGGAAAAC61.76153379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6264744GGGGGTGGAAAAGGAAAACGTTTTCCTTTTCCACCCCC0.129100.018300.844800.750001.000001.00000


Target Position: 3022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022UCCAAAAGAUACCCAAAUU72.96511931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503040TCCAAAAGATACCCAAATTAATTTGGGTATCTTTTGGA0.601600.201100.862100.750001.000001.00000


Target Position: 4569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4569AGUGUUUUGGAGAAAAAAA86.6488443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8974587AGTGTTTTGGAGAAAAAAATTTTTTTCTCCAAAACACT0.196600.005400.706900.750001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776AGGAUUUUGAGCACGUGAA82.3043792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181794AGGATTTTGAGCACGTGAATTCACGTGCTCAAAATCCT0.049200.047200.672400.750001.000001.00000


Target Position: 4733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4733GAAAAGGAAAACAAUUCAA92.0523150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614751GAAAAGGAAAACAATTCAATTGAATTGTTTTCCTTTTC0.266900.059600.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4731-4753TGGAAAAGGAAAACAATTCAAGCUUGAAUUGUUUUCCUUUUCCAGAAAAGGAAAACAAUUCAAGCU13.818.702


Target Position: 4784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4784AUAAAUUUUAUUAAACAAU73.60031838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8694802ATAAATTTTATTAAACAATATTGTTTAATAAAATTTAT0.262000.172900.534500.500001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371GGACAACGUUUAUUACUAU98.766715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322389GGACAACGTTTATTACTATATAGTAATAAACGTTGTCC0.112700.057600.827601.000001.000001.00000


Target Position: 4271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4271UCCGUGGUUUGUACUCAAA78.25021239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434289TCCGTGGTTTGTACTCAAATTTGAGTACAAACCACGGA0.046200.004300.870700.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CCAAAGUCACGCUGAAUAC73.65791822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
873477CCAAAGTCACGCTGAATACGTATTCAGCGTGACTTTGG0.057000.037000.663800.750001.000001.00000


Target Position: 3818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3818CCUGAAUUCAGUUGCUUUG68.60912551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743836CCTGAATTCAGTTGCTTTGCAAAGCAACTGAATTCAGG0.067600.005900.698300.750000.907600.62500


Target Position: 3888, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3888GAAGUUUGUGUCUUUGUCU84.8928572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3886-3908AAGAAGTTTGTGTCTTTGTCTGGAGACAAAGACACAAACUUCUUGAAGUUUGUGUCUUUGUCUGGU19.210.332


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CAAAGGACAGCCUAUUUUU85.2843541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
887332CAAAGGACAGCCTATTTTTAAAAATAGGCTGTCCTTTG0.053900.009200.646600.750000.983700.87500


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950CUCAGGUCAUAAACAUCAU85.0583557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431968CTCAGGTCATAAACATCATATGATGTTTATGACCTGAG0.110200.020600.655200.750001.000001.00000


Target Position: 2683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683AGACAAAGACCAGGACUAU84.0406640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3572701AGACAAAGACCAGGACTATATAGTCCTGGTCTTTGTCT0.299700.099900.681000.750001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CCCAUACCAGAACCUCGAA83.0078731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001919CCCATACCAGAACCTCGAATTCGAGGTTCTGGTATGGG0.303300.047100.819001.000001.000001.00000


Target Position: 4013, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013CUGAGUAAGUGUGUUCAUU82.2514798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9224031CTGAGTAAGTGTGTTCATTAATGAACACACTTACTCAG0.144300.004800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4011-4033TTCTGAGTAAGTGTGTTCATTAAAAUGAACACACUUACUCAGAACUGAGUAAGUGUGUUCAUUAAU20.520.322


Target Position: 3458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3458GGCUCAAGUGAUCCUCCCA90.1858237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913476GGCTCAAGTGATCCTCCCATGGGAGGATCACTTGAGCC0.124500.044600.655200.750000.967400.62500


Target Position: 3659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3659CUUUUUAUUUUUUUGUACA84.3944604

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3657-3679TCCTTTTTATTTTTTTGTACAGAUGUACAAAAAAAUAAAAAGGACUUUUUAUUUUUUUGUACAGAU14.7-9.721


Target Position: 3785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3785CCCAGCCUCCAUGUUUUAA77.00351382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2003803CCCAGCCTCCATGTTTTAATTAAAACATGGAGGCTGGG0.583300.100100.956901.000001.000001.00000


Target Position: 4798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4798ACAAUUUUGUUAAACCAUA84.3638607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4284816ACAATTTTGTTAAACCATATATGGTTTAACAAAATTGT0.364700.071100.663800.750001.000001.00000


Target Position: 312, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312GACAAAGGACAGCCUAUUU85.8399504

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_931219GACAAAGGACAGCCTATTT1/1/0/094.96CDH1NM_004360.31NANANANA00CDH1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
752330GACAAAGGACAGCCTATTTAAATAGGCTGTCCTTTGTC0.103500.010200.819000.750000.956500.62500


