siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 733   781   3066   4077   4081   4117   4175   4505   4547   4564   4616   4706   4875   4901   4908   4938   4973  
Biltr, Rnaxs 2   19   124   125   126   127   128   129   130   223   232   233   242   308   309   336   337   343   345   346  
365   422   430   431   436   437   438   439   440   441   442   443   444   445   446   447   448   449   450   451  
471   472   473   499   500   501   502   505   506   533   536   537   538   540   541   575   646   647   648   649  
650   651   652   653   654   658   675   677   678   679   692   693   694   695   726   729   730   731   732   736  
737   740   741   742   743   745   755   756   760   784   827   849   853   854   862   867   868   871   872   921  
926   927   933   937   950   960   973   974   975   976   979   1007   1045   1046   1047   1055   1056   1057   1058   1081  
1082   1110   1121   1126   1127   1130   1132   1133   1134   1136   1159   1187   1188   1189   1205   1206   1212   1240   1252   1253  
1254   1255   1256   1257   1258   1259   1260   1261   1262   1263   1286   1288   1312   1313   1314   1345   1358   1360   1443   1498  
1501   1502   1512   1513   1516   1517   1518   1519   1520   1559   1561   1562   1567   1568   1569   1573   1597   1598   1601   1602  
1603   1604   1605   1608   1611   1612   1620   1629   1630   1631   1632   1633   1634   1635   1650   1651   1652   1653   1699   1700  
1701   1702   1703   1705   1708   1717   1718   1768   1793   1794   1795   1797   1798   1799   1802   1803   1809   1810   1811   1821  
1822   1835   1837   1838   1839   1840   1841   1844   1845   1846   1847   1848   1850   1851   1852   1853   1854   1855   1856   1857  
1858   1859   1860   1861   1882   1883   1919   1920   1921   1922   1924   1925   1927   1928   1929   1933   1934   1936   1937   1938  
1950   1967   2000   2001   2002   2003   2004   2005   2012   2013   2014   2015   2035   2063   2109   2110   2111   2112   2113   2165  
2223   2224   2225   2230   2231   2232   2233   2234   2247   2250   2251   2252   2254   2255   2256   2264   2402   2407   2408   2409  
2410   2411   2412   2413   2414   2415   2416   2417   2419   2450   2451   2452   2465   2479   2480   2481   2482   2483   2484   2508  
2516   2519   2520   2613   2614   2615   2617   2618   2619   2653   2669   2678   2736   2737   2738   2739   2740   2741   2745   2767  
2769   2778   2779   2781   2796   2813   2871   2872   2873   2878   2879   2880   2913   2914   2915   2916   2917   2918   3000   3003  
3004   3008   3009   3024   3027   3028   3029   3032   3035   3036   3038   3039   3040   3041   3042   3043   3044   3045   3046   3047  
3068   3069   3075   3076   3098   3099   3100   3101   3102   3105   3106   3107   3131   3132   3133   3136   3137   3138   3140   3141  
3142   3145   3146   3147   3150   3151   3152   3156   3170   3171   3172   3181   3182   3183   3184   3185   3186   3188   3189   3190  
3191   3192   3193   3194   3212   3213   3214   3215   3216   3218   3219   3223   3224   3225   3226   3227   3228   3230   3231   3232  
3233   3234   3235   3238   3239   3243   3247   3248   3249   3250   3252   3253   3260   3269   3288   3364   3365   3366   3369   3370  
3371   3445   3446   3447   3448   3471   3472   3473   3474   3478   3479   3480   3544   3545   3546   3547   3548   3549   3551   3552  
3556   3557   3558   3565   3566   3567   3570   3571   3572   3574   3575   3576   3577   3578   3579   3580   3608   3620   3621   3622  
3623   3625   3686   3690   3691   3695   3696   3697   3698   3699   3700   3701   3702   3703   3706   3707   3708   3709   3710   3737  
3738   3813   3814   3842   3844   3846   3847   3849   3850   3851   3852   3853   3880   3958   4015   4016   4017   4018   4019   4020  
4021   4022   4023   4025   4053   4054   4056   4057   4061   4062   4063   4064   4065   4067   4070   4071   4072   4083   4089   4090  
4092   4101   4102   4103   4105   4106   4110   4111   4112   4113   4114   4121   4125   4126   4127   4151   4152   4153   4154   4155  
4159   4160   4161   4163   4164   4167   4170   4171   4178   4179   4190   4191   4192   4193   4194   4195   4196   4197   4199   4201  
4218   4219   4220   4221   4222   4223   4224   4225   4228   4253   4256   4260   4261   4262   4263   4270   4280   4281   4282   4293  
4298   4299   4300   4301   4302   4303   4354   4355   4356   4357   4358   4359   4360   4364   4365   4366   4378   4379   4380   4428  
4432   4433   4434   4437   4438   4439   4440   4442   4443   4446   4447   4448   4452   4453   4454   4455   4456   4468   4470   4471  
4472   4474   4475   4476   4477   4478   4479   4480   4481   4482   4484   4485   4489   4491   4496   4497   4498   4499   4500   4501  
4502   4503   4504   4514   4515   4521   4522   4523   4524   4528   4533   4536   4538   4539   4540   4541   4544   4545   4546   4549  
4553   4557   4558   4559   4560   4567   4569   4571   4578   4656   4673   4677   4678   4683   4700   4701   4707   4708   4710   4712  
4713   4714   4722   4723   4797   4798   4799   4846   4847   4850   4851   4852   4855   4856   4857   4871   4872   4878   4880   4881  
4882   4902   4903   4912   4913   4922   4923   4924   4926   4927   4928   4929   4932   4933   4934   4937   4967   4968   4969   4970  
4993   4994   4995   5000   5005   5013   5017   5030   5031   5032   5035   5038   5039   5040   5041   5042   5045   5046   5051   5052  
5053   5058   5063   5064   5124   5126   5127   5128   5129   5201   5203   5204   5213   5214   5215   5216   5217   5238   5266   5271  
5272   5273   5274   5282   5283   5285   5286   5287   5289   5290   5291   5292   5294   5295   5297   5298   5299  
Biltr, Ernai, Rnaxs 1120   2253   4925  
Biltr, Ernai, Rnaxs, Sidirect 4104   4702   4904   4935  
Biltr, Rnaxs, Sidirect 826   1609   1610   1796   2780   3254   4024   4068   4069   4091   4093   4156   4165   4166   4198   4200   4483   4486   4490   4527  
4534   4535   4537   4542   4543   4566   4568   4572   4703   4709   4711   4877   4879   4936   5033   5043   5044   5054   5059   5228  
5229   5284   5288   5293   5296  
Biltr, Ernai 5262   5265  
Biltr, Ernai, Sidirect 3261  


Target Position: 4069, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4069CAUUGAGUCUUUGAGAUUU86.7754242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8514087CATTGAGTCTTTGAGATTTAAATCTCAAAGACTCAATG0.013700.004300.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4067-4089CCCATTGAGTCTTTGAGATTTTAAAAUCUCAAAGACUCAAUGGGCAUUGAGUCUUUGAGAUUUUAU20.419.222


Target Position: 1718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718CUCCUACUCGGCCAGCAUC63.15232743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7611736CTCCTACTCGGCCAGCATCGATGCTGGCCGAGTAGGAG0.492100.052600.629300.500000.907600.75000


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741CCCUCACCCCUCCCUCUCC55.29123852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572759CCCTCACCCCTCCCTCTCCGGAGAGGGAGGGGTGAGGG0.492400.386500.620700.500001.000001.00000


Target Position: 3578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578GGGACAGGGCUGGAAGAUC68.91381916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6613596GGGACAGGGCTGGAAGATCGATCTTCCAGCCCTGTCCC0.052700.022900.810300.750001.000001.00000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851CUCCUCACCCCCUUUCCAG59.71263234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821869CTCCTCACCCCCTTTCCAGCTGGAAAGGGGGTGAGGAG0.728000.674500.525900.500001.000001.00000


Target Position: 4547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4547GUACAUUUUAAAAAUUUCA84.8782328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4545-4567ATGTACATTTTAAAAATTTCACAUGAAAUUUUUAAAAUGUACAUGUACAUUUUAAAAAUUUCACAU0.46.922


Target Position: 4222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4222UACCCUGGUGGUCAUAAAA79.6739703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5164240TACCCTGGTGGTCATAAAATTTTATGACCACCAGGGTA0.269000.025500.681000.500000.902200.62500


Target Position: 4354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4354GGCCUGGCUACCUCAUCUU78.642790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6094372GGCCTGGCTACCTCATCTTAAGATGAGGTAGCCAGGCC0.616000.007100.862101.000000.934800.62500


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262GCUGGAGGACAAUGACUAU92.45673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791280GCTGGAGGACAATGACTATATAGTCATTGTCCTCCAGC0.197600.014800.810301.000001.000001.00000


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856CACCCCCUUUCCAGUUCUU73.32641330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451874CACCCCCTTTCCAGTTCTTAAGAACTGGAAAGGGGGTG0.682800.636700.655200.750000.972800.62500


Target Position: 2225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225CCAAUCCCCCACCCGCUGU57.06943636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182243CCAATCCCCCACCCGCTGTACAGCGGGTGGGGGATTGG0.096600.020900.637900.750001.000001.00000


Target Position: 4355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4355GCCUGGCUACCUCAUCUUU80.2909655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5954373GCCTGGCTACCTCATCTTTAAAGATGAGGTAGCCAGGC0.678000.007901.000001.000001.000001.00000


Target Position: 4104, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4104GAAAAAGUCAGAUCCAAUU85.7915280

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2410419GAAAAAGTCAGATCCAATT1/1/0/097.75AKT2NM_001626.31NANANANA00AKT2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3294122GAAAAAGTCAGATCCAATTAATTGGATCTGACTTTTTC0.234800.080100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4102-4124CAGAAAAAGTCAGATCCAATTTAAAUUGGAUCUGACUUUUUCUGGAAAAAGUCAGAUCCAAUUUAU20.13.222


Target Position: 2778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2778CAGCCUUAAGGUUGAACAU83.676394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8482796CAGCCTTAAGGTTGAACATATGTTCAACCTTAAGGCTG0.014500.001200.629300.750001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568GCCACCCUUCAAACCUCAG63.24322729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881586GCCACCCTTCAAACCTCAGCTGAGGTTTGAAGGGTGGC0.072600.011900.715500.750001.000001.00000


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250AUGGGGGCAGAAAAGCAAU67.42252112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7012268ATGGGGGCAGAAAAGCAATATTGCTTTTCTGCCCCCAT0.607400.004700.646600.500000.951100.87500


Target Position: 4228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4228GGUGGUCAUAAAAUAGGCA90.2547124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7564246GGTGGTCATAAAATAGGCATGCCTATTTTATGACCACC0.032200.003600.500000.750001.000001.00000


Target Position: 5266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5266CAGCAGUCCUGUAAUAAAC78.716786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5575284CAGCAGTCCTGTAATAAACGTTTATTACAGGACTGCTG0.640000.015200.637900.500000.934800.62500


Target Position: 5005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5005CUGCAAAUGGACACGGCAU77.9101858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6165023CTGCAAATGGACACGGCATATGCCGTGTCCATTTGCAG0.064500.018200.629300.750001.000001.00000


Target Position: 4200, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4200CCUUAAUUUAAUUACAAAA92.550770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1214218CCTTAATTTAATTACAAAATTTTGTAATTAAATTAAGG0.530800.398100.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4198-4220GACCTTAATTTAATTACAAAAGTUUUUGUAAUUAAAUUAAGGUCCCUUAAUUUAAUUACAAAAGUU7.2-4.322


Target Position: 4300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4300CCCACGUUGCUGCUCCUCA79.6983698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4834318CCCACGTTGCTGCTCCTCATGAGGAGCAGCAACGTGGG0.115800.034600.767200.750001.000001.00000


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601CGACACAAGGUACUUCGAU82.3735488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521619CGACACAAGGTACTTCGATATCGAAGTACCTTGTGTCG0.055300.007800.612101.000001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979UUGUGAUGGAGUAUGCCAA80.3515648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
826997TTGTGATGGAGTATGCCAATTGGCATACTCCATCACAA0.083200.001900.500000.500000.956500.62500


Target Position: 309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309GUGUCUGUCAUCAAAGAAG76.33990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760327GTGTCTGTCATCAAAGAAGCTTCTTTGATGACAGACAC0.099500.006600.655200.500001.000001.00000


Target Position: 2247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2247CCUAUGGGGGCAGAAAAGC49.23464501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952265CCTATGGGGGCAGAAAAGCGCTTTTCTGCCCCCATAGG0.057900.002400.491400.500000.951100.75000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695GACUGAGGAGAUGGAAGUG75.7831050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
647713GACTGAGGAGATGGAAGTGCACTTCCATCTCCTCAGTC0.208300.035700.525900.500001.000001.00000


Target Position: 2519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2519GCCUUACCUCCCGCUGGAC59.96543187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192537GCCTTACCTCCCGCTGGACGTCCAGCGGGAGGTAAGGC0.039400.005500.681000.750000.902200.62500


Target Position: 5215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5215CGCUUCAGCUGCCCCGUUA83.0519442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5105233CGCTTCAGCTGCCCCGTTATAACGGGGCAGCTGAAGCG0.100700.024400.887901.000000.940200.87500


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537UGGACCACAGUCAUCGAGA75.03851134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867555TGGACCACAGTCATCGAGATCTCGATGACTGTGGTCCA0.110300.015800.620700.500000.956500.75000


Target Position: 4447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4447GGUUAUCCUGUAGAGCUUU81.7359518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6354465GGTTATCCTGTAGAGCTTTAAAGCTCTACAGGATAACC0.059200.017200.853401.000001.000001.00000


Target Position: 5284, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5284CUAGCUAUCCAUCUGUAAA94.239540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2875302CTAGCTATCCATCTGTAAATTTACAGATGGATAGCTAG0.691500.597300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5282-5304AACTAGCTATCCATCTGTAAAAAUUUACAGAUGGAUAGCUAGUUCUAGCUAUCCAUCUGUAAAAAU20.319.5


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853AGGAAGUCAUCAUUGCCAA88.78167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768871AGGAAGTCATCATTGCCAATTGGCAATGATGACTTCCT0.206100.002100.698300.750001.000001.00000


Target Position: 4167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4167GUUUUUUAGUUUGUCUUUC63.49492688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8414185GTTTTTTAGTTTGTCTTTCGAAAGACAAACTAAAAAAC0.096100.042900.474100.500001.000001.00000


Target Position: 3254, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254GGUACAAGCAAUAAAGACA95.96825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3593272GGTACAAGCAATAAAGACATGTCTTTATTGCTTGTACC0.267700.086900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3252-3274ACGGTACAAGCAATAAAGACACTUGUCUUUAUUGCUUGUACCGUGGUACAAGCAAUAAAGACACUU14.619.023


Target Position: 3738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3738AGGCCCCCAAAUUCCAGUA72.19581483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503756AGGCCCCCAAATTCCAGTATACTGGAATTTGGGGGCCT0.033600.004600.663800.750001.000001.00000


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190GCGAUGUUGUUAUCUGACA88.478180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293208GCGATGTTGTTATCTGACATGTCAGATAACAACATCGC0.017800.002100.715500.750001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206GACGGGGCCACCAUGAAAA85.0343319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261224GACGGGGCCACCATGAAAATTTTCATGGTGGCCCCGTC0.043300.003200.819000.750000.918500.62500


Target Position: 4967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4967CAGGGCCUUGAGUACUCAU83.2401424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7164985CAGGGCCTTGAGTACTCATATGAGTACTCAAGGCCCTG0.178500.003400.629300.750001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922CUCCAGCCUCCAGCCUCAC55.27983855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251940CTCCAGCCTCCAGCCTCACGTGAGGCTGGAGGCTGGAG0.290800.092000.517200.500000.907601.00000


Target Position: 5285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5285UAGCUAUCCAUCUGUAAAA85.0349318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8325303TAGCTATCCATCTGTAAAATTTTACAGATGGATAGCTA0.697800.617800.672400.500001.000001.00000


Target Position: 4569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4569AUUCUUUUUUGUAUAUAAA87.2672219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6884587ATTCTTTTTTGTATATAAATTTATATACAAAAAAGAAT0.085800.007200.508600.500001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708UCCCCCAGUUCUCCUACUC51.67914255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6181726TCCCCCAGTTCTCCTACTCGAGTAGGAGAACTGGGGGA0.064000.014500.560300.500000.989100.87500


Target Position: 5053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5053UGUAAUCUUUUCCAGUUAA84.7512336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4015071TGTAATCTTTTCCAGTTAATTAACTGGAAAAGATTACA0.161200.118500.672400.750001.000001.00000


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CCACCCUUCAAACCUCAGG53.09864097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261587CCACCCTTCAAACCTCAGGCCTGAGGTTTGAAGGGTGG0.058100.034300.500000.500000.902200.62500


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256UGAGGUGCUGGAGGACAAU71.09721625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231274TGAGGTGCTGGAGGACAATATTGTCCTCCAGCACCTCA0.202800.011500.715500.750001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732GCUAAAGUGACCAUGAAUG73.84631272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599750GCTAAAGTGACCATGAATGCATTCATGGTCACTTTAGC0.076600.007500.698300.750001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445UACCCCCCUUAAACAACUU64.77742506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599463TACCCCCCTTAAACAACTTAAGTTGTTTAAGGGGGGTA0.320100.295400.543100.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UCCCCCAGUGACUCCUCCA67.61542097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
664693TCCCCCAGTGACTCCTCCATGGAGGAGTCACTGGGGGA0.052400.005800.525900.500001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451CCUUAAACAACUUCUCCGU73.37131323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539469CCTTAAACAACTTCTCCGTACGGAGAAGTTGTTTAAGG0.106300.096200.569000.750001.000001.00000


Target Position: 4092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4092UGAAUGUAAGCAGAAAAAG61.71322923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6654110TGAATGTAAGCAGAAAAAGCTTTTTCTGCTTACATTCA0.244400.034800.586200.500001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847CCACCUCCUCACCCCCUUU72.76091405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531865CCACCTCCTCACCCCCTTTAAAGGGGGTGAGGAGGTGG0.839000.689100.844801.000001.000001.00000


Target Position: 5000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5000CCUCUCUGCAAAUGGACAC62.97052768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5875018CCTCTCTGCAAATGGACACGTGTCCATTTGCAGAGAGG0.123000.031000.551700.750001.000001.00000


Target Position: 4152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4152ACUCGUUUGGUUGGGGUUU58.51283411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7994170ACTCGTTTGGTTGGGGTTTAAACCCCAACCAAACGAGT0.022100.002100.706900.750001.000001.00000


Target Position: 4709, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4709CUCUACAAAAAAUACAAAA85.611293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3844727CTCTACAAAAAATACAAAATTTTGTATTTTTTGTAGAG0.945400.287700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4707-4729ATCTCTACAAAAAATACAAAAATUUUUGUAUUUUUUGUAGAGAUCUCUACAAAAAAUACAAAAAUU6.920.300


Target Position: 4470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4470AAGAAGGGUGUUUGAACUU72.41051447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894488AAGAAGGGTGTTTGAACTTAAGTTCAAACACCCTTCTT0.204900.001800.500000.500001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233CCACCCGCUGUCCCCCUAU66.75252213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842251CCACCCGCTGTCCCCCTATATAGGGGGACAGCGGGTGG0.025600.014600.801701.000001.000001.00000


Target Position: 4475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4475GGGUGUUUGAACUUAGAGU83.3727410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3474493GGGTGTTTGAACTTAGAGTACTCTAAGTTCAAACACCC0.197500.050600.784500.750001.000001.00000


Target Position: 2878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878GUGUGUGUGCAUGUGUGUU81.5983534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622896GTGTGTGTGCATGTGTGTTAACACACATGCACACACAC0.012300.002900.646600.750001.000001.00000


Target Position: 2918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2918CCAGUGUGCAUGGUGUGUG67.13952153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782936CCAGTGTGCATGGTGTGTGCACACACCATGCACACTGG0.050700.008600.551700.750000.989100.62500


Target Position: 2780, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780GCCUUAAGGUUGAACAUGA91.608389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012798GCCTTAAGGTTGAACATGATCATGTTCAACCTTAAGGC0.021900.003200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2778-2800CAGCCTTAAGGTTGAACATGAGTUCAUGUUCAACCUUAAGGCUGGCCUUAAGGUUGAACAUGAGUU20.515.832


Target Position: 4536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4536UCUUUUGCAAUGUACAUUU70.21051738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1844554TCTTTTGCAATGTACATTTAAATGTACATTGCAAAAGA0.408000.187300.724100.750001.000001.00000


Target Position: 5265, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5265CCAGCAGUCCUGUAAUAAA98.718312

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3526519CCAGCAGTCCTGTAATAAA1/1/0/097.75AKT2NM_001626.31NANANA19:40736241..40736259(-)00AKT2(0.002)


Target Position: 4091, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4091GUGAAUGUAAGCAGAAAAA88.6663174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3474109GTGAATGTAAGCAGAAAAATTTTTCTGCTTACATTCAC0.251300.032900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4089-4111AAGTGAATGTAAGCAGAAAAAGTUUUUUCUGCUUACAUUCACUUGUGAAUGUAAGCAGAAAAAGUU12.220.522


Target Position: 4798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4798CACUUGAGCCCAGGAGUUU75.42241089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6204816CACTTGAGCCCAGGAGTTTAAACTCCTGGGCTCAAGTG0.270300.006400.793100.750001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CCCCACCCCCACCUCCUCA67.39892117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1351857CCCCACCCCCACCTCCTCATGAGGAGGTGGGGGTGGGG0.767000.406800.767200.750001.000001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652ACCCCAUGGACUACAAGUG62.98512765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788670ACCCCATGGACTACAAGTGCACTTGTAGTCCATGGGGT0.025000.008000.560300.500001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533GCAGUGGACCACAGUCAUC75.5421072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
696551GCAGTGGACCACAGTCATCGATGACTGTGGTCCACTGC0.052300.004200.672400.750000.956500.87500


Target Position: 5299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5299UAAAAAAAAAAAAAAAAAA80.6168621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7235317TAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTA0.996600.978400.534500.500001.000001.00000


Target Position: 3690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3690UCCUAUCCUGCCCCACCUC49.33114492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943708TCCTATCCTGCCCCACCTCGAGGTGGGGCAGGATAGGA0.187200.097800.560300.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GGGCUAAAGUGACCAUGAA98.011916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665748GGGCTAAAGTGACCATGAATTCATGGTCACTTTAGCCC0.066700.005000.819001.000000.956500.62500


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014AGGUUUUAAUCCACACAAG74.78491160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932032AGGTTTTAATCCACACAAGCTTGTGTGGATTAAAACCT0.045200.023000.706900.500001.000001.00000


Target Position: 4501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4501AAAUCUUACCAAAUAAAUU83.757388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8024519AAATCTTACCAAATAAATTAATTTATTTGGTAAGATTT0.095800.032500.491400.500001.000001.00000


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617UGGCUGUUACAAUCUUACA81.4664547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722635TGGCTGTTACAATCTTACATGTAAGATTGTAACAGCCA0.743500.003900.637900.500001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448CCCCCUUAAACAACUUCUC60.4383119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275466CCCCCTTAAACAACTTCTCGAGAAGTTGTTTAAGGGGG0.259300.249800.681000.750001.000001.00000


Target Position: 4175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4175GUUUGUCUUUCUAAAGUCA91.231596

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4173-4195TAGTTTGTCTTTCTAAAGTCATGUGACUUUAGAAAGACAAACUAGUUUGUCUUUCUAAAGUCAUGU14.619.232


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365UCCUCCUGUACUAGCCGUU61.51012947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4423383TCCTCCTGTACTAGCCGTTAACGGCTAGTACAGGAGGA0.232300.047900.724100.750001.000001.00000


Target Position: 4179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4179GUCUUUCUAAAGUCAUGUG72.33781457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8104197GTCTTTCTAAAGTCATGTGCACATGACTTTAGAAAGAC0.020800.005000.525900.500001.000001.00000


Target Position: 3248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248UUGUACGGUACAAGCAAUA70.94451639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753266TTGTACGGTACAAGCAATATATTGCTTGTACCGTACAA0.153400.026600.603400.500000.989100.62500


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860CCCUUUCCAGUUCUUCUUC61.25822985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551878CCCTTTCCAGTTCTTCTTCGAAGAAGAACTGGAAAGGG0.590200.500800.819000.750001.000001.00000


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045CUCCCUGUAGCAACACCUC63.79932652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343063CTCCCTGTAGCAACACCTCGAGGTGTTGCTACAGGGAG0.083300.009100.500000.500001.000001.00000


Target Position: 3101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3101CCUAUCCCAUCUCCUGUAC63.39512698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6503119CCTATCCCATCTCCTGTACGTACAGGAGATGGGATAGG0.055300.028900.663800.750001.000001.00000


Target Position: 4198, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4198GACCUUAAUUUAAUUACAA97.874617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3464216GACCTTAATTTAATTACAATTGTAATTAAATTAAGGTC0.632400.291400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4196-4218TGGACCTTAATTTAATTACAAAAUUGUAAUUAAAUUAAGGUCCAGACCUUAAUUUAAUUACAAAAU6.918.621


Target Position: 4880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4880UAAAAAUAAAAAAAAAAAA82.3267490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8274898TAAAAATAAAAAAAAAAAATTTTTTTTTTTTATTTTTA0.980700.964100.534500.500001.000001.00000


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252GGGGGCAGAAAAGCAAUAA82.7967462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812270GGGGGCAGAAAAGCAATAATTATTGCTTTTCTGCCCCC0.601700.008600.956901.000000.951101.00000


Target Position: 3702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702CCACCUCCCUGUUUAUGCU79.6852700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043720CCACCTCCCTGTTTATGCTAGCATAAACAGGGAGGTGG0.234700.022200.491400.750001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224UGGCCUUUCUCCUCGUCUU72.10461496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3533242TGGCCTTTCTCCTCGTCTTAAGACGAGGAGAAAGGCCA0.187900.133100.706900.750000.994600.75000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150GGGGUUGGUUCGGGUGGGU63.23532731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4133168GGGGTTGGTTCGGGTGGGTACCCACCCGAACCAACCCC0.168000.063200.637900.750001.000001.00000


Target Position: 3546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3546AGUGCUGCUUAGGCUAAGA80.7273605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183564AGTGCTGCTTAGGCTAAGATCTTAGCCTAAGCAGCACT0.350900.002100.482800.500000.983701.00000


Target Position: 3364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3364CUCCUCCUGUACUAGCCGU68.78191940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113382CTCCTCCTGTACTAGCCGTACGGCTAGTACAGGAGGAG0.223500.009300.534500.500001.000001.00000


Target Position: 3039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3039CCUCCCCUCCCUGUAGCAA73.9841261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423057CCTCCCCTCCCTGTAGCAATTGCTACAGGGAGGGGAGG0.058000.012400.698301.000001.000001.00000


Target Position: 5041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5041CUGCUCUUUUUGUGUAAUC65.63242357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7315059CTGCTCTTTTTGTGTAATCGATTACACAAAAAGAGCAG0.267300.045900.603400.500001.000001.00000


Target Position: 4253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4253UGAAGAAAGGCCUUUUACU74.44211206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344271TGAAGAAAGGCCTTTTACTAGTAAAAGGCCTTTCTTCA0.100800.004700.517200.500001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852UCCUCACCCCCUUUCCAGU60.36393128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961870TCCTCACCCCCTTTCCAGTACTGGAAAGGGGGTGAGGA0.730100.676600.663800.500000.994600.62500


Target Position: 4482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4482UGAACUUAGAGUCUUAAUA84.4694352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2724500TGAACTTAGAGTCTTAATATATTAAGACTCTAAGTTCA0.483600.153100.681000.750001.000001.00000


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250GUACGGUACAAGCAAUAAA92.97161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3193268GTACGGTACAAGCAATAAATTTATTGCTTGTACCGTAC0.216200.045800.681000.750001.000001.00000


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431CCCUGAUCAGACUCUACCC69.35071850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741449CCCTGATCAGACTCTACCCGGGTAGAGTCTGATCAGGG0.422700.183600.500000.500001.000001.00000


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191CGAUGUUGUUAUCUGACAG84.8783327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8273209CGATGTTGTTATCTGACAGCTGTCAGATAACAACATCG0.017900.006100.508600.750001.000001.00000


Target Position: 2736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GGCCCCCCUCACCCCUCCC43.47934905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792754GGCCCCCCTCACCCCTCCCGGGAGGGGTGAGGGGGGCC0.493000.027400.508600.500000.951100.62500


Target Position: 2230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2230CCCCCACCCGCUGUCCCCC39.98545076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142248CCCCCACCCGCTGTCCCCCGGGGGACAGCGGGTGGGGG0.059900.024200.500000.500001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575UCCAGACGAGAGGGAGGAG55.38953838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781593TCCAGACGAGAGGGAGGAGCTCCTCCCTCTCGTCTGGA0.025900.005600.560300.500000.923900.75000


Target Position: 3700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3700CCCCACCUCCCUGUUUAUG54.52283945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3103718CCCCACCTCCCTGTTTATGCATAAACAGGGAGGTGGGG0.263200.043100.836200.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609GGUACUUCGAUGAUGAAUU85.6534290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391627GGTACTTCGATGATGAATTAATTCATCATCGAAGTACC0.016100.004700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1607-1629AAGGTACTTCGATGATGAATTTAAAUUCAUCAUCGAAGUACCUUGGUACUUCGAUGAUGAAUUUAU16.221.433


Target Position: 4114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4114GAUCCAAUUUACAGAAAUC84.5688348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304132GATCCAATTTACAGAAATCGATTTCTGTAAATTGGATC0.251900.224400.500000.500001.000001.00000


Target Position: 4496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4496UAAUAAAAUCUUACCAAAU81.1546569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6504514TAATAAAATCTTACCAAATATTTGGTAAGATTTTATTA0.133400.125100.525900.500001.000001.00000


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137GGUGGGGAGGGGUGGGGUU68.0562032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3993155GGTGGGGAGGGGTGGGGTTAACCCCACCCCTCCCCACC0.308500.022800.706901.000001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GACUAUCUCAAACUCCUUG75.19241114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839774GACTATCTCAAACTCCTTGCAAGGAGTTTGAGATAGTC0.044700.040500.672400.500001.000001.00000


Target Position: 3696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696CCUGCCCCACCUCCCUGUU62.1812865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2543714CCTGCCCCACCTCCCTGTTAACAGGGAGGTGGGGCAGG0.275500.173700.698301.000001.000001.00000


Target Position: 5204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5204GACCCCUCAACCGCUUCAG58.63873389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7165222GACCCCTCAACCGCTTCAGCTGAAGCGGTTGAGGGGTC0.214500.221000.534500.500000.972800.62500


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924CCAGCCUCCAGCCUCACCU65.28562418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7491942CCAGCCTCCAGCCTCACCTAGGTGAGGCTGGAGGCTGG0.492000.084900.500000.750000.907600.75000


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130GCUGGAAAACCUCAUGCUG72.87591387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371148GCTGGAAAACCTCATGCTGCAGCATGAGGTTTTCCAGC0.058600.007300.569000.750000.956500.87500


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447CCCCCCUUAAACAACUUCU67.14762152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366465CCCCCCTTAAACAACTTCTAGAAGTTGTTTAAGGGGGG0.271100.265800.767200.750001.000001.00000


Target Position: 1717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1717UCUCCUACUCGGCCAGCAU70.13681745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461735TCTCCTACTCGGCCAGCATATGCTGGCCGAGTAGGAGA0.264900.042400.569000.750000.907600.62500


Target Position: 3472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472GCUGUGGGGCUGAGGGGUA79.5402718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8203490GCTGTGGGGCTGAGGGGTATACCCCTCAGCCCCACAGC0.177100.001400.672401.000001.000001.00000


Target Position: 2113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113CUGCUGCAUCUGGACGAAG65.192430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462131CTGCTGCATCTGGACGAAGCTTCGTCCAGATGCAGCAG0.080800.003800.646600.500001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502CGCGACCCAACACCUUUGU61.16593002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576520CGCGACCCAACACCTTTGTACAAAGGTGTTGGGTCGCG0.076800.025200.715500.750000.907600.62500


Target Position: 3622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622CCUGUGCUGUCACUGAAUG71.65851552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153640CCTGTGCTGTCACTGAATGCATTCAGTGACAGCACAGG0.083600.003400.689700.750000.918500.87500


Target Position: 4539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4539UUUGCAAUGUACAUUUUAA85.891275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8574557TTTGCAATGTACATTTTAATTAAAATGTACATTGCAAA0.480500.190500.465500.500001.000001.00000


Target Position: 3479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3479GGCUGAGGGGUAUGGGAAG70.12321751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4933497GGCTGAGGGGTATGGGAAGCTTCCCATACCCCTCAGCC0.292200.013300.862100.750001.000001.00000


Target Position: 4356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4356CCUGGCUACCUCAUCUUUU78.2251834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4744374CCTGGCTACCTCATCTTTTAAAAGATGAGGTAGCCAGG0.669600.015700.844801.000001.000001.00000


Target Position: 3844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3844CAGCCCUCCCCUAGUCACU70.78281657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253862CAGCCCTCCCCTAGTCACTAGTGACTAGGGGAGGGCTG0.052300.001300.577600.500001.000001.00000


Target Position: 3184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3184CUGUGUGCGAUGUUGUUAU82.2702492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253202CTGTGTGCGATGTTGTTATATAACAACATCGCACACAG0.121400.006300.741400.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GCCACAUCAAGAUCACUGA88.0828191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041177GCCACATCAAGATCACTGATCAGTGATCTTGATGTGGC0.136800.001600.775900.750001.000001.00000


Target Position: 4937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4937AGUAUAAGAAAGGAAAUUC69.12631887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6664955AGTATAAGAAAGGAAATTCGAATTTCCTTTCTTATACT0.329300.226900.534500.500000.983700.62500


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007GCUGUUCUUCCACCUGUCC61.38352964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591025GCTGTTCTTCCACCTGTCCGGACAGGTGGAAGAACAGC0.035200.001000.482800.500000.956500.62500


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499GGCCGCGACCCAACACCUU72.06651500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341517GGCCGCGACCCAACACCTTAAGGTGTTGGGTCGCGGCC0.198500.054500.862101.000000.907600.87500


Target Position: 5216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5216GCUUCAGCUGCCCCGUUAA86.1959262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4115234GCTTCAGCTGCCCCGTTAATTAACGGGGCAGCTGAAGC0.156900.028000.819001.000000.940201.00000


Target Position: 3075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3075AGUUUAGCUUUUGUGGGUU72.04691502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093093AGTTTAGCTTTTGTGGGTTAACCCACAAAAGCTAAACT0.020800.005700.560300.750001.000001.00000


Target Position: 4925, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4925CAGCAAAGCAGGAGUAUAA97.844218

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8492519CAGCAAAGCAGGAGTATAA1/1/0/094.96AKT2NM_001626.31NANANA19:40736581..40736599(-)00AKT2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2134943CAGCAAAGCAGGAGTATAATTATACTCCTGCTTTGCTG0.431900.099100.750000.750001.000001.00000


Target Position: 4503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4503AUCUUACCAAAUAAAUUUU72.12021494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5294521ATCTTACCAAATAAATTTTAAAATTTATTTGGTAAGAT0.102300.025100.681000.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313GGUCAUGUACGAGAUGAUG77.2508904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901331GGTCATGTACGAGATGATGCATCATCTCGTACATGACC0.045800.006100.698300.750001.000001.00000


Target Position: 1937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937UCACCUUUGUGCCCAGACU67.65952093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491955TCACCTTTGTGCCCAGACTAGTCTGGGCACAAAGGTGA0.091500.011400.517200.500000.923900.62500


Target Position: 2005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2005UGGAGAUUCAGGUUUUAAU79.2893733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022023TGGAGATTCAGGTTTTAATATTAAAACCTGAATCTCCA0.160500.030600.836200.750001.000001.00000


Target Position: 4491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4491AGUCUUAAUAAAAUCUUAC72.68841417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7204509AGTCTTAATAAAATCTTACGTAAGATTTTATTAAGACT0.279700.153400.525900.500001.000001.00000


Target Position: 5031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5031UGGUAGUUUCCUGCUCUUU68.5521972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7625049TGGTAGTTTCCTGCTCTTTAAAGAGCAGGAAACTACCA0.030200.003600.844800.750000.972800.75000


Target Position: 2450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450GGAGGAACAUUUGGGGCCA80.2966654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502468GGAGGAACATTTGGGGCCATGGCCCCAAATGTTCCTCC0.039600.001100.525900.750001.000001.00000


Target Position: 4515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4515AAAUUUUGAGUAGAAUAAU78.9292769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8424533AAATTTTGAGTAGAATAATATTATTCTACTCAAAATTT0.090600.003600.491400.500001.000001.00000


Target Position: 4882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4882AAAAUAAAAAAAAAAAAAA86.0906267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7674900AAAATAAAAAAAAAAAAAATTTTTTTTTTTTTTATTTT0.948800.934700.500000.500001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518AGGUUCUUCCUCAGCAUCA80.4834639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081536AGGTTCTTCCTCAGCATCATGATGCTGAGGAAGAACCT0.230600.034900.620700.500000.962000.62500


Target Position: 3189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189UGCGAUGUUGUUAUCUGAC63.01372761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313207TGCGATGTTGTTATCTGACGTCAGATAACAACATCGCA0.018300.001200.534500.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615CUUGGCUGUUACAAUCUUA91.845683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832633CTTGGCTGTTACAATCTTATAAGATTGTAACAGCCAAG0.655400.001900.603400.750001.000001.00000


Target Position: 2914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914UCCUCCAGUGUGCAUGGUG56.80183672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7902932TCCTCCAGTGTGCATGGTGCACCATGCACACTGGAGGA0.042300.001800.577600.500000.956500.75000


Target Position: 4468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4468CCAAGAAGGGUGUUUGAAC73.31851331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8144486CCAAGAAGGGTGTTTGAACGTTCAAACACCCTTCTTGG0.177400.001500.698300.750001.000001.00000


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482CCCAGCCCCGUGCCUUACU58.19463461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782500CCCAGCCCCGTGCCTTACTAGTAAGGCACGGGGCTGGG0.131600.019000.784500.750000.934800.87500


Target Position: 4126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4126AGAAAUCAGAGUUAGCUAC70.71441670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7794144AGAAATCAGAGTTAGCTACGTAGCTAACTCTGATTTCT0.026000.022600.543100.500001.000001.00000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408GCCUCCUCCCCACCAAACU65.47212386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3282426GCCTCCTCCCCACCAAACTAGTTTGGTGGGGAGGAGGC0.367400.075400.793100.750001.000001.00000


Target Position: 4024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024CAGAUGAAUUUGAGAUUUU87.8659200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5344042CAGATGAATTTGAGATTTTAAAATCTCAAATTCATCTG0.091500.073100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4022-4044CACAGATGAATTTGAGATTTTGCAAAAUCUCAAAUUCAUCUGUGCAGAUGAAUUUGAGAUUUUGCU14.820.422


Target Position: 3556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3556AGGCUAAGAGAGGUGGGGU66.7142216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563574AGGCTAAGAGAGGTGGGGTACCCCACCTCTCTTAGCCT0.030000.007300.491400.500001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471GCAGAAUGCCAGCUGAUGA90.9652104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710489GCAGAATGCCAGCTGATGATCATCAGCTGGCATTCTGC0.041200.009600.629300.750001.000001.00000


Target Position: 3235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3235CUCGUCUUCAUAUUUGUAC62.12672868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7483253CTCGTCTTCATATTTGTACGTACAAATATGAAGACGAG0.033800.020400.629300.500001.000001.00000


Target Position: 4111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4111UCAGAUCCAAUUUACAGAA80.2679657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5824129TCAGATCCAATTTACAGAATTCTGTAAATTGGATCTGA0.340900.128000.551700.750001.000001.00000


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483CCAGCCCCGUGCCUUACUA80.2997652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022501CCAGCCCCGTGCCTTACTATAGTAAGGCACGGGGCTGG0.121100.012600.672401.000000.934800.75000


Target Position: 1796, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796GUUUUUUCCCCCUAACUUU77.9484854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641814GTTTTTTCCCCCTAACTTTAAAGTTAGGGGGAAAAAAC0.554400.454300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1794-1816TGGTTTTTTCCCCCTAACTTTTTAAAGUUAGGGGGAAAAAACCAGUUUUUUCCCCCUAACUUUUUU9.80.722


Target Position: 5128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5128GCAGUGCGAUUCCCUUUUA88.5088179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4955146GCAGTGCGATTCCCTTTTATAAAAGGGAATCGCACTGC0.112600.016100.819001.000001.000001.00000


Target Position: 4117, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4117CCAAUUUACAGAAAUCAGA83.7138391

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4115-4137ATCCAATTTACAGAAATCAGAGTUCUGAUUUCUGUAAAUUGGAUCCAAUUUACAGAAAUCAGAGUU12.0-1.422


Target Position: 5045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5045UCUUUUUGUGUAAUCUUUU70.10211754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3745063TCTTTTTGTGTAATCTTTTAAAAGATTACACAAAAAGA0.372300.123800.724100.750001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632GCCCAGUCCAUCACAAUCA84.675341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361650GCCCAGTCCATCACAATCATGATTGTGATGGACTGGGC0.586700.180000.775900.750001.000001.00000


Target Position: 3620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3620UGCCUGUGCUGUCACUGAA85.41307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523638TGCCTGTGCTGTCACTGAATTCAGTGACAGCACAGGCA0.033400.001100.681000.750000.918501.00000


Target Position: 3576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3576GAGGGACAGGGCUGGAAGA84.3808359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6633594GAGGGACAGGGCTGGAAGATCTTCCAGCCCTGTCCCTC0.154400.021400.586200.500001.000001.00000


Target Position: 1443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443GCUGGGCUGCUUAAGAAGG61.13813010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241461GCTGGGCTGCTTAAGAAGGCCTTCTTAAGCAGCCCAGC0.198600.001300.508600.500001.000001.00000


Target Position: 4711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4711CUACAAAAAAUACAAAAAU81.4704545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4434729CTACAAAAAATACAAAAATATTTTTGTATTTTTTGTAG0.718300.661200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4709-4731CTCTACAAAAAATACAAAAATTAAUUUUUGUAUUUUUUGUAGAGCUACAAAAAAUACAAAAAUUAU5.67.200


Target Position: 4154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4154UCGUUUGGUUGGGGUUUUU60.95223042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6944172TCGTTTGGTTGGGGTTTTTAAAAACCCCAACCAAACGA0.052500.004200.793100.750001.000001.00000


Target Position: 1598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GGUCGACACAAGGUACUUC76.4054977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231616GGTCGACACAAGGTACTTCGAAGTACCTTGTGTCGACC0.038500.010900.681000.750001.000001.00000


Target Position: 4153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4153CUCGUUUGGUUGGGGUUUU64.00432622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7134171CTCGTTTGGTTGGGGTTTTAAAACCCCAACCAAACGAG0.040500.004600.810300.750001.000001.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233GUGCCUCCUGCAUGUCCUG66.70662218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699251GTGCCTCCTGCATGTCCTGCAGGACATGCAGGAGGCAC0.065200.005500.508600.500000.929300.62500


Target Position: 4256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256AGAAAGGCCUUUUACUCUU77.4233885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5124274AGAAAGGCCTTTTACTCTTAAGAGTAAAAGGCCTTTCT0.598500.020100.586200.750001.000001.00000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254GGGCAGAAAAGCAAUAAUG76.284996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3322272GGGCAGAAAAGCAATAATGCATTATTGCTTTTCTGCCC0.418700.037300.836200.750000.951100.75000


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651CACCCCCUGACCGCUAUGA68.09132027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771669CACCCCCTGACCGCTATGATCATAGCGGTCAGGGGGTG0.158100.102900.569000.500001.000001.00000


Target Position: 4192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4192CAUGUGGACCUUAAUUUAA92.932762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6314210CATGTGGACCTTAATTTAATTAAATTAAGGTCCACATG0.453900.006100.620700.750001.000001.00000


Target Position: 4170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4170UUUUAGUUUGUCUUUCUAA80.3139650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8434188TTTTAGTTTGTCTTTCTAATTAGAAAGACAAACTAAAA0.113700.039500.465500.500001.000001.00000


Target Position: 4847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4847GCACUGCAGCCUGGGACAA80.587623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6074865GCACTGCAGCCTGGGACAATTGTCCCAGGCTGCAGTGC0.067200.009500.706901.000000.994600.75000


Target Position: 5273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5273CCUGUAAUAAACUAGCUAU90.4744116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1265291CCTGTAATAAACTAGCTATATAGCTAGTTTATTACAGG0.517300.492200.801701.000001.000001.00000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848CACCUCCUCACCCCCUUUC54.03194007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6021866CACCTCCTCACCCCCTTTCGAAAGGGGGTGAGGAGGTG0.843700.702200.620700.500001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760AUCUCAAACUCCUUGGCAA87.1097227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868778ATCTCAAACTCCTTGGCAATTGCCAAGGAGTTTGAGAT0.011600.010700.534500.500001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625GUGCUGUCACUGAAUGAGA87.3622216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7493643GTGCTGTCACTGAATGAGATCTCATTCAGTGACAGCAC0.159700.002500.569000.500000.989100.75000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046UCCCUGUAGCAACACCUCU64.07242611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6833064TCCCTGTAGCAACACCTCTAGAGGTGTTGCTACAGGGA0.070600.007100.646600.500001.000001.00000


Target Position: 4935, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4935GGAGUAUAAGAAAGGAAAU90.0488130

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9493519GGAGTATAAGAAAGGAAAT1/1/0/094.96AKT2NM_001626.31NANANA19:40736571..40736589(-)00AKT2(0.002)&LOC100289480(0.029)&DYNC1LI1(0.029)&LOC100292259(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1724953GGAGTATAAGAAAGGAAATATTTCCTTTCTTATACTCC0.410400.190500.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4933-4955CAGGAGTATAAGAAAGGAAATTCAUUUCCUUUCUUAUACUCCUGGGAGUAUAAGAAAGGAAAUUCU18.715.812


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501AGGAGGUCAUGGAGCACAG72.97441372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831519AGGAGGTCATGGAGCACAGCTGTGCTCCATGACCTCCT0.025700.017100.560300.500001.000001.00000


Target Position: 2479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479CCUCCCAGCCCCGUGCCUU61.592937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232497CCTCCCAGCCCCGTGCCTTAAGGCACGGGGCTGGGAGG0.114500.001300.706901.000000.934800.75000


Target Position: 5046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5046CUUUUUGUGUAAUCUUUUC68.33192004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8655064CTTTTTGTGTAATCTTTTCGAAAAGATTACACAAAAAG0.354900.118900.465500.500001.000001.00000


Target Position: 3847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3847CCCUCCCCUAGUCACUGCC50.65174367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173865CCCTCCCCTAGTCACTGCCGGCAGTGACTAGGGGAGGG0.091400.001400.491400.500001.000001.00000


Target Position: 2915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2915CCUCCAGUGUGCAUGGUGU80.2879656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602933CCTCCAGTGTGCATGGTGTACACCATGCACACTGGAGG0.039400.002300.637900.750000.956500.75000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846CCCACCUCCUCACCCCCUU61.56622940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371864CCCACCTCCTCACCCCCTTAAGGGGGTGAGGAGGTGGG0.838400.608100.853401.000001.000001.00000


Target Position: 5262, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5262CUACCAGCAGUCCUGUAAU83.335415

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10526219CTACCAGCAGTCCTGTAAT1/1/0/094.96AKT2NM_001626.31NANANA19:40736244..40736262(-)00AKT2(0.002)


Target Position: 2402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402GGUCCGGCCUCCUCCCCAC65.76152345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512420GGTCCGGCCTCCTCCCCACGTGGGGAGGAGGCCGGACC0.186500.010300.560300.750000.907600.62500


Target Position: 4432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4432UAGUUGAGCAUGUGUGGUU73.9921260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8374450TAGTTGAGCATGTGTGGTTAACCACACATGCTCAACTA0.033200.001200.525900.500001.000001.00000


Target Position: 4443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4443GUGUGGUUAUCCUGUAGAG80.7794601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8174461GTGTGGTTATCCTGTAGAGCTCTACAGGATAACCACAC0.061000.005400.482800.500000.983701.00000


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559GAAGCUCCUGCCACCCUUC69.22011870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111577GAAGCTCCTGCCACCCTTCGAAGGGTGGCAGGAGCTTC0.146400.011200.500000.500000.923900.75000


Target Position: 872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872GGAUGAAGUCGCUCACACA105.8421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450890GGATGAAGTCGCTCACACATGTGTGAGCGACTTCATCC0.145000.017900.663800.750000.940200.62500


Target Position: 4490, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4490GAGUCUUAAUAAAAUCUUA104.3055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4364508GAGTCTTAATAAAATCTTATAAGATTTTATTAAGACTC0.286100.090100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4488-4510TAGAGTCTTAATAAAATCTTACCUAAGAUUUUAUUAAGACUCUAGAGUCUUAAUAAAAUCUUACCU5.318.932


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692CACGACUGAGGAGAUGGAA83.4504405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525710CACGACTGAGGAGATGGAATTCCATCTCCTCAGTCGTG0.101100.011400.620700.750001.000001.00000


Target Position: 4196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4196UGGACCUUAAUUUAAUUAC58.93443361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7054214TGGACCTTAATTTAATTACGTAATTAAATTAAGGTCCA0.737400.024000.663800.500001.000001.00000


Target Position: 5298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5298GUAAAAAAAAAAAAAAAAA85.6732288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2635316GTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAC0.995600.973700.681000.750001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650ACACCCCCUGACCGCUAUG54.79673914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381668ACACCCCCTGACCGCTATGCATAGCGGTCAGGGGGTGT0.162300.107200.551700.500000.972800.62500


Target Position: 4442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4442UGUGUGGUUAUCCUGUAGA74.66431180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8154460TGTGTGGTTATCCTGTAGATCTACAGGATAACCACACA0.122100.012800.482800.500000.983701.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755CGACUAUCUCAAACUCCUU88.7154172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608773CGACTATCTCAAACTCCTTAAGGAGTTTGAGATAGTCG0.066800.059000.655201.000001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919UGCCUCCAGCCUCCAGCCU50.95024343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961937TGCCTCCAGCCTCCAGCCTAGGCTGGAGGCTGGAGGCA0.323300.105700.508600.500000.907600.62500


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063GGCCUGCCUGAGUUUCUGG65.26872421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8482081GGCCTGCCTGAGTTTCTGGCCAGAAACTCAGGCAGGCC0.035300.001100.655200.500001.000001.00000


Target Position: 4195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4195GUGGACCUUAAUUUAAUUA84.6665343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5134213GTGGACCTTAATTTAATTATAATTAAATTAAGGTCCAC0.740400.012100.758600.750001.000001.00000


Target Position: 4927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4927GCAAAGCAGGAGUAUAAGA88.7882165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4434945GCAAAGCAGGAGTATAAGATCTTATACTCCTGCTTTGC0.362600.233600.629300.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850CCUCCUCACCCCCUUUCCA76.3397988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181868CCTCCTCACCCCCTTTCCATGGAAAGGGGGTGAGGAGG0.822900.755200.500000.750001.000001.00000


Target Position: 3448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448CUGGAGAGGGUGGGUGGAG57.13623621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383466CTGGAGAGGGTGGGTGGAGCTCCACCCACCCTCTCCAG0.069900.047600.474100.500001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925CAGCCUCCAGCCUCACCUU78.837779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851943CAGCCTCCAGCCTCACCTTAAGGTGAGGCTGGAGGCTG0.538500.100000.646600.750000.907600.62500


Target Position: 5039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5039UCCUGCUCUUUUUGUGUAA75.53391073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3705057TCCTGCTCTTTTTGTGTAATTACACAAAAAGAGCAGGA0.221800.027600.836200.750001.000001.00000


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308GGUGUCUGUCAUCAAAGAA95.202931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863326GGTGTCTGTCATCAAAGAATTCTTTGATGACAGACACC0.160400.001000.681001.000001.000001.00000


Target Position: 3227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3227CCUUUCUCCUCGUCUUCAU80.0378676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3913245CCTTTCTCCTCGTCTTCATATGAAGACGAGGAGAAAGG0.167000.167700.689701.000001.000001.00000


Target Position: 5051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5051UGUGUAAUCUUUUCCAGUU78.6195794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5605069TGTGTAATCTTTTCCAGTTAACTGGAAAAGATTACACA0.180900.035600.560300.750001.000001.00000


Target Position: 4497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4497AAUAAAAUCUUACCAAAUA90.3787119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624515AATAAAATCTTACCAAATATATTTGGTAAGATTTTATT0.125300.106300.465500.500001.000001.00000


Target Position: 3471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3471UGCUGUGGGGCUGAGGGGU52.02494213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573489TGCTGTGGGGCTGAGGGGTACCCCTCAGCCCCACAGCA0.029100.001000.500000.500000.972800.75000


Target Position: 4191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4191UCAUGUGGACCUUAAUUUA86.5963247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6354209TCATGTGGACCTTAATTTATAAATTAAGGTCCACATGA0.336900.006100.689700.750001.000001.00000


Target Position: 849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849CGGAAGGAAGUCAUCAUUG74.16531245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811867CGGAAGGAAGTCATCATTGCAATGATGACTTCCTTCCG0.020800.002000.767200.750001.000001.00000


Target Position: 3557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3557GGCUAAGAGAGGUGGGGUG69.35561848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7553575GGCTAAGAGAGGTGGGGTGCACCCCACCTCTCTTAGCC0.032200.009500.706900.750001.000001.00000


Target Position: 4281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4281CGUCCCAGCCCCGAGUUGA74.46111203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464299CGTCCCAGCCCCGAGTTGATCAACTCGGGGCTGGGACG0.014900.001600.551700.750000.945700.87500


Target Position: 5228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5228CCGUUAACAGGAAUUGACU79.2647735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7645246CCGTTAACAGGAATTGACTAGTCAATTCCTGTTAACGG0.029900.003600.706900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5226-5248CCCCGTTAACAGGAATTGACTTGAGUCAAUUCCUGUUAACGGGGCCGUUAACAGGAAUUGACUUGU14.815.033


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CCAGUGAGGGGUGAAGCAU74.91141144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282053CCAGTGAGGGGTGAAGCATATGCTTCACCCCTCACTGG0.146000.023200.689701.000001.000001.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481UCCCAGCCCCGUGCCUUAC42.57864958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482499TCCCAGCCCCGTGCCTTACGTAAGGCACGGGGCTGGGA0.176700.025400.689700.500000.934801.00000


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GGCAGAAAAGCAAUAAUGU83.3653412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282273GGCAGAAAAGCAATAATGTACATTATTGCTTTTCTGCC0.271300.025900.793100.750000.951100.75000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840CCCACCCCCACCUCCUCAC51.19884314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061858CCCACCCCCACCTCCTCACGTGAGGAGGTGGGGGTGGG0.799600.415400.698300.750001.000001.00000


Target Position: 5043, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5043GCUCUUUUUGUGUAAUCUU83.8571382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2275061GCTCTTTTTGTGTAATCTTAAGATTACACAAAAAGAGC0.314000.146600.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5041-5063CTGCTCTTTTTGTGTAATCTTTTAAGAUUACACAAAAAGAGCAGGCUCUUUUUGUGUAAUCUUUUU14.510.322


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125GCCGGGAAACACAAGGAAA87.7787206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308143GCCGGGAAACACAAGGAAATTTCCTTGTGTTTCCCGGC0.574600.044701.000001.000001.000001.00000


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128GGGAAACACAAGGAAAGGG61.60822936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860146GGGAAACACAAGGAAAGGGCCCTTTCCTTGTGTTTCCC0.434500.282700.500000.500001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109CGCGCUGCUGCAUCUGGAC67.09552158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062127CGCGCTGCTGCATCTGGACGTCCAGATGCAGCAGCGCG0.087300.001600.603400.750000.945700.75000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736AAGUGACCAUGAAUGACUU86.2348260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732754AAGTGACCATGAATGACTTAAGTCATTCATGGTCACTT0.172400.019100.500000.500001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938CACCUUUGUGCCCAGACUC66.34292270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221956CACCTTTGTGCCCAGACTCGAGTCTGGGCACAAAGGTG0.647000.009600.482800.500000.983700.62500


Target Position: 5213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5213ACCGCUUCAGCUGCCCCGU50.16054421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8225231ACCGCTTCAGCTGCCCCGTACGGGGCAGCTGAAGCGGT0.068500.017100.577600.500000.940200.62500


Target Position: 3036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3036ACGCCUCCCCUCCCUGUAG56.0383755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333054ACGCCTCCCCTCCCTGTAGCTACAGGGAGGGGAGGCGT0.148900.049800.603400.500001.000001.00000


Target Position: 2419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419ACCAAACUGUCCUCACCCU71.6711550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632437ACCAAACTGTCCTCACCCTAGGGTGAGGACAGTTTGGT0.079600.069000.508600.500001.000001.00000


Target Position: 3131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3131UGGCAGGGUGGGGAGGGGU47.98954606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923149TGGCAGGGTGGGGAGGGGTACCCCTCCCCACCCTGCCA0.046600.010200.491400.500001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082GGCUCUUGAGUACUUGCAC74.22091234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431100GGCTCTTGAGTACTTGCACGTGCAAGTACTCAAGAGCC0.035300.003100.706900.750001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702CCCACUUCCCCCAGUUCUC59.51423263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811720CCCACTTCCCCCAGTTCTCGAGAACTGGGGGAAGTGGG0.074900.070400.681000.750000.945700.87500


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694CGACUGAGGAGAUGGAAGU78.3052823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513712CGACTGAGGAGATGGAAGTACTTCCATCTCCTCAGTCG0.198300.022500.586200.750001.000001.00000


Target Position: 4480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4480UUUGAACUUAGAGUCUUAA75.17781117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8474498TTTGAACTTAGAGTCTTAATTAAGACTCTAAGTTCAAA0.332300.120400.465500.500001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855UCACCCCCUUUCCAGUUCU59.74363227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061873TCACCCCCTTTCCAGTTCTAGAACTGGAAAGGGGGTGA0.727500.660600.500000.500000.972800.62500


Target Position: 4933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4933CAGGAGUAUAAGAAAGGAA94.841834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4834951CAGGAGTATAAGAAAGGAATTCCTTTCTTATACTCCTG0.472300.188900.612100.750001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517CAGGUUCUUCCUCAGCAUC68.56151970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871535CAGGTTCTTCCTCAGCATCGATGCTGAGGAAGAACCTG0.157800.020400.603400.500000.918500.62500


Target Position: 4113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4113AGAUCCAAUUUACAGAAAU82.9908445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2694131AGATCCAATTTACAGAAATATTTCTGTAAATTGGATCT0.263000.230600.715500.750001.000001.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835GUGUCCCCACCCCCACCUC55.08673876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121853GTGTCCCCACCCCCACCTCGAGGTGGGGGTGGGGACAC0.652600.398900.482800.500000.934800.62500


Target Position: 3580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580GACAGGGCUGGAAGAUCUG71.21891606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433598GACAGGGCTGGAAGATCTGCAGATCTTCCAGCCCTGTC0.263800.001100.534500.500001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810ACUUUUUACUUAGCCUUUU69.36571847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351828ACTTTTTACTTAGCCTTTTAAAAGGCTAAGTAAAAAGT0.091500.077600.706900.750001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440GACUCUACCCCCCUUAAAC74.2681229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584458GACTCTACCCCCCTTAAACGTTTAAGGGGGGTAGAGTC0.831300.394500.672400.500001.000001.00000


Target Position: 4923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4923GACAGCAAAGCAGGAGUAU77.4046887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3934941GACAGCAAAGCAGGAGTATATACTCCTGCTTTGCTGTC0.370700.084200.775900.750001.000001.00000


Target Position: 1822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822GCCUUUUUGGUUUGUGUCC56.3633710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981840GCCTTTTTGGTTTGTGTCCGGACACAAACCAAAAAGGC0.045700.001700.629300.500000.989100.75000


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700GACCCACUUCCCCCAGUUC67.3672120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421718GACCCACTTCCCCCAGTTCGAACTGGGGGAAGTGGGTC0.092800.092600.646600.500000.945700.75000


Target Position: 4549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4549ACAUUUUAAAAAUUUCACA79.9518684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7554567ACATTTTAAAAATTTCACATGTGAAATTTTTAAAATGT0.386800.324700.500000.500001.000001.00000


Target Position: 5059, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5059CUUUUCCAGUUAAUGUGAA84.3834357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8485077CTTTTCCAGTTAATGTGAATTCACATTAACTGGAAAAG0.201100.026600.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5057-5079ATCTTTTCCAGTTAATGTGAAGCUUCACAUUAACUGGAAAAGAUCUUUUCCAGUUAAUGUGAAGCU20.520.112


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212GCCACCAUGAAAACCUUCU68.62771962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671230GCCACCATGAAAACCTTCTAGAAGGTTTTCATGGTGGC0.041800.001000.775900.750001.000001.00000


Target Position: 3136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3136GGGUGGGGAGGGGUGGGGU59.05313340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4323154GGGTGGGGAGGGGTGGGGTACCCCACCCCTCCCCACCC0.296000.020200.637900.750001.000001.00000


Target Position: 2452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2452AGGAACAUUUGGGGCCAAA74.98831139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462470AGGAACATTTGGGGCCAAATTTGGCCCCAAATGTTCCT0.034600.038000.844800.750001.000001.00000


Target Position: 4437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4437GAGCAUGUGUGGUUAUCCU88.7683168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8504455GAGCATGTGTGGTTATCCTAGGATAACCACACATGCTC0.049300.005000.465500.500000.983700.75000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500GCCGCGACCCAACACCUUU74.15021247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417518GCCGCGACCCAACACCTTTAAAGGTGTTGGGTCGCGGC0.154300.040701.000001.000000.907600.87500


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967GACUCCACCUCCCGCCCAG65.33222411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541985GACTCCACCTCCCGCCCAGCTGGGCGGGAGGTGGAGTC0.016000.008600.534500.500001.000001.00000


Target Position: 4359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4359GGCUACCUCAUCUUUUUAG73.32891329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2204377GGCTACCTCATCTTTTTAGCTAAAAAGATGAGGTAGCC0.338600.095700.827600.750001.000001.00000


Target Position: 2004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2004UUGGAGAUUCAGGUUUUAA76.11621011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442022TTGGAGATTCAGGTTTTAATTAAAACCTGAATCTCCAA0.284600.011400.612100.500001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205UGACGGGGCCACCAUGAAA80.7001610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691223TGACGGGGCCACCATGAAATTTCATGGTGGCCCCGTCA0.028500.002400.724100.750000.918500.75000


Target Position: 4070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4070AUUGAGUCUUUGAGAUUUU75.8521041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8324088ATTGAGTCTTTGAGATTTTAAAATCTCAAAGACTCAAT0.016900.004500.508600.500001.000001.00000


Target Position: 5286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5286AGCUAUCCAUCUGUAAAAA87.9924196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2405304AGCTATCCATCTGTAAAAATTTTTACAGATGGATAGCT0.709600.660000.853400.750001.000001.00000


Target Position: 4535, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4535GUCUUUUGCAAUGUACAUU75.81091046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3034553GTCTTTTGCAATGTACATTAATGTACATTGCAAAAGAC0.406200.180100.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4533-4555TCGTCTTTTGCAATGTACATTTTAAUGUACAUUGCAAAAGACGAGUCUUUUGCAAUGUACAUUUUU20.412.232


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003GUUGGAGAUUCAGGUUUUA87.6292209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852021GTTGGAGATTCAGGTTTTATAAAACCTGAATCTCCAAC0.300200.008400.612100.750001.000001.00000


Target Position: 3579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3579GGACAGGGCUGGAAGAUCU87.2647220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503597GGACAGGGCTGGAAGATCTAGATCTTCCAGCCCTGTCC0.285600.010100.646600.750001.000001.00000


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182CUCUGUGUGCGAUGUUGUU80.2975653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7123200CTCTGTGTGCGATGTTGTTAACAACATCGCACACAGAG0.040700.005900.663800.750001.000001.00000


Target Position: 5203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5203AGACCCCUCAACCGCUUCA72.20891481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7565221AGACCCCTCAACCGCTTCATGAAGCGGTTGAGGGGTCT0.307900.221200.500000.500001.000001.00000


Target Position: 3066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066GGUGUUUGGAGUUUAGCUU81.3278558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086TGGGTGTTTGGAGTTTAGCTTTTAAGCUAAACUCCAAACACCCAGGUGUUUGGAGUUUAGCUUUUU18.319.322


Target Position: 4566, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4566CACAUUCUUUUUUGUAUAU84.7284338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7214584CACATTCTTTTTTGTATATATATACAAAAAAGAATGTG0.426700.003300.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4564-4586CACACATTCTTTTTTGTATATAAAUAUACAAAAAAGAAUGUGUGCACAUUCUUUUUUGUAUAUAAU8.519.222


Target Position: 2738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2738CCCCCCUCACCCCUCCCUC46.39784732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342756CCCCCCTCACCCCTCCCTCGAGGGAGGGGTGAGGGGGG0.460900.213700.681000.750001.000001.00000


Target Position: 3567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3567GGUGGGGUGGAGGGACAGG56.4823697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6973585GGTGGGGTGGAGGGACAGGCCTGTCCCTCCACCCCACC0.052400.005700.508600.500001.000001.00000


Target Position: 4904, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4904GAUACAUGCUAUUAAAAAA105.572

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4490419GATACATGCTATTAAAAAA1/1/0/096.22AKT2NM_001626.31NANANA14:97790984..97791002(+)00AKT2(0.002)&DNAJC5(0.007)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4534922GATACATGCTATTAAAAAATTTTTTAATAGCATGTATC0.521600.017500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4902-4924ATGATACATGCTATTAAAAAAGAUUUUUUAAUAGCAUGUAUCAUGAUACAUGCUAUUAAAAAAGAU-9.113.310


Target Position: 4428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4428CCCGUAGUUGAGCAUGUGU73.91741267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8604446CCCGTAGTTGAGCATGTGTACACATGCTCAACTACGGG0.012400.002400.784500.750001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597AGGUCGACACAAGGUACUU76.6722958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7671615AGGTCGACACAAGGTACTTAAGTACCTTGTGTCGACCT0.037500.002100.706900.750001.000001.00000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731GGCUAAAGUGACCAUGAAU92.025581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
618749GGCTAAAGTGACCATGAATATTCATGGTCACTTTAGCC0.073100.006400.991401.000001.000001.00000


Target Position: 4485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4485ACUUAGAGUCUUAAUAAAA92.658868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1944503ACTTAGAGTCTTAATAAAATTTTATTAAGACTCTAAGT0.588400.185500.706900.750001.000001.00000


Target Position: 5290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5290AUCCAUCUGUAAAAAAAAA83.3648413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8155308ATCCATCTGTAAAAAAAAATTTTTTTTTACAGATGGAT0.977600.700300.681000.500001.000001.00000


Target Position: 3194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194UGUUGUUAUCUGACAGUUC69.83441781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7983212TGTTGTTATCTGACAGTTCGAACTGTCAGATAACAACA0.022300.009200.534500.500001.000001.00000


Target Position: 3710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3710CUGUUUAUGCUGCCACCUG67.54522102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523728CTGTTTATGCTGCCACCTGCAGGTGGCAGCATAAACAG0.024300.020900.500000.500000.962000.87500


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068UGUUUGGAGUUUAGCUUUU70.94081640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8273086TGTTTGGAGTTTAGCTTTTAAAAGCTAAACTCCAAACA0.229200.001300.706900.750001.000001.00000


Target Position: 4054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4054UUAGCACUUCACACCCAUU73.48691306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8214072TTAGCACTTCACACCCATTAATGGGTGTGAAGTGCTAA0.073500.013000.525900.500001.000001.00000


Target Position: 1821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1821AGCCUUUUUGGUUUGUGUC60.19133150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331839AGCCTTTTTGGTTTGTGTCGACACAAACCAAAAAGGