siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 411   880   881   882  
Biltr, Sidirect 851  
Biltr, Ernai, Rnaxs 225   843   844   872   878  
Biltr, Rnaxs, Sidirect 181   190   401   402  
Biltr, Rnaxs 60   62   63   98   99   100   101   102   103   106   107   108   109   132   133   134   135   137   138   140  
141   142   155   164   165   170   171   173   175   178   179   180   182   183   185   186   188   191   192   195  
226   227   234   239   240   244   245   246   247   248   249   250   251   252   257   258   259   260   281   282  
299   313   314   315   316   317   318   319   335   365   370   371   391   392   395   396   397   398   399   400  
407   408   409   410   413   420   423   459   460   461   462   463   464   465   466   467   468   470   471   472  
473   474   477   478   479   482   484   485   486   487   500   501   502   503   504   505   506   507   508   510  
511   512   513   514   534   535   536   537   589   590   591   592   593   594   626   627   628   629   630   649  
650   651   709   757   758   759   760   761   762   763   764   765   766   767   768   771   800   811   819   821  
822   823   824   825   826   827   828   831   836   837   838   840   842   845   846   847   848   849   873   874  
875   876   877   879   883   884   885   886   887   888   889   890   891   892   893   894   895   896   897   898  
Biltr, Ernai 272  


Target Position: 164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164ACCUCCUCUGCCUGCCCGA63.8674505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173182ACCTCCTCTGCCTGCCCGATCGGGCAGGCAGAGGAGGT0.313000.004100.560300.500001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760GAGACCACAGAGAGCACAG76.9526204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167778GAGACCACAGAGAGCACAGCTGTGCTCTCTGTGGTCTC0.277300.045900.525900.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CGGCACCUGGAGCUGAAAG65.1964471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205607CGGCACCTGGAGCTGAAAGCTTTCAGCTCCAGGTGCCG0.136700.001300.775900.750000.972800.75000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800CCUCCGACUCAGCCUCCUA87.083553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212818CCTCCGACTCAGCCTCCTATAGGAGGCTGAGTCGGAGG0.017100.001000.672401.000001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GUGAAGUGGAGCCCAAAUA83.877285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163521GTGAAGTGGAGCCCAAATATATTTGGGCTCCACTTCAC0.430200.006500.750000.750000.989101.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CCCCAUCCCCUCCUCACCC49.3656775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186844CCCCATCCCCTCCTCACCCGGGTGAGGAGGGGATGGGG0.196100.212200.500000.500001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CUCUAUUCCAACACCCUCA82.22123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162490CTCTATTCCAACACCCTCATGAGGGTGTTGGAATAGAG0.276200.029500.586200.500001.000001.00000


Target Position: 411, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411GAACUUCAAUGCCAAAUAU92.264816

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_941119GAACTTCAATGCCAAATAT1/0/1/090.92ARD1ANM_003491.21NANANAX:153197792..153197810(-)00ARD1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115429GAACTTCAATGCCAAATATATATTTGGCATTGAAGTTC0.200600.101300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
409-431GAGAACTTCAATGCCAAATATGTAUAUUUGGCAUUGAAGUUCUCGAACUUCAAUGCCAAAUAUGUU12.819.212


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281UGGCCAAAAUGGAAGAGGA80.3016153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212299TGGCCAAAATGGAAGAGGATCCTCTTCCATTTTGGCCA0.012500.001700.474100.500001.000001.00000


Target Position: 99, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
99CCCCGCCGCCGUUAUGAAC56.2876659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186117CCCCGCCGCCGTTATGAACGTTCATAACGGCGGCGGGG0.395100.002800.844800.750000.967400.87500


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CUAUUCCAACACCCUCAAC65.4816462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155492CTATTCCAACACCCTCAACGTTGAGGGTGTTGGAATAG0.217000.077500.525900.500001.000001.00000


Target Position: 872, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872GUGGCACUGGGAAAAAAAA86.932355

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_287219GTGGCACTGGGAAAAAAAA1/0/1/094.96ARD1ANM_003491.21NANANANA10ARD1A(0.002)&FAM195B(0.029)&HDGFRP3(0.029)&MCTP2(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182890GTGGCACTGGGAAAAAAAATTTTTTTTCCCAGTGCCAC0.997000.003200.793100.750001.000001.00000


Target Position: 896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
896AAAAAAAAAAAAAAAAAAA83.5835105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176914AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999600.500000.500001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245CUGAGGACGAGAAUGGGAA83.2748111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131263CTGAGGACGAGAATGGGAATTCCCATTCTCGTCCTCAG0.143200.024000.612100.750001.000001.00000


Target Position: 463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463GCCCUGCACCUCUAUUCCA83.729788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96481GCCCTGCACCTCTATTCCATGGAATAGAGGTGCAGGGC0.267100.075200.655200.750001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627GCUGGGUGCCAUCGAGAAC68.4436396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184645GCTGGGTGCCATCGAGAACGTTCTCGATGGCACCCAGC0.131100.003000.706900.750000.983700.75000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873UGGCACUGGGAAAAAAAAA74.2545254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56891TGGCACTGGGAAAAAAAAATTTTTTTTTCCCAGTGCCA0.997000.183800.844800.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GAGCCUGCCCCAUCCCCUC62.0897557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190837GAGCCTGCCCCATCCCCTCGAGGGGATGGGGCAGGCTC0.874100.188500.500000.500000.994600.62500


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891AAAAAAAAAAAAAAAAAAA83.5835100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205909AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999400.500000.500001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259GGGAAGAUUGUGGGGUAUG66.7625428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187277GGGAAGATTGTGGGGTATGCATACCCCACAATCTTCCC0.041500.045200.836200.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GAAGUGGAGCCCAAAUACU83.1192113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212523GAAGTGGAGCCCAAATACTAGTATTTGGGCTCCACTTC0.331700.008800.465500.500000.989101.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886AAAAAAAAAAAAAAAAAAA83.583595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182904AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999000.500000.500001.000001.00000


Target Position: 881, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881GGAAAAAAAAAAAAAAAAA90.192230

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_588119GGAAAAAAAAAAAAAAAAA1/0/1/091.19WBSCR22&SETNM_017528.2&NM_001122821.1+NM_003011.32&2+2RCN3&KDM4A&TEX264&TMEM216&VAMP2&LOC100288977&POLR2G&HERC1&DGCR8&PARVG&LOC728431&TK1&ZBTB42&DOC2A&RPL31P11&GFOD2&VIL1&TMEM151A&EIF6&RGMB&CYBA&C9orf142&NCF1B&HAS3&PCMTD2&MBNL2&MTA2&AGFG1&APOBEC3D&RHPN1&SLC39A4&EGFL8&NTSR1&EPHA3&HS3ST3A1&FNDC4&MFAP4&KIF7&RABIF&FAM195B&ATXN7L2&CNNM1&IP6K2&ANKRD13B&C17orf74&CDRT1&CCS&FHL3&ZDHHC1&ASAP1IT1&PRKCZ&COMMD4&TPD52L2&DDX28&FBXL6&DPYSL2&PAPD5&RBCK1&MAP3K3&PCDH1&SASH1&LRRN2&PTCD3&PCOLCE&NFASC&CXCR1&SLC12A3&CLCA4&FBP2&DDOST&FAHD1&SLC44A3&CHM&PRDX6&HMHA1&DDX19B&MAPKAPK5&DGKG&FAAH2&ZFP91&TCP10L&NME2&NEUROD2&MFGE8&CLDN4&ASPRV1&C1orf26&MAP3K7IP2&DHH&PHLDB3&FAM22A&RPL29&TMEM86A&RPS20&GPC5&CNIH2&MRM1&LYSMD4&PGF&SAG&RGS3&HN1L&LOC100287186&SLC25A46&HIC1&SNX27&SARS2&TMEM127&NFATC1&SAMD12&ADAMTS1&ACAT1&SLC18A3&LOC654433&ZNF83&ANLN&HIBCH&LILRB3&ZNF37B&PRR16&CHRNA5&ZNF669&TRIM7&THAP10&TUBB4&LOC100291863&SLC16A7&ZNF23&LOC100288956&THSD7A&PUSL1&ATP8B2&GALNT6&LEPREL2&SLFN12&LOC100133315&THOC4&C1orf174&NDRG1&LOC100128822&SP1&RTF1&PAQR6&C19orf43&CTDSP2&TMEM159&LPGAT1&BRMS1&SAMD14&PIK3CA&MAP1D&NKX3-1&ETNK2&NR4A1&LOC100131354&ST6GALNAC4&TAF7L&MRAP&TRIM31&C9orf37&NPB&SYT13&MRPL55&NPHS2&ACTRT2&SLC1A4&PI4KA&ENY2&ZNF574&LOC100294416&NDUFS8&REXO4&ZC3H3&NDUFA8&YEATS2&SLC35B2&LLGL2&CYP27A1&APOOL&LOC644613&PRG2&PIGQ&VAX2&GPATCH3&IPO8&QRICH2&RPL34&LOC254559&GMPPA&DENND1A&SNX19&STAT5B&PRPF8&NEU4&LOC100130581&TNXB&ZNF692&LOC92659&ZNHIT1&METT11D1&RSRC1&SP140&PTRF&HLA-DRA&C15orf57&SLC35E1&RNF39&MYL7&GPSM3&LOC728661&ALG1L&NCKAP1L&LOC388789&PPP2R2A&EMP3&RCSD1&ZNF331&PRR15&LOC100292658&COMMD7&DDX39&FYB&UNC93A&CCHCR1&KRTAP24-1&EFNB2&COMP&SRP72&TMEM35&C7orf38&ABHD3&NME1-NME2&GMFG&KIAA1549&ARD1A&SLC30A1&C3orf47&GZMB&SENP7&ATG10&GATAD2A&FAM156A&CDC42EP5&MICAL3&CAPS2&CPEB1&CPSF7&CD300LB&WASH5P&CCDC56&FOXS1&NACC2&QKI&ELMO1&ZNF467&DIO2&C15orf39&UXS1&ABHD8&TGOLN2&FGFR3&FOLR1&MYOT&FSCB&CMTM4&LOC732160&DPP9&KDELC1&SETDB2&DBH&SEZ6&PRDM4&LEMD2&CLEC3B&ISL2&STAP2&TECR&LOC338588&RRP9&RAB26&TMEM231&PRRT4&MED21&HTR3C&ACAD10&C16orf57&SPEM1&LRRC59&OTUD5&TXNDC9&LYL1&GALNT14&C3orf45&MED12&CHMP1A&RCC2&CNIH4&MTTP&MPV17&DST&PNPLA6&C9orf125&OGG1&ST3GAL4&NCKIPSD&MTA1&SFRS12&KIAA1012&LPIN3&TIMELESS&PBRM1&RUNX2&ZER1&GGA1&EMR1&ARFGAP3&LRRC8B&RPA3&C2orf63&GPC2&NLRP4&LRRN3&SH2D2A&PGM2L1&DNAJC7&H2AFV&E2F2&ZNF747&SGCD&PTGES2&ZDHHC14&TMEM108&TMEM198&RASGRP4&FAM83F&PRAC&RGS9&IFI16&DDX59&KRT19&PCBD1&SCN3A&IPO11&SLC30A5&LAMB3&KIAA1984&PDE9A&GDPD2&NUDT16P&IL10RA&BAI2&LOC100289081&CD151&CLDN9&FAM13AOS&PET117&DDX42&NENF&TTC13&GJB5&STAT2&RNF113A&AP2M1&RPUSD1&RNH1&OXNAD1&RLTPR&C6orf145&ZNF236&SLC34A3&FAM122C&LOC100288778&MRPL21&RBMX&TMEM213&VANGL2&GALE&ACAP2&TBC1D10B&MEIS1&DPCR1&JPH2&ACCN1&LOC100291035&CPSF3&ALS2CL&NECAB2&CD248&TMEM219&ATP6V0A1&HARS&C9orf69&DRAP1&BOLA2&C19orf42&GATAD1&HBS1L&PTBP2&GPATCH8&RNF19B&JAK3&LOC646851&LYPD2&ARHGDIA&SH3BP1&TMEM186&SCNN1A&SIGLEC16&C5orf46&XKR7&LDHA&VWA5B2&NPM2&CD207&OSBPL3&RBM7&B4GALT2&PRKCH&LOC645769&TTC5&CDKN2C&RCVRN&ADCY4&HELZ&C10orf140&TNFRSF1A&RTKN&TEX9&FOXP1&CLEC4G&COL6A3&PDILT&ATN1&SFTPD&FAM131C&LOC100129138&C7orf20&LOC285375&TLX1&GNS&INPP1&LOC100291242&DPEP3&SPCS2&AZI2&NUAK2&PEX26&PEX19&CAP1&KIF2C&SEZ6L2&H2AFB3&GPM6B&HRNBP3&CDC42EP2&BLZF1&CLDN1&ZNF362&MICALL2&ZNF259&FIS1&ACD&TSPAN33&SOX11&SIX1&MOBKL2A&WDR4&CDC26&FRAT2&NHLH1&INCA1&PPP1R16A&POMGNT1&VGF&TPPP&SLCO5A1&FAM160B2&PSMD2&HIST2H2BF&TUB&DEDD2&PLEKHO2&CHCHD5&NUDT22&GIPC1&WASH3P&GPX4&MRPL23&ST3GAL5&NTN5&CCDC85B&CPT1C&DVL1&PRMT1&EXOSC6&AMDHD2&TAF15&SORBS3&MKL1&CRYBG3&TBC1D29&SDK2&SRRT&PMEPA1&HOXD9&COL11A1&GPR68&RAPSN&NFATC3&RAMP3&PPIA&ESRRB&HNRNPH2&ARHGAP26&SNHG7&PTX3&LOC100287950&WNT5B&KLF10&PDE1B&PCBD2&ITGB2&FTSJ3&WDR13&MLLT11&PRAP1&UTP14A&TXNL4A&ERI2&PCTK3&HPGD&NCRNA00201&APOL1&GART&ENPP2&MFAP3L&SETBP1&PRPF40B&PNMA3&SCARB1&CES7&TGFB1&DCUN1D2&ALG11&GPR182&LOC389168&TBX6&METTL3&DHX34&TRPS1&ARPC1A&GCN1L1&HMGA1&COX19&BNC2&SERPINA3&RUFY1&ZFYVE19&TXNDC12&MFI2&MEIS3&RPL23AP7&LOC641518&FOXE3&TOMM22&LOC100292164&PTH1R&IRF9&ULBP1&APBB1IP&C4orf26&LOC100128292&NF2&ZNF444&CALHM2&POLR3C&SLC9A3R2&CRISPLD2&C19orf44&ZFAND2B&GP2&DGCR2&WNT10B&SAMD4B&WNT7B&RPAP1&PEX6&CEBPE&GLI4&ALDOA&SMAP2&LPCAT1&APOL3&C3orf75&SRRM2&PARS2&POU2F2&PBX2&GDPD1&TSPY4&ABTB1&MATN4&GPM6A&MYBBP1A&FBXL19&TXNIP&COQ2&COBRA1&ARGLU1&CCND3&B9D2&DOT1L&FKBP2&LRRC3B&HYAL2&RRAGB&POLD4&RPP30&TMEM206&AOC2&ZNF358&VEGFB&C21orf67&RAD51L1&GOLPH3L&PSTPIP2&TMEM100&C14orf101<B4R&FLJ44606&SF1&TTC30A&MAPK8IP1&CDC2L2&PPAN&C19orf50&SLCO1C1&AMTN&IL11RA&PSPH&FAM165B&STEAP1&HMSD&KLF3&DUSP23&RNF169&MAGEF1&RXRBNM_020650.2&NM_014663.2&NM_001129884.1+NM_015926.4+NR_024012.1&NM_016499.3&NM_014232.2&XM_002343168.1+XM_002347331.1&NM_002696.2&NM_003922.3&NM_022720.5&NM_001137605.1+NM_001137606.1+NM_022141.5+NR_024428.1+NR_024427.1+NR_024426.1&XM_001716728.2+XM_001127447.2+XM_001132105.2&NM_003258.4&NM_001137601.1&NM_003586.2&NR_002595.1&NM_030819.3+NR_027398.1+NR_027399.1&NM_007127.2&NM_153266.3&NM_181466.1+NM_002212.2+NM_181468.1&NM_001012761.2&NM_000101.2&NM_183241.1&NR_003186.1&NM_138612.1+NM_005329.2&NM_001104925.1+NM_018257.2&NM_144778.2+NM_207304.1&NM_004739.2&NM_001135189.1+NM_001135187.1+NM_001135188.1+NM_004504.4&NM_152426.3&NM_052924.2&NM_130849.2+NM_017767.2&NM_030652.2&NM_002531.2&NM_005233.5+NM_182644.2&NM_006042.1&NM_022823.2&NM_002404.1&NM_198525.2&NM_002871.3&NM_001093767.1+NM_207368.3&NM_153340.4&NM_020348.2&NM_001005910.1+NM_001005911.1+NM_001146178.1+NR_027438.1+NM_001146179.1+NR_027437.1+NM_001005909.1+NM_016291.2&NM_152345.4&NM_175734.4&NM_006382.3&NM_005125.1&NM_004468.3&NM_013304.2&NR_002765.2&NM_001033581.1+NM_001033582.1+NM_002744.4&NM_017828.3&NM_199363.1+NM_199362.1+NM_003288.2+NM_199359.1+NM_199361.1+NM_199360.1&NM_018380.3&NM_012162.1+NM_024555.3&NM_001386.4&NM_001040284.2+NM_001040285.2&NM_031229.2+NM_006462.4&NM_203351.1+NM_002401.3&NM_002587.3+NM_032420.2&NM_015278.3&NM_006338.2+NM_201630.1&NM_017952.5&NM_002593.3&NM_001160331.1+NM_001005388.2+NM_015090.3+NM_001160332.1+NM_001160333.1+NM_001005389.1&NM_000634.2&NM_000339.2+NM_001126107.1+NM_001126108.1&NR_024602.1+NM_012128.3&NM_003837.2&NM_005216.4&NM_001018104.2+NM_001142398.1+NM_031208.3&NM_152369.3+NM_001114106.1&NM_001145414.1+NM_000390.2&NM_004905.2&NM_012292.2&NM_001014449.1+NM_007242.4+NM_001014451.1&NM_139078.1+NM_003668.2&NM_001080745.1+NM_001346.2+NM_001080744.1&NM_174912.3&NM_053023.3&NM_144659.5&NM_001018139.1+NM_001018138.1+NM_001018137.1+NM_002512.2&NM_006160.3&NM_001114614.1+NM_005928.2&NM_001305.3&NM_152792.2&NM_001105518.1+NM_017673.6&NM_015093.3&NM_021044.2&NM_198850.3&NM_001099338.1&NM_000992.2&NM_153347.1&NM_001023.3+NM_001146227.1&NM_004466.4&NM_182553.1&NM_024864.3&NM_152449.2&NM_002632.4&NM_000541.4&NM_017790.3+NM_144488.4+NM_144489.2+NM_134427.1+NM_021106.3+NM_130795.2&NM_144570.2&XM_002342539.1+XM_002346717.1&NM_138773.1&NM_001098202.1+NM_006497.3&NM_030918.5&NM_001145901.1+NM_017827.3&NM_017849.1&NM_006162.3+NM_172388.1+NM_172387.1+NM_172389.1+NM_172390.1&NM_001101676.1+NM_207506.2&NM_006988.3&NM_000019.3&NM_003055.2&NR_015377.1&NM_001105550.1+NM_001105549.1+NM_001105552.1+NM_001105551.1+NM_018300.3+NM_001105553.1+NR_003936.1+NM_001105554.1&NM_018685.2&NM_014362.2+NM_198047.1&NM_001081450.1+NM_006864.2&NR_026777.1&NM_016644.1&NM_000745.2&NM_024804.2+NM_001142572.1&NM_203297.1+NM_203293.1+NM_203295.1+NM_203296.1+NM_203294.1+NM_033342.2&NM_020147.2&NM_006087.2&XM_002345839.1&NM_004731.3&NM_145911.1&XM_002342810.1&NM_015204.2&NM_153339.1&NM_001005855.1+NM_020452.3&NM_007210.3&NM_014262.3&NM_018042.3&NR_029192.1&NM_005782.3&NM_207356.2&NM_001135242.1+NM_006096.3&NR_027387.1+XR_079573.1+XR_079498.1+XR_079530.1+XR_079586.1&NM_003109.1+NM_138473.2&NM_015138.4&NM_198406.1+NM_024897.2&NM_024038.2&NM_005730.3&NM_020422.4&NM_014873.2&NM_015399.3+NM_001024957.1&NM_174920.2&NM_006218.2&NM_199227.1&NM_006167.3&NM_018208.2&NM_002135.3+NM_173157.1&XM_001718006.2+XM_001719406.1&NM_175039.3+NM_175040.3&NM_024885.2&NM_178817.3+NM_206898.1&NM_007028.3&NM_032937.4&NM_148896.3&NM_020826.2&NM_181464.2+NM_181454.2+NM_181463.2+NM_181455.2+NM_181462.2+NM_181465.2+NM_181456.2+NM_181441.2&NM_014625.2&NM_080431.4&NM_001135581.1+NM_003038.3&NM_002650.2+NM_058004.2&NM_020189.4&NM_022752.5&XM_002347851.1&NM_002496.2&NM_020385.2&NM_015117.2&NM_014222.2&NM_018023.4&NM_178148.2&NM_001015002.1+NM_001031803.1+NM_004524.2&NM_000784.3&NM_198450.3&XM_002344580.1+XM_002343111.1&NM_002728.4&NM_148920.1+NM_004204.2&NM_012476.2&NM_022078.2&NM_006390.2&NM_032134.1&NM_033625.2+NM_000995.3&NR_015411.1&NM_013335.2+NM_205847.1&NM_024820.2+NM_020946.1&NM_014758.2&NM_012448.3&NM_006445.3&NM_001167599.1+NM_080741.2+NM_001167602.1+NM_001167601.1+NM_001167600.1&NR_027412.1+NR_027413.2&NM_032470.3+NM_019105.6&NM_017865.2+NM_001136036.1&NR_015454.1&NM_006349.2&NM_022734.2+NM_001029991.1&NM_016625.2&NM_001005176.2+NM_007237.4&NM_012232.5&NM_019111.3&NM_052849.2+NM_001080792.1+NM_001080791.1&NM_024881.4&NM_025236.2+NM_170769.1&NM_021223.2&NM_022107.1&NM_001110781.1&NM_001015050.1&NM_005337.4&NR_015432.1&NM_002717.2&NM_001425.2&NM_052862.3&NM_018555.5+NM_001079906.1+NM_001079907.1&NM_175887.2&XM_002344670.1&NM_053041.2+NM_001099339.1&NM_005804.2&NM_001465.3+NM_199335.2&NM_018974.3+NM_001143947.1&NM_001105564.1+NM_001105563.1+NM_019052.3&NM_001085455.1&NM_004093.2&NM_000095.2&NM_006947.3&NM_021637.2&NM_145111.2&NM_138340.4&NM_001018136.1&NM_004877.2&NM_020910.2+NM_001164665.1&NM_003491.2&NM_021194.2&NR_026991.1&NM_004131.4&NM_020654.3+NM_001077203.1&NM_031482.4+NM_001131028.1&NM_017660.3&NM_014138.3&NM_145057.2&NM_001136004.1+NM_001122731.1+NM_015241.2&NM_032606.3&NM_030594.3+NM_001079535.1+NM_001079533.1+NM_001079534.1&NM_001142565.1+NM_024811.3+NM_001136040.2&NM_174892.2&NR_024540.1&NM_001040431.1&NM_004118.3&NM_144653.3&NM_006775.1+NM_206854.1+NM_206853.1+NM_206855.1&NM_001039459.1+NM_014800.9+NM_130442.2&NM_207336.1&NM_000793.4+NM_013989.3+NM_001007023.2&NM_015492.4&NM_025076.3&NM_024527.4&NM_006464.2&NM_001163213.1+NM_022965.3+NM_000142.4&NM_016725.2+NM_016724.2+NM_000802.3+NM_016729.2&NM_001135940.1+NM_006790.2&NM_032135.3&NM_178818.2+NM_181521.2&XM_002346479.1&NM_139159.4&NM_024089.2&NM_031915.2+NM_001160308.1&NM_000787.3&NM_178860.4+NM_001098635.1&NM_012406.3&NM_181336.3+NM_001143944.1&NM_003278.2&NM_145805.1&NM_017720.2+NM_001013841.1&NM_138501.4&NR_015425.1&NM_004704.3&NM_014353.4&NM_001077416.1+NM_001077418.1+NM_001077419.1&NM_001114726.1&NM_004264.3&NM_130770.2&NM_001136538.1+NM_025247.5&NM_024598.2&NM_199339.2&NM_018509.2&NM_001136158.1+NM_001136159.1+NM_017602.3+NM_001136157.1&NM_005783.3&NM_005583.3&NM_024572.2&NM_153215.1&NM_005120.2&NM_002768.2+NM_001083314.1&NM_018715.2+NM_001136204.1&NM_014184.2&NM_000253.2&NM_002437.4&NM_001144771.1+NM_001144770.1+NM_001144769.1+NM_020388.3+NM_015548.3+NM_001723.4+NM_183380.2&NM_001166112.1+NM_001166113.1+NM_001166114.1+NM_001166111.1+NM_006702.4&NM_032342.1&NM_002542.5+NM_016820.3+NM_016819.3+NM_016829.2+NM_016828.2+NM_016827.2+NM_016821.2+NM_016826.2&NM_006278.1&NM_016453.2+NM_184231.1&NM_004689.3&NM_001077199.1+NM_139168.2&NM_014939.3&NM_022896.1&NM_003920.3&NM_018165.4+NM_018313.4+NM_181042.3&NM_001024630.3+NM_001015051.3+NM_004348.3&NM_006336.2&NM_001001560.1+NM_013365.3+NM_001001561.1&NM_001974.3&NM_001142293.1+NM_014570.4&NM_001134476.1+NM_015350.2&NM_002947.3&NM_152385.2+NM_001135598.1&NM_152742.1&NM_134444.4&NM_018334.4+NM_001099658.1+NM_001099660.1&NM_001161444.1+NM_001161442.1+NM_003975.3+NM_001161443.1+NM_001161441.1&NM_173582.3&NM_001144766.2+NR_029431.1+NM_003315.3&NM_138635.3+NM_201517.2+NM_201516.2+NM_201436.2+NM_012412.4&NM_004091.2&NM_023931.2&NM_000337.5+NM_001128209.1+NM_172244.2&NR_027812.1+NM_025072.5+NR_027811.1&NM_024630.2+NM_153746.1&NM_023943.2+NM_001136469.1&NM_001005209.1&NM_001146205.1+NM_001146206.1+NM_001146203.1+NM_001146207.1+NM_001146202.1+NM_170604.2+NM_001146204.1&NM_138435.2&NM_032391.2&NM_003835.3+NM_001081955.2+NM_001165933.1&NM_005531.2&NM_001031725.4&NM_002276.4&NM_000281.2&NM_001081677.1+NM_006922.3+NM_001081676.1&NM_016338.4+NM_001134779.1&NM_022902.2+NM_024055.2&NM_001127641.1+NM_001017402.1+NM_000228.2&NM_001039374.3&NM_001001582.1+NM_001001576.1+NM_001001575.1+NM_001001579.1+NM_001001585.1+NM_001001573.1+NM_001001577.1+NM_001001572.1+NM_001001581.1+NM_001001584.2+NM_001001578.1+NM_001001567.1+NM_002606.2+NM_001001580.1+NM_001001574.1+NM_001001583.1+NM_001001568.1+NM_001001570.1+NM_001001571.1+NM_001001569.1&NM_017711.2&NR_027766.1+NR_002949.2&NR_026691.1+NM_001558.3&NM_001703.2&XM_002342045.1&NM_139030.3+NM_001039490.1+NM_139029.1+NM_004357.4&NM_020982.3&NR_002806.2&NM_001164811.1&NM_007372.2+NM_203499.1&NM_013349.4+NR_026598.1&NM_024525.3+NM_001122835.1&NM_005268.2&NM_005419.2&NM_006978.2&NM_004068.3+NM_001025205.1&NM_058192.2&NM_203383.1+NM_203385.1+NM_203387.1+NM_203386.1+NM_203388.1+NM_203389.1+NM_002939.3+NM_203384.1&NM_138381.2&NM_001013838.1&NM_183373.3&NM_007345.3&NM_080877.2&NM_138819.2&NR_028269.1&NM_181514.1+NM_181515.1&NM_001164803.1+NM_002139.3+NR_028477.1+NR_028476.1&NM_001085429.1&NM_020335.1&NM_001127621.1+NM_001008216.1+NM_000403.3&NM_012287.4&NM_015527.3&NM_002398.2&NM_080870.3&NM_020433.4+NM_175913.3&NM_001094.4+NM_183377.1&XM_002346962.1&NM_016207.2&NM_147129.2+NM_182775.1&NM_019065.2&NM_020404.2&NM_194280.3+NM_001083613.1&NM_001130021.1+NM_001130020.1+NM_005177.3&NM_002109.3&NM_152833.2&NM_006442.3&NM_001031827.1&NM_024104.3&NM_021167.3&NM_001145158.1+NM_006620.3+NM_001145207.1&NM_021190.2&NM_001002909.1&NM_153341.2+NM_001127361.1&NM_000215.3&NM_001013647.1&NM_205545.1&NM_004309.3&NM_018957.3&NM_015421.3&NM_001038.5+NM_001159575.1+NM_001159576.1&NR_002825.1&NM_206966.2&NM_001011718.1&NM_001165414.1+NM_001135239.1+NM_001165415.1+NM_005566.3+NM_001165416.1+NR_028500.1&NM_138345.1&NM_182795.1&NM_015717.2&NM_145322.1+NM_145320.1+NM_145321.1+NM_015550.2&NM_016090.2&NM_003780.3+NM_001005417.1&NM_006255.3&XR_040624.2+XR_015325.2+XR_015458.2&NM_138376.2&NM_001262.2+NM_078626.2&NM_002903.2&NM_139247.2&NM_014877.3&NM_207371.3&NM_001065.2&NM_033046.2+NM_001015056.1+NM_001015055.1&NM_198524.1&NM_032682.4+NM_001012505.1&NM_198492.3&NM_057166.4+NM_004369.3+NM_057167.3+NM_057165.4+NM_057164.4&NM_174924.1&NM_001007026.1+NM_001940.3&NM_003019.4&NM_182623.2&XR_037141.2+XR_036957.2+XR_037310.2&NM_015949.2&NR_027103.1&NM_005521.3&NM_002076.3&NM_002194.3+NM_001128928.1&XM_002347979.1&NM_022357.3+NM_001129758.1&NM_014752.2&NM_022461.3+NM_001134433.1+NM_001134432.1&NM_030952.1&NM_017929.4+NM_001127649.1&NM_002857.3+NM_001131039.1&NM_001105530.1+NM_006367.3&NM_006845.3&NM_012410.2+NM_001114100.1+NM_001114099.1+NM_201575.2&NM_080720.1&NM_001001996.1+NM_001001994.1+NM_005278.3+NM_001001995.1&NM_001082575.1&NM_006779.2&NM_003666.2&NM_021101.3&NM_152493.2&NM_182924.3&NM_003904.3&NM_016068.2&NM_001082486.1+NM_022914.2+NM_001082487.1&NM_178562.2&NM_003108.3&NM_005982.3&NM_130807.2&NM_033661.3+NM_018669.4&NM_139286.3&NM_012083.2&NM_005598.3&NM_001167986.1+NM_001167985.1+NM_001167987.1+NM_213726.2&NM_032902.5&NR_024332.1+NM_017739.3&NM_003378.3&NM_007030.2&NM_030958.2+NM_001146008.1+NM_001146009.1&NM_022749.5&NM_002808.3&NM_001024599.3+NM_001161334.1&NM_003320.4+NM_177972.2&NM_133328.2&NM_025201.4&NM_032309.2&NM_032344.2+NM_001128613.1+NM_001128612.1&NM_202470.1+NM_202468.1+NM_202494.1+NM_202469.1+NM_005716.2+NM_202467.1&NR_003659.2&NM_002085.3+NM_001039847.1+NM_001039848.1&NM_021134.3&NM_001042437.1+NM_003896.3&NM_145807.1&NM_006848.2&NM_152359.1+NM_001136052.1&NM_004421.2&NM_198318.2+NM_001536.3+NM_198319.2&NM_058219.2&NM_015944.3+NM_001145815.1&NM_003487.2+NM_139215.1&NM_005775.4+NM_001018003.2&NM_020831.3&NM_153605.2&NM_015594.2&NM_001144952.1&NM_001128854.1+NM_001128853.1+NM_015908.5+NM_001128852.1&NM_199171.1+NM_199169.1+NM_020182.3+NM_199170.1&NM_014213.3&NM_001168249.1+NM_001854.3+NM_080629.2+NM_080630.2&NM_003485.3&NM_032645.3+NM_005055.3&NM_173164.1+NM_173163.1+NM_004555.2+NM_173165.1&NM_005856.2&NM_021130.3&NM_004452.3&NM_019597.3+NM_001032393.1&NM_015071.4+NM_001135608.1&NR_024542.1+NR_024543.1+NR_003672.2&NM_002852.3&XM_002343658.1&NM_032642.2+NM_030775.2&NM_005655.2+NM_001032282.2&NM_001165975.1+NM_000924.3&NM_032151.4&NM_000211.3+NM_001127491.1&NM_017647.3&NM_001166426.1+NM_017883.4+NR_029427.1&NM_006818.3&NM_001145201.1+NM_145202.4&NM_006649.3+NM_001166221.1&NM_006701.2&NM_001142725.1+NM_080663.2&NM_002596.3+NM_212503.2+NM_212502.2&NR_027332.1+NM_000860.4+NM_001145816.1&NR_026778.1&NM_003661.3+NM_145343.2+NM_001136540.1+NM_001136541.1&NM_175085.2+NM_001136005.1+NM_000819.4+NM_001136006.1&NM_001130863.1+NM_006209.3+NM_001040092.1&NM_001009554.2+NM_021647.6&NM_001130110.1+NM_015559.2&NM_012272.1+NM_001031698.1&NM_013364.4&NM_001082959.1+NM_005505.4&NM_145024.2+NM_001143685.1&NM_000660.4&NM_001014283.1&NM_001004127.1&NM_007264.3&XR_039278.2+XR_017613.3+XR_019471.3&NM_004608.3&NM_019852.3&NM_014681.5&NM_014112.2&NM_006409.2&NM_006836.1&NM_145899.2+NM_145905.2+NM_002131.3+NM_145903.2+NM_145901.2+NM_145902.2&NM_001031617.2&NM_017637.5&NM_001085.4&NM_001040451.1+NM_025158.3+NM_001040452.1&NM_001077268.1&NM_015913.2&NM_033316.3+NM_005929.4&NM_001009813.1+NM_020160.1&NR_024531.1+NR_024530.1+NR_024528.1+NR_000029.3+NR_024529.1&NR_029373.1+NR_029374.1&NM_012186.2&NM_020243.4&XM_002345312.1&NM_000316.2&NM_006084.4&NM_025218.2&NM_019043.3&NM_178497.2&NR_024585.1&NM_000268.3+NM_181832.2+NM_181833.2+NM_016418.5+NM_181830.2+NM_181828.2+NM_181829.2+NM_181831.2+NM_181825.2&NM_018337.2&NR_024552.1+NM_015916.4&NM_006468.6&NM_004785.4+NM_001130012.1&NM_031476.3&NM_032207.2&NM_138802.1&NM_001007242.1+NM_001502.2+NM_001007240.1+NM_001007241.1&NM_005137.2&NM_003394.2&NM_018028.2&NM_058238.2&NM_015540.2&NM_000287.3&NM_001805.2&NM_138465.3&NM_184041.1+NM_001127617.1+NM_184043.1+NM_000034.2&NM_022733.1&NM_024830.3&NR_027834.1+NM_145642.2+NM_145640.2+NR_027833.1+NR_027835.1+NM_145641.2&NM_001031703.2&NM_016333.3&NM_152268.2&NM_002698.2&NM_002586.4&NM_001165994.1+NM_182569.3+NM_001165993.1&NM_001164471.1&NM_172027.1+NM_032548.2+NM_172028.1&NM_003833.3+NM_030590.2+NM_030592.2&NM_201591.1+NM_201592.1+NM_005277.3&NM_001105538.1+NM_014520.3&NM_001099784.2&NM_006472.3&NM_015697.7&NM_015456.3&NM_018011.3&NM_001760.3+NM_001136017.2+NM_001136126.1+NM_001136125.1&NM_030578.3&NM_032482.2&NM_004470.3+NM_057092.2+NM_001135208.1&NM_052953.2&NM_003773.3+NM_033158.3&NM_016656.3+NM_006064.4&NM_021173.3&NM_006413.4+NM_001104546.1&NM_018252.2&NM_009590.2+NM_001158.3&NM_018083.4&NM_003377.3&NR_027128.1+NR_027129.1&NM_002877.4+NM_133510.2+NM_133509.2&NM_018178.5&NM_024430.3&NM_001099640.1+NM_018286.2&NM_017799.3&NM_181657.3+NM_001143919.2&NM_001164479.1+NM_001164478.1&NM_004630.2+NM_201995.1+NM_201998.1+NM_201997.1&NM_152275.3&NM_005456.2&NM_033529.2+NM_024011.2&NM_020230.4&NM_024069.2&NM_001145946.1+NM_001145944.1+NM_017435.4+NM_001145945.1&NM_212557.2&NM_001142784.1+NM_004512.3+NM_147162.1&NM_004577.3&NM_058182.4&NM_012449.2&NM_001123366.1&NM_016531.5&NM_017823.3&NM_001098638.1&NM_022149.4&NM_021976.31&1&1+1+1&1&1&1+1&1&1&1&1+1+1+0+0+0&1+0+0&1&1&1&1&1+1+0&1&1&1+1+1&1&1&1&1&1+0&1+1&1+1&1&1+1+1+1&1&1&1+1&1&1&1+0&1&1&1&1&1&1+1&1&1&1+1+1+1+1+1+0+0&1&1&1&1&1&1&1&1+1+1&1&1+1+1+1+1+1&1&1+1&1&1+1&1+1&1+1&1+0&1&1+0&1&1&1+1+1+1+0+0&1&1+1+1&1+1&1&1&1+1+0&1+1&1+0&1&1&1+1+1&1+1&1+1+1&1&1&1&1+1+1+0&1&1+1&1&1&1+1&1&1&1&1&1&1&1+0&1&1&1&1&1&1&1+0+0+0+0+0&1&1+1&1&1+1&1&1+1&1&1+1+1+1+0&1+0&1&1&1&1&1+1+1+1+1+1+1+1&1&1+1&1+1&1&1&1&1+1&1+1+1+1+1+0&1&1&1&1&1&1&1&1&1+0&1&1&1&1&1&1&1+1&1+0+0+0+0&1+1&1&1+0&1&1&1&1&1+0&1&1&1&1&1&1+1&1+0&1+1&1&1+0&1&1&1&1&1+1+1+1+1+1+1+1&1&1&1+1&1+1&1&1&1&1&1&1&1&1&1&1+0+0&1&1&1+1&1&1+0&1&1&1&1&1+1&1&1+1&1+0&1&1&1&1+1+1+1+1&1+0&1+1&1+0&1&1&1+1&1&1+0&1&1&1+1+1&1&1+1&1&1&1&1&1&1&1&1&1&1+1+1&1&1&1+1&1&1+1&1+1&1+1+1&1&1&1&1&1&1&1&1&1&1+1&1&1&1&1&1+1&1+1&1&1&1&1+0+0&1&1+1+1+1&1+1+1&1&1&1&1&1&1+0+0+0&1+1+1&1&1+1+1&1&1&1&1&1+1+1&1+1+1+1&1+1&1&1+1&1&1&1&1+1&1&1+1&1&1+1&1&1&1+1&1&1&1&1&1+1+1&1&1&1&1+1&1&1&1&1+1+1+1&1&1&1&1&1&1+1&1+1&1&1&1&1+1+1+0+0+0+0&1+1+1+1+1&1&1+1+1+0+0+0+0+0&1&1+1&1&1+1&1&1&1&1+1+1&1+1+1&1&1+1+0&1&1+1&1+1&1&1+1&1&1&1+1+1&1+1+1+1+1&1&1+1+1&1+0+0+0+0&1&1&1+1+0&1+1+1&1+1&1+1&1&1+1+1+1+1+1+1&1&1&1+1+0&1&1&1&1&1+1+1&1+1&1+0&1+1+1&1&1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1&1&1+1&1+1&1&1&1+1+1+1&1&1&1&1+1&1+1&1+1&1&1&1&1+1&1&1+1+1+1+1+1+1+1&1&1&1&1&1&1&1&1+1&1+0+0+0&1&1&1+1+0&1&1&1&1&1+0&1+1&1&1&1+1&1&1&1+1&1+1+1&1&1&1&1&1&1&1+1+0&1&1&1+1&1&1&1&1&1&1&1+1+1&1&1&1&1+1+1+1+1+1&1&1&1&1+1+1+1&1&1+1&1&1+0+0&1&1+0&1&1&1&1&1&1+1+1&1&1+0&1&1+1+1+0+0&1&1+1&1&1&1+1+0&1&1&1&1&1+1&1&1+1&1&1+0+0&1&1+1&1+1&1+1&1&1+1+1+1&1&1+1+1+0&1&1&1&1&1&1&1&1&1+1+1&1&1&1&1&1+0&1&1&1&1+1+1+1&1&1+1&1&1&1+1+1&1&1&1+0&1+1&1&1&1&1+1+1&1+1+1+1+1+1&1&1+1+1&1&1+0&1&1&1+1&1&1+1+1&1&1+0&1+0&1+1&1&1&1&1&1+1+1+1&1+1+1+1&1&1+0+0+0&1&1+0&1+0+0+0&1&1&1&1+1&1+1&1+1+0&1&1&1+0&1+1&1+1&1&1+1&1&1+1+1&1&1+1&1+1&1&1+0&1+1+1&1+1+1&1&1+1+1+1&1+0+0+0&1+0+0&1+1&1+0&1+1&1&1+1&1+1&1&1&1&1&1+1+1&1&1&1&1&1&1&1+1+1+1+1+1&1&1&1&1+1+1&1&1&1+0&1+0&1+1+0+0+0&1+1&1&1&1&1&1&1&1&1&1&1+1+1+1+1+1+1+0+0&1&1+1&1&1+1&1&1&1&1+1+1+1&1&1&1&1&1&1&1&1&1+1+1+1&1&1&1+1+1+1+1+1&1&1&1&1&1&1+0+0&1&1+1+1&1+1+1&1+0+0&1+1&1&1&1&1&1&1+1+1+1&1&1&1+1+1&1&1+1&1+1&1&1+0&1&1+1&1&1&1+0&1+0+0&1&1&1+1&1&1+1&1+0&1+1+1+0&1&1&1+1&1&1&1+1+1+1&1&1+1+0&1&1&1&1&1&1&1&1&1NA10TMEM198(0.002)&C9orf37(0.002)&MRPL55(0.002)&RASGRP4(0.002)&NPHS2(0.002)&NUDT22(0.002)&GIPC1(0.002)&SLC1A4(0.002)&GPX4(0.002)&PI4KA(0.002)&MRPL23(0.002)&ST3GAL5(0.002)&CPT1C(0.002)&KRT19(0.002)&ZNF574(0.002)&PRMT1(0.002)&POLR2G(0.002)&IPO11(0.002)&SLC30A5(0.002)&SORBS3(0.002)&LAMB3(0.002)&CRYBG3(0.002)&KIAA1984(0.002)&PDE9A(0.002)&PARVG(0.002)&GDPD2(0.002)&SRRT(0.002)&PMEPA1(0.002)&TK1(0.002)&NUDT16P(0.002)&PRG2(0.002)&LOC100289081(0.002)&RAPSN(0.002)&CD151(0.002)&FAM13AOS(0.002)&PET117(0.002)&RGMB(0.002)&NENF(0.002)&HNRNPH2(0.002)&ARHGAP26(0.002)&RPL34(0.002)&SNHG7(0.002)&GMPPA(0.002)&AP2M1(0.002)&PCMTD2(0.002)&WNT5B(0.002)&STAT5B(0.002)&RNH1(0.002)&NEU4(0.002)&RHPN1(0.002)&RLTPR(0.002)&ITGB2(0.002)&EPHA3(0.002)&LOC100288778(0.002)&HS3ST3A1(0.002)&PRAP1(0.002)&UTP14A(0.002)&TXNL4A(0.002)&ERI2(0.002)&PCTK3(0.002)&SP140(0.002)&HLA-DRA(0.002)&GALE(0.002)&APOL1(0.002)&IP6K2(0.002)&SETBP1(0.002)&ANKRD13B(0.002)&GPSM3(0.002)&TGFB1(0.002)&ALG1L(0.002)&NCKAP1L(0.002)&RCSD1(0.002)&LOC389168(0.002)&LOC100291035(0.002)&CPSF3(0.002)&NECAB2(0.002)&METTL3(0.002)&CD248(0.002)&GCN1L1(0.002)&ARPC1A(0.002)&HMGA1(0.002)&ATP6V0A1(0.002)&CCHCR1(0.002)&KRTAP24-1(0.002)&COMP(0.002)&TPD52L2(0.002)&DDX28(0.002)&FBXL6(0.002)&HARS(0.002)&DPYSL2(0.002)&PAPD5(0.002)&RBCK1(0.002)&MEIS3(0.002)&RPL23AP7(0.002)&PTH1R(0.002)&NME1-NME2(0.002)&LOC100292164(0.002)&C4orf26(0.002)&HBS1L(0.002)&PTBP2(0.002)&NF2(0.002)&ARD1A(0.002)&POLR3C(0.002)&CRISPLD2(0.002)&SLC9A3R2(0.002)&C19orf44(0.002)&NFASC(0.002)&DGCR2(0.002)&ARHGDIA(0.002)&GP2(0.002)&CLCA4(0.002)&DDOST(0.002)&SAMD4B(0.002)&CD300LB(0.002)&WASH5P(0.002)&SLC44A3(0.002)&RPAP1(0.002)&ELMO1(0.002)&SET(0.002)&FGFR3(0.002)&CEBPE(0.002)&MAPKAPK5(0.002)&DGKG(0.002)&C5orf46(0.002)&APOL3(0.002)&TCP10L(0.002)&PRKCH(0.002)&LOC732160(0.002)&RBM7(0.002)&B4GALT2(0.002)&OSBPL3(0.002)&NEUROD2(0.002)&MFGE8(0.002)&CDKN2C(0.002)&ASPRV1(0.002)&C1orf26(0.002)&PHLDB3(0.002)&SETDB2(0.002)&DBH(0.002)&RTKN(0.002)&FAM22A(0.002)&MRM1(0.002)&FOXP1(0.002)&TECR(0.002)&LOC338588(0.002)&HN1L(0.002)&LOC100287186(0.002)&RRP9(0.002)&MYBBP1A(0.002)&TMEM231(0.002)&TXNIP(0.002)&PRRT4(0.002)&HTR3C(0.002)&NFATC1(0.002)&ACAD10(0.002)&C16orf57(0.002)&B9D2(0.002)&CCND3(0.002)&LRRC59(0.002)&FKBP2(0.002)&OTUD5(0.002)&LOC654433(0.002)&SLC18A3(0.002)&HYAL2(0.002)&LOC100291242(0.002)&DPEP3(0.002)&AZI2(0.002)&SPCS2(0.002)&ZNF83(0.002)&GALNT14(0.002)&C3orf45(0.002)&LILRB3(0.002)&TRIM7(0.002)&CNIH4(0.002)&GPM6B(0.002)&LOC100291863(0.002)&MTTP(0.002)&TMEM206(0.002)&PUSL1(0.002)&PNPLA6(0.002)&CLDN1(0.002)&ZNF362(0.002)&LOC100133315(0.002)&ACD(0.002)&TSPAN33(0.002)&C1orf174(0.002)&SIX1(0.002)&SP1(0.002)&RAD51L1(0.002)&MOBKL2A(0.002)&WDR4(0.002)&PSTPIP2(0.002)&TMEM100(0.002)&LPIN3(0.002)&PBRM1(0.002)&LPGAT1(0.002)&POMGNT1(0.002)&CDC2L2(0.002)&ARFGAP3(0.002)&LRRC8B(0.002)&RPA3(0.002)&PPAN(0.002)&GPC2(0.002)&NKX3-1(0.002)&NLRP4(0.002)&PSPH(0.002)&SH2D2A(0.002)&HIST2H2BF(0.002)&TUB(0.002)&KLF3(0.002)&SGCD(0.002)&RNF169(0.002)&PTGES2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17899GGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCC0.999500.996500.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
879-901TGGGAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUCCCAGGAAAAAAAAAAAAAAAAAAAU-11.30.700


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107CCGUUAUGAACAUCCGCAA86.203266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174125CCGTTATGAACATCCGCAATTGCGGATGTTCATAACGG0.058000.027300.767201.000001.000001.00000


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195GAAAUACUACUUCUACCAU91.671720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159213GAAATACTACTTCTACCATATGGTAGAAGTAGTATTTC0.474100.371000.517200.750001.000001.00000


Target Position: 141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
141CCUAAUGAACAUGCAGCAC65.1531473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195159CCTAATGAACATGCAGCACGTGCTGCATGTTCATTAGG0.028300.026100.551700.750001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895AAAAAAAAAAAAAAAAAAA83.5835104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196913AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999600.500000.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500UCAGUGAAGUGGAGCCCAA81.9911127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197518TCAGTGAAGTGGAGCCCAATTGGGCTCCACTTCACTGA0.113400.002000.577600.750000.989100.62500


Target Position: 402, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402CAUGAUAGAGAACUUCAAU91.130226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89420CATGATAGAGAACTTCAATATTGAAGTTCTCTATCATG0.460700.087500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
400-422GCCATGATAGAGAACTTCAATGCAUUGAAGUUCUCUAUCAUGGCCAUGAUAGAGAACUUCAAUGCU19.213.312


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246UGAGGACGAGAAUGGGAAG66.1467442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181264TGAGGACGAGAATGGGAAGCTTCCCATTCTCGTCCTCA0.157500.029400.586200.500001.000001.00000


Target Position: 594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594CCUGGAGCUGAAAGAGAAG72.3876299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145612CCTGGAGCTGAAAGAGAAGCTTCTCTTTCAGCTCCAGG0.510100.015500.706900.750001.000001.00000


Target Position: 186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186CUACCAGAUGAAAUACUAC79.8339163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196204CTACCAGATGAAATACTACGTAGTATTTCATCTGGTAG0.563100.197200.491400.500001.000001.00000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GGACAUAUCACCUCAUUGG75.2558237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190337GGACATATCACCTCATTGGCCAATGAGGTGATATGTCC0.035700.003400.525900.500001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762GACCACAGAGAGCACAGAU87.963346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123780GACCACAGAGAGCACAGATATCTGTGCTCTCTGTGGTC0.177800.048200.637900.750001.000001.00000


Target Position: 101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
101CCGCCGCCGUUAUGAACAU75.284236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168119CCGCCGCCGTTATGAACATATGTTCATAACGGCGGCGG0.480300.005300.758601.000000.967400.75000


Target Position: 171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171CUGCCUGCCCGAGAACUAC63.1289534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155189CTGCCTGCCCGAGAACTACGTAGTTCTCGGGCAGGCAG0.403500.224900.603400.500001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370GCUCAGAAACUGAUGGACC70.1517355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204388GCTCAGAAACTGATGGACCGGTCCATCAGTTTCTGAGC0.019600.001400.500000.500000.918500.75000


Target Position: 100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
100CCCGCCGCCGUUAUGAACA68.3417398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176118CCCGCCGCCGTTATGAACATGTTCATAACGGCGGCGGG0.475300.003800.784500.750000.967400.75000


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371CUCAGAAACUGAUGGACCA88.549242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211389CTCAGAAACTGATGGACCATGGTCCATCAGTTTCTGAG0.021600.002500.465500.500000.918500.62500


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766ACAGAGAGCACAGAUGUCA81.0141140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205784ACAGAGAGCACAGATGTCATGACATCTGTGCTCTCTGT0.122400.067300.482800.500001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464CCCUGCACCUCUAUUCCAA87.558151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79482CCCTGCACCTCTATTCCAATTGGAATAGAGGTGCAGGG0.298100.106900.844801.000001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890AAAAAAAAAAAAAAAAAAA83.583599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204908AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999400.500000.500001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836UCCUCACCCCACGAGCUUU64.6666482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183854TCCTCACCCCACGAGCTTTAAAGCTCGTGGGGTGAGGA0.045300.045100.870700.750000.907600.75000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894AAAAAAAAAAAAAAAAAAA83.5835103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175912AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999500.500000.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408AGAGAACUUCAAUGCCAAA91.482423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95426AGAGAACTTCAATGCCAAATTTGGCATTGAAGTTCTCT0.268200.050800.724100.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513GCCCAAAUACUAUGCAGAU86.314264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
157531GCCCAAATACTATGCAGATATCTGCATAGTATTTGGGC0.093800.039600.819001.000001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155AGCACUGCAACCUCCUCUG63.7101512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209173AGCACTGCAACCTCCTCTGCAGAGGAGGTTGCAGTGCT0.015700.001200.569000.500001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470ACCUCUAUUCCAACACCCU72.1714308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163488ACCTCTATTCCAACACCCTAGGGTGTTGGAATAGAGGT0.291100.025800.508600.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CACGAGCUUUCACAAUAAA92.706515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137863CACGAGCTTTCACAATAAATTTATTGTGAAAGCTCGTG0.933700.019000.793100.750001.000001.00000


Target Position: 102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
102CGCCGCCGUUAUGAACAUC64.1935491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115120CGCCGCCGTTATGAACATCGATGTTCATAACGGCGGCG0.332200.028500.741400.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413ACUUCAAUGCCAAAUAUGU76.4588212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199431ACTTCAATGCCAAATATGTACATATTTGGCATTGAAGT0.122800.056600.500000.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GCCAGAGGACCUAAUGAAC73.685272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78150GCCAGAGGACCTAATGAACGTTCATTAGGTCCTCTGGC0.516700.053800.853400.750001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GAGGACGCCUAUGCCAUGA78.047182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
208553GAGGACGCCTATGCCATGATCATGGCATAGGCGTCCTC0.118600.001700.586200.500000.951100.87500


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252CGAGAAUGGGAAGAUUGUG72.6448294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191270CGAGAATGGGAAGATTGTGCACAATCTTCCCATTCTCG0.271100.031100.500000.750001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767CAGAGAGCACAGAUGUCAA101.781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146785CAGAGAGCACAGATGTCAATTGACATCTGTGCTCTCTG0.120600.067300.637900.750001.000001.00000


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227CCCAGCUCUCUUACAUUGC56.6667651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188245CCCAGCTCTCTTACATTGCGCAATGTAAGAGAGCTGGG0.039100.009100.637900.500001.000001.00000


Target Position: 181, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181GAGAACUACCAGAUGAAAU88.457544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90199GAGAACTACCAGATGAAATATTTCATCTGGTAGTTCTC0.273500.181000.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
179-201CCGAGAACTACCAGATGAAATACAUUUCAUCUGGUAGUUCUCGGGAGAACUACCAGAUGAAAUACU16.318.912


Target Position: 843, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843CCCACGAGCUUUCACAAUA88.604741

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1084319CCCACGAGCTTTCACAATA1/0/1/090.92ARD1ANM_003491.21NANANAX:153195398..153195416(-)00ARD1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126861CCCACGAGCTTTCACAATATATTGTGAAAGCTCGTGGG0.936200.024800.948301.000001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898AAAAAAAAAAAAAAAAAAA83.5835107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169916AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999700.500000.500001.000001.00000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407UAGAGAACUUCAAUGCCAA88.8237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188425TAGAGAACTTCAATGCCAATTGGCATTGAAGTTCTCTA0.358200.091200.525900.500001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395CUCGAGCCAUGAUAGAGAA91.169725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165413CTCGAGCCATGATAGAGAATTCTCTATCATGGCTCGAG0.170100.006100.637900.750001.000001.00000


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192GAUGAAAUACUACUUCUAC83.849786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177210GATGAAATACTACTTCTACGTAGAAGTAGTATTTCATC0.475000.233500.500000.500000.951100.75000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459GGCCGCCCUGCACCUCUAU71.5079327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
113477GGCCGCCCTGCACCTCTATATAGAGGTGCAGGGCGGCC0.200800.036100.956901.000000.902200.75000


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185ACUACCAGAUGAAAUACUA90.401728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152203ACTACCAGATGAAATACTATAGTATTTCATCTGGTAGT0.537000.204600.534500.750001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GGACGCCUAUGCCAUGAAG75.9097224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203555GGACGCCTATGCCATGAAGCTTCATGGCATAGGCGTCC0.031300.001500.732800.750000.951100.62500


Target Position: 98, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
98GCCCCGCCGCCGUUAUGAA80.3532152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189116GCCCCGCCGCCGTTATGAATTCATAACGGCGGCGGGGC0.199800.002600.827601.000000.967401.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892AAAAAAAAAAAAAAAAAAA83.5835101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171910AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999500.500000.500001.000001.00000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423CAAAUAUGUCUCCCUGCAU85.552271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203441CAAATATGTCTCCCTGCATATGCAGGGAGACATATTTG0.019700.003000.491400.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GGCACCUGGAGCUGAAAGA79.9648161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152608GGCACCTGGAGCTGAAAGATCTTTCAGCTCCAGGTGCC0.176400.012000.775900.750000.972800.75000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409GAGAACUUCAAUGCCAAAU73.6026273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104427GAGAACTTCAATGCCAAATATTTGGCATTGAAGTTCTC0.235000.053500.801700.750001.000001.00000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883AAAAAAAAAAAAAAAAAAA83.583592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180901AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.997400.500000.500001.000001.00000


Target Position: 851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851CUUUCACAAUAAAUUUGCU79.1498169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
849-871AGCTTTCACAATAAATTTGCTCCAGCAAAUUUAUUGUGAAAGCUCUUUCACAAUAAAUUUGCUCCU14.020.512


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CCCCACGAGCUUUCACAAU72.1858307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116860CCCCACGAGCTTTCACAATATTGTGAAAGCTCGTGGGG0.932400.027600.982801.000001.000001.00000


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248AGGACGAGAAUGGGAAGAU74.0603261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129266AGGACGAGAATGGGAAGATATCTTCCCATTCTCGTCCT0.163600.040100.663800.750001.000001.00000


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106GCCGUUAUGAACAUCCGCA82.9674115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164124GCCGTTATGAACATCCGCATGCGGATGTTCATAACGGC0.074700.025400.646600.750001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897AAAAAAAAAAAAAAAAAAA83.5835106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210915AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999600.500000.500001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60CAGCUGACUGCGCCUUCAC69.3242373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
21078CAGCTGACTGCGCCTTCACGTGAAGGCGCAGTCAGCTG0.030000.001100.491400.500000.902200.62500


Target Position: 840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
840CACCCCACGAGCUUUCACA81.82130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179858CACCCCACGAGCTTTCACATGTGAAAGCTCGTGGGGTG0.169800.032900.586200.500000.962000.62500


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251ACGAGAAUGGGAAGAUUGU71.2101332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173269ACGAGAATGGGAAGATTGTACAATCTTCCCATTCTCGT0.327800.029400.569000.500001.000001.00000


Target Position: 272, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272GGUAUGUCCUGGCCAAAAU85.490472

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_827219GGTATGTCCTGGCCAAAAT1/0/1/090.92ARD1ANM_003491.21NANANAX:153199396..153199414(-)00ARD1A(0.002)


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837CCUCACCCCACGAGCUUUC56.2304662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185855CCTCACCCCACGAGCTTTCGAAAGCTCGTGGGGTGAGG0.042900.042800.672400.750000.907600.62500


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885AAAAAAAAAAAAAAAAAAA83.583594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202903AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.998400.500000.500001.000001.00000


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GCCUCCUAGAGCCUGCCCC50.2176762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201829GCCTCCTAGAGCCTGCCCCGGGGCAGGCTCTAGGAGGC0.200600.017800.508600.500000.913000.62500


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758GCGAGACCACAGAGAGCAC76.5837211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104776GCGAGACCACAGAGAGCACGTGCTCTCTGTGGTCTCGC0.290800.039500.629300.750001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893AAAAAAAAAAAAAAAAAAA83.5835102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185911AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999500.500000.500001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134CAGAGGACCUAAUGAACAU91.635521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105152CAGAGGACCTAATGAACATATGTTCATTAGGTCCTCTG0.223000.037900.629300.750001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501CAGUGAAGUGGAGCCCAAA91.986717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181519CAGTGAAGTGGAGCCCAAATTTGGGCTCCACTTCACTG0.135800.003200.784500.750000.989100.75000


Target Position: 466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466CUGCACCUCUAUUCCAACA82.2827119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142484CTGCACCTCTATTCCAACATGTTGGAATAGAGGTGCAG0.464500.149700.577600.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108CGUUAUGAACAUCCGCAAU83.633990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180126CGTTATGAACATCCGCAATATTGCGGATGTTCATAACG0.048000.041100.767201.000001.000001.00000


Target Position: 391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
391GCCUCUCGAGCCAUGAUAG76.0085220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
208409GCCTCTCGAGCCATGATAGCTATCATGGCTCGAGAGGC0.016300.002000.827600.750001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258UGGGAAGAUUGUGGGGUAU68.5815394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155276TGGGAAGATTGTGGGGTATATACCCCACAATCTTCCCA0.095000.034200.801700.750001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299ACCCAGAUGAUGUGCCCCA72.2907301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210317ACCCAGATGATGTGCCCCATGGGGCACATCATCTGGGT0.014100.001100.508600.500001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879UGGGAAAAAAAAAAAAAAA77.5468193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107897TGGGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCCCA0.999400.762600.844800.750001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UCCCCUCCUCACCCCACGA61.0459578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166849TCCCCTCCTCACCCCACGATCGTGGGGTGAGGAGGGGA0.070000.071500.577600.500000.989100.62500


Target Position: 507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
507AGUGGAGCCCAAAUACUAU86.679559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141525AGTGGAGCCCAAATACTATATAGTATTTGGGCTCCACT0.515300.017300.663800.750000.989100.75000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875GCACUGGGAAAAAAAAAAA86.530861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43893GCACTGGGAAAAAAAAAAATTTTTTTTTTTCCCAGTGC0.997800.183500.853401.000001.000001.00000


Target Position: 849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849AGCUUUCACAAUAAAUUUG66.7775427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191867AGCTTTCACAATAAATTTGCAAATTTATTGTGAAAGCT0.033600.031000.706900.500001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506AAGUGGAGCCCAAAUACUA90.532727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210524AAGTGGAGCCCAAATACTATAGTATTTGGGCTCCACTT0.371700.012300.465500.500000.989100.87500


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GAGCACAGAUGUCAAGGAC77.5569192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202789GAGCACAGATGTCAAGGACGTCCTTGACATCTGTGCTC0.028300.014100.491400.500000.951100.62500


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763ACCACAGAGAGCACAGAUG67.2769417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140781ACCACAGAGAGCACAGATGCATCTGTGCTCTCTGTGGT0.124500.059000.698300.500001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887AAAAAAAAAAAAAAAAAAA83.583596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170905AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821GCCUGCCCCAUCCCCUCCU55.8954670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114839GCCTGCCCCATCCCCTCCTAGGAGGGGATGGGGCAGGC0.681100.300300.655200.750001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847CGAGCUUUCACAAUAAAUU84.426282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147865CGAGCTTTCACAATAAATTAATTTATTGTGAAAGCTCG0.933000.014500.784501.000001.000001.00000


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335UGGCUGUGAAGCGUUCCCA69.4534370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207353TGGCTGTGAAGCGTTCCCATGGGAACGCTTCACAGCCA0.017000.001900.500000.500000.940200.75000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536AGGACGCCUAUGCCAUGAA80.8354144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172554AGGACGCCTATGCCATGAATTCATGGCATAGGCGTCCT0.114000.004100.672400.750000.951100.75000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828CCAUCCCCUCCUCACCCCA71.2508331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181846CCATCCCCTCCTCACCCCATGGGGTGAGGAGGGGATGG0.202700.171000.500000.750001.000001.00000


Target Position: 225, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
225GCCCCAGCUCUCUUACAUU85.131173

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_722519GCCCCAGCTCTCTTACATT1/0/1/091.10ARD1ANM_003491.21NANANANA00ARD1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104243GCCCCAGCTCTCTTACATTAATGTAAGAGAGCTGGGGC0.258100.035900.991401.000001.000001.00000


Target Position: 180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
180CGAGAACUACCAGAUGAAA94.10639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98198CGAGAACTACCAGATGAAATTTCATCTGGTAGTTCTCG0.263400.131900.793101.000001.000001.00000


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234CUCUUACAUUGCUGAGGAC74.5908248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205252CTCTTACATTGCTGAGGACGTCCTCAGCAATGTAAGAG0.017700.005700.491400.500001.000001.00000


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135AGAGGACCUAAUGAACAUG70.2328351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159153AGAGGACCTAATGAACATGCATGTTCATTAGGTCCTCT0.083300.024500.569000.500001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257AUGGGAAGAUUGUGGGGUA83.3838110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206275ATGGGAAGATTGTGGGGTATACCCCACAATCTTCCCAT0.112200.017200.474100.500001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876CACUGGGAAAAAAAAAAAA87.359352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119894CACTGGGAAAAAAAAAAAATTTTTTTTTTTTCCCAGTG0.998500.183300.793100.750001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461CCGCCCUGCACCUCUAUUC60.3447588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114479CCGCCCTGCACCTCTATTCGAATAGAGGTGCAGGGCGG0.200700.051200.741400.750001.000001.00000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GCACCUCUAUUCCAACACC72.0702310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166486GCACCTCTATTCCAACACCGGTGTTGGAATAGAGGTGC0.465100.195300.500000.500001.000001.00000


Target Position: 465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465CCUGCACCUCUAUUCCAAC72.9662287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86483CCTGCACCTCTATTCCAACGTTGGAATAGAGGTGCAGG0.459100.117700.698300.750001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759CGAGACCACAGAGAGCACA82.2236122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115777CGAGACCACAGAGAGCACATGTGCTCTCTGTGGTCTCG0.288500.042100.586200.750001.000001.00000


Target Position: 315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315CCAUGGACAUAUCACCUCA95.25876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177333CCATGGACATATCACCTCATGAGGTGATATGTCCATGG0.064500.003600.620700.750000.951100.87500


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478UCCAACACCCUCAACUUUC53.294720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147496TCCAACACCCTCAACTTTCGAAAGTTGAGGGTGTTGGA0.130000.121500.698300.500001.000001.00000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183GAACUACCAGAUGAAAUAC77.6763189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211201GAACTACCAGATGAAATACGTATTTCATCTGGTAGTTC0.421400.213300.491400.500001.000001.00000


Target Position: 142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
142CUAAUGAACAUGCAGCACU75.6973227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209160CTAATGAACATGCAGCACTAGTGCTGCATGTTCATTAG0.021000.019900.465500.500001.000001.00000


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888AAAAAAAAAAAAAAAAAAA83.583597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168906AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999200.500000.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137AGGACCUAAUGAACAUGCA83.5804108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201155AGGACCTAATGAACATGCATGCATGTTCATTAGGTCCT0.069700.026100.491400.500001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133CCAGAGGACCUAAUGAACA87.015654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117151CCAGAGGACCTAATGAACATGTTCATTAGGTCCTCTGG0.713200.050400.637900.750001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884AAAAAAAAAAAAAAAAAAA83.583593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173902AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.998100.500000.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GAGCCCAAAUACUAUGCAG80.1546155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154529GAGCCCAAATACTATGCAGCTGCATAGTATTTGGGCTC0.359700.125000.525900.500001.000001.00000


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140ACCUAAUGAACAUGCAGCA80.4288149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192158ACCTAATGAACATGCAGCATGCTGCATGTTCATTAGGT0.033500.020000.500000.500001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626UGCUGGGUGCCAUCGAGAA79.3577167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200644TGCTGGGTGCCATCGAGAATTCTCGATGGCACCCAGCA0.124500.001900.681000.750000.967400.75000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410AGAACUUCAAUGCCAAAUA84.622578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110428AGAACTTCAATGCCAAATATATTTGGCATTGAAGTTCT0.215100.114700.681000.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477UUCCAACACCCUCAACUUU65.3713464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176495TTCCAACACCCTCAACTTTAAAGTTGAGGGTGTTGGAA0.134500.047200.672400.500001.000001.00000


Target Position: 649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649GUGGAGAGCAAAGGCAAUU71.4694328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211667GTGGAGAGCAAAGGCAATTAATTGCCTTTGCTCTCCAC0.069900.001100.784500.750001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317AUGGACAUAUCACCUCAUU73.264280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169335ATGGACATATCACCTCATTAATGAGGTGATATGTCCAT0.115800.004800.646600.500000.951100.75000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397CGAGCCAUGAUAGAGAACU73.8789268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155415CGAGCCATGATAGAGAACTAGTTCTCTATCATGGCTCG0.271200.009000.586200.750001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889AAAAAAAAAAAAAAAAAAA83.583598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167907AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999300.500000.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534GGAGGACGCCUAUGCCAUG76.975202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207552GGAGGACGCCTATGCCATGCATGGCATAGGCGTCCTCC0.137100.001200.715500.750000.951100.87500


Target Position: 401, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401CCAUGAUAGAGAACUUCAA95.99385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97419CCATGATAGAGAACTTCAATTGAAGTTCTCTATCATGG0.264000.073000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
399-421AGCCATGATAGAGAACTTCAATGUUGAAGUUCUCUAUCAUGGCUCCAUGAUAGAGAACUUCAAUGU19.214.913


Target Position: 467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467UGCACCUCUAUUCCAACAC52.6533730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165485TGCACCTCTATTCCAACACGTGTTGGAATAGAGGTGCA0.463000.187000.560300.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765CACAGAGAGCACAGAUGUC79.4577166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207783CACAGAGAGCACAGATGTCGACATCTGTGCTCTCTGTG0.119100.067700.474100.500001.000001.00000


Target Position: 650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650UGGAGAGCAAAGGCAAUUC57.0044640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198668TGGAGAGCAAAGGCAATTCGAATTGCCTTTGCTCTCCA0.067900.007500.672400.500001.000001.00000


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510GGAGCCCAAAUACUAUGCA83.671889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161528GGAGCCCAAATACTATGCATGCATAGTATTTGGGCTCC0.378700.041800.517200.750001.000001.00000


Target Position: 882, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882GAAAAAAAAAAAAAAAAAA89.083534

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_688219GAAAAAAAAAAAAAAAAAA1/0/1/091.19MAP3K3&WBSCR22&CPEB1&LPIN3&SET&DIO2&RNF24&SGCD&BASP1&DHRS3&SNX27NM_203351.1+NM_002401.3&NM_017528.2&NM_030594.3+NM_001079535.1+NM_001079533.1+NM_001079534.1&NM_022896.1&NM_001122821.1+NM_003011.3&NM_013989.3+NM_000793.4+NM_001007023.2&NM_007219.3+NM_001134337.1+NM_001134338.1&NM_000337.5+NM_001128209.1+NM_172244.2&NM_006317.3&NM_004753.4&NM_030918.52+2&2&2+2+2+2&2&2+2&2+1+1&2+2+2&2+2+0&2&2&2AACS&PCNXL3&MMP2&TMEM216&INSL3&PINK1&MT1B&CCDC116&GNL3&ITGA5&UTP20&ERAL1&MGC16275&MMGT1&RTKN2&TKT&COX7A2L&DDT&AEN&ARRB2&GFOD2&NAGPA&TMEM151A&AHSA2&FRAS1&MGC2889&WISP2&NTSR1&HS3ST3A1&HIC2&MON1B&BTN2A1&CHORDC1&FAM113B&LOC100130331&C4orf22&ANKRD13B&VCY1B&FLJ38717&CCDC28B&CHD9&FLJ35024&FGR&AATK&RNF14&RAB3IP&HEPH&AGPAT1&COX6C&ING3&CLCNKA&ADAM7&COPS7A&MAX&PROSC&SPIN2B&LRRN2&RRP7A&OAZ2&LY6K&PTCD3&PCOLCE&DKK2&PUF60&FAHD1&C9orf43&ELOVL5&DIP2A&CCL22&ARHGAP21&KIAA1033&CDC25B&HOOK3&NOXO1&CAND1&PAPSS2&ACSM3&ASPRV1&PHLDB3&BAZ1B&RELT&GPC5&IMPDH2&SLC25A46&ZMYND15&ZNF702P&PARP16&FGGY&ZNF212&NUDT1&MANEA&SFRS1&ZNF83&GDPD5&ANLN&RHOC&C15orf52&ZNF37B&PRR16&CHRNA5&GNAS&DDB2&PYY&RBM10&MFF&DNAJC15&LEPREL2&UCRC&C1orf174&RTF1&SERPINB9&TNFRSF9&RIPK4&LOC220930&C19orf43&CTDSP2&BUD31&ETNK2&MSH6&IL1F5&HDGF2&ZNF484&MRAP&GJB1&SYT13&BOP1&NDUFA8&DSCR6&TUBB&WBP4&NPW&FNDC1&LLGL2&VAX2&MEIS2&HCRTR2&SCP2&C9orf119&MYO15B&GMPPA&ABHD2&DENND1A&ORAI3&QPRT&BDKRB1&SNX19&SLC6A6&SEC14L1&TAF12&PSMD3&RPL13AP17&NUP37&TNXB&LOC92659&GPD1&CD6&RSRC1&FTMT&DEFB119&PTRF&FBXO24&RNF39&DNAL4&EN1&UQCRC1&RCSD1&EDNRA&TMEM200A&DDX18&ZNF331&CEP120&FYB&DDX39&FLJ42709&GUCA1B&SAMM50&SRP72&KRTAP24-1&HLA-J&C12orf44&LDHB&RAB5B&NME1-NME2&GMFG&C16orf48&RHBDF1&SNX25&UPF3A&MT3&SENP7&ATG10&CNTFR&ERO1L&SARS&NCAM1&MED27&ZNF467&DHDPSL&FSCB&DAPP1&ATF7&KDM4B&LRRC10&HABP4&LOC732160&PLD1&KDELC1&NFIL3&CHI3L1&SEZ6&DBH&XRCC6BP1&CLEC3B&LEMD2&TTLL11&ZNF655&LYSMD2&IMMT&NEU1&PKIB&HDHD2&CARS&ANKLE2&PHF1&AGTRAP&DNHD1&ZNF432&PNPLA6&AKR7A3&C5orf36&FAM154B&TIAM1&PTGER1&GATA1&RTN4RL1&KIAA1012&ARMC6&CCDC109A&FN1&PXMP2&LOC728758&RPL4&FAM126B&GGA1&DLEC1&RBM38&C16orf62&EMR1&DDX24&TTC21B&SERTAD2&RBM6&FRMPD3&LSMD1&SH3PXD2A&SH2D2A&KLF4&PGM2L1&MRPS24&ZNF747&SKAP2&PRND&CXorf50B&AURKB&KIF19&HAPLN4&IFI16&UIMC1&NIPAL4&LOC653881&SCN3A&TIAF1&LAMB3&C10orf104&LGALS7B&TMEM212&CD151&CLDN9&ZAN&TP53I13&SLC17A9&NENF&HRH2&SOX9&TTC13&GJB5&ZFPM2&CASC4&LOC400752&FTH1&ADRB1&CEBPD&SLC34A3&BCKDK&C6orf173&CYHR1&APBA2&DNAJC11&HNRNPA0&LOC399744&MEIS1&MAGEC1&GLDN&C3orf22&NECAB2&GNRH1&CENPL&HARS&PAWR&TIGD2&PREX2>F3C5&C3orf59&RER1&COQ5&COQ10A&LOC729991-MEF2B&GPATCH8&METTL7B&TFE3&KCTD13&PSMD8&XRCC4&CYB561&RARS2&RCAN1&PELI3&NTN4&SIGLEC16&TRAPPC2&TMIGD2&ACAP3&C5orf46&DSE&RBM7&OSBPL3&TM9SF4&TAF9&ETV7&TNFRSF1A&TAC3&TEX9&KRTAP1-5&PQLC2&CD8A&PRRT1&C9orf140&GLI1&HBP1&RGPD2&SFTPD&FAM131C&LOC91316&ZNF710&GNS&LOC100291242&CBX1&PEX26&MYL10&NF1&LRP5&LYPD3&ARR3&H2AFB3&SPG7&CD2&ZNF561&NAV2&LOC285847&TRAPPC5&ZNF362&SLMO2&ATXN7&TRIM56&FIS1&ELF4&C11orf49&MOBKL2A&IGF2AS&NCKAP5L&WNK4&INCA1&HNRPLL&NKAP&ZNF468&SLC16A2&OXA1L&GK5&SGK2&NEURL3&PSMD2&TOR2A&ZSCAN12&RRAS&SOST&DNAJC1&USP43&LOC284412&PLEKHO2&SST&GLOD4&CHCHD5&PRF1&MAPK7&NUDT22&GPX4&SPSB2&CCDC85B&WIF1&DVL1&GCH1&PRMT1&PPDPF&IRS2&RHOV&DENND2A&CSNK2A2&SRRT&SDK2&RABGGTB&ZNF681&SNRPG&PTP4A3&COMTD1&RAPSN&MUC20&NFATC3&RAMP3&GRTP1&ARHGAP26&TDRD9&HRAS&BSDC1&RBP7&THEM4&FRS3&TNFRSF10C&MEF2B&DMGDH&PCBD2&PTPN4&ITGB2&UBE2K&PHPT1&TEX14&TXNL4A&SRRD&PCTK3&PARVB&MORC1&ELL&APOL1&ENPP2&TBCCD1&SETBP1&AREG&UXT&LOC220729&TGFB1&ALG11&GPR182&LRRC8E&C1orf201&GRIN2A&ARPC1A&RUFY1&MFI2&TXNDC12&ARSA&PTGIR&FOXE3&TOMM22&ULBP1&SLC9A3R2&C19orf44&VWA3A&ARID1B&GP2&WNT10B&RPS24&TPST2&TRAPPC6A&C1orf125&RPAP1&PCSK2&RPL27&ZFAND6&NIPA2&BGN&APOBEC3F&FAM91A1&PARS2&RAB4B&CTSF&C14orf129&C10orf114&POU2F2&PLA2G10&TSPAN14&ATG3&BLK&GPM6A&CLCNKB&TRIP10&B9D2&COBRA1&C11orf83&ZNF3&HYAL2&ABI3&TMEM62&TBC1D10A&SERPINA4&CDH29&NRTN&TWSG1&LOC100287216&POLD4&WNT16&RPP30&EFCAB4A&UBE2T&C15orf44&ELK4&MKKS&GHDC&RECQL5&GCDH&HSD17B7P2&TP53I3&UBE2QL1&SLCO6A1&LOC344595&FLJ44606&AGPAT6&PDE7B&TDP1&C11orf57&TNRC6B&TBC1D16&DNAJB11&PROC&SLCO1C1&AMTN&GLCCI1&OLFM2&ZNF165&FAM83A&DUSP23&KIAA1429&ITGA10&MAGEF1&QSOX2&KDM4A&CLNK&LYPD6B&HERC1&INPP5F&DGCR8&MTUS2&PARVG&DUSP12&LOC728431&CASQ1&IHH&IL19&DIAPH3&C2orf18&DOC2A&BUB3&VIL1&SP7&CCDC107&FLJ35776&DCTN4&CNN2&COL5A3&HNRNPH1&HAS3&LRRC63&TCF7L1&SLC39A4&C2orf52&C12orf49&EGFL8&CD302&FNDC4&CGNL1&RABIF&TMEM102&PKIG&TMED3&IP6K2&SPIN2A&LOC645323&C17orf74&CDRT1&YWHAG&CCS&RMND5A&ZDHHC1&BGLAP&PRKCZ&WDR70&C13orf31&CBWD1&CCL18&TSSC4&LOC146880&COL11A2&MAF1&NRN1&CSNK1E&ORC1L&ANO4&CXCR1&LGALS7&PTGER2&SLC44A3&SDSL&HMHA1&IFT172&FAAH2&MMD2&SCAMP4&NARG1L&MFGE8&C1orf26&RICH2&MAP3K7IP2&SH3TC2&DHH&ACP5&CNPY3&MRM1&PGF&HN1L&ATPIF1&SAG&CTRC&GHRLOS&WDFY3&CLIC4&GPSM1&HIC1&PSMB7&MESDC1&ANKH&OLFM4&FTO&RHOU&TACC1&SH3PXD2B&PPP3R1&ZNF691&ARL17B&USP46&SPRY1&LILRB3&FAM117A&SERPINI1&TUBB4&HDHD3&NLK&IQCE&CD99L2&C21orf99&C19orf70&THSD7A&LRRC23&VPS4B&RASL12&GALNT6&THOC4&BOK&POLL&NDRG1&MRPL46&TMEM136&LRFN1&TMEM203&SRPX2&NKX3-1&CBR3&C19orf52&SLC25A17&FZD5&NR4A1&TTC39A&ST6GALNAC4&CSGALNACT1&TBC1D3G&PRC1&SAMD11&C10orf2&MRPL55&SPATA3&NPHS2&RPS3A&TMPRSS3&OSBPL7&REXO4&CLDN14&ZNF142&LPIN2&ROPN1B&NAPSA&SELPLG&APOOL&SLC38A3&MRPL14&PRG2&PIGQ&CLSTN3&QRICH2&BBS4&KRT20&RPL34&LOC440335&MARK2&AMBN&ATP6V0C&STAT5B&HSD3B2&GNE&TUSC3&C2orf72&METT11D1&CD74&SFRS9&KRTAP4-4&DBNDD1&PHACTR2&SP140&RPRD1A&FEZ1&SLC35E1&LAD1&ZNF880&TMEM126A&PDE5A&LOC728661&PPP2R2A&EMP3&ROBO4&NRGN&COMP&RNASEH2B&RFC1&MTAP&ACSL1&ADORA3&LOC389458&MOCOS&CRIPAK&PRDM10&ARD1A&SPINK4&SLC30A1&GZMB&CDC42EP5&FAM156A&LRRC26&WASH2P&CAPS2&CRIP2&AKR1B1&WASH5P&CCDC56&FOXS1&STIP1&RASL11B&CALN1&ELMO1&ZNF423&USP33&C15orf39&UXS1&ABHD8&CHST7&RAD50&TRIOBP&RBM5&NOP14&ERO1LB&EIF4EBP1&PPP1R9B&DPP9&GSPT1&CDK7&SSR2&GUSB&COPS3&NID2&IL25&GAS2L2&EXTL2&MED21&C16orf57&ST5&DCAF13&PDZD2&BHLHE40&CEP192&GALNT14&C3orf45&P2RY10&CHMP1A&LRSAM1&KIAA1543&CNIH4&VMO1&NXNL1&PTPN6&PLXNB2&MPV17&HTATSF1&TST&LOC647546&ST3GAL4&PDXDC1&TOX2&TMEM200B&SRC&MTA1&SBK1&ZER1&GPR84&IDH3G&ARFGAP3&LRRC8B&SEC14L2&KRT7&RPA3&YIF1A&NLRP4&PGA5&SLITRK2&E2F2&THRA&PTGES2&PLEKHA2&TMEM108&ZNF204P&COL4A6&RASGRP4&GFER&GAS1&PRAC&PQLC1&DDX59&ZNF559&KRT19&PCBD1&ZMYM4&SP3&KIAA1984&ABHD10&GDPD2&IL10RA&NUDT16P&SLC35C1&GAB3&NEURL4&SEZ6L&NDUFB11&SLFN11&TBC1D7&BRMS1L&PET117&FFAR2&SEC11A&LOC653889&RBM41&TP53&PEX5&LENG1&BCL7B&RNH1&C6orf145&C9orf82&ALKBH5&TOMM5&SAA4&FIZ1&SYPL1&FGF13&C11orf48&C14orf139&PBXIP1&CASKIN2&MED24&CXorf40B&EHD1&C19orf61&ATP6V0A1&IFIT1L&C9orf69&ZNF768&ZNF496&DYNC2LI1&SAPS3&CEACAM19&PCOTH&SSPN&TMEM59L&RNF10&FAM168A&FAM78B&TMEM186&ISLR2&MGAT3&SEMA4F&MAGOH&ELAVL1&PIAS4&S100PBP&HRC&IGBP1&KIRREL&PRKCH&STAM2&PIK3R1&CDKN2C&ADCY4&HELZ&ABCB6>F2E2&PTGR2&DLC1&C12orf62&MRPS6&KCNH7&AZI2&NUAK2&XRCC5&AHSG&MDP1&RND2&LOC100288598&KLC2&FXYD1&MASP1&BLZF1&UBE2U&VRK3&CENPK&FAM54A&LMF2&MUC13&DUS1L&C14orf64&NHLH1&TOMM40&GNB1&VGF&TPPP&HPSE&SLCO5A1&FGF21&ZNF404&LARP4&AGBL5&NARG1&MKX&DEDD2&SPANXC&ZBTB3&TLK2&TSGA13&SH3GL2&ST3GAL5&MRPL23&SFMBT1&CPT1C&CLEC11A&GAK&FAM117B&TAF15&SORBS3&C11orf84&LOC400931&SREBF1&DCN&SEC61A2&COL11A1&GPR68&EPAS1&OBFC2A&LOC100131868&UBTF&D2&IFNAR2&TIMP4&LOC100287950&PDE1B&WDR13&MLLT11&COX7C&FAM108B1&WFDC1&ELK3&C2orf39&TBC1D3P2&SEC61B&NCRNA00201&GPX1&SLC39A1&GALNS&PRPF40B&PSAPL1&PNMA3&FAM127B&ARCN1&DHX58&DNAJB14&TPR&TBX6&BPI&ZSCAN20&SPTBN4&TTC4&GCN1L1&BNC2&SERPINA3&MAGED1&ETV1&LOC100292164&IRF9&PARP9&MT2A&LBH&ZFY&HSD17B14&SLC25A41&ZFAND2B&BMP2K&SAMD4B&WNT7B&CEBPE&CHPF&C5orf35&SMAP2&LOC644538&LOC100294332&LPCAT1&CCDC148&SIVA1&CLEC18C&CD3E&SRRM2&C1orf86&HNRNPA1&AMIGO2&PBX2&AANAT&TRIM36&BCAS3&HGS&POLA2&CTTN&KTN1&ABTB1&MYBBP1A&TBC1D8B&HEPACAM&PIM2&RANBP9&NCRNA00181&SLC17A5&HGF&XPO7&TRIM5&RRAGB&ARL8B&GKN2&TRMT5&MLYCD&SOX2&HTRA4&C18orf21&ANKRD58&TMEM206&CACNA1G&AOC2&RCBTB2&THNSL2&BRWD1&ZFAT&VEGFB&C16orf53&RAD51L1&MGC23284&GOLPH3L&DUSP13&FNBP1&EYA2&MAPK8IP1&MLLT4&ACY3&CKAP4&MYADM&C19orf50&C21orf82&TRIM68&PSPH&MFSD3&FAM165B&STEAP1&KLF3&DERL3&KCTD14&NAT14&PFN3&NPDC1&RCN3&ESPL1&RBP5&DBNL&VAMP2&ZAP70&PTN&C1orf106&C14orf72&SPIB&RPL31P11&MYL4&EIF6&ADAMTS18&SLC17A1&CYBA&RGMB&ST7OT3&NCF1B&NFE2&NUFIP2&PCMTD2&FBXL12&TOMM20&ZDHHC2&MBNL2&TAF4B&ZNF189&LOC100294339&MTA2&LOC100292556&AGFG1&KIAA1279&COL22A1&ATP1A3&NID1&PNKP&RASSF7&NUBP2&ZNF783&ATXN7L2&GPR107&HOXC13&AP1G1&NDUFA6&FOXQ1&KLF11&KCNE1&C20orf24&C8orf45&FHL3&SLC37A3&MTCP1NB&SERPINA6&GABARAP&FBXL6&DPYSL2&KLC4&CHID1&C8orf51&PPM1J&DERA&C19orf53&ZFP106&FBP2&DDOST&PRDX6&GPR83&ZNF219&AMBP&LOC100292357&FAM164C&DDX19B&AKAP7&NAPSB&TUBAL3&SOX21&LASS1&CLDN4&SLC22A18&MSL3&MANBAL&FAM46B&FAM22A&RPL29&TMEM86A&KIAA1683&ACACA&LYSMD4&EPHA2&RGS3&SARS2&ZCWPW1&NFATC1&SAMD12&SCYL1&UAP1L1&SLC18A3&SYNGR3&PTPN11&LOC148189&SMAD3&ZBTB22&ZNF669&ZNF581&THAP10&NDUFA11&HTR2C&SLC16A7&LOC283663&FAM192A&PUSL1&RFTN1&DDX47&ATP8B2&ZNF43&LOC100133315&RPL7L1&ARMCX5&ZNF148&CNOT4&PAQR6&MEIS3P1&CMTM1&CAPZA2&KCNA2&LPGAT1&BRMS1&SLC16A12&LGALS1&UBQLN4&CASP10&TRPV6&SRI&LOC100131354&ARMC1&C5orf15&TRIM31&BTN3A2&NPB&ARNT&C17orf59&PI4KA&MRPL12&ZNF574&NDUFS8&BTRC&EIF4EBP3&ZC3H3&TFCP2L1&TRIM3&YEATS2&RBM4&DDAH1&KIAA1797&SLC35B2&EDC3&FNIP1&IPO8&PSMB6&MRAP2&LOC254559&TMCO5A&KIAA1143&SDR42E1&NKRF&C3orf23&LOC100130581&LMF1&ZNF692&HSD17B11&ZNHIT1&HMGN3&C1orf56&C9orf98&CAPN14&CTSW&LOC729991&ANGPTL7&HTN3&TAF2&ALG1L&LOC388789&ADORA2A&FAM7A3&TBX2&COMMD7&MPPED1&CHD3&SLC25A44&COL21A1&LRFN3&TNNI3&GDI1&C3orf47&GATAD2A&PTGES3&TRO&CS&CPSF7&PTRH1&ARHGAP4&NACC2&EXOSC10&CCDC102A&ECE2&FOLR1&MYOT&BCL2L2&EMG1&FBRSL1&GRIN2C&DSG2&MYNN&CNN3&ALOX15&CHGA&PRDM4&ISL2&TECR&NEAT1&LOC338588&CST1&DHRS13&RRP9&RAB26&DCTN3&SH3D20&PRRT4&HTR3C&KIAA0174&SPEM1&GNB1L&SLC6A18&MAPT&ATP2C1&RCC2&CTAG2&MTTP&C1orf64&KCTD5&KHK&RDH5&OGG1&DUSP26&CSTF2T&ZNF410&TMEM165&CRY1&PBRM1&STRADA&EGFL7&ITGB7&DNAJC7&CHKB&LOC100292508&NOL3&BRF1&CCL27&ACTR6&ATP2A1&COG2&PVRIG&EARS2&CCDC109B&AASDHPPT&LOC100190939&PDE9A&PGBD1&LOC285629&ABCA8&PITPNA&RPS2&NDUFA4L2&ZNF585B&RCOR2&FBXW4&STUB1&ILK&SLC25A22&CTPS&MRPS7&DDX42&C4orf19&MTHFD2&NPTX2>F2F2&CDC42SE1&PLA1A&CAMKK1&AP2M1&RPUSD1&CDK6&KIAA1407&SLC22A11&LRIG3&ZNF236&TUFT1&LOC100288778&LILRA2&C3orf10&FBLN1&ANKS1B&GATSL3&VANGL2&QPCTL&DKFZP434L187&INF2&DLG4&ALG13&SGSM1&PRPF6&ZIC1&RAG1AP1&GSN&DPCR1&ADH7&MED11&ZBTB45&CPSF3&SNX4&CD248&CCR2&MYO1H&ZYX&EDN3&RSPH1&SH3KBP1&CERKL&BOLA2&C19orf42&GATAD1&SRBD1&FHL2&C9orf23&PDGFB&C14orf34&ADRA1B&NUDT6&ANO2&CST9L&RNF112&ABCC3&C20orf3&PIP5K1A&TWF2&C2orf89&SUPT3H&ZGLP1&XKR7&LDHA&NPM2&FER1L4&CD207&B4GALT2&LOC645769&HMP19&TTC5&RCVRN&SILV&C10orf140&CD226&PDK2&SLC38A2&PDILT&SPHK1&ATN1&IL34&BEND7&C7orf20&TBXAS1&DPEP3&NCRNA00152&PCTK1&CAP1&KIF2C&SEZ6L2&FLJ39582&TBC1D3C&CDC42EP2&CTRB2&SLC45A2&GAMT&ZNF259&ATG4D&TSPAN33&TREML4&CXorf40A&WDR4&CDC26&FRAT2&UACA&HEXB&CIDEC&CRIM1&PPP1R16A&LOC400965&POMGNT1&SNX2&CRLF1&ATP1B2&SPINK7&NOC2L&C6orf97&EDF1&TUB&ARHGEF18&WDR78&ITM2C&SCAMP5&DCAF7&TCTEX1D2&WBSCR17&GSTT2&OTP&WDR60&AGFG2&AMDHD2&MAN2A1&C20orf196&PPIA&CSNK1D&SNHG7&PTX3&ARFGAP2&ZKSCAN4&TTC15&MRPL50&CIR1&CCK&FTSJ3&KIAA1274&CINP&PRAP1&TYSND1&DEF6&UTP14A&CD3D&OSGEPL1&ERI2&TMEM129&DKC1&STAT6&ZNRF2&THOP1&SCARB1&CES7&ANO7&ATG9A&TFRC&LOC151162&DHX34&COX19&PFDN5&RPL23AP7&MEIS3&NTRK3&MED16&ABLIM2&POLR3C&PLOD3&C7&UROS&TADA1&PEX6&AIP&ZFP82&PBK&ALDOA&MRPS30&C3orf75&CHODL&PMS2L11&ORAOV1&IFRD1&GPHA2&TBX15&GDPD1&PRR14&FUZ&AMIGO1&FBXL19&KIAA1539&TXNIP&DARC&SLC7A8&NUDT3&CRISP3&TMEM41B&FBXL8&AGAP2&CCND3&COASY&DOT1L&DFNA5&ZNF761&GRAMD1A&TROAP&TRPM5&ANXA5&PRICKLE2&SNX7&CPT2&C5orf23&TEF&C9orf114&MTX3&ING2&C19orf20&MYST1&PSTPIP2&TMEM100<B4R&ISG15&FXR1&ZCCHC14&SF1&IDH3A&ZFR2&SCLY&ENTPD5&GPR89B&DHX9&C6orf146&TMSB4Y&HSD3B7&ZNF618&STX3&SLCO4A1&AFG3L1&ARSI&GPR82&TK1&MGAM&RPL26&ZBTB37&KIAA1324L&NDUFB10&SAP30L&H2BFM&SIGIRR&C9orf142&NDUFV3&ARMC3&PRKAR2B&FOSL2&SYT1&RNF207&MMP28&SFRS2&RHPN1&ZNF394&EPHA3&FAM103A1&MOV10&MFAP4&H2AFJ&FAM195B&GZMH&CNNM1&CMAH&LOC400043&TMEM158&FAM108C1&COTL1&TAF6&PGK2&FLJ33630&TYW3&SKAP1&COMMD4&B3GNT8&RPL36&DDX28&ASPM&RRP8&RBCK1&PPARA&ZDHHC8&PCDH1&ACTL6B&SCFD2&PLCG2&CAPZA1&GLRX3&EBF4&C7orf47&BCMO1&NFASC&CLCA4&ZNF512&PSAP&CHM&ATP1A2&TMSB15B&PLEK2&COPS5&HERPUD1&HDX&DUSP6&MAPKAPK5&TOMM6&AFAP1L2&POMP&DGKG&ELK1&GMPPB&ZFP91&C7orf57&AARSD1&TCP10L&NME2&GDAP2&GCC1&COX6B1&SLC36A1&SLC5A6&RAI1&NOP56&RPS20&SEPP1&LRRC24&CNIH2&IGF2&NPEPPS&LRRK1&XPNPEP1&PHF6&FOXO4&ADAMTS1&RNF26&JMJD6&LOC654433&RIN3&HIBCH&PCF11&IQCA1&PLA2G5&TRIM7&AAMP&CYP20A1&MBD6&CYTL1&ZNF238&ZNF23&LOC100288956&NPC1L1&LOC644936&RREB1&LRCH2&TRIM13&GPR115&NAT9&LOC100128822&ZSCAN2&MT1L&DENND1B&C9orf86&SAMD14&C20orf7&TRAPPC1&C22orf29&YIPF1&DCAF15&ATP6V1E2&SEPX1&ADORA1&HOXC9&HES6&DCUN1D1&CYB5R1&RUSC1&DKFZp686A1627&GRIK5&ARRDC3&RPL23AP53&CACNA1A&SERPINB1&SLC1A4&HPCAL1&SPG21&ENY2&ITPA&KIAA1671&ZNF226&EDA&CREG1&HCG4&APH1A&C14orf1&CYP27A1&LOC644613&CCDC82&THAP7&ZNF777&GNPNAT1&XPA&TBC1D10C&APOBEC3H&CCDC33&BRUNOL5&RBM11&EPHA6&PABPC4&R3HCC1&NEU4&DDX6&SLC43A1&TFAP2C&HNRNPM&PCDHB10&GLUL&ZNF71&GAGE12I&C15orf57&COPS8&RASSF2&MYL7&CX3CL1&C16orf89&PRR15&UNC93A&WDR72&PURG&EFNB2&RBM47&ALDH1A1&BCL2L1&TMEM35&C7orf38&ABHD3&RAPGEF3&HELLS&TMEM188&LHX6&MAPK3&KIAA1549&BAG2&AQP12B&IRX2&CBWD3&MICAL3&TRIM38&CD300LB&PRR7&THBS2&LRRC7&TGOLN2&C1orf74&MRPL49&CCT6P1&NHLRC4&FLJ46111&PCDH8&C7orf30&LDHC&GPR146&NOL6&SFTPB&VAMP3&UBE4B&OR51E1&SH2B3&TCIRG1&CYP2W1&STAP2&TBX19&DNTTIP1&RELA&TMEM231&ACAD10&RPL27A&TSEN34&LRRC59&LY6H&TXNDC9&LOC100134713&OTUD5&LARP1B&TMEM22&LYL1&PRKY&ANPEP&COPG&CYP11B1&FAM43A&MED28&WBSCR27&EIF3L&ARMCX6&PTPRA&STOML2&PPP4C&DST&C9orf125&FLAD1&C15orf24&FAM158A&CD48&NCKIPSD&SFRS12&AFMID&SLC46A1&TSC22D4&ARL3&ZNF205&NR1H4&RRM1&RASL10A&COX7A1&PA2G4&THOC6&RPL13&PRDX2&GPC2&TRIM10&CADM1&LRRN3&RILP&CD5&ARHGEF1&ACBD4&ZFAND3&C7orf43&PPAPDC2&ST6GALNAC6&ZDHHC14&TMEM198&TKTL2&CALM3&ACTB&FAM83F&NMI&RGS9&CNKSR1&LOC100292392&MKRN3&IPO11&SLC30A5&ZC3H11A&IYD&CCDC88C&BAI2&PPP2R5D&FAM13AOS&CAP2&VCAM1&C11orf63&STAT2&ILVBL&FAM83D&IFNGR1&OXNAD1&RLTPR&FAM122C&CCDC90A&MRPL21&RBMX&FGFBP2&TMEM213&PLEKHA8&ACMSD&MLEC&KLC1&GALE&TBC1D10B&NCALD&WWTR1&OAF&RNF121&LOC100291035&ACCN1&SLITRK1&MTERFD2&SNAP47&ALS2CL&C9orf68&TMEM219&BCCIP&TLE6&RPL13A&DRAP1&SLC38A1&SARDH&TOMM40L&FLJ40125&RBBP5&PHF20L1&NOG&MYO1F&ST3GAL3&HBS1L&PTBP2&PDS5A&CLEC18A&ME3&PSG6&SMPDL3B&LY6E&SLC39A11&ARHGDIA&NDUFA3&ENPP1&SCNN1A&MGC15885&C2orf77&VWA5B2&ADIPOR2&CDC34&ABCA7&NPY2R&ECHDC2&RTKN&CIRBP&FOXP1&COL6A3&CLEC4G&TMX2&NT5C3L&ZNHIT3&PPM1F&LOC100129138&LOC285375&TMEM179B&NDUFA9&LILRA3&CAMKK2&SPCS2&FDXR&HS6ST3&PEX19&CHSY3&GPX3&TCP11L2&GPM6B&HRNBP3&PAGE5&C4BPB&MICALL2&SS18L1&ACD&SOX11&GNAT2&ST13&CGN&C20orf108&TLCD1&NUDT5&ARRDC1&CABLES1&TUBGCP6&FAM48A&ALKBH8&ZNF222&FAM160B2&COL10A1&SIGLEC11&HIST2H2BF&RLIM&DEFB123&GSK3A&KRT6B&SUPT6H&GIPC1&WASH3P&FAM193B&NTN5&EXOSC6&TRPC4AP&TBC1D29&FKBP9&LAMA4&RABL2A&PMEPA1&RNF157&MOAP1&CFP&HOXD9&CTSZ&ROBLD3&LMNA&HNRNPH2&ZNF250&TMEM48&CASQ2&SAPS1&LOC116437&WNT5B&KLF10&CRYBB2&MYOZ1&LOC221122&DCTN2&SC65&GNGT2&IFT20&APLF&UHRF1&PLA2G4B&L1TD1&BCAT1&ETV6&DLX1&LOC389168&MEX3C&METTL3&VPS13C&TRPS1&HMGA1&ATP5E&ACOX2&ANXA4&ZFYVE19&C3orf53&PTH1R&APBB1IP&C4orf26&ONECUT2&CXCL16&LOC100128292&NF2&NRG1&TOMM7&CALHM2&TBC1D9&PRRT2&CRISPLD2&ZNF557&SYT9&KIAA1267&DGCR2&MARVELD2&DDX3X&GATM&PLXDC1&RASA3&MPG&GLI4&CLCF1&TNFAIP8L2&C2orf16&TFF3&APOL3&CHCHD4&HEYL&SLC17A8&G6PC3&PPP4R4&C21orf58&SUCLA2&LOC100289130&TSPY4&GGA2&EVPLL&SPANXN3&LOC100293983&COQ2&SRF&MAD2L2&ADD2&PKD2L2&LRRC3B&SEMA4C&C7orf40&C3orf21&WDR93&TP63&RBL1&ATP2B1&ZNF358&ORC5L&NUSAP1&C21orf67&ERCC2&LOC100287260&MAMLD1&JOSD2&TTC30A&CRISP1&CDC2L2&LOC552889&PUM1&RAB39&SMCR8&IL11RA&SPANXE&RNF169&SLC39A6&APBA1&RXRBNM_023928.3&NM_032223.2&NM_001127891.1+NM_004530.4&NM_016499.3&NM_005543.2&NM_032409.2&NM_005947.2&NM_152612.2&NM_206825.1+NM_206826.1+NM_014366.4&NM_002205.2&NM_014503.2&NM_005702.2&NR_026914.1&NM_173470.1&NM_145307.2&NM_001064.2+NM_001135056.1+NM_001135055.1&NM_004718.2&NM_001355.3+NM_001084392.1&NM_022767.3&NM_199004.1+NM_004313.3&NM_030819.3+NR_027398.1+NR_027399.1&NM_016256.2&NM_153266.3&NM_152392.2&NM_001166133.1+NM_025074.6&NR_026877.1&NM_003881.2&NM_002531.2&NM_006042.1&NM_015094.2&NM_014940.2&NM_007049.2+NM_078476.1&NM_001144073.1+NM_012124.2&NM_138371.1&NR_027247.1&NM_152770.1&NM_152345.4&NM_181880.1&XR_040734.2+XR_040735.2+XR_040736.2&NM_024296.3&NM_025134.4&NR_015375.1&NM_001042747.1+NM_005248.2+NM_001042729.1&NM_001080395.2&NM_183399.1+NM_183401.1+NM_183400.1+NM_183398.1+NM_004290.3&NM_001024647.2+NM_175624.2+NM_022456.3+NM_175625.2+NM_175623.2&NM_138737.2+NM_014799.2+NM_001130860.1&NM_032741.3+NM_006411.2&NM_004374.2&NM_198267.1+NM_019071.2&NM_001042704.1+NM_004070.3&NM_003817.2&NM_016319.2+NM_001164094.1+NM_001164093.1+NM_001164095.1&NM_145114.1+NM_145113.1+NM_145112.1+NM_145116.1+NM_197957.2+NM_002382.3&NM_007198.3&NM_001006681.1+NM_001006682.1+NM_001006683.1&NM_006338.2+NM_201630.1&NM_015703.3&NM_002537.2&NM_001160355.1+NM_017527.3+NM_001160354.1&NM_017952.5&NM_002593.3&NM_014421.2&NM_014281.3+NM_078480.1+NM_001136033.1&NM_001018104.2+NM_001142398.1+NM_031208.3&NM_152786.1&NM_021814.3&NM_206890.2+NM_001146115.1+NM_206889.2+NM_001146116.1+NM_015151.3+NM_206891.2+NM_001146114.1&NM_002990.3&NM_020824.3&NM_015275.1&NM_021872.2+NM_004358.3+NM_021873.2&NM_032410.3&NM_144603.2+NM_172167.1+NM_172168.1&NM_018448.3&NM_001015880.1+NM_004670.3&NM_202000.2+NM_005622.3&NM_152792.2&NM_198850.3&NM_032408.3&NM_152222.1+NM_032871.3&NM_004466.4&NM_000884.2&NM_138773.1&NM_032265.1+NM_001136046.1&NR_003578.1&NM_017851.4&NM_018291.3+NM_001113411.1&NM_012256.2&NM_198953.1+NM_198952.1+NM_198950.1+NM_198949.1+NM_002452.3+NM_198954.1+NM_198948.1&NM_024641.2&NM_006924.4+NM_001078166.1&NM_001105550.1+NM_001105549.1+NM_001105552.1+NM_001105551.1+NM_001105553.1+NM_018300.3+NM_001105554.1+NR_003936.1&NM_030792.6&NM_018685.2&NM_001042678.1+NM_175744.4+NM_001042679.1&NM_207380.2&NR_026777.1&NM_016644.1&NM_000745.2&NM_016592.2+NM_001077488.1+NM_080426.2+NM_080425.2+NM_001077490.1+NM_000516.4+NM_001077489.1+NR_003259.1&NM_000107.2&NM_004160.3&NM_005676.3+NM_152856.1&NM_020194.4&NM_013238.2&NM_014262.3&NM_013387.3+NM_001003684.1&NM_207356.2&NM_015138.4&NM_004155.4&NM_001561.4&NM_020639.2&NR_024284.1&NM_024038.2&NM_005730.3&NM_003910.3&NM_018208.2&NM_000179.2&NM_173170.1+NM_012275.2&NM_032631.2+NM_001001520.1&NM_031486.1+NM_001007101.1&NM_178817.3+NM_206898.1&NM_001097642.2+NM_000166.5&NM_020826.2&NM_015201.3&NM_014222.2&NM_018962.2&NM_178014.2&NM_007187.3&NM_001099456.2&NM_032532.2&NM_004524.2+NM_001031803.1+NM_001015002.1&NM_012476.2&NM_172316.1+NM_002399.2+NM_170676.2+NM_172315.1+NM_170677.2+NM_170675.2+NM_170674.2&NM_001526.3&NM_001007098.1+NM_002979.3+NM_001007099.1+NM_001007100.1+NM_001007250.1&NM_001040011.1&NR_003587.2&NM_013335.2+NM_205847.1&NM_152924.4+NM_007011.7&NM_024820.2+NM_020946.1&NM_152288.2&NM_014298.3&NM_000710.2&NM_014758.2&NM_001134368.1+NM_001134367.1+NM_003043.3&NM_001039573.2+NM_001143998.1+NM_001144001.1+NM_003003.3+NM_001143999.1&NM_001135218.1+NM_005644.3&NM_002809.2&NR_003680.1&NM_024057.2&NM_032470.3+NM_019105.6&NR_015454.1&NM_005276.2&NM_006725.3&NM_016625.2&NM_177478.1&NM_153323.3+NM_173460.1+NM_153289.2&NM_012232.5&NM_033506.2+NM_012172.4+NM_001163499.1&NM_025236.2+NM_170769.1&NM_005740.2&NM_001426.3&NM_003365.2&NM_052862.3&NM_001166055.1+NR_028596.1+NM_001957.3&NM_052913.2&NM_006773.3&NM_001079906.1+NM_018555.5+NM_001079907.1&NM_153223.3+NM_001166226.1&NM_001465.3+NM_199335.2&NM_005804.2&NR_021490.1+NR_021491.1+NR_015369.1&NM_002098.5&NM_015380.4&NM_006947.3&NM_001085455.1&NR_024240.1&NM_001098673.1+NM_021934.4&NM_002300.5&NM_002868.2&NM_001018136.1&NM_004877.2&NM_032140.1&NM_022450.3&NM_031953.2&NM_023011.2+NM_080687.1&NM_005954.2&NM_020654.3+NM_001077203.1&NM_001131028.1+NM_031482.4&NM_147164.1+NM_001842.3&NM_014584.1&NM_006513.2&NM_001076682.2+NM_000615.5+NM_181351.3&NM_004269.2&NM_207336.1&NM_001134670.1+NM_138413.3&NM_032135.3&NM_014395.2&NM_001130059.1+NM_001130060.1+NM_006856.2&NM_015015.2&NM_201550.2&NM_014282.2&XM_002346479.1&NM_002662.3+NM_001130081.1&NM_024089.2&NM_005384.2&NM_001276.2&NM_178860.4+NM_001098635.1&NM_000787.3&NM_033276.2&NM_003278.2&NM_181336.3+NM_001143944.1&NM_001139442.1+NM_194252.2&NM_001009960.1+NM_001083956.1+NM_001085368.1+NM_138494.2+NM_001009958.1+NM_024061.3+NM_001085366.1+NM_001085367.1&NM_001143917.1+NM_153374.2&NM_001100170.1+NM_001100169.1+NM_006839.2&NM_000434.3&NM_181794.1+NM_032471.4+NM_181795.1&NM_032124.4&NM_139273.2+NM_001751.4+NM_001014437.1+NM_001014438.1&NM_015114.1&NM_002636.4+NR_027692.1+NM_024165.2&NM_001040194.1+NM_001040195.1+NM_001040197.1+NM_001040196.1+NM_020350.4&NM_144666.2+NM_173589.3&NM_014650.2&NM_001166112.1+NM_001166114.1+NM_001166113.1+NM_001166111.1+NM_006702.4&NM_012067.2&NM_001145678.1+NM_173665.2&NM_001008226.1&NM_003253.2&NM_000955.2&NM_002049.3&NM_178568.2&NM_014939.3&NM_033415.2&NM_138357.1&NM_054034.2+NM_212482.1+NM_212476.1+NM_212475.1+NM_002026.2+NM_212474.1+NM_212478.1&NM_018663.1&NR_003571.1&NM_000968.2&NM_173822.3&NM_001001560.1+NM_013365.3+NM_001001561.1&NM_007335.2+NM_007337.2&NM_183425.1+NM_017495.4&NM_020314.4&NM_001974.3&NM_020414.3&NM_024753.3&NM_014755.2&NM_005777.1+NM_001167582.1&XM_001714381.2+XM_042978.6+XM_937007.2&NM_032356.3&NM_014631.2&NM_001161442.1+NM_003975.3+NM_001161443.1+NM_001161441.1+NM_001161444.1&NM_004235.4&NM_173582.3&NM_032014.2&NM_023931.2&NM_003930.3&NM_012409.2&NR_026594.1&NM_004217.2&NM_153209.3&NM_023002.2&NM_005531.2&NM_016290.3&NM_001099287.1&XM_001718435.1&NM_001081677.1+NM_006922.3+NM_001081676.1&NM_004740.3&NM_001127641.1+NM_001017402.1+NM_000228.2&NM_173473.2&NM_001042507.3&NM_001164436.1&NM_001039490.1+NM_139030.3+NM_139029.1+NM_004357.4&NM_020982.3&NM_173059.1+NM_003386.1&NM_138349.2&NM_022082.3&NM_013349.4+NR_026598.1&NM_001131055.1+NM_022304.2&NM_000346.3&NM_024525.3+NM_001122835.1&NM_005268.2&NM_012082.3&NM_177974.1+NM_138423.2&NR_024270.1&NM_002032.2&NM_000684.2&NM_005195.3&NM_080877.2&NM_005881.2+NM_001122957.1&NM_001012507.2&NM_032687.3+NM_001129888.1+NM_138496.1&NM_005503.3+NM_001130414.1&NM_018198.3&NM_006805.3&NR_024497.2&NM_002398.2&NM_005462.4&NM_181789.2&NM_152533.1&NM_019065.2&NM_001083111.1+NM_000825.3&NM_033319.2+NM_001127181.1&NM_002109.3&NM_002583.2&NM_145715.2&NM_024870.2+NM_025170.4&NM_012087.3+NM_001122823.1&NM_178496.3&NM_007033.4&NM_032314.3&NM_001099337.1+NM_144576.3&NR_027308.1+NR_027307.1+NM_005919.3&NM_001002909.1&NM_152637.2&NM_006521.3&NM_178863.2&NM_002812.4&NM_022550.2+NM_022406.2+NM_003401.3&NM_001915.3+NM_001017917.1+NM_001017916.1&NM_020320.3&NM_203417.1+NM_203418.1+NM_004414.5&NM_145065.2+NM_001098510.1&NM_021229.3&NR_002825.1&NM_014563.4+NM_001011658.2+NM_001128835.1&NM_144615.1&NM_030649.2&NM_206966.2&NM_001080976.1+NM_013352.2&NM_016090.2&NM_145322.1+NM_145320.1+NM_145321.1+NM_015550.2&NM_014742.3&NM_003187.4+NM_001015892.1+NM_001015891.1+NM_016283.4&NM_016135.2&NM_001065.2&NM_013251.2&NM_198524.1&NM_031957.1&NM_001040125.1+NM_001040126.1+NM_017765.2&NR_027353.1+NM_001145873.1+NM_001768.6+NM_171827.3&NM_030651.3&NM_178448.3&NM_005269.2+NM_001160045.1+NM_001167609.1&NM_012257.3&NM_001078170.2&NM_003019.4&NM_182623.2&NR_024448.2&NM_198526.2&NM_002076.3&XM_002347979.1&NM_006807.4+NM_001127228.1&NM_017929.4+NM_001127649.1&NM_138403.4&NM_001042492.2+NM_000267.3+NM_001128147.2&NM_002335.2&NM_014400.2&NM_004312.2&NM_080720.1&NM_199367.1+NM_003119.2&NM_001767.3&NM_152289.2&NM_001111018.1+NM_001111019.1+NM_182964.5+NM_145117.4&NR_027117.1&NM_174894.1+NM_001042461.1+NM_001042462.1&NM_152493.2&NM_016045.2&NM_001128149.1+NM_000333.3&NM_030961.1&NM_016068.2&NM_001421.3+NM_001127197.1&NM_001003678.1+NM_001003677.1+NM_024113.3+NM_001003676.1&NM_130807.2&NR_028043.1+NR_028044.1&NM_001037806.3&NM_032387.4&NM_001167986.1+NM_001167985.1+NM_001167987.1+NM_213726.2&NM_001142650.1+NM_138394.3&NM_024528.2&NM_001008801.1+NM_199132.1&NM_006517.3&NM_005015.3&NM_001039547.1&NM_016276.3+NM_170693.1&NR_026875.1&NM_002808.3&NM_001134430.1+NM_001134431.1+NM_130459.2+NM_001085347.1&NR_028077.1+NM_001163391.1&NM_006270.3&NM_025237.2&NM_022365.3&NM_153210.3&NR_029390.1&NM_025201.4&NM_001048.3&NM_016080.3&NM_032309.2&NM_001083116.1+NM_005041.4&NM_002749.3+NM_139034.2+NM_139032.2+NM_139033.2&NM_032344.2+NM_001128613.1+NM_001128612.1&NM_002085.3+NM_001039847.1+NM_001039848.1&NM_001146316.1+NM_032641.3&NM_006848.2&NM_007191.3&NM_004421.2&NM_000161.2+NM_001024070.1+NM_001024024.1+NM_001024071.1&NM_198318.2+NM_001536.3+NM_198319.2&NM_024299.2&NM_003749.2&NM_133639.3&NM_015689.3&NM_001896.2&NM_001128854.1+NM_001128853.1+NM_015908.5+NM_001128852.1&NM_001144952.1&NM_004582.2&NM_138286.2&NM_003096.2&NM_007079.2+NM_032611.1&NM_144589.2&NM_032645.3+NM_005055.3&NM_001098516.1+NM_152673.2&NM_173164.1+NM_173163.1+NM_004555.2+NM_173165.1&NM_005856.2&NM_024719.2&NM_015071.4+NM_001135608.1&NM_153046.2&NM_005343.2+NM_176795.3+NM_001130442.1&NM_001143889.1+NM_018045.6+NM_001143888.1+NM_001143890.1&NM_052960.2&NM_053055.3&NM_006653.3&NM_003841.2&NM_001145785.1&NM_013391.2&NM_032151.4&NM_002830.2&NM_000211.3+NM_001127491.1&NM_001111112.1+NM_005339.4+NM_001111113.1&NM_001135861.1+NM_014172.4&NM_031272.3+NM_198393.2&NM_006701.2&NM_001013694.2&NM_002596.3+NM_212503.2+NM_212502.2&NM_001003828.1+NM_013327.3&NM_014429.3&NM_006532.3&NM_003661.3+NM_001136540.1+NM_145343.2+NM_001136541.1&NM_001130863.1+NM_006209.3+NM_001040092.1&NM_001134415.1+NM_018138.3&NM_001130110.1+NM_015559.2&NM_001657.2&NM_153477.1+NM_004182.2&NR_003266.2&NM_000660.4&NM_001004127.1&NM_007264.3&NM_025061.3&NM_178122.3&NM_001134407.1+NM_000833.3+NM_001134408.1&NM_006409.2&NM_001040451.1+NM_025158.3+NM_001040452.1&NM_033316.3+NM_005929.4&NM_015913.2&NM_000487.4+NM_001085425.1+NM_001085427.1+NM_001085428.1+NM_001085426.1&NM_000960.3&NM_012186.2&NM_020243.4&NM_025218.2&NM_004785.4+NM_001130012.1&NM_032207.2&NM_173615.3&NM_020732.2+NM_175863.2+NM_017519.1&NM_001007242.1+NM_001502.2+NM_001007240.1+NM_001007241.1&NM_003394.2&NM_033022.3+NM_001026.4+NM_001142283.1+NM_001142284.1+NM_001142282.1+NM_001142285.1&NM_003595.3+NM_001008566.1&NM_024108.1&NM_182766.2+NM_144696.3&NM_015540.2&NM_002594.2&NM_000988.3&NM_019006.2&NM_030922.5+NM_001008860.1+NM_001008892.1+NM_001008894.1&NM_001711.4&NM_001006666.1+NM_145298.5&NM_144963.2&NM_152268.2&NM_016154.3&NM_003793.3&NM_016472.3&NM_001010911.2&NM_002698.2&NM_003561.1&NM_030927.2+NM_001128309.1&NM_022488.3&NM_001715.2&NM_201591.1+NM_201592.1+NM_005277.3&NM_001165945.1+NM_000085.3&NM_004240.2&NM_030578.3&NM_015456.3&NM_001085372.1&NM_032924.3+NM_017715.2&NM_003773.3+NM_033158.3&NM_001135186.1+NM_016428.2&NM_024956.3&NM_031937.1&NM_006215.2&NM_001007540.2&NM_004558.3&NM_020648.5&NR_029193.1&NM_021173.3&NM_016087.2+NM_057168.1&NM_006413.4+NM_001104546.1&NM_173584.3&NM_014176.3&NM_030800.1+NM_001136043.1&NM_001973.2+NM_021795.2&NM_018848.2+NM_170784.1&NR_024573.1+NM_032484.4+NM_001142622.1+NM_001142623.1&NM_004259.5+NM_001003715.2+NM_001003716.2&NM_000159.2+NM_013976.2&NR_003086.1&NM_147184.1+NM_004881.2&NM_001145161.1&NM_173488.3&NR_028301.1+NR_028302.1&NM_001164479.1+NM_001164478.1&NM_178819.3&NM_018945.3&NM_018319.3+NM_001008744.1&NM_001082969.1+NM_001082970.1+NM_018195.3&NM_001024843.1+NM_001162501.1+NM_015088.2&NM_019020.2&NM_016306.4&NM_000312.2&NM_001145946.1+NM_001145944.1+NM_017435.4+NM_001145945.1&NM_212557.2&NM_138426.2&NM_058164.2&NM_003447.2&NM_032899.4+NM_207006.1&NM_017823.3&NM_183009.1+NM_015496.3&NM_003637.3&NM_022149.4&NM_181701.3&NM_014663.2&NM_052964.2&NM_177964.3&NM_003922.3&NM_014937.2+NR_003252.1+NR_003251.1&NM_022720.5&NM_015233.5+NM_001033602.2&NM_001137605.1+NM_001137606.1+NM_022141.5+NR_024428.1+NR_024427.1+NR_024426.1&NM_007240.1&XM_001716728.2+XM_001127447.2+XM_001132105.2&NM_001231.4&NM_002181.2&NM_013371.2+NM_153758.1&NM_001042517.1+NM_030932.3&NM_017877.3&NM_003586.2&NM_004725.3+NM_001007793.2&NM_007127.2&NM_152860.1&NM_174923.1&NR_024101.1&NM_001135644.1+NM_001135643.1+NM_016221.3&NM_201277.1+NM_004368.2&NM_015719.3&NM_005520.2&NM_138612.1+NM_005329.2&XM_001718341.1+XM_001714777.1+XM_001716651.1&NM_031283.1&NM_130849.2+NM_017767.2&NR_024079.1&NM_024738.1&NM_030652.2&NM_014880.4&NM_022823.2&NM_032866.3&NM_002871.3&NM_178518.2&NM_007066.3+NM_181804.1+NM_181805.1&NM_007364.2&NM_001005910.1+NM_001005911.1+NM_001146178.1+NR_027438.1+NM_001146179.1+NR_027437.1+NM_001005909.1+NM_016291.2&NM_019003.3&NR_024384.1+NR_024383.1+NR_015436.1&NM_175734.4&NM_006382.3&NM_012479.3&NM_005125.1&NM_022780.3&NM_013304.2&NM_199173.3&NM_001033581.1+NM_001033582.1+NM_002744.4&NM_018034.2&NM_001128303.1+NM_153218.2&NM_001145356.1+NM_001145355.1+NM_018491.3&NM_002988.2&NM_005706.2&NR_027487.2+NR_026899.1&NM_001163771.1+NM_080680.2+NM_080681.2+NM_080679.2&NM_032272.4&NM_016588.2&NM_152221.2+NM_001894.4&NM_004153.2&NM_178826.3&NM_000634.2&NM_002307.3&NM_000956.3&NM_152369.3+NM_001114106.1&NM_138432.2&NM_012292.2&NM_015662.1&NM_174912.3&NM_001100600.1+NM_198403.3&NM_079834.2&NM_018527.2+NM_001110798.1+NM_024561.4&NM_001114614.1+NM_005928.2&NM_001105518.1+NM_017673.6&NM_014859.4&NM_015093.3&NM_024577.3&NM_021044.2&NM_001611.3+NM_001111034.1+NM_001111036.1+NM_001111035.1&NM_006586.3&NM_024864.3&NM_002632.4&NM_144570.2&NM_178190.1+NM_016311.3+NM_178191.1&NM_000541.4&NM_007272.2&NR_024145.1+NR_024144.1+NR_024146.1+NR_004431.2&NM_178585.2+NM_178583.2+NM_014991.4&NM_013943.2&NM_001145638.1+NM_015597.4+NM_001145639.1&NM_001098202.1+NM_006497.3&NM_002799.2&NM_022566.2&NM_054027.4&NM_006418.3&NM_001080432.2&NM_021205.4&NM_001146216.2+NM_006283.2+NM_001122824.1&NM_001017995.2&NM_000945.3&NM_015911.2&NM_001039083.3+NM_001103154.1&NM_022832.3+NM_001134223.1&NM_005841.1+NM_199327.1&NM_001081450.1+NM_006864.2&NM_030802.3&NM_001122752.1+NM_005025.4&NM_006087.2&NM_031219.2&NM_016231.4&NM_001100390.1+NM_152558.3&NM_134445.2+NM_031462.2+NM_134446.2&NR_026916.1&NM_205767.1&NM_015204.2&NM_006992.3+NM_001135217.1+NM_201650.2&NM_004869.3&NM_016563.2&NM_007210.3&NM_005782.3&NM_032515.3&NM_013274.2&NM_006096.3+NM_001135242.1&NM_022163.3&NM_174926.1&NM_020862.1&NM_053045.1&NM_014467.2&NM_006167.3&NM_001236.3&NM_138358.2&NM_006358.2&NM_003468.3&NM_002135.3+NM_173157.1&NM_001144832.1+NM_001080494.2&NM_175039.3+NM_175040.3&NR_024040.1+NM_001130518.1+NM_018371.4&NM_001040282.2&NM_199414.1+NM_199413.1+NM_003981.2&NM_152486.2&NM_001163813.1+NM_001163812.1+NM_001163814.1+NM_021830.4&NM_181464.2+NM_181454.2+NM_181463.2+NM_181455.2+NM_181462.2+NM_181465.2+NM_181456.2+NM_181441.2&NM_139073.3&NM_014625.2&NM_001006.3&NR_027348.1+NM_024022.2+NM_032405.1&NM_145798.2&NM_020385.2&NM_144492.2+NM_001146078.1+NM_001146079.1+NM_012130.2+NM_001146077.1&NM_001105537.1&NM_014646.2&NM_001012337.1&NM_004851.1&NM_003006.3&NM_198450.3&NM_006841.4&NM_032111.2&NM_002728.4&NM_148920.1+NM_004204.2&NM_014718.3&NM_032134.1&NM_033028.3&NM_019010.1&NM_033625.2+NM_000995.3&NR_029454.1+NR_029453.1+NR_029455.1&NM_017490.3+NM_004954.4+NM_001039469.2+NM_001163297.1+NM_001163296.1&NM_016519.4&NM_001694.2&NM_012448.3&NM_001166120.1+NM_000198.3&NM_001128227.1+NM_005476.4&NM_178234.1+NM_006765.2&NM_001144994.1&NM_022734.2+NM_001029991.1&NM_004355.2+NM_001025159.1+NM_001025158.1&NM_003769.2&NM_032524.1&NM_024043.2+NM_001042610.1&NM_001100165.1+NM_001100164.1+NM_001100166.1+NM_014721.2&NM_001005176.2+NM_007237.4&NM_018170.3&NM_022549.2+NM_005103.3&NM_024881.4&NM_005558.3&NM_001145434.1&NM_032273.2&NM_033437.2+NM_001083.3+NM_033430.2&NM_001110781.1&NM_002717.2&NM_001425.2&NM_019055.5&NM_001126181.1+NM_006176.2&NM_000095.2&NM_001142279.1+NM_024570.2&NM_002913.3&NM_002451.3&NM_001995.2&NM_001081976.1+NM_000677.3+NM_020683.6&NR_015343.1&NM_017947.2&NM_175918.3&NM_020228.2+NM_199438.1+NM_199439.1+NM_199437.1&NM_003491.2&NM_014471.1&NM_021194.2&NM_004131.4&NM_145057.2&NM_014138.3&NM_001013653.2&NR_024077.2&NM_032606.3&NM_001312.2&NM_001628.2&NR_024540.1&NM_001040431.1&NM_004118.3&NM_006819.2&NM_023940.2&NM_001017440.2+NM_031468.3&NM_001039459.1+NM_014800.9+NM_130442.2&NM_015069.2&NM_201626.1+NM_015017.3+NM_201624.1&NM_015492.4&NM_025076.3&NM_024527.4&NM_019886.2&NM_133482.1+NM_005732.2&NM_138632.2+NM_007032.5+NM_001039141.2&NM_005778.1&NM_003703.1&NM_019891.3&NM_004095.3&NM_032595.3&NM_139159.4&NM_001130006.1+NM_002094.3+NM_001130007.1&NM_001799.3&NM_003145.3&NM_000181.3&NM_003653.2&NM_007361.3&NM_172314.1+NM_022789.2&NM_139285.2&NM_001033025.1+NM_001439.2&NM_004264.3&NM_024598.2&NM_213618.1+NM_139157.2+NM_005418.3&NM_015420.6&NM_178140.2&NM_003670.2&NM_032142.3&NM_024572.2&NM_153215.1&NM_198333.1+NM_014499.2&NM_002768.2+NM_001083314.1&NM_001005373.1+NM_001005374.1+NM_138361.3&NM_020902.1+NM_001080429.2&NM_014184.2&NM_001144941.1+NM_182566.2+NM_001144940.1+NM_001144939.1&NM_138454.1&NM_080549.3+NM_002831.5+NM_080548.4&NM_012401.2&NM_002437.4&NM_014500.4+NM_001163280.1&NM_003312.4&XM_936601.4&NM_006278.1&NM_015027.2&NM_001098796.1+NM_001098797.1+NM_032883.2+NM_001098798.1&NM_001003682.2&NM_198291.1+NM_005417.3&NM_004689.3&NM_001024401.2&NM_006336.2&NM_020370.1&NM_004135.2+NM_174869.1&NM_001142293.1+NM_014570.4&NM_001134476.1+NM_015350.2&NM_012429.2+NM_033382.1&NM_005556.3&NM_002947.3&NM_020470.2&NM_134444.4&NM_014224.1&NM_001144005.1+NM_001144009.1+NM_001144010.1+NM_001144003.1+NM_001144006.1+NM_032539.3+NM_001144004.1+NM_001144007.1+NM_001144008.1&NM_004091.2&NM_003250.4+NM_199334.2&NR_027812.1+NM_025072.5+NR_027811.1&NM_021623.1&NM_023943.2+NM_001136469.1&NR_002722.2+NR_024553.1&NM_001847.2+NM_033641.2&NM_001146205.1+NM_001146206.1+NM_001146203.1+NM_001146207.1+NM_001146202.1+NM_170604.2+NM_001146204.1&NM_005262.2&NM_002048.2&NM_032391.2&NM_001146345.1+NM_025078.4+NM_001146343.1&NM_001031725.4&NM_032497.1&NM_002276.4&NM_000281.2&NM_005095.2&NM_001017371.3+NM_003111.3&NM_001039374.3&NM_018394.2&NM_017711.2&NR_026691.1+NM_001558.3&NR_027766.1+NR_002949.2&NM_001145265.1+NM_018389.4+NM_001145266.1&NM_001081573.1+NM_080612.2&NM_032442.2+NM_001005408.1&NM_021115.3&NR_024234.2+NM_019056.5+NM_001135998.1+NR_024235.1&NM_001104589.1+NM_001104588.1+NM_152270.3+NM_001104590.1+NM_001104587.1&NM_001143966.1+NM_016495.3+NM_001143965.1+NM_001143964.1&NM_032352.3&NM_001164811.1&NM_005306.2&NM_014300.2&XM_001713844.2&NM_018301.2&NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.1&NM_000319.4+NM_001131023.1+NM_001131024.1+NM_001131025.1+NM_001131026.1&NM_024316.1&NM_001707.2&NM_203383.1+NM_203385.1+NM_203388.1+NM_203387.1+NM_203386.1+NM_203389.1+NM_002939.3+NM_203384.1&NM_183373.3&NM_001167575.1+NM_024828.3&NM_017758.3&NM_001134484.1+NM_001001790.2+NM_001134485.1&NM_006512.2&NM_032836.2&NM_182715.1+NM_006754.2&NM_033642.2+NM_001139501.1+NM_001139502.1+NM_004114.3+NM_001139498.1+NM_001139500.1&NM_024099.3&NR_026779.1&NM_020524.2&NM_001142643.1+NM_020753.3&NM_014815.3+NM_001079518.1&NM_001013845.1&NM_006795.2&NM_019108.2&NM_001130021.1+NM_001130020.1+NM_005177.3&NM_001010987.1&NM_152833.2&NM_024671.3&NM_032752.1&NM_015522.2+NM_001012665.1+NM_016008.2&NM_001164163.1+NM_001164164.1+NM_018312.4+NM_001164160.1+NM_001164162.1+NM_001164161.1&NM_001127893.1+NM_020219.3&NM_001014442.2+NM_001135816.1&NM_001135823.1+NM_005086.4&NM_012109.2&NM_014868.4&NM_015159.1&NM_001017961.2&NM_015421.3&NM_001130138.1+NM_020851.2+NM_001130137.1+NM_001130136.1&NM_001098270.1+NM_002409.4&NM_004263.3&NM_002370.2&NM_001419.2&NM_015897.2&NM_022753.2+NM_001017406.1&NM_002152.2&NM_001551.2&NM_018240.5&NM_006255.3&NM_005843.4&NM_181504.2+NM_181523.1+NM_181524.1&NM_001262.2+NM_078626.2&NM_139247.2&NM_014877.3&NM_005689.1&NM_002095.4&NM_001146154.1+NM_152444.2+NM_001146155.1&NM_024767.3+NM_001164271.1+NM_006094.4+NM_182643.2&NM_032901.2&NM_032476.3&NM_173162.1+NM_033272.2&NM_022461.3+NM_001134433.1+NM_001134432.1&NM_030952.1&NM_021141.3&NM_001622.2&NM_138476.2&NM_005440.4&XM_002347140.1+XM_002342996.1+XM_002342997.1+XM_002347141.1&NM_001134776.1+NM_001134775.1+NM_022822.2+NM_001134774.1&NM_021902.2+NM_005031.3&NM_001031849.1+NM_001879.4+NM_139125.2&NM_003666.2&NM_152489.1&NM_001025778.1+NM_016440.3&NM_022145.3&NM_138419.3+NM_001099286.1&NM_033200.2&NM_033049.2&NM_022156.3&NR_015430.1&NM_005598.3&NM_001128917.1+NM_006114.2+NM_001128916.1&NM_002074.2&NM_003378.3&NM_007030.2&NM_001098540.1+NM_001166498.1+NM_006665.4&NM_030958.2+NM_001146008.1+NM_001146009.1&NM_019113.2&NM_001033719.2&NM_052879.3+NM_199188.1+NM_199190.1&NM_001035507.2+NM_021831.5&NM_057175.3&NM_173576.2&NM_133328.2&NM_022661.2&NM_024784.3&NM_001112707.1+NM_006852.3&NM_052933.2&NM_003026.2&NM_001042437.1+NM_003896.3&NM_021134.3&NM_001005159.1+NM_016329.2+NM_001005158.1&NM_152359.1+NM_001136052.1&NM_002975.2&NM_005255.2&NM_173511.3&NM_003487.2+NM_139215.1&NM_005775.4+NM_001018003.2&NM_138471.1&NR_027033.1&NM_004176.4+NM_001005291.2&NM_133505.2+NM_001920.3+NM_133504.2+NM_133506.2+NM_133503.2+NM_133507.2&NR_024576.1+NR_024577.1+NM_001142627.1+NM_001142628.1+NM_018144.3&NM_001168249.1+NM_001854.3+NM_080629.2+NM_080630.2&NM_003485.3&NM_001430.4&NM_001031716.2+NR_024415.1&XR_036945.2+XR_038143.2&NM_014233.2+NM_001076684.1+NM_001076683.1&NM_139156.2+NM_203404.1+NM_004037.6&NM_207584.1+NM_000874.3+NM_207585.1&NM_003256.2&XM_002343658.1&NM_001165975.1+NM_000924.3&NM_001166426.1+NM_017883.4+NR_029427.1&NM_006818.3&NM_001867.2&NM_001025780.1+NM_016014.2&NM_021197.2&NM_005230.2&NM_145038.2&NR_027486.1&NM_006808.2&NR_026778.1&NM_201397.1+NM_000581.2&NM_014437.3&NM_000512.4&NM_012272.1+NM_001031698.1&NM_001085382.1&NM_013364.4&NM_001078172.1+NM_001134321.1&NM_001142281.1+NM_001655.4&NM_024119.2&NM_001031723.2&NM_003292.2&NM_004608.3&NM_001725.2&NM_145238.3&NM_020971.2+NM_025213.2&NM_004623.3&NM_006836.1&NM_017637.5&NM_001085.4&NM_001005332.1+NM_001005333.1+NM_006986.3&NM_001163148.1+NM_001163150.1+NM_001163151.1+NM_001163149.1+NM_001163147.1+NM_004956.4+NM_001163152.1&XM_002345312.1&NM_006084.4&NM_001146105.1+NM_031458.2+NM_001146102.1+NM_001146103.1+NM_001146104.1+NM_001146106.1&NM_005953.3&NM_030915.3&NM_001145275.1+NM_003411.3+NM_001145276.1&NM_016246.2&NM_173637.3&NM_138802.1&NM_198892.1+NM_017593.3&NM_018028.2&NM_058238.2&NM_001805.2&NM_024536.5&NM_153706.2&NM_022733.1&NM_001163438.1&XM_002344060.1&NM_024830.3&NM_138803.2&NM_021709.2+NM_006427.3&NM_173619.2&NM_000733.3&NM_016333.3&NM_182533.2&NM_031157.2+NM_002136.2&NM_001143668.1+NM_181847.4&NM_002586.4&NM_001088.2+NM_001166579.1&NM_018700.3+NM_001017397.1+NM_001017398.1&NM_001099432.1+NM_017679.3&NM_004712.3&NM_002689.2&NM_138565.1+NM_005231.3&NM_182926.2+NM_001079521.1+NM_001079522.1+NM_004986.2&NM_032548.2+NM_172027.1+NM_172028.1&NM_001105538.1+NM_014520.3&NM_198881.1+NM_017752.2&NM_152722.4&NM_006875.3&NM_005493.2&NR_015380.1&NM_012434.4&NM_001010933.1+NM_001010931.1+NM_001010932.1+NM_001010934.1+NM_000601.4&NM_001100162.1+NM_015024.4+NM_001100161.1&NM_033093.1+NM_033034.1+NM_033092.1&NM_016656.3+NM_006064.4&NM_018184.2&NM_182536.2&NM_020810.2&NM_012213.2&NM_003106.2&NM_153692.3&NM_031446.3&NM_001105576.2&NM_018252.2&NM_198387.1+NM_198388.1+NM_198384.1+NM_198380.1+NM_198377.1+NM_198378.1+NM_198385.1+NM_198397.1+NM_198376.1+NM_198396.1+NM_198386.1+NM_198379.1+NM_018896.3+NM_198382.1+NM_198383.1&NM_009590.2+NM_001158.3&NM_001268.2&NM_018271.3&NM_018963.3+NM_001007246.1+NM_033656.2&NM_001167583.1+NM_020863.3+NM_001029939.2&NM_003377.3&NM_024516.3&NM_002877.4+NM_133510.2+NM_133509.2&NR_024399.1+NR_024402.1&NM_018178.5&NM_016364.3+NM_001007271.1+NM_001007272.1+NM_001007273.1&NM_015033.2&NM_172110.3+NM_005244.4&NM_005456.2&NM_001040001.1+NM_001040000.1+NM_005936.2&NM_080658.1&NM_006825.3&NM_001020820.1+NM_001020821.1+NM_138373.3+NM_001020819.1+NM_001020818.1&NM_024069.2&NR_027267.1+NR_027266.1&NM_018073.5&NM_004577.3&NM_138431.1&NM_058182.4&NM_012449.2&NM_016531.5&NM_198440.3+NM_001002862.2+NM_001135751.1&NM_023930.3&NM_020378.2&NM_001029886.2&NM_015392.3&NM_020650.2&NM_012291.4&NM_031491.2&NM_014063.6+NM_001014436.2+NM_001122956.1&NM_014232.2&NM_207519.1+NM_001079.3&NM_002825.5&NM_018265.2+NM_001142569.1&NR_026774.1&NM_003121.3&NR_002595.1&NM_001002841.1+NM_002476.2&NM_181466.1+NM_002212.2+NM_181468.1&NM_199355.2&NM_005074.3&NM_000101.2&NM_001012761.2&NR_002332.1&NR_003186.1&NM_006163.1+NM_001136023.1&NM_020772.2&NM_001104925.1+NM_018257.2&NM_017703.1&NM_014765.2&NM_016353.4&NM_144778.2+NM_207304.1&NM_005640.1&NM_003452.2+NM_197977.1&XM_002344066.1&NM_004739.2&XR_078903.1&NM_001135189.1+NM_001135187.1+NM_001135188.1+NM_004504.4&NM_015634.2&NM_152888.1&NM_152296.3&NM_002508.2&NM_007254.2&NM_001143993.1+NM_003475.3+NM_001143994.1&NM_012225.2&NR_015357.2&NM_153340.4&NM_001136557.1+NM_001136558.1+NM_020960.4&NM_017410.2&NM_001128.5+NM_001030007.1&NM_002490.3&NM_033260.3&NM_003597.4&NM_001127670.1+NM_001127669.1+NM_000219.3+NM_001127668.1&NR_026562.1+NM_018840.2+NM_199483.1&NM_001136161.1+NM_001136160.1+NM_173518.4&NM_004468.3&NM_032295.2+NM_207113.1&NM_001018024.2&NM_001756.3&NM_007278.1&NM_012162.1+NM_024555.3&NM_001386.4&NM_138343.2+NM_201521.1+NM_201523.1+NM_201522.1&NM_001142676.1+NM_001142677.1+NM_023947.3+NM_001142674.1+NM_001142675.1&NR_026785.1&NM_005167.5&NM_015954.2&NM_014047.2&NM_022473.1&NM_003837.2&NM_005216.4&NM_004905.2&NM_016540.3&NM_016423.2+NM_001102454.1+NM_001101672.1&NM_001633.3&XM_002344491.1+XM_002344492.1&NM_024643.2+NM_001042430.1&NM_007242.4+NM_001014449.1+NM_001014451.1&NM_016377.2+NM_138633.1+NM_004842.2&NR_002798.1&NM_024803.1&NM_007084.2&NM_198207.2+NM_021267.3&NM_001305.3&NM_183233.2+NM_002555.5&NM_006800.2+NM_078629.2+NM_078628.1+NM_078630.1&NM_022077.3+NM_001003897.1&NM_052943.3&NM_001099338.1&NM_000992.2&NM_153347.1&NM_001145305.1+NM_001145304.1+NM_025249.3&NM_198836.1+NM_198839.1+NM_198838.1+NM_198834.1+NM_198837.1&NM_152449.2&NM_004431.2&NM_144488.4+NM_144489.2+NM_021106.3+NM_130795.2+NM_017790.3+NM_134427.1&NM_001145901.1+NM_017827.3&NM_017984.3&NM_006162.3+NM_172388.1+NM_172389.1+NM_172390.1+NM_172387.1&NM_001101676.1+NM_207506.2&NM_001048218.1+NM_020680.3&NM_207309.2&NM_003055.2&NM_004209.4&NM_002834.3&NR_027301.1&NM_005902.3+NM_001145104.1+NM_001145103.1+NM_001145102.1&NM_005453.4+NM_001145338.1&NM_024804.2+NM_001142572.1&NM_016535.3&NM_020147.2&NM_175614.2&NM_000868.2&NM_004731.3&NR_024433.1&NM_024946.2&NM_153339.1&NM_015150.1&NM_016355.3+NM_201224.1&NM_001005855.1+NM_020452.3&NM_003423.2&NR_029192.1&NM_198486.2&NM_022838.2&NM_021964.2&NM_013316.2+NM_001008225.1&NM_198406.1+NM_024897.2&NR_002211.1&NM_181268.2+NM_052999.3+NM_181296.2+NM_181269.2+NM_181272.2+NM_181283.2+NM_181271.2+NM_181270.2&NM_006136.2&NM_004974.2&NM_014873.2&NM_015399.3+NM_001024957.1&NM_213606.2&NM_002305.3&NM_020131.3&NM_032977.3+NM_001230.4+NM_032974.3&NM_018646.2&NM_003130.2+NM_198901.1&XM_001718006.2+XM_001719406.1&NM_018120.3&NM_020199.2&NM_007028.3&NM_007047.3&NM_148896.3&NM_178427.1+NM_001668.2+NM_178426.1&NM_017622.2&NM_002650.2+NM_058004.2&NM_002949.2&NM_022752.5&NM_002496.2&NM_033637.2+NM_003939.3&NM_003732.2&NM_015117.2&NM_014553.2&NM_033278.2+NM_006458.2&NM_018023.4&NM_002896.2&NM_012137.3+NM_001134445.1&NM_017794.3&NM_178148.2&NM_001142443.1+NM_001142444.1+NM_025083.3&NM_133372.2+NM_001008738.2&NM_006390.2&NM_002798.1&NM_138409.2&NR_015411.1&NM_152453.2&NM_020696.3&NM_145168.2&NM_017544.2&NM_173826.3+NM_001029840.2+NM_001029839.2&NR_027412.1+NR_027413.2&NM_022773.2&NM_017865.2+NM_001136036.1&NM_016245.3&NM_006349.2&NM_138730.1+NM_004242.2&NM_017860.3&NM_152572.2&NM_001145122.1&NM_001335.3&NM_001145784.1+NM_001145783.1&NM_021146.2&NM_000200.2&NM_003184.3&NM_001015050.1&NR_015432.1&NM_000675.4&NR_026859.1&NM_005994.3&NM_053041.2+NM_001099339.1&NM_001044370.1&NM_001005271.2+NM_001005273.2+NM_005852.3&NM_014655.2&NM_030820.3&NM_024509.1&NM_000363.4&NM_001493.2&NR_026991.1&NM_017660.3&NM_006601.5&NM_177556.1+NM_001039705.1+NM_016157.2&NM_004077.2&NM_001142565.1+NM_024811.3+NM_001136040.2&NM_001002913.1&NM_001164741.1+NM_001666.4&NM_144653.3&NM_002685.2+NM_001001998.1&NM_033212.3&NM_032331.3+NM_001100120.1+NM_001037324.2+NM_014693.3+NM_001100121.1&NM_016725.2+NM_016724.2+NM_000802.3+NM_016729.2&NM_001135940.1+NM_006790.2&NM_004050.3&NM_006331.6&NM_001142641.1&NM_000835.3&NM_001943.3&NM_018657.3&NM_001839.3&NM_001140.3&NM_001275.3&NM_012406.3&NM_145805.1&NM_138501.4&NR_028272.1&NR_015425.1&NM_001898.2&NM_144683.3&NM_004704.3&NM_014353.4&NM_024348.2+NM_007234.3&NM_174919.3&NM_001114726.1&NM_130770.2&NM_014761.2&NM_199339.2&NM_053004.2&NM_182632.2&NM_016841.3+NM_001123067.2+NM_016835.3+NM_001123066.2+NM_016834.3+NM_005910.4&NM_001001486.1+NM_001001485.1+NM_001001487.1+NM_014382.2&NM_018715.2+NM_001136204.1&NM_172377.2+NM_020994.2&NM_000253.2&NM_178840.2&NM_018992.3&NM_000221.2+NM_006488.2&NM_002905.3&NM_002542.5+NM_016820.3+NM_016819.3+NM_016829.2+NM_016828.2+NM_016827.2+NM_016821.2+NM_016826.2&NM_024025.1&NM_015235.2&NM_021188.1&NM_018475.3&NM_004075.3&NM_018165.4+NM_018313.4+NM_181042.3&NM_001003786.2+NM_001003788.2+NM_001003787.2+NM_001165970.1+NM_153335.5+NM_001165969.1&NM_201446.1+NM_016215.3&NM_000889.1&NM_001144766.2+NM_003315.3+NR_029431.1&NM_005198.4&XM_002344779.1&NM_003946.3&NM_145685.2+NM_001519.2&NM_006664.2&NM_022496.3&NM_173201.2+NM_004320.3&NM_007357.2+NM_001145036.1&NM_024070.3&NM_001083614.1+NR_003501.1&NM_017918.4&NM_015423.2&NR_024458.1&NM_001001582.1+NM_001001576.1+NM_001001575.1+NM_001001579.1+NM_001001585.1+NM_001001573.1+NM_001001577.1+NM_001001572.1+NM_001001581.1+NM_001001584.2+NM_001001578.1+NM_001001567.1+NM_002606.2+NM_001001580.1+NM_001001574.1+NM_001001583.1+NM_001001568.1+NM_001001570.1+NM_001001571.1+NM_001001569.1&NM_032507.2&NR_027111.1&NM_007168.2&NM_006224.3&NM_002952.3&NM_020142.3&NM_152279.2&NM_173587.3&NM_022039.3&NM_005861.2&NM_001014795.1+NM_004517.2+NM_001014794.1&NM_024698.4&NM_001905.2&NM_015971.3&NM_007372.2+NM_203499.1&NM_001104629.1+NM_018302.2&NR_027405.1+NM_006636.3&NM_002523.2&NM_004128.2&NM_020239.3+NM_001038707.1&NM_015900.2&NM_032294.2+NM_172206.1+NM_172207.2&NM_004068.3+NM_001025205.1&NM_058192.2&NM_001259.6+NM_001145306.1&NM_020817.1&NM_018484.2&NM_153377.3+NM_001136051.1&NM_007345.3&NM_001126337.1+NM_020127.2&NR_028269.1&NM_001130917.1+NM_006866.2&NM_018462.4&NM_001996.2+NM_006487.2+NM_006485.3+NM_006486.2&NM_181670.2+NM_020140.2+NM_152788.3&NM_001037666.2&NM_020335.1&NM_001163377.1+NM_017659.3&NR_026771.1&NM_032714.1+NM_001031714.3+NM_022489.3&NM_001128827.1+NM_001365.3&NM_018466.3&NM_001098497.1+NM_001039948.2+NM_133454.2+NM_001098498.1&NM_012469.3&NM_003412.3&NM_018845.3+NM_001122837.1+NM_001122839.1&NM_000177.4+NM_001127662.1+NM_001127665.1+NM_198252.2+NM_001127666.1+NM_001127667.1+NM_001127663.1+NM_001127664.1&NM_080870.3&NM_001166504.1+NM_000673.4&NM_001001683.2&NM_032792.2&NM_016207.2&NM_003794.2&NM_020404.2&NM_001123041.2+NM_001123396.1&NM_001101421.3&NM_001010972.1+NM_003461.4&NM_207032.1+NM_207033.1+NM_000114.2+NM_207034.1&NM_080860.2&NM_031892.2+NM_001024666.2&NM_001160277.1+NM_201548.4+NM_001030311.2+NM_001030313.2+NM_001030312.2+NR_027690.1+NR_027689.1&NM_001031827.1&NM_024104.3&NM_021167.3&NM_018079.4&NM_201555.1+NM_201557.3+NM_001450.3+NM_001039492.2&NM_148179.1+NM_148178.1&NM_002608.2+NM_033016.2&NR_026797.1+NR_026796.1&NM_000679.3&NM_007083.3+NM_198041.1&NM_020373.2&NM_080610.2&NM_007148.4&NM_001144070.1+NM_003786.3&NM_020531.2&NM_001135638.1+NM_001135637.1+NM_003557.2+NM_001135636.1&NM_007284.3&NM_001080824.1&NM_181356.1+NM_003599.2&NM_001103167.1&NM_001011718.1&NM_001165414.1+NM_001135239.1+NM_001165415.1+NM_005566.3+NM_001165416.1+NR_028500.1&NM_182795.1&NR_024377.1&NM_015717.2&NM_003780.3+NM_001005417.1&XR_040624.2+XR_015325.2+XR_015458.2&NM_015980.3&NM_138376.2&NM_002903.2&NM_006928.3&NM_207371.3&NM_006566.2&NM_002611.3&NM_018976.4&NM_174924.1&NM_001142601.1+NM_001142602.1+NM_021972.3+NM_182965.2&NM_001007026.1+NM_001940.3&NM_152456.1&NM_001100912.1+NM_152751.2&NM_015949.2&NM_030984.3+NR_029394.1+NM_001166253.1+NM_001061.4+NM_001166254.1+NM_001130966.2&NM_022357.3+NM_001129758.1&NR_024204.1+NR_024206.1+NR_024205.1&NM_033018.3+NM_006201.3&NM_006367.3+NM_001105530.1&NM_006845.3&NM_012410.2+NM_001114100.1+NM_001114099.1+NM_201575.2&NR_027052.1+NR_027051.1&NM_001001418.3&NM_006779.2&NM_001025200.3&NM_016180.3+NM_001012509.2&NM_000156.4+NM_138924.1&NM_003904.3&NM_032885.4&NM_178562.2&NM_198153.2&NM_178124.3&NM_033661.3+NM_018669.4&NM_139286.3&NM_012083.2&NM_001008224.1+NM_018003.2&NM_000521.3&NM_022094.2&NM_016441.1&NM_032902.5&XR_079469.1+XR_078929.1+XR_078256.1&NR_024332.1+NM_017739.3&NM_003100.2&NM_004750.4&NM_001678.3&NM_032566.2&NM_015658.3&NM_025059.3&NM_003792.2+NM_153200.1&NM_003320.4+NM_177972.2&NM_015318.3+NM_001130955.1&NM_024763.3+NM_207014.1&NM_030926.4+NM_001012514.1+NM_001012516.1&NM_138967.2&NM_005828.3&NM_152773.3&NM_022479.1&NM_000854.3&NM_032109.2+XM_002345816.1&NM_018051.4&NM_006076.4&NM_015944.3+NM_001145815.1&NM_002372.2&NM_152504.2&NM_021130.3&NM_139062.1+NM_001893.3&NR_024542.1+NR_024543.1+NR_003672.2&NM_002852.3&NM_032389.3&NM_019110.3&NM_016030.5&NM_019051.2&NM_004882.3&NM_000729.3&NM_017647.3&NM_014431.2&NM_032630.2&NM_001145201.1+NM_145202.4&NM_173555.2+NM_001040273.1&NM_022047.3&NM_006649.3+NM_001166221.1&NM_001040651.1+NM_000732.4&NM_022353.2&NM_001142725.1+NM_080663.2&NM_001127266.1+NM_138385.3&NM_001142463.1+NM_001363.3&NM_003153.3&NM_147128.3&NM_003249.3&NM_001082959.1+NM_005505.4&NM_145024.2+NM_001143685.1&NM_001001666.3+NM_001001891.3&NM_001077198.1+NM_024085.3&NM_003234.2+NM_001128148.1&NR_024275.1&NM_014681.5&NM_001031617.2&NM_145897.2+NM_002624.3&NR_024531.1+NR_024530.1+NR_024528.1+NR_000029.3+NR_024529.1&NM_001009813.1+NM_020160.1&NM_001007156.1+NM_001012338.1+NM_002530.2&NM_005481.2&NM_001130088.1+NM_001130083.1+NM_001130084.1+NM_001130085.1+NM_001130087.1+NM_001130086.1+NM_032432.4&NM_006468.6&NM_001084.4&NM_000587.2&NM_000375.2&NM_053053.3&NM_000287.3&NM_003977.2&NM_133466.2&NM_018492.2&NM_184041.1+NM_001127617.1+NM_184043.1+NM_000034.2&NM_016640.3&NM_001031703.2&NM_024944.2&NR_023383.1&NM_153451.2&NM_001550.2+NM_001007245.1&NM_130769.3&NM_152380.2&NM_001165994.1+NM_182569.3+NM_001165993.1&NM_024031.2&NM_025129.3&NM_020703.2&NM_001099784.2&NM_025182.2&NM_006472.3&NM_002036.2+NM_001122951.1&NM_182728.1+NM_012244.2&NM_006703.2&NM_006061.1&NM_015012.2+NM_001165030.1+NR_028491.1&NM_018378.2&NM_014770.2+NM_001122772.1&NM_001760.3+NM_001136126.1+NM_001136017.2+NM_001136125.1&NM_001042532.2+NM_001042529.1+NM_025233.5+NM_001042531.1+NM_001042530.1&NM_032482.2&NM_004403.2+NM_001127453.1+NM_001127454.1&NM_001008401.3&NM_001136199.1+NM_020895.3&NM_001100620.1+NM_005480.3&NM_014555.3&NM_001154.3&NM_198859.3&NM_015976.3+NM_152238.2&NM_000098.2&NM_024563.3&NM_003216.2+NM_001145398.1&NM_016390.2&NM_001010891.4+NM_001167741.1&NM_001564.2&NM_033513.2&NM_032188.2+NM_182958.2&NM_024430.3&NM_001099640.1+NM_018286.2&NM_181657.3+NM_001143919.2&NM_005101.3&NM_001013439.1+NM_005087.2+NM_001013438.1&NM_015144.2&NM_004630.2+NM_201995.1+NM_201998.1+NM_201997.1&NM_005530.2&NR_027149.1+NM_015174.1+NM_001145640.1&NM_016510.4&NM_001249.2&NM_016334.3&NM_001357.3&NM_173563.1&NM_004202.2&NM_001142778.1+NM_025193.3+NM_001142777.1&NM_133374.2&NM_004177.3&NM_016354.3&NR_003226.1+NR_003227.1+NR_003228.1&NM_001012301.2&NM_080817.3&NM_003258.4&NM_004668.2&NM_000987.3&NM_032522.3+NM_001122770.1&NM_001142749.2+NM_152748.3+NR_030672.1&NM_004548.2&NM_024632.5+NR_024084.1+NM_001131062.1+NM_001131063.1&XM_001714135.2+XM_001723437.2+XM_936705.4+NM_001164416.1&NM_021805.2+NM_001135054.1+NM_001135053.1&NM_183241.1&NM_001001503.1+NM_021075.3&NM_173081.3&NM_002736.2&NM_005253.3&NM_005639.2+NM_001135806.1+NM_001135805.1&NM_207396.2&NM_001032278.1+NM_024302.3&NM_003016.3&NM_052924.2&NM_032164.2&NM_005233.5+NM_182644.2&NM_031452.2&NM_020963.3+NM_001130079.1&NM_002404.1&NR_027716.1+NM_177925.2&NM_001093767.1+NM_207368.3&NM_033423.3&NM_020348.2&NR_002174.2+NR_027626.1&NR_026656.1&NM_015444.2&NM_021214.1&NM_021149.2&NM_139315.1+NM_139123.1+NM_139122.1+NM_005641.2&NM_138733.3&NR_015360.1&NR_027962.1+NM_001162916.1+NM_138467.2&NM_003726.3+NM_001075099.1&NM_017828.3&NM_198540.2&NM_015414.3+NM_033643.2&NM_018380.3&NM_018136.4&NM_015324.2&NM_031229.2+NM_006462.4&NM_001001928.2+NM_005036.4&NM_013373.2&NM_002587.3+NM_032420.2&NM_016188.4&NM_152540.3&NM_002661.2&NM_006135.2&NM_006541.3&NM_001110514.1&NM_145030.2&NM_017429.2&NM_001160331.1+NM_001005388.2+NM_015090.3+NM_001160332.1+NM_001160333.1+NM_001005389.1&NR_024602.1+NM_012128.3&NM_032434.2&NM_002778.2+NM_001042466.1+NM_001042465.1&NM_001145414.1+NM_000390.2&NM_000702.3&NM_194324.2&NM_016445.1&NM_006837.2&NM_001010990.1+NM_001010989.1+NM_014685.2&NM_144657.3&NM_001946.2+NM_022652.2&NM_139078.1+NM_003668.2&NM_001134493.1&NM_032550.2+NM_001001936.1&NM_015932.4&NM_001080745.1+NM_001346.2+NM_001080744.1&NM_001114123.1+NM_005229.3&NM_021971.1+NM_013334.2&NM_053023.3&NM_001100159.1&NM_001142653.1+NM_001142654.1+NM_001136042.2+NM_025267.3&NM_144659.5&NM_001018139.1+NM_001018138.1+NM_001018137.1+NM_002512.2&NM_017686.3+NM_001135589.1&NM_024523.5&NM_001863.3&NM_078483.2&NM_021095.2+NR_028323.1&NM_030665.3&NR_027700.1+NM_006392.2&NM_001023.3+NM_001146227.1&NM_005410.2+NM_001093726.1+NM_001085486.1&NM_001024678.3&NM_182553.1&NM_000612.4+NM_001007139.4+NM_001127598.1&NM_006310.3&NM_024652.3&NM_020383.3+NM_001167604.1+NR_030724.1&NM_032335.3+NM_032458.2+NM_001015877.1&NM_005938.2&NM_006988.3&NM_032015.3&NM_001081461.1+NM_015167.2&NR_015377.1&NM_024832.3&NM_014362.2+NM_198047.1&NM_015885.3&NM_024726.3&NM_000929.2&NM_203297.1+NM_203293.1+NM_203295.1+NM_203296.1+NM_203294.1+NM_033342.2&NM_001087.3&NM_177538.2&NM_052897.3&NM_018659.2&NM_205768.2+NM_006352.3&NM_145911.1&XM_002342810.1&NM_001101648.1+NM_013389.2&NR_004845.1&NM_001003700.1+NM_001003699.3+NM_001003698.3+NM_001168344.1&NM_020871.3&NM_005798.3+NM_001007278.1+NM_052811.2+NM_213590.1&NM_153838.3&NM_015654.3&NR_027387.1+XR_079573.1+XR_079498.1+XR_079530.1+XR_079586.1&NM_017894.5+NM_181877.3+NM_001007072.1&NR_001447.2&NM_144977.4+NM_001142795.1&NM_024718.3+NM_017995.1&NM_174920.2&NM_001039375.2+NM_024120.4+NR_029377.1&NM_001166621.1+NM_021210.4+NR_030697.1+NR_030684.1&NM_024627.5&NM_018982.3&NM_138353.2&NM_080653.3&NM_016332.2&NM_001048230.1+NM_000674.2&NM_006897.1&NM_018645.4+NM_001142853.1&NM_020640.2&NM_016243.2&NM_001105204.1+NM_001105203.1+NM_001105205.1+NM_014328.3&NR_002801.1&NM_002088.3&NM_020801.2&NR_003572.2&NM_001127222.1+NM_001127221.1&NM_030666.2&NM_001135581.1+NM_003038.3&NM_002149.2+NM_134421.1&NM_001127889.1+NM_001127890.1+NM_016630.3&NM_020189.4&NM_033453.2+NM_181493.1&NM_001145206.1&NM_001032373.1+NM_001032372.1+NM_001146220.2+NM_001032374.1+NM_015919.3&NM_001399.4+NM_001005609.1+NM_001005615.1+NM_001005612.1+NM_001005611.1+NM_001005610.1&NM_003851.2&NR_002139.2&NM_001077628.1+NM_016022.2&NM_007176.2&NM_000784.3&XM_002344580.1+XM_002343111.1&NM_024725.3&NM_030573.2+NM_001008695.1&NM_015694.2&NM_198066.3&NM_000380.3+NR_027302.1&NM_198517.2&NM_001166002.1+NM_001166003.1+NM_181773.3+NM_001166004.1&NM_025055.3+NM_182791.2&NM_021938.3&NM_144770.3&NM_173655.2+NM_001080448.2&NM_001135653.1+NM_001135654.1+NM_003819.3&NM_001136108.1&NM_080741.2+NM_001167599.1+NM_001167602.1+NM_001167601.1+NM_001167600.1&NM_004397.4&NM_003627.4&NM_003222.3&NM_005968.3+NM_031203.2&NM_018930.3&NM_001033044.2+NM_001033056.2+NM_002065.5&NM_021216.4&NM_001477.1&NM_052849.2+NM_001080792.1+NM_001080791.1&NM_198189.2+NM_006710.4&NM_170774.1+NM_014737.2&NM_021223.2&NM_002996.3&NM_152459.3+NM_001098514.1&NM_175887.2&NM_018974.3+NM_001143947.1&NM_182758.2&NM_001015508.1+NM_013357.2&NM_004093.2&NM_001098634.1+NM_019027.3&NM_000689.3&NM_138578.1+NM_001191.2&NM_021637.2&NM_145111.2&NM_138340.4&NM_006105.5+NM_001098532.2+NM_001098531.2&NM_018063.3&NM_153261.4&NM_014368.3+NM_199160.2&NM_001109891.1+NM_002746.2+NM_001040056.1&NM_020910.2+NM_001164665.1&NM_004282.3&NM_001102467.1&NM_033267.4+NM_001134222.1&NM_201453.2&NM_001136004.1+NM_001122731.1+NM_015241.2&NM_006355.2&NM_174892.2&NM_030567.3&NM_003247.2&NM_020794.2&NM_006464.2&NM_152485.2&NM_004927.2&NR_003110.2&NM_176677.1&NR_027713.1&NM_002590.2+NM_032949.1&NM_138446.1&NM_002301.4+NM_017448.3&NM_138445.2&NM_139235.3+NM_022917.4&NM_000542.2+NM_198843.1&NM_004781.3&NM_001105562.1+NM_006048.3&NM_152430.3&NM_005475.2&NM_006019.2+NM_006053.2&NM_017781.2&NM_017720.2+NM_001013841.1&NM_005149.2&NM_052951.2&NM_001145138.1+NM_021975.3&NM_001077416.1+NM_001077418.1+NM_001077419.1&NM_001136538.1+NM_025247.5&NM_000990.4&NM_024075.3+NM_001077446.2&NM_018509.2&NM_001135655.1+NM_002347.4+NM_001130478.1&NM_005783.3&NR_024454.1&NM_001136158.1+NM_001136159.1+NM_001136157.1+NM_017602.3&NM_018078.2+NM_178043.1+NM_032239.2&NM_025246.2+NM_001097599.1+NM_001097600.1&NM_005583.3&NR_028062.1&NM_001150.2&NM_016128.3&NM_001026213.1+NM_000497.3&NM_153690.4&NM_025205.3&NM_152559.2&NM_016091.2&NM_001009584.1+NM_019007.3&NM_080841.2+NM_080840.2+NM_002836.3&NM_013442.1&NM_002720.1&NM_001144771.1+NM_001144770.1+NM_001144769.1+NM_020388.3+NM_015548.3+NM_001723.4+NM_183380.2&NM_032342.1&NM_201398.1+NM_025207.3&NM_020154.2&NM_016049.3&NM_001778.2&NM_016453.2+NM_184231.1&NM_001077199.1+NM_139168.2&NM_001145526.1+NM_001010982.3+NR_027083.1&NM_080669.3&NM_030935.3&NM_004311.2&NM_003456.2+NM_001042428.1&NM_005123.2&NM_001033.3&NM_001007279.1+NM_006477.3&NM_001864.2&NM_006191.2&NM_024339.3+NM_001142350.1&NM_033251.1+NM_000977.2&NM_005809.4+NM_181738.1&NM_152742.1&NM_006778.3+NM_052828.2&NM_001098517.1+NM_014333.3&NM_018334.4+NM_001099660.1+NM_001099658.1&NM_031430.2&NM_014207.3&NM_198977.1+NM_004706.3+NM_199002.1&NM_001135705.1+NM_001135704.1+NM_001135706.1+NM_024722.2+NM_001135707.1&NM_021943.2&NM_018275.3&NM_203453.2&NM_013443.3&NM_024630.2+NM_153746.1&NM_001005209.1&NM_032136.4&NM_005184.2&NM_001101.3&NM_138435.2&NM_004688.2&NM_003835.3+NM_001081955.2+NM_001165933.1&NR_023345.1+NM_006314.2&XM_002345775.1&NM_005664.3&NM_016338.4+NM_001134779.1&NM_022902.2+NM_024055.2&NM_014827.4&NM_001164695.1+NM_203395.2+NM_001164694.1&NM_001080414.2&NM_001703.2&NM_006245.2+NM_180976.1+NM_180977.1&NR_002806.2&NM_006366.2&NM_001078.2+NM_080682.1&NM_024806.2+NM_199124.1&NM_005419.2&NM_006844.3&NM_030919.2&NM_000416.2&NM_138381.2&NM_001013838.1&NM_138819.2&NM_001031713.2&NM_181514.1+NM_181515.1&NM_001164803.1+NM_002139.3+NR_028477.1+NR_028476.1&NM_031950.3&NM_001085429.1&NM_032639.2&NM_138326.2&NM_014730.2&NM_005552.4+NM_182923.3+NM_001130107.1&NM_001127621.1+NM_001008216.1+NM_000403.3&NM_015527.3&NM_001040625.1+NM_001040626.1+NM_001040630.1+NM_032041.2+NM_001040627.1+NM_001040624.1+NM_001040628.1+NM_001040629.1&NM_001168280.1+NM_001168278.1+NM_015472.4&NM_178507.2&NR_024147.1+NM_018320.4+NR_024148.1&XM_002346962.1&NM_001094.4+NM_183377.1&NM_052910.1&NM_182501.3+NR_028051.1+NR_028050.1+NR_028049.1&NM_053052.3&NM_147129.2+NM_182775.1&NM_001039395.3&NM_194280.3+NM_001083613.1&NM_078469.2+NM_016567.3+NM_078468.2&NM_024760.2+NM_001143986.1&NM_012423.2&NM_006442.3&NM_001077484.1+NM_030674.3&NM_007101.3+NM_001134707.1&NM_032174.4&NM_001080401.1&NM_005057.2&NM_032205.3+NM_198513.1+NM_016018.4&NM_005450.4&NM_012335.2&NM_174969.1+NM_174963.1+NM_006279.2+NM_174968.1+NM_174970.1+NM_174964.1+NM_174971.1+NM_174966.1+NM_174967.1+NM_174965.1&NM_001145158.1+NM_006620.3+NM_001145207.1&NM_021190.2&NM_001100400.1+NM_001100399.1+NM_015200.2&NM_001136214.1+NM_182619.2&NM_001161586.1+NM_001014811.1+NM_006680.2&NM_001031850.2+NM_002782.3&NM_014474.2+NM_001009568.1&NM_001127213.1+NM_002346.2&NM_139177.3+NM_001159770.1&NM_004309.3&NM_004542.3&NM_006208.2&NM_001038.5+NM_001159575.1+NM_001159576.1&NR_026897.1&NM_001085447.1&NM_138345.1&NM_024551.2&NM_004359.1&NM_019112.3&NM_000910.2&NM_018281.2&NM_033046.2+NM_001015056.1+NM_001015055.1&NR_023312.1+NR_023313.1+NM_001280.2&NM_001012505.1+NM_032682.4&NM_057166.4+NM_004369.3+NM_057167.3+NM_057165.4+NM_057164.4&NM_198492.3&NM_001144012.1+NM_015959.2+NR_026593.1&NM_052935.3&NM_004773.2&NM_014634.2&XR_037141.2+XR_036957.2+XR_037310.2&NR_027103.1&NM_199337.2&NM_005002.3&NM_006865.2&NM_172214.2+NM_153500.1+NM_006549.3+NM_172216.1+NM_153499.2+NM_172215.2+NM_172226.2&NM_014752.2&NM_004110.3+NM_024417.2&NM_153456.2+XM_002344743.1&NM_002857.3+NM_001131039.1&NM_175856.4&NM_002084.3&NM_152772.1&NM_001001996.1+NM_001001994.1+NM_005278.3+NM_001001995.1&NM_001082575.1&NM_001013435.1+NM_130467.3&NM_001017365.1+NM_001017367.1+NM_001017364.1+NM_001017366.1+NM_000716.3&NM_182924.3&NM_198935.1&NM_001082486.1+NM_022914.2+NM_001082487.1&NM_003108.3&NM_005272.3&NM_003932.3&NM_020770.2&NM_080821.2&NM_138463.3+NM_001160407.1&NM_014142.2&NM_152285.2&NM_001100619.2+NM_138375.2+NR_023359.1&NM_020461.3&NM_017569.3+NM_001014286.2&NM_138775.2&NM_001129996.1+NM_013360.2&NM_022749.5&NM_000493.3&NM_052884.2+NM_001135163.1&NM_001024599.3+NM_001161334.1&NM_183353.2+NM_016120.3&NM_153324.2&NM_019884.2&NM_005555.3&NM_003170.3&NM_202470.1+NM_202468.1+NM_202494.1+NM_202469.1+NM_005716.2+NM_202467.1&NR_003659.2&NR_024019.1+NM_019057.3&NM_145807.1&NM_058219.2&NM_199368.1+NM_015638.2&NM_015594.2&NM_007270.3&NM_001105208.1+NM_001105209.1+NM_001105206.1+NM_001105207.1+NM_002290.3&NM_007082.3+NM_013412.2&NM_199171.1+NM_199169.1+NM_020182.3+NM_199170.1&NM_052916.2&NM_022151.4&NM_002621.2+NM_001145252.1&NM_014213.3&NM_001336.3&NM_001145264.1+NM_014017.3&NM_170707.2+NM_170708.2+NM_005572.3&NM_019597.3+NM_001032393.1&NM_021061.3+NM_001109689.2&NM_018087.3&NM_001232.3&NM_014931.3&NR_026670.2&NM_032642.2+NM_030775.2&NM_005655.2+NM_001032282.2&NM_000496.2&NM_021245.2&NR_026681.1&NM_006400.3&NM_006455.2&NM_031498.2&NM_174887.2&NM_173545.2&NM_013282.3+NM_001048201.1&NM_001114633.1&NM_019079.4+NM_001164835.1&NM_005504.5&NM_001987.4&NM_178120.4+NM_001038493.1&XR_039278.2+XR_017613.3+XR_019471.3&NM_016626.4&NM_019852.3&NM_017684.3+NM_018080.2+NM_001018088.1+NM_020821.1&NM_014112.2&NM_145899.2+NM_145905.2+NM_002131.3+NM_145903.2+NM_145901.2+NM_145902.2&NM_001001977.1+NM_006886.2&NM_003500.3&NM_001153.3&NM_001077268.1&XR_041222.2+XR_041224.2+XR_041223.2&NM_000316.2&NM_019043.3&NM_178497.2&NM_004852.2&NM_022059.2+NM_001100812.1&NR_024585.1&NM_000268.3+NM_181832.2+NM_181833.2+NM_016418.5+NM_181830.2+NM_181828.2+NM_181829.2+NM_181831.2+NM_181825.2&NM_001160008.1+NM_013964.3+NM_001160001.1+NM_013962.2+NM_013956.3+NM_013958.3+NM_001160007.1+NM_001159995.1+NM_001160004.1+NM_001160005.1+NM_013959.3+NM_001160002.1+NM_001159999.1+NM_004495.3+NM_001159996.1+NM_013957.3+NM_013960.3&NM_019059.2&NR_024552.1+NM_015916.4&NM_015130.2&NM_145239.2&NM_031476.3&NM_001044388.1+NM_001044387.1+NM_024341.2&NM_175733.2&NM_015443.2&NM_005137.2&NM_001038603.1+NM_144724.1&NM_001356.3&NM_001482.2&NM_020405.4&NM_007368.2&NM_001015052.1+NM_001015054.1+NM_002434.2&NM_138465.3&NM_001166212.1+NM_013246.2&NM_024575.3&NM_032266.3&NM_003226.2&NR_027834.1+NM_145640.2+NM_145642.2+NR_027833.1+NR_027835.1+NM_145641.2&NM_001098502.1+NM_144636.2&NM_014571.3&NM_139319.2+NM_001145288.1&NR_028582.1+NR_028581.1+NM_138387.3&NM_020958.2+NM_058237.1&NM_058180.3&NM_003850.2&XM_002342355.1+XM_002346520.1&NM_001164471.1&NM_015044.3&NM_001145127.1&NM_001009609.2&XM_002344536.1&NM_015697.7&NM_003131.2&NM_006341.3+NM_001127325.1&NM_001617.2+NM_017482.2+NM_017484.2+NM_017488.2+NM_017483.2&NM_014386.2&NM_052953.2&NM_017789.4&NR_003697.1&NM_152531.4&NM_020212.1&NM_001114980.1+NM_001114981.1+NM_001114978.1+NM_003722.4+NM_001114982.1+NM_001114979.1&NM_183404.1+NM_002895.2&NM_001682.2+NM_001001323.1&NM_018083.4&NM_181747.1+NM_002553.2&NM_018454.6+NM_016359.3+NM_001129897.1&NR_027128.1+NR_027129.1&NM_001130867.1+NM_000400.3&XR_078672.1+XR_079418.1&NM_005491.2&NM_138334.2&NM_152275.3&NM_001131.2+NM_170609.1&NM_033529.2+NM_024011.2&NM_001136262.1&NM_001020658.1+NM_014676.2&NM_017516.1&NM_144775.2&NM_001142784.1+NM_004512.3+NM_147162.1&NM_145665.1&NM_001098638.1&NM_012319.3+NM_001099406.1&NM_001163.3&NM_021976.31&1&1+1&1&1&1&1&1&1+1+0&1&1&1&1&1&1&1+0+0&1&1+1&1&1+1&1+1+0&1&1&1&1+0&1&1&1&1&1&1&1+0&1+1&1&1&1&1&1&1+0+0&1&1&1&1+1+1&1&1+1+1+1+1&1+1+1+1+1&1+0+0&1+0&1&1+0&1+1&1&1+1+1+1&1+0+0+0+0+0&1&1+1+0&1+0&1&1&1+1+1&1&1&1&1+1+0&1+1+0&1&1&1+1+0+0+0+0+0&1&1&1&1+1+1&1&1+0+0&1&1+1&1+0&1&1&1&1+1&1&1&1&1+0&1&1&1+1&1&1+1+1+1+1+1+1&1&1+1&1+1+1+1+1+1+1+1&1&1&1+1+1&1&1&1&1&1+1+1+1+1+1+1+0&1&1&1+0&1&1&1&1+1&1&1&1&1&1&1&1&1&1&1&1&1+1&1+1&1+0&1+0&1+1&1&1&1&1&1&1&1&1&1+1+1&1&1+1+0+0+0+0+0&1&1+0+0+0+0&1&1&1+1&1+1&1+0&1&1&1&1&1+0+0&1+0+0+0+0&1+1&1&1&1&1+1&1&1&1&1&1&1+0+0&1&1+1+1&1+1&1&1&1&1&1+1+1&1&1&1+1+1&1+1&1+1&1&1+0+0&1&1&1&1&1&1+1&1&1&1&1&1&1&1&1+1&1&1+1&1+1&1+1&1&1&1+0+0&1&1&1+1&1&1&1+1+1&1&1&1&1&1+1&1&1&1&1+1&1&1&1&1+1&1+0&1+1+1+1+0+0+0+0&1+1&1+1+1&1&1+1+1&1&1+1+0+0&1&1+1+1&1+1+1+1+1&1+0&1&1+1+1+1+1&1&1+0&1&1&1&1&1&1&1&1&1+0+0+0+0+0+0&1&1&1&1&1+1+0&1+1&1+1&1&1&1&1&1&1+0&1+0+0&1&1&1+1+1+1+0&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1+1+1&1&1+1+1&1&1&1&1+1+1+1&1&1+1&1&1&1+1&1+0&1&1+1&1&1&1+1&1&1&1&1&1&1+1&1&1+1+0&1+1&1&1&1&1&1&1&1&1&1+1&1+0&1&1&1&1+0&1+1&1&1&1&1+1&1+1+1&1&1&1&1&1&1+1+1&1+1+1&1&1+1+1&1+1&1&1&1+1+0&1&1&1&1+1&1&1+1+1+1&1&1+1+0+0&1&1&1&1&1&1+1+1&1+1+1+1&1&1&1+1+0&1&1&1&1&1&1&1&1&1+1&1+1&1&1+1+0&1&1&1&1&1+0&1&1&1+1+1+1&1&1+1+1&1&1&1+1&1&1&1+0&1+0+0+0&1&1+1&1&1&1+1+1+1&1+1&1&1+1&1&1&1&1+0&1&1&1+1+0+0&1+0&1&1&1&1&1&1&1&1&1&1+1&1+1+1+1&1+1+1&1+1+1&1+1&1&1&1&1+1+1+1&1+1+1&1&1&1&1&1&1+1+1+1&1&1&1&1&1+1&1&1+0&1+1&1+0+0+0&1&1&1+1&1&1+1+1&1+1+1+1&1&1&1&1&1&1&1&1&1+1&1+1+1&1+1&1+1&1&1&1+1+1&1+1&1&1&1+1+1+1&1+0+0&1+1&1+0&1&1+0&1&1&1&1&1&1&1+1+0&1&1+1+1&1+0&1&1+1+1+1+1&1&1&1&1&1+1&1&1&1+1+1&1+1+1+1&1&1+1+1+1+1+0&1+1&1&1+1&1&1&1&1&1+1+1+1&1&1+0&1&1&1&1&1&1&1&1&1+1&1&1&1+0+0&1+1&1&1&1&1&1+0&1+1&1+1&1&1&1&1&1&1&1&1&1+1&1+0&1&1&1+0&1+0&1+0&1+1+1+1&1+0+0&1+1&1&1+0&1&1&1+0&1+0&1&1&1+1&1+1+1&1+1+1&1&1&1&1+1+1+1&1&1&1&1&1+0&1&1+0&1&1&1&1&1&1&1&1+0+0&1&1+1&1+1+1+0+0+0&1&1+0+0&1&1&1+0&1+0&1&1&1+1&1&1&1&1&1+1+1&1+1&1&1&1+0&1+1+0&1&1+1&1&1&1&1&1&1&1&1&1+1+1&1&1+1+1+1+1+1+0+0&1&1+1+0&1&1&1&1&1&1&1&1+1+1&1&1+1&1+1+1&1&1&1+0&1+0+0+0&1&1&1+1&1&1&1&1&1&1+1&1&1&1&1&1+1&1&1+0+0&1+1&1+1&1&1&1&1&1+1+1+1&1&1&1&1&1+1+1&1&1&1+1+1+1&1+0+0&1&1+1+1&1+1&1&1&1&1&1&1&1+0+0&1&1&1&1+0&1+1&1+0&1+1&1&1+1&1&1&1&1+1&1+1+1&1&1&1&1+1+1&1&1&1&1&1&1&1+1&1&1&1&1&1&1&1&1&1&1&1+1&1+1&1+1&1+1+1&1&1+1+0&1&1+1+1+1&1+1+1+1+1+1+1+1&1&1&1&1+1+0&1&1&1+1+1+1+1&1&1&1&1&1&1&1&1&1&1+0&1&1&1&1&1+1&1+1+1&1+1+1+1+1&1&1&1&1+1&1+1&1+1&1&1+1&1+1+0&1&1&1+1&1+1+1+1&1+0&1&1+0&1&1&1&1&1+1+1&1&1&1&1&1+1&1&1+0&1&1&1&1+0+0&1&1&1&1+1+0+0&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1+1&1+1+1&1&1+0+0&1&1&1&1&1+1&1+0+0&1&1&1&1&1&1&1+1+1&1&1&1&1&1&1+1&1&1+1&1&1&1+1+1&1&1&1&1&1&1&1+1&1+1&1+1+1&1+1&1&1+1+1+1&1&1+1+1&1&1&1+1&1&1&1&1&1+1+1+1&1&1+1&1&1&1&1&1+0&1+1&1+1&1+0&1&1&1&1&1&1+1+1+1+1+1+1+1+1&1&1+0&1+1+1&1&1+1&1+1&1+1&1+1+1+1+1+1+1&1&1&1&1+1+1&1&1&1&1&1&1+0&1&1&1&1+1&1+1&1+1+1&1+1&1+1&1&1+1+0+0&1+1+1+1+1&1+1+1+1&1&1&1&1&1&1&1+1+1+1+1+1+1&1+1+1+1+0&1&1&1+1+1+1+1+1+1+1&1&1+1&1&1+1+1&1&1&1+1&1+1+1+1+1+1&1&1&1&1+1&1+1&1&1&1&1+1+1&1&1&1&1&1+0+0&1+1+1+1+1+1&1+0&1+0&1+1&1&1&1&1&1&1+1+1+1&1+1&1&1&1&1&1+0&1&1&1&1&1&1+1+1&1+0&1&1&1&1&1+1+1&1+0+0+0&1&1&1+0&1+0+0&1&1&1&1&1&1+1+0+0&1+1+1+0&1+0&1+0+0&1&1&1+1&1&1+1&1&1&1&1&1&1+1+1&1&1&1&1+1+1&1+1+1&1&1&1+1+1&1+0&1&1&1&1&1&1+1&1&1&1+0&1&1+1+1&1+1&1&1&1&1+0&1+1&1&1&1+1&1+1+1+1+1+1&1+1+1+0+0&1+0+0+0&1&1&1+0&1+0&1+1+1&1+1+1&1+1+0&1&1&1+1&1+1+1&1&1&1+0&1&1&1&1&1&1&1+1&1&1&1+1&1&1&1+1&1+1&1&1&1&1&1&1&1+0&1&1&1&1&1+1+1&1+1+1+1+1+1+1&1&1&1+1+1+1+1+0&1&1&1+1+1&1&1&1&1+0&1&1&1&1&1&1&1&1&1&1&1+1&1&1&1&1&1+1&1+0&1&1+1&1+0+0&1+1&1&1&1+1&1+1+1+0&1+1+1&1+1&1+1&1&1&1&1&1&1+1+0+0+0&1+1+1&1+0+0&1+1&1&1&1&1&1&1&1&1&1&1+1+0+0+0+0+0+0+0+0+0+0+0+0+0&1+1&1&1&1+0+0&1+1+0&1&1&1+1+0&1+1&1&1+0+0+0&1&1+0&1&1+0+0&1&1&1+1+1+1+1&1&1+0&1&1&1&1&1&1&1+1+1&1&1&1&1&1&1&1&1+1+1&1&1+1&1&1+1&1&1&1&1+0&1+1+1&1&1&1&1&1&1&1+1&1&1+1&1&1&1&1+1&1&1+1&1&1&1&1+1+1+1&1&1&1&1&1&1+1+1&1&1&1&1+1+1&1&1+1&1&1&1&1+1+1+1&1+0+0&1+0+0&1&1+1&1&1&1&1+1&1&1+0+0+0&1+1+1+1+1&1&1&1&1&1&1&1&1&1&1+1+1&1&1+0&1+1&1+1+1&1+1+1&1&1&1&1+0&1&1+0&1+0+0+0&1+1&1&1&1&1&1+1+1&1+1+1+1+1&1&1&1+1+1+1+1+0&1+1&1&1+1+1+0+0&1+0&1+1&1&1&1&1&1&1+0+0+0&1+1&1+1&1&1&1&1&1&1&1&1&1&1+1&1+0&1&1&1&1&1&1+0&1+0&1&1+1+1+1+1+1+1+1&1&1&1&1+0&1&1&1&1+1+0&1&1+1&1+0&1&1&1&1&1&1+1+1&1&1+1&1&1&1&1+0&1&1&1&1+1&1&1&1+1&1&1&1+1+0&1+1&1&1&1&1&1&1&1&1&1+0+0&1+0&1&1+0&1&1&1+0&1&1&1&1&1+0&1&1&1&1&1&1&1&1&1+1&1&1+1+1&1&1&1&1&1&1&1&1&1+1+0&1&1+1+1&1&1+1&1&1+1&1&1+0+0+0+0&1+1+1+1&1+1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1&1+1&1&1&1&1&1&1&1&1+1+1+1+1+1&1+1+1+0&1+1&1+0&1&1&1&1+1&1&1+1+1+0+0+0+0+0&1&1&1&1&1&1+1+1&1+1+1+1+1+1&1+1&1&1+1+1&1&1&1&1+0&1&1&1+1&1+1&1&1+1&1&1&1&1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1&1&1&1&1&1&1&1&1&1&1&1+1+1&1&1&1&1+1&1+1&1+1&1&1&1+1&1&1+1+0&1+1&1&1+1&1&1&1+0&1&1+0&1&1+1&1&1+0+0+0&1+0+0&1&1&1+1&1&1+0+0&1+0&1&1+1+1+1&1&1&1+1+1&1+1+1+1+1+1+1+1&1&1+1&1&1&1&1&1&1+0&1&1+1&1+1+1+1&1&1+0&1+1+1+1+1+1+1&1&1&1&1&1+1+1+1&1+1&1+1&1+1&1&1+0&1&1&1&1+0&1&1+1+1+1&1&1&1+0&1&1&1+1+1+1+1+1&1&1&1&1+1&1+0+0&1&1&1&1&1&1&1&1&1&1+1+1+1&1+1&1&1+0&1&1+1+1+1+1+1&1+1&1+1+1&1+1&1+1&1&1+1+1+1&1+0&1&1&1&1+0&1+0&1&1&1&1&1&1+0&1&1&1+1&1&1&1&1&1+0+0&1+1&1&1&1&1&1&1&1+0&1+1&1+1&1+0&1+1+1&1&1&1&1&1&1+0&1&1&1+0&1&1&1&1+1&1+1+0&1&1&1&1&1&1&1&1&1&1&1+1&1+1&1&1+1&1+1&1&1+0&1+1&1+1&1&1&1&1+1&1+1&1+0&1+1&1+1&1&1&1&1+1&1+1+0+0+0&1+0&1+0+0&1&1+0+0+0+0+0+0&1&1&1&1&1&1&1&1&1&1+1+1+1&1&1&1&1&1&1+1&1&1&1+0+0&1&1&1&1&1&1&1+1&1+1&1&1&1+0+0&1&1+1&1+1+1+1&1+0+0+0+0&1&1+1+1&1&1+1&1+0&1&1&1&1+1&1&1&1+1&1&1+1&1&1&1+1&1&1+1&1+1&1&1+1+1&1&1+1+1+0&1&1+0+0&1&1&1&1&1&1&1+1+1&1&1&1&1+1+0&1&1&1&1&1&1+0&1+1+1&1&1+1+1+1&1+0+0+0&1+1+1&1&1+1&1&1&1&1+1+1&1&1+0&1&1&1&1+0&1&1+1&1&1+1&1+1&1&1&1+0&1&1&1&1&1+0+0+0&1&1&1+1+1&1+1&1&1&1+1&1&1&1&1+1&1+1&1&1+0&1&1&1&1&1&1&1&1&1+1+1+1+0+0&1+1&1&1+1+1&1+0&1&1&1&1&1+1+1&1&1+1&1+1&1&1+1&1&1+1+1&1+1&1+1&1&1&1+1+0+0&1&1+1+1+0&1+0&1&1&1&1+1&1&1+1&1+0&1+1+1&1&1&1+1+1&1&1&1+1+0&1+0+0&1&1&1&1+0&1&1&1+1&1&1&1&1+1+1+1+1+0&1&1&1&1&1+1&1&1&1+1&1&1+1+1+1&1&1+1+1+1&1&1&1+0+0+0+0&1+0+0&1&1+0&1+1&1&1+1+1&1+1+1+0&1&1&1&1&1&1+1&1&1+1&1&1&1+1+1+1&1&1&1&1&1+1&1&1+1&1+0&1+1+1&1&1+1&1&1+1+0+0+0&1+1+0+0+0+0&1&1&1+1&1&1&1+1&1&1+1&1&1&1+1&1&1+1+1+0&1+0&1&1&1+0&1+1+1&1&1+1+1+1+1&1&1&1&1+1&1&1+1+1&1&1&1+1+1&1+1&1+0&1&1&1+1&1&1+1&1&1+0&1&1+1&1&1+1&1&1&1&1+1+1&1&1&1+1&1+1+1&1+1&1&1&1+1&1&1+0+0&1&1&1&1&1&1&1&1&1&1&1&1+1&1&1+1&1&1+1&1+0&1&1+1&1&1&1+1&1&1+1&1&1&1+1&1+1+1&1+1&1&1+1&1&1+1+1&1&1&1+1+1+1&1+0+0&1+1+1&1&1&1&1&1+1&1&1&1&1&1+1&1+1+1&1&1&1+1+1+0+0+0+0&1&1+1&1&1&1&1+1&1+1&1+1+0&1&1&1&1+1&1&1&1+0&1&1&1+1&1+1&1+0&1&1+1&1+1&1+1+1&1&1&1+1+1&1+1+1+1+0&1&1&1&1&1+1&1&1&1&1&1&1&1+1+0&1+1&1&1&1+1&1+1&1&1+1+1&1&1&1+1+1&1&1&1+1&1+0&1&1&1&1&1&1&1&1&1+1&1+0+0+0&1&1&1&1&1&1+0+0&1+1+0&1&1+1+1+1+1+1+1+1&1+1+1&1&1+1+1&1&1+1&1&1+0+0+0&1&1+1&1&1+1&1+0+0&1+1&1&1&1+1&1+1&1&1&1&1+0+0&1&1&1+1+1+1+1+1+1+1+1+1&1+1+0&1&1+0+0&1+1&1+0+0&1+0&1+0&1+1&1+1&1&1&1&1+1+1&1&1&1&1&1&1&1&1&1+1+1&1+1+0&1+1&1+1+1+0+0&1&1+1+0&1&1&1&1+1+0&1&1&1&1&1+1+1+1+1+1+0&1&1+1&1+0&1+1&1&1&1&1+1+1+0&1&1+1&1+1+1+1+1&1&1&1+1+1&1&1&1&1&1&1+1&1&1&1+1+1&1&1+1&1&1+1&1&1&1+1&1+0&1+1&1&1&1&1&1+1+1+1+1+1&1&1+0&1&1&1+1&1&1&1+1+0+0+0&1+1&1+1+1+1&1&1&1+1&1&1&1+1&1+1+0&1+1&1+1&1&1&1&1&1+0&1+1&1&1&1&1&1&1&1&1&1+1&1&1+1&1&1&1+1&1+1+1&1&1&1+0+0+0&1&1+1+1+1+1+1&1+0&1&1&1&1+0+0&1&1&1&1&1+0&1&1+1+1+1+1+1+1+0+0&1+0+0+0+0+0+0+0+0+0+0+0+0+0+0+0+0&1&1+1&1&1&1&1+1+1&1&1&1&1+0&1&1&1&1&1+1+1&1&1+1&1&1&1&1+1+1+1+1+1&1+1&1&1+1&1+1+1&1+0&1&1&1+0&1&1&1&1&1&1&1&1+1&1+1+1+1+1&1&1&1&1&1&1&1+1+1+1+0+0&1+0&1+1&1&1+0&1+1+1&1+0&1+0&1+0&1&1&1&1+1&1+1&1&1+1&1&1&1+1+0&1&1&1+0&1&1NA10C10orf2(0.002)&CACNA1A(0.002)&RASGRP4(0.002)&ARNT(0.002)&COL4A6(0.002)&NUDT22(0.002)&CALM3(0.002)&SLC1A4(0.002)&PI4KA(0.002)&MRPL23(0.002)&ST3GAL5(0.002)&PQLC1(0.002)&CNKSR1(0.002)&GCH1(0.002)&ZNF574(0.002)&ITPA(0.002)&CLDN14(0.002)&GNL3(0.002)&EDA(0.002)&SLCO4A1(0.002)&TRPC4AP(0.002)&SORBS3(0.002)&ERAL1(0.002)&PARVG(0.002)&LLGL2(0.002)&SREBF1(0.002)&IYD(0.002)&PMEPA1(0.002)&MOAP1(0.002)&CCDC82(0.002)&GAB3(0.002)&LGALS7B(0.002)&FNIP1(0.002)&PTP4A3(0.002)&C20orf196(0.002)&ILK(0.002)&CD151(0.002)&TP53I13(0.002)&ZAN(0.002)&EPAS1(0.002)&LOC100131868(0.002)&H2BFM(0.002)&HNRNPH2(0.002)&ARHGAP26(0.002)&CDC42SE1(0.002)&HRAS(0.002)&ARMC3(0.002)&LOC653889(0.002)&D2(0.002)&BSDC1(0.002)&APOBEC3H(0.002)&FRS3(0.002)&GNE(0.002)&TAF12(0.002)&CEBPD(0.002)&RNH1(0.002)&CRYBB2(0.002)&DDX6(0.002)&ZNF394(0.002)&WISP2(0.002)&NUBP2(0.002)&TEX14(0.002)&HS3ST3A1(0.002)&GLUL(0.002)&H2AFJ(0.002)&TXNL4A(0.002)&MON1B(0.002)&SP140(0.002)&FAM113B(0.002)&APOL1(0.002)&IP6K2(0.002)&TBCCD1(0.002)&SETBP1(0.002)&ZIC1(0.002)&EN1(0.002)&NCALD(0.002)&ANO7(0.002)&RCSD1(0.002)&FAM7A3(0.002)&LRRC8E(0.002)&GLDN(0.002)&LOC100291035(0.002)&TFRC(0.002)&CASKIN2(0.002)&MED24(0.002)&SNX4(0.002)&HMGA1(0.002)&ARPC1A(0.002)&RNF14(0.002)&SLC37A3(0.002)&PURG(0.002)&FLJ42709(0.002)&MTCP1NB(0.002)&COMP(0.002)&EDN3(0.002)&RPL36(0.002)&DPYSL2(0.002)&SLC25A44(0.002)&RBCK1(0.002)>F3C5(0.002)&SARDH(0.002)&ETV1(0.002)&MAX(0.002)&ARSA(0.002)&RPL23AP7(0.002)&CERKL(0.002)&PARP9(0.002)&MAPK3(0.002)&ST3GAL3(0.002)&RER1(0.002)&CEACAM19(0.002)&NF2(0.002)&NRG1(0.002)&SPINK4(0.002)&ARD1A(0.002)&PRRT2(0.002)&LY6K(0.002)&ZNF557(0.002)&ADRA1B(0.002)&NFASC(0.002)&TRO(0.002)&LY6E(0.002)&SARS(0.002)&CLCA4(0.002)&CD300LB(0.002)&ISLR2(0.002)&ELMO1(0.002)&DIP2A(0.002)&SET(0.002)&RPL27(0.002)&DHDPSL(0.002)&HERPUD1(0.002)&DUSP6(0.002)&IFT172(0.002)&RAD50(0.002)&HOOK3(0.002)&ATF7(0.002)&APOL3(0.002)&C7orf30(0.002)&OSBPL3(0.002)&B4GALT2(0.002)&RBM7(0.002)&MFGE8(0.002)&PIK3R1(0.002)&CDKN2C(0.002)&C1orf26(0.002)&PHLDB3(0.002)&FAM22A(0.002)&IL25(0.002)&RTKN(0.002)&ECHDC2(0.002)&SLC17A8(0.002)&TAC3(0.002)&AANAT(0.002)&CD8A(0.002)&SEPP1(0.002)&UBE4B(0.002)&FOXP1(0.002)&ATG3(0.002)&GAS2L2(0.002)&SPHK1(0.002)&LOC338588(0.002)&ATPIF1(0.002)&GHRLOS(0.002)&LRRK1(0.002)&TMX2(0.002)&MYBBP1A(0.002)&ZNHIT3(0.002)&ZNF655(0.002)&TXNIP(0.002)&PHF6(0.002)&ZCWPW1(0.002)&NFATC1(0.002)&ACAD10(0.002)&SCYL1(0.002)&FGGY(0.002)&TSEN34(0.002)&C16orf57(0.002)&CCND3(0.002)&LRRC59(0.002)&ADD2(0.002)&SLC18A3(0.002)&LOC100291242(0.002)&NCRNA00152(0.002)&ZNF83(0.002)&PKIB(0.002)&CBX1(0.002)&CHSY3(0.002)&NRTN(0.002)&MDP1(0.002)&KLC2(0.002)&ANXA5(0.002)&LRSAM1(0.002)&VMO1(0.002)&C18orf21(0.002)&PTPRA(0.002)&CD99L2(0.002)&PTPN6(0.002)&LOC283663(0.002)&PAGE5(0.002)&PNPLA6(0.002)&ZNF362(0.002)&FAM158A(0.002)&GPR115(0.002)&SS18L1(0.002)&GHDC(0.002)&TRIM56(0.002)&LOC100133315(0.002)&CENPK(0.002)&LMF2(0.002)&PDXDC1(0.002)&TREML4(0.002)&MTX3(0.002)&PTGER1(0.002)&ZNF148(0.002)&RAD51L1(0.002)&MRPL46(0.002)&LOC100287260(0.002)&LPIN3(0.002)&CIDEC(0.002)&AGPAT6(0.002)&SEC14L2(0.002)&LGALS1(0.002)&ATP1B2(0.002)&C21orf82(0.002)&ALKBH8(0.002)&PSPH(0.002)&TTC39A(0.002)&SH2D2A(0.002)&IL1F5(0.002)&RUSC1(0.002)&RRAS(0.002)&HIST2H2BF(0.002)&CSGALNACT1(0.002)&PRC1(0.002)&FAM83A(0.002)&RNF169(0.002)&DERL3(0.002)&GJB1(0.002)&ITGA10(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73900GAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTC0.999600.997000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
880-902GGGAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUCCCGAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460GCCGCCCUGCACCUCUAUU70.7501340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120478GCCGCCCTGCACCTCTATTAATAGAGGTGCAGGGCGGC0.190600.040800.991401.000000.945700.62500


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514CCCAAAUACUAUGCAGAUG69.6339365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197532CCCAAATACTATGCAGATGCATCTGCATAGTATTTGGG0.026600.025100.836200.750001.000001.00000


Target Position: 165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
165CCUCCUCUGCCUGCCCGAG57.2342637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171183CCTCCTCTGCCTGCCCGAGCTCGGGCAGGCAGAGGAGG0.295000.004300.534500.750000.902200.62500


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485CCCUCAACUUUCAGAUCAG78.7749175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182503CCCTCAACTTTCAGATCAGCTGATCTGAAAGTTGAGGG0.046800.026600.706900.750001.000001.00000


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282GGCCAAAAUGGAAGAGGAC71.5929326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180300GGCCAAAATGGAAGAGGACGTCCTCTTCCATTTTGGCC0.086700.003400.681000.750001.000001.00000


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628CUGGGUGCCAUCGAGAACA75.0882240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175646CTGGGTGCCATCGAGAACATGTTCTCGATGGCACCCAG0.163900.004000.577600.500000.983700.62500


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757AGCGAGACCACAGAGAGCA76.2703216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178775AGCGAGACCACAGAGAGCATGCTCTCTGTGGTCTCGCT0.280800.035600.500000.500000.945700.62500


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170UCUGCCUGCCCGAGAACUA73.1997283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143188TCTGCCTGCCCGAGAACTATAGTTCTCGGGCAGGCAGA0.471600.042500.551700.750001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240CAUUGCUGAGGACGAGAAU80.9742142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192258CATTGCTGAGGACGAGAATATTCTCGTCCTCAGCAATG0.049900.002400.646600.750001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GGGUGCCAUCGAGAACAAG71.8697317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199648GGGTGCCATCGAGAACAAGCTTGTTCTCGATGGCACCC0.060400.001900.853400.750001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761AGACCACAGAGAGCACAGA81.7705131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172779AGACCACAGAGAGCACAGATCTGTGCTCTCTGTGGTCT0.306800.050200.500000.500001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592CACCUGGAGCUGAAAGAGA84.641377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212610CACCTGGAGCTGAAAGAGATCTCTTTCAGCTCCAGGTG0.543500.008800.569000.500001.000001.00000


Target Position: 400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
400GCCAUGAUAGAGAACUUCA91.41724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111418GCCATGATAGAGAACTTCATGAAGTTCTCTATCATGGC0.207700.048500.775900.750001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318UGGACAUAUCACCUCAUUG71.9249315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164336TGGACATATCACCTCATTGCAATGAGGTGATATGTCCA0.081400.006300.698300.500000.951100.75000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313CCCCAUGGACAUAUCACCU76.3334215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193331CCCCATGGACATATCACCTAGGTGATATGTCCATGGGG0.044300.002100.646600.750000.951100.75000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512AGCCCAAAUACUAUGCAGA81.9933126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180530AGCCCAAATACTATGCAGATCTGCATAGTATTTGGGCT0.315100.088600.629300.500001.000001.00000


Target Position: 62, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
62GCUGACUGCGCCUUCACGA80.3839150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
19480GCTGACTGCGCCTTCACGATCGTGAAGGCGCAGTCAGC0.057400.002100.560300.750000.940200.75000


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CCCAUGGACAUAUCACCUC63.7587509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188332CCCATGGACATATCACCTCGAGGTGATATGTCCATGGG0.051600.002600.681000.750000.951100.75000


Target Position: 226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
226CCCCAGCUCUCUUACAUUG71.374330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189244CCCCAGCTCTCTTACATTGCAATGTAAGAGAGCTGGGG0.038200.022400.844800.750001.000001.00000


Target Position: 487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487CUCAACUUUCAGAUCAGUG68.9225380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211505CTCAACTTTCAGATCAGTGCACTGATCTGAAAGTTGAG0.013600.006000.517200.500000.978300.62500


Target Position: 178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
178CCCGAGAACUACCAGAUGA85.945269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111196CCCGAGAACTACCAGATGATCATCTGGTAGTTCTCGGG0.262300.134400.767200.750000.923900.62500


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365GUCUGGCUCAGAAACUGAU83.0436114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209383GTCTGGCTCAGAAACTGATATCAGTTTCTGAGCCAGAC0.022600.001100.637900.750000.918500.62500


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479CCAACACCCUCAACUUUCA87.740748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121497CCAACACCCTCAACTTTCATGAAAGTTGAGGGTGTTGG0.188200.106200.620700.750001.000001.00000


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239ACAUUGCUGAGGACGAGAA83.740587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195257ACATTGCTGAGGACGAGAATTCTCGTCCTCAGCAATGT0.052700.002000.534500.750001.000001.00000


Target Position: 392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
392CCUCUCGAGCCAUGAUAGA79.0991170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187410CCTCTCGAGCCATGATAGATCTATCATGGCTCGAGAGG0.066000.002700.620700.750001.000001.00000


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874GGCACUGGGAAAAAAAAAA86.691458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42892GGCACTGGGAAAAAAAAAATTTTTTTTTTCCCAGTGCC0.997400.183601.000001.000001.000001.00000


Target Position: 179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
179CCGAGAACUACCAGAUGAA93.299810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100197CCGAGAACTACCAGATGAATTCATCTGGTAGTTCTCGG0.260400.134200.741401.000001.000001.00000


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838CUCACCCCACGAGCUUUCA68.7581385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189856CTCACCCCACGAGCTTTCATGAAAGCTCGTGGGGTGAG0.042500.040500.586200.500000.962000.87500


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629UGGGUGCCAUCGAGAACAA81.9548128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178647TGGGTGCCATCGAGAACAATTGTTCTCGATGGCACCCA0.412600.003500.698300.750001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709CUGGCUGCCGAGGAUAGUG62.657542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198727CTGGCTGCCGAGGATAGTGCACTATCCTCGGCAGCCAG0.273200.002500.491400.500001.000001.00000


Target Position: 593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
593ACCUGGAGCUGAAAGAGAA90.344629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146611ACCTGGAGCTGAAAGAGAATTCTCTTTCAGCTCCAGGT0.524600.014600.681000.750001.000001.00000


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316CAUGGACAUAUCACCUCAU89.755731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179334CATGGACATATCACCTCATATGAGGTGATATGTCCATG0.077400.004100.500000.750000.951100.87500


Target Position: 63, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
63CUGACUGCGCCUUCACGAU77.2573197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
18381CTGACTGCGCCTTCACGATATCGTGAAGGCGCAGTCAG0.124100.003200.603400.750000.940200.87500


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247GAGGACGAGAAUGGGAAGA71.6974324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186265GAGGACGAGAATGGGAAGATCTTCCCATTCTCGTCCTC0.172600.034900.586200.500001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824UGCCCCAUCCCCUCCUCAC52.0608743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135842TGCCCCATCCCCTCCTCACGTGAGGAGGGGATGGGGCA0.368500.334900.560300.500001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GCUGAGGACGAGAAUGGGA83.5314109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204262GCTGAGGACGAGAATGGGATCCCATTCTCGTCCTCAGC0.104100.019500.482800.750001.000001.00000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462CGCCCUGCACCUCUAUUCC62.2979550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149480CGCCCTGCACCTCTATTCCGGAATAGAGGTGCAGGGCG0.250200.062200.551700.500001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420UGCCAAAUAUGUCUCCCUG66.3503437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209438TGCCAAATATGTCTCCCTGCAGGGAGACATATTTGGCA0.062600.017200.569000.500001.000001.00000


Target Position: 880, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880GGGAAAAAAAAAAAAAAAA88.633340

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_488019GGGAAAAAAAAAAAAAAAA1/0/1/091.19RCN3&CHCHD5&SYT13&NTN5&TMEM216&CPT1C&DVL1&KRT19&PRMT1&SORBS3&DGCR8&PARVG&APOOL&SRRT&NUDT16P&VAX2&NFATC3&CYBA&PPIA&DDX42&RPL34&STAT5B&NEU4&WDR13&PRAP1&LOC92659&ZSWIM3&FAM195B&VANGL2&HPGD&SP140&GALE&SLC35E1&ACAP2&SCARB1&TBC1D10B&GALNTL4&CDRT1&DCUN1D2&DPCR1&RCSD1&LOC389168&LOC100291035&CCS&CPSF3&NECAB2&ALS2CL&METTL3&DHX34&TRPS1&ASAP1IT1&COMP&TPD52L2&ZFYVE19&MFI2&RBCK1&TAL1&NXNL2&TOMM22&C4orf26&ARD1A&POLR3C&C3orf47&ATG10&SLC9A3R2&CRISPLD2&PTCD3&LOC646851&CPEB1&SAMD4B&FOXS1&SET&PRDX6&DIO2&HMHA1&CEBPE&ALDOA&SMAP2&LDHA&XKR7&LPCAT1&LOC732160&MFGE8&RCVRN&DBH&PBX2&RPS20&COL6A3&CNIH2&MRM1&ISL2&ABTB1&RGS3&SLC25A46&RRP9&FBXL19&SNX27&SFTPD&COQ2&LOC285375&ACAT1&GNS&AZI2&RRAGB&MED12&ZNF669&RPP30&SLC16A7&LOC100288956&CDC42EP2&LEPREL2&SLFN12&RBBP9&FIS1&ACD&SIX1&SP1&RTF1&PSTPIP2&GABBR2&SNRNP35&SF1&POMGNT1&PPAN&C19orf50&MAP1D&LRRN3&SH2D2A&E2F2&DEDD2NM_020650.2&NM_032309.2&NM_020826.2&NM_145807.1&NM_016499.3&NM_152359.1+NM_001136052.1&NM_004421.2&NM_002276.4&NM_198318.2+NM_198319.2+NM_001536.3&NM_005775.4+NM_001018003.2&NM_022720.5&NM_001137605.1+NM_001137606.1+NM_022141.5+NR_024428.1+NR_024427.1+NR_024426.1&NM_198450.3&NM_001128854.1+NM_001128853.1+NM_015908.5+NM_001128852.1&NR_027766.1+NR_002949.2&NM_012476.2&NM_173164.1+NM_173163.1+NM_004555.2+NM_173165.1&NM_000101.2&NM_021130.3&NM_007372.2+NM_203499.1&NM_033625.2+NM_000995.3&NM_012448.3&NM_080741.2+NM_001167599.1+NM_001167602.1+NM_001167601.1+NM_001167600.1&NM_001166426.1+NM_017883.4+NR_029427.1&NM_001145201.1+NM_145202.4&NR_015454.1&NM_080752.2&NM_001093767.1+NM_207368.3&NM_020335.1&NR_027332.1+NM_000860.4+NM_001145816.1&NM_001005176.2+NM_007237.4&NM_001127621.1+NM_000403.3+NM_001008216.1&NM_024881.4&NM_012287.4&NM_001082959.1+NM_005505.4&NM_015527.3&NM_198516.2&NM_006382.3&NM_001014283.1&NM_080870.3&NM_052862.3&XR_039278.2+XR_017613.3+XR_019471.3&XM_002346962.1&NM_005125.1&NM_016207.2&NM_019065.2&NM_147129.2+NM_182775.1&NM_019852.3&NM_014681.5&NM_014112.2&NR_002765.2&NM_000095.2&NM_199363.1+NM_199362.1+NM_003288.2+NM_199359.1+NM_199361.1+NM_199360.1&NM_001077268.1&NM_033316.3+NM_005929.4&NM_031229.2+NM_006462.4&NM_003189.2&NM_145283.2+NM_001161625.1&NM_020243.4&NM_178497.2&NM_003491.2&NM_006468.6&NR_026991.1&NM_001131028.1+NM_031482.4&NM_004785.4+NM_001130012.1&NM_031476.3&NM_017952.5&NM_001013647.1&NM_030594.3+NM_001079535.1+NM_001079533.1+NM_001079534.1&NM_018028.2&NM_004118.3&NM_001122821.1+NM_003011.3&NM_004905.2&NM_000793.4+NM_013989.3+NM_001007023.2&NM_012292.2&NM_001805.2&NM_184041.1+NM_001127617.1+NM_000034.2+NM_184043.1&NM_022733.1&NM_001165414.1+NM_001135239.1+NM_001165415.1+NM_005566.3+NM_001165416.1+NR_028500.1&NM_001011718.1&NM_024830.3&XM_002346479.1&NM_001114614.1+NM_005928.2&NM_002903.2&NM_000787.3&NM_002586.4&NM_001023.3+NM_001146227.1&NM_004369.3+NM_057166.4+NM_057167.3+NM_057165.4+NM_057164.4&NM_182553.1&NM_024864.3&NM_145805.1&NM_172027.1+NM_032548.2+NM_172028.1&NM_017790.3+NM_144488.4+NM_144489.2+NM_134427.1+NM_021106.3+NM_130795.2&NM_138773.1&NM_004704.3&NM_001099784.2&NM_030918.5&NM_003019.4&NM_015697.7&NR_027103.1&NM_000019.3&NM_002076.3&NM_022461.3+NM_001134433.1+NM_001134432.1&NM_016656.3+NM_006064.4&NM_005120.2&NM_024804.2+NM_001142572.1&NM_006413.4+NM_001104546.1&NM_004731.3&XM_002342810.1&NM_006779.2&NM_014262.3&NM_018042.3&NM_006606.2&NM_016068.2&NM_001082486.1+NM_022914.2+NM_001082487.1&NM_005982.3&NM_003109.1+NM_138473.2&NM_015138.4&NM_024430.3&NM_005458.6&NM_180703.2+NM_022717.2+NM_180699.1&NM_004630.2+NM_201995.1+NM_201998.1+NM_201997.1&NR_024332.1+NM_017739.3&NM_020230.4&NM_024069.2&NM_199227.1&NM_018334.4+NM_001099660.1+NM_001099658.1&NM_003975.3+NM_001161442.1+NM_001161443.1+NM_001161441.1+NM_001161444.1&NM_004091.2&NM_133328.21&1&1&1&1&1+1&1&1&1+1+1&1+1&1&1+1+1+0+0+0&1&1+1+1+1&1+1&1&1+0+0+0&1&1&1+1&1+1&1&1+1+1+1+1&1+1+1&1+1&1&1&1+1&1&1+1+1&1+0&1+1+1&1&1&1+1&1&1&1&1&1&1&1+1+1&1&1&1&1&1+1&1&1&1&1&1&1+1+1+1+1+1&1&1+0&1+1&1&1+0&1&1&1&1&1&1+1&1+1&1&1&1&1+1+1+1&1&1&1+1&1&1+1+1&1&1&1+1+1+1&1&1+1+1+1+1+1&1&1&1&1+1&1&1&1&1+0&1+1+1+0+0&1&1&1&1+1+1&1+0+0+0+0+0&1&1&1&1&1&1&1&1&1&1+0+0&1+1&1&1+1&1+0&1&1&1&1&1&1&1&1+1+1&1&1+1&1&1&1&1+0+0&1+1+1+0&1+1&1&1&1&1+1+1&1+1+1+1+0&1&1NANANANA10RCN3(0.002)&SYT13(0.002)&CHCHD5(0.002)&TMEM216(0.002)&NTN5(0.002)&CPT1C(0.002)&DVL1(0.002)&KRT19(0.002)&PRMT1(0.002)&SORBS3(0.002)&DGCR8(0.002)&PARVG(0.002)&APOOL(0.002)&SRRT(0.002)&NUDT16P(0.002)&VAX2(0.002)&NFATC3(0.002)&CYBA(0.002)&DDX42(0.002)&PPIA(0.002)&RPL34(0.002)&STAT5B(0.002)&NEU4(0.002)&WDR13(0.002)&LOC92659(0.002)&PRAP1(0.002)&ZSWIM3(0.002)&FAM195B(0.002)&VANGL2(0.002)&HPGD(0.002)&SP140(0.002)&SLC35E1(0.002)&GALE(0.002)&ACAP2(0.002)&SCARB1(0.002)&TBC1D10B(0.002)&GALNTL4(0.002)&DCUN1D2(0.002)&CDRT1(0.002)&DPCR1(0.002)&RCSD1(0.002)&LOC389168(0.002)&CCS(0.002)&LOC100291035(0.002)&CPSF3(0.002)&NECAB2(0.002)&ALS2CL(0.002)&METTL3(0.002)&TRPS1(0.002)&DHX34(0.002)&ASAP1IT1(0.002)&COMP(0.002)&TPD52L2(0.002)&ZFYVE19(0.002)&MFI2(0.002)&RBCK1(0.002)&TAL1(0.002)&NXNL2(0.002)&TOMM22(0.002)&C4orf26(0.002)&ARD1A(0.002)&C3orf47(0.002)&POLR3C(0.002)&ATG10(0.002)&CRISPLD2(0.002)&SLC9A3R2(0.002)&PTCD3(0.002)&LOC646851(0.002)&CPEB1(0.002)&SAMD4B(0.002)&FOXS1(0.002)&SET(0.002)&DIO2(0.002)&PRDX6(0.002)&HMHA1(0.002)&CEBPE(0.002)&ALDOA(0.002)&SMAP2(0.002)&LDHA(0.002)&XKR7(0.002)&LPCAT1(0.002)&LOC732160(0.002)&MFGE8(0.002)&RCVRN(0.002)&DBH(0.002)&PBX2(0.002)&RPS20(0.002)&MRM1(0.002)&COL6A3(0.002)&CNIH2(0.002)&ISL2(0.002)&ABTB1(0.002)&RGS3(0.002)&RRP9(0.002)&SLC25A46(0.002)&FBXL19(0.002)&SNX27(0.002)&SFTPD(0.002)&COQ2(0.002)&LOC285375(0.002)&ACAT1(0.002)&GNS(0.002)&AZI2(0.002)&RRAGB(0.002)&MED12(0.002)&ZNF669(0.002)&RPP30(0.002)&SLC16A7(0.002)&LOC100288956(0.002)&CDC42EP2(0.002)&LEPREL2(0.002)&SLFN12(0.002)&RBBP9(0.002)&FIS1(0.002)&ACD(0.002)&SIX1(0.002)&SP1(0.002)&RTF1(0.002)&PSTPIP2(0.002)&GABBR2(0.002)&SNRNP35(0.002)&SF1(0.002)&POMGNT1(0.002)&PPAN(0.002)&MAP1D(0.002)&C19orf50(0.002)&LRRN3(0.002)&SH2D2A(0.002)&E2F2(0.002)&DEDD2(0.002)&RASGRP4(0.007)&NUDT22(0.007)&SLC1A4(0.007)&PI4KA(0.007)&MRPL23(0.007)&ST3GAL5(0.007)&ZNF574(0.007)&POLR2G(0.007)&CRYBG3(0.007)&PMEPA1(0.007)&CD151(0.007)&HNRNPH2(0.007)&ARHGAP26(0.007)&RNH1(0.007)&HS3ST3A1(0.007)&TXNL4A(0.007)&APOL1(0.007)&SETBP1(0.007)&NMUR2(0.007)&RPL23AP7(0.007)&NF2(0.007)&NFASC(0.007)&CLCA4(0.007)&CD300LB(0.007)&MGC3771(0.007)&APOL3(0.007)&OSBPL3(0.007)&B4GALT2(0.007)&RBM7(0.007)&CDKN2C(0.007)&PHLDB3(0.007)&FAM22A(0.007)&RTKN(0.007)&LOC338588(0.007)&MYBBP1A(0.007)&TXNIP(0.007)&NFATC1(0.007)&ACAD10(0.007)&C16orf57(0.007)&LRRC59(0.007)&SLC18A3(0.007)&LOC100291242(0.007)&ZNF83(0.007)&PNPLA6(0.007)&ZNF362(0.007)&LOC100133315(0.007)&RAD51L1(0.007)&LPIN3(0.007)&INTS2(0.007)&HIST2H2BF(0.007)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
19898GGGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCCC0.999500.996500.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
878-900CTGGGAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUCCCAGGGGAAAAAAAAAAAAAAAAAAU-11.314.300


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822CCUGCCCCAUCCCCUCCUC52.3799736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150840CCTGCCCCATCCCCTCCTCGAGGAGGGGATGGGGCAGG0.646400.324300.534500.750001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182AGAACUACCAGAUGAAAUA91.756619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118200AGAACTACCAGATGAAATATATTTCATCTGGTAGTTCT0.379900.189600.681000.750001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651GGAGAGCAAAGGCAAUUCA89.045935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162669GGAGAGCAAAGGCAATTCATGAATTGCCTTTGCTCTCC0.076200.007600.646600.750001.000001.00000


Target Position: 103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
103GCCGCCGUUAUGAACAUCC56.8925643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206121GCCGCCGTTATGAACATCCGGATGTTCATAACGGCGGC0.217400.020100.629300.500001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764CCACAGAGAGCACAGAUGU79.5819165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
143782CCACAGAGAGCACAGATGTACATCTGTGCTCTCTGTGG0.123600.055500.637900.750001.000001.00000


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175CUGCCCGAGAACUACCAGA75.9012225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170193CTGCCCGAGAACTACCAGATCTGGTAGTTCTCGGGCAG0.282800.120400.560300.500000.923900.62500


Target Position: 844, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844CCACGAGCUUUCACAAUAA98.05792

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_184419CCACGAGCTTTCACAATAA1/0/1/097.21ARD1ANM_003491.21NANANANA00ARD1A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131862CCACGAGCTTTCACAATAATTATTGTGAAAGCTCGTGG0.936300.022000.810301.000001.000001.00000


Target Position: 878, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CUGGGAAAAAAAAAAAAAA84.389883

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_387819CTGGGAAAAAAAAAAAAAA1/0/1/091.19MGC3771&ZNF669&FAM195B&PRDX6&CHCHD5&SF1&CEBPE&SLC25A46&GALE&SNX27&CPT1C&TBC1D10B&EDNRB&PRMT1&MAP1D&ARD1A&ACAT1&SLC9A3R2&PTCD3&LRRN3&SLFN12&CPSF3&LOC646851&RCVRN&ALS2CL&E2F2&PBX2&COL6A3NR_024166.1+NR_024167.1&NM_024804.2+NM_001142572.1&NM_001093767.1+NM_207368.3&NM_004905.2&NM_032309.2&NM_004630.2+NM_201995.1+NM_201998.1+NM_201997.1&NM_001805.2&NM_138773.1&NM_001127621.1+NM_000403.3+NM_001008216.1&NM_030918.5&NM_152359.1+NM_001136052.1&NM_015527.3&NM_001122659.1+NM_003991.2+NM_000115.2&NM_198318.2+NM_198319.2+NM_001536.3&NM_199227.1&NM_003491.2&NM_000019.3&NM_004785.4+NM_001130012.1&NM_017952.5&NM_018334.4+NM_001099658.1+NM_001099660.1&NM_018042.3&NM_016207.2&NM_001013647.1&NM_002903.2&NM_147129.2+NM_182775.1&NM_004091.2&NM_002586.4&NM_004369.3+NM_057166.4+NM_057167.3+NM_057165.4+NM_057164.41+1&1+1&1+1&1&1&1+1+1+0&1&1&1+1+1&1&1+1&1&1+1+1&1+1+1&1&1&1&1+1&1&1+1+1&1&1&1&1&1+1&1&1&1+1+1+0+0NANANANA10CHCHD5(0.002)&CPT1C(0.002)&PRMT1(0.002)&FAM195B(0.002)&GALE(0.002)&TBC1D10B(0.002)&CPSF3(0.002)&ALS2CL(0.002)&ARD1A(0.002)&SLC9A3R2(0.002)&PTCD3(0.002)&LOC646851(0.002)&MGC3771(0.002)&PRDX6(0.002)&CEBPE(0.002)&EDNRB(0.002)&RCVRN(0.002)&PBX2(0.002)&COL6A3(0.002)&SLC25A46(0.002)&SNX27(0.002)&ACAT1(0.002)&ZNF669(0.002)&SLFN12(0.002)&SF1(0.002)&MAP1D(0.002)&LRRN3(0.002)&E2F2(0.002)&NTN5(0.007)&DVL1(0.007)&PARVG(0.007)&APOOL(0.007)&NUDT16P(0.007)&KCNMB3(0.007)&VANGL2(0.007)&PTCHD1(0.007)&SCARB1(0.007)&CDRT1(0.007)&RCSD1(0.007)&CCS(0.007)&NECAB2(0.007)&METTL3(0.007)&TRPS1(0.007)&ASAP1IT1(0.007)&C13orf31(0.007)&ZFYVE19(0.007)&MFI2(0.007)&KLB(0.007)&C4orf26(0.007)&LOC440944(0.007)&POLR3C(0.007)&SAMD4B(0.007)&LPCAT1(0.007)&LOC732160(0.007)&AUH(0.007)&DBH(0.007)&MRM1(0.007)&CNIH2(0.007)&ABTB1(0.007)&RRP9(0.007)&COQ2(0.007)&GNS(0.007)&AZI2(0.007)&SLC16A7(0.007)&FIS1(0.007)&RBBP9(0.007)&PSTPIP2(0.007)&GABBR2(0.007)&SNRNP35(0.007)&EML5(0.007)&LMOD3(0.007)&DEDD2(0.007)&RCN3(0.029)&SYT13(0.029)&TMEM216(0.029)&KRT19(0.029)&SORBS3(0.029)&DGCR8(0.029)&FAM105B(0.029)&SRRT(0.029)&VAX2(0.029)&NFATC3(0.029)&KIAA1688(0.029)&CYBA(0.029)&DDX42(0.029)&PPIA(0.029)&RPL34(0.029)&STAT5B(0.029)&MAN2B2(0.029)&NEU4(0.029)&WDR13(0.029)&LOC92659(0.029)&PRAP1(0.029)&RG9MTD3(0.029)&ZSWIM3(0.029)&HPGD(0.029)&SP140(0.029)&SLC35E1(0.029)&ANKRD24(0.029)&ACAP2(0.029)&GALNTL4(0.029)&HMGB3(0.029)&DCUN1D2(0.029)&DPCR1(0.029)&LOC389168(0.029)&LOC100291035(0.029)&GJB7(0.029)&DHX34(0.029)&COMP(0.029)&TPD52L2(0.029)&PTPRE(0.029)&RBCK1(0.029)&TAL1(0.029)&NXNL2(0.029)&TOMM22(0.029)&LARP1(0.029)&MALL(0.029)&C3orf47(0.029)&ATG10(0.029)&CRISPLD2(0.029)&STK4(0.029)&CPEB1(0.029)&INHBB(0.029)&KIAA1267(0.029)&CALM1(0.029)&FOXS1(0.029)&SET(0.029)&DIO2(0.029)&HMHA1(0.029)&FGFBP3(0.029)&ALDOA(0.029)&SMAP2(0.029)&XKR7(0.029)&LDHA(0.029)&MFGE8(0.029)&CNTN2(0.029)&DMD(0.029)&RPS20(0.029)&ISL2(0.029)&RGS3(0.029)&FBXL19(0.029)&SFTPD(0.029)&LOC285375(0.029)&RRAGB(0.029)&MED12(0.029)&RPP30(0.029)&LOC100288956(0.029)&CDC42EP2(0.029)&SIX3(0.029)&LEPREL2(0.029)&ACD(0.029)&SIX1(0.029)&TGIF2(0.029)&SP1(0.029)&RTF1(0.029)&FBXW9(0.029)&LOC100287041(0.029)&C12orf64(0.029)&POMGNT1(0.029)&XPO5(0.029)&C19orf50(0.029)&PPAN(0.029)&SH2D2A(0.029)&LOC642852(0.029)&PPP1R3D(0.029)&LOC100293791(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36896CTGGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCCAG0.999300.284300.784500.750001.000001.00000


Target Position: 190, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
190CAGAUGAAAUACUACUUCU91.635522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153208CAGATGAAATACTACTTCTAGAAGTAGTATTTCATCTG0.455200.213000.560300.500000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
188-210ACCAGATGAAATACTACTTCTACAGAAGUAGUAUUUCAUCUGGUCAGAUGAAAUACUACUUCUACU18.920.422


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398GAGCCAUGAUAGAGAACUU96.18084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153416GAGCCATGATAGAGAACTTAAGTTCTCTATCATGGCTC0.178900.010900.672400.750001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825GCCCCAUCCCCUCCUCACC54.4069697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164843GCCCCATCCCCTCCTCACCGGTGAGGAGGGGATGGGGC0.352200.347800.646600.500001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CCCAUCCCCUCCUCACCCC47.9181800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174845CCCATCCCCTCCTCACCCCGGGGTGAGGAGGGGATGGG0.218800.189300.500000.500001.000001.00000


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260GGAAGAUUGUGGGGUAUGU81.4101137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198278GGAAGATTGTGGGGTATGTACATACCCCACAATCTTCC0.024200.026500.663800.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GAGCUUUCACAAUAAAUUU87.816247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91866GAGCTTTCACAATAAATTTAAATTTATTGTGAAAGCTC0.931900.048200.810300.750001.000001.00000


Target Position: 399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399AGCCAUGAUAGAGAACUUC64.1328494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193417AGCCATGATAGAGAACTTCGAAGTTCTCTATCATGGCT0.194200.013400.681000.500001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482ACACCCUCAACUUUCAGAU72.5947296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163500ACACCCTCAACTTTCAGATATCTGAAAGTTGAGGGTGT0.075900.064900.525900.750001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191AGAUGAAAUACUACUUCUA96.69963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144209AGATGAAATACTACTTCTATAGAAGTAGTATTTCATCT0.470300.240500.551700.750000.951100.75000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250GACGAGAAUGGGAAGAUUG76.7058208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207268GACGAGAATGGGAAGATTGCAATCTTCCCATTCTCGTC0.222100.031600.672400.500001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768AGAGAGCACAGAUGUCAAG73.3999277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182786AGAGAGCACAGATGTCAAGCTTGACATCTGTGCTCTCT0.117000.064600.586200.500001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138GGACCUAAUGAACAUGCAG80.1447157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181156GGACCTAATGAACATGCAGCTGCATGTTCATTAGGTCC0.047600.024900.586200.750001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173GCCUGCCCGAGAACUACCA74.6225247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87191GCCTGCCCGAGAACTACCATGGTAGTTCTCGGGCAGGC0.280400.138100.655200.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CUGCCCCAUCCCCUCCUCA70.656342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203841CTGCCCCATCCCCTCCTCATGAGGAGGGGATGGGGCAG0.646200.511200.560300.500001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473UCUAUUCCAACACCCUCAA70.9422339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125491TCTATTCCAACACCCTCAATTGAGGGTGTTGGAATAGA0.239700.086600.577600.750001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877ACUGGGAAAAAAAAAAAAA79.9716159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54895ACTGGGAAAAAAAAAAAAATTTTTTTTTTTTTCCCAGT0.998700.183900.706900.750001.000001.00000


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484ACCCUCAACUUUCAGAUCA75.8055226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200502ACCCTCAACTTTCAGATCATGATCTGAAAGTTGAGGGT0.055800.049400.629300.500001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CCUCUAUUCCAACACCCUC68.7123388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149489CCTCTATTCCAACACCCTCGAGGGTGTTGGAATAGAGG0.289700.024200.534500.750001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591GCACCUGGAGCUGAAAGAG70.9662338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158609GCACCTGGAGCTGAAAGAGCTCTTTCAGCTCCAGGTGC0.136500.007700.543100.750001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504UGAAGUGGAGCCCAAAUAC65.252469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162522TGAAGTGGAGCCCAAATACGTATTTGGGCTCCACTTCA0.366900.007400.543100.500000.989101.00000


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249GGACGAGAAUGGGAAGAUU89.700332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139267GGACGAGAATGGGAAGATTAATCTTCCCATTCTCGTCC0.125500.021000.862101.000001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502AGUGAAGUGGAGCCCAAAU77.5919191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170520AGTGAAGTGGAGCCCAAATATTTGGGCTCCACTTCACT0.094300.004800.698300.750000.989100.87500


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109GUUAUGAACAUCCGCAAUG65.9462447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199127GTTATGAACATCCGCAATGCATTGCGGATGTTCATAAC0.023400.017700.491400.500001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396UCGAGCCAUGAUAGAGAAC56.5839654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187414TCGAGCCATGATAGAGAACGTTCTCTATCATGGCTCGA0.272300.007600.646600.500001.000001.00000


Target Position: 188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
188ACCAGAUGAAAUACUACUU77.8462187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56206ACCAGATGAAATACTACTTAAGTAGTATTTCATCTGGT0.460600.156400.715500.750001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846ACGAGCUUUCACAAUAAAU76.9296205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144864ACGAGCTTTCACAATAAATATTTATTGTGAAAGCTCGT0.933400.016600.767200.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508GUGGAGCCCAAAUACUAUG68.8022383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159526GTGGAGCCCAAATACTATGCATAGTATTTGGGCTCCAC0.393200.018400.637900.500000.989100.62500


Target Position: 486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
486CCUCAACUUUCAGAUCAGU77.6643190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165504CCTCAACTTTCAGATCAGTACTGATCTGAAAGTTGAGG0.072600.014500.637900.750001.000001.00000