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673AUGGAACAGAAAAUAACAU75.8311541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851691ATGGAACAGAAAATAACATATGTTATTTTCTGTTCCAT0.511700.146200.500000.500001.000001.00000


Target Position: 4691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4691ACAUGUGUGGGUGCUGAUA81.2054916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8544709ACATGTGTGGGTGCTGATATATCAGCACCCACACATGT0.062100.016500.663800.750001.000001.00000


Target Position: 2059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2059AACCCAAGAAUCUAUCAUU83.1136713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962077AACCCAAGAATCTATCATTAATGATAGATTCTTGGGTT0.098300.091300.637900.500001.000001.00000


Target Position: 4725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4725UGGGGGUGGAAAAGGAAAA71.1692153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6864743TGGGGGTGGAAAAGGAAAATTTTCCTTTTCCACCCCCA0.168400.013200.844800.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777GGAUUUUGAGCACGUGAAG73.91721787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761795GGATTTTGAGCACGTGAAGCTTCACGTGCTCAAAATCC0.039300.035200.732800.750001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982CACAGACGCGGACGAUGAU83.6414671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571000CACAGACGCGGACGATGATATCATCGTCCGCGTCTGTG0.044600.003900.612100.750000.994600.62500


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912ACCUCGAACUAUAUUCUUC72.04282037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571930ACCTCGAACTATATTCTTCGAAGAATATAGTTCGAGGT0.429700.049600.681000.500000.967400.62500


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983CUCCCAAUACAUCUCCCUU79.13741143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322001CTCCCAATACATCTCCCTTAAGGGAGATGTATTGGGAG0.289400.268300.672400.750001.000001.00000


Target Position: 1223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223GACACCAACGAUAAUCCUC70.70852235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151241GACACCAACGATAATCCTCGAGGATTATCGTTGGTGTC0.198600.151000.508600.500001.000001.00000


Target Position: 2599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2599GCCUUAUGAUUCUCUGCUC75.92221528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792617GCCTTATGATTCTCTGCTCGAGCAGAGAATCATAAGGC0.056100.038800.689700.750001.000001.00000


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226CCCUCUGCCUUUUUUUUUU74.55541706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1843244CCCTCTGCCTTTTTTTTTTAAAAAAAAAAGGCAGAGGG0.715700.106800.991401.000001.000001.00000


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142UCAGCUACUCUAGUUCUGU68.39712583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273160TCAGCTACTCTAGTTCTGTACAGAACTAGAGTAGCTGA0.171100.028900.517200.500001.000001.00000


Target Position: 3526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3526CCCAGCUCCCCAACUCCCU59.97243603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733544CCCAGCTCCCCAACTCCCTAGGGAGTTGGGGAGCTGGG0.420000.029800.646600.750000.902200.87500


Target Position: 2539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539UGAAAUUGGAAAUUUUAUU71.45172113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872557TGAAATTGGAAATTTTATTAATAAAATTTCCAATTTCA0.077900.011000.715500.750001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758GGAUGGCUGAAGGUGACAG74.181751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832776GGATGGCTGAAGGTGACAGCTGTCACCTTCAGCCATCC0.373200.007000.586200.750000.989100.62500


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334CCUCGACACCCGAUUCAAA93.3358102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730352CCTCGACACCCGATTCAAATTTGAATCGGGTGTCGAGG0.088500.015600.844801.000000.951100.75000


Target Position: 1492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492GACGAAUGUGGUACCUUUU84.2652619

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1490-1512GTGACGAATGTGGTACCTTTTGAAAAAGGUACCACAUUCGUCACGACGAAUGUGGUACCUUUUGAU18.621.132


Target Position: 2927, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927CACUUUAUAGCUCUAAUAA97.148529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7292945CACTTTATAGCTCTAATAATTATTAGAGCTATAAAGTG0.088500.053700.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2925-2947TCCACTTTATAGCTCTAATAAGTUUAUUAGAGCUAUAAAGUGGACACUUUAUAGCUCUAAUAAGUU8.44.633


Target Position: 4772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4772AGAUGCAUUUUUAUAAAUU83.8561657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2484790AGATGCATTTTTATAAATTAATTTATAAAAATGCATCT0.403400.201000.715500.750001.000001.00000


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GCUGCCCAGAAAAUGAAAA81.4735887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
643627GCTGCCCAGAAAATGAAAATTTTCATTTTCTGGGCAGC0.273900.016000.853401.000001.000001.00000


Target Position: 2980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2980AGCUUUUUUUUUUUUCCCA75.77551547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952998AGCTTTTTTTTTTTTCCCATGGGAAAAAAAAAAAAGCT0.215200.010600.508600.500001.000001.00000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071UGUUCACCAUUAACAGGAA88.0452352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881089TGTTCACCATTAACAGGAATTCCTGTTAATGGTGAACA0.053900.007800.534500.750000.994600.75000


Target Position: 3910, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3910CACAUCUUGACUAGGUAUU74.20821747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753928CACATCTTGACTAGGTATTAATACCTAGTCAAGATGTG0.333000.003600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3908-3930GCCACATCTTGACTAGGTATTGTAAUACCUAGUCAAGAUGUGGCCACAUCUUGACUAGGUAUUGUU19.819.232


Target Position: 2875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2875GAAAAAAAAGAGACUGGUU86.6763440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622893GAAAAAAAAGAGACTGGTTAACCAGTCTCTTTTTTTTC0.092000.087800.525900.750001.000001.00000


Target Position: 4731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4731UGGAAAAGGAAAACAAUUC60.2893567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8964749TGGAAAAGGAAAACAATTCGAATTGTTTTCCTTTTCCA0.178900.042300.672400.500001.000001.00000


Target Position: 2612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612CUGCUCGUGUUUGACUAUG61.93613355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122630CTGCTCGTGTTTGACTATGCATAGTCAAACACGAGCAG0.158000.006300.629300.500001.000001.00000


Target Position: 4315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4315UUGAUGAUGUCUACAGAAA81.6372871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8704333TTGATGATGTCTACAGAAATTTCTGTAGACATCATCAA0.057900.012600.646600.500001.000001.00000


Target Position: 4017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4017GUAAGUGUGUUCAUUAAUG78.97181165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8554035GTAAGTGTGTTCATTAATGCATTAATGAACACACTTAC0.129700.013700.525900.500001.000001.00000


Target Position: 4663, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4663GAGAAUGUCACUGUAGUUU80.7176964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4154681GAGAATGTCACTGTAGTTTAAACTACAGTGACATTCTC0.181600.044600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4661-4683TAGAGAATGTCACTGTAGTTTTGAAACUACAGUGACAUUCUCUAGAGAAUGUCACUGUAGUUUUGU19.019.202


Target Position: 3945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3945UUUAAUGGCUUCCCUCUUU63.923125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813963TTTAATGGCTTCCCTCTTTAAAGAGGGAAGCCATTAAA0.062400.009700.500000.500000.923901.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357UGUAUACACCAUAUUGAAU82.0799815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6491375TGTATACACCATATTGAATATTCAATATGGTGTATACA0.109300.050900.698300.750001.000001.00000


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056CCCAACCCAAGAAUCUAUC58.61173746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3852074CCCAACCCAAGAATCTATCGATAGATTCTTGGGTTGGG0.196300.192900.810300.750001.000001.00000


Target Position: 4482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4482AUUUGGAUCUCUUUUUAUU79.48911104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944500ATTTGGATCTCTTTTTATTAATAAAAAGAGATCCAAAT0.084000.004600.500000.500001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800GCACGUACACAGCCCUAAU87.9699356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391818GCACGTACACAGCCCTAATATTAGGGCTGTGTACGTGC0.087400.021300.844801.000001.000001.00000


Target Position: 3548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548AUUUUUUAAGAGACAGUUU73.45551863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093566ATTTTTTAAGAGACAGTTTAAACTGTCTCTTAAAAAAT0.073400.041400.508600.500001.000001.00000


Target Position: 3535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3535CCAACUCCCUGCCAUUUUU77.90381282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773553CCAACTCCCTGCCATTTTTAAAAATGGCAGGGAGTTGG0.554700.273700.844801.000001.000001.00000


Target Position: 4767, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4767CUCAAAGAUGCAUUUUUAU80.6496979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5404785CTCAAAGATGCATTTTTATATAAAAATGCATCTTTGAG0.485800.041700.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4765-4787TTCTCAAAGATGCATTTTTATAAAUAAAAAUGCAUCUUUGAGAACUCAAAGAUGCAUUUUUAUAAU-9.720.402


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051UGAGCUCCCUGACAAAAAU78.0251272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721069TGAGCTCCCTGACAAAAATATTTTTGTCAGGGAGCTCA0.568800.003700.715500.750001.000001.00000


Target Position: 3381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3381ACCACUACGCAUGACUAAU74.43921727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4233399ACCACTACGCATGACTAATATTAGTCATGCGTAGTGGT0.177900.064900.844800.750000.983700.62500


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972UGCAGACCUUCCUCCCAAU76.16761499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841990TGCAGACCTTCCTCCCAATATTGGGAGGAAGGTCTGCA0.733600.146400.844800.750000.940200.75000


Target Position: 3029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3029GAUACCCAAAUUUUAAUAU82.8524745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233047GATACCCAAATTTTAATATATATTAAAATTTGGGTATC0.728400.469700.637900.750001.000001.00000


Target Position: 4791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4791UUAUUAAACAAUUUUGUUA79.22031134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9804809TTATTAAACAATTTTGTTATAACAAAATTGTTTAATAA0.100100.078900.500000.500000.994600.62500


Target Position: 4768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4768UCAAAGAUGCAUUUUUAUA82.6231762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3804786TCAAAGATGCATTTTTATATATAAAAATGCATCTTTGA0.481300.229600.681000.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384GGCCUCUACGGUUUCAUAA88.6417311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877402GGCCTCTACGGTTTCATAATTATGAAACCGTAGAGGCC0.074400.005800.965501.000000.945700.75000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437UCCACCUACAGAAAGUUUU62.18983319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566455TCCACCTACAGAAAGTTTTAAAACTTTCTGTAGGTGGA0.358800.155500.870700.750000.962000.75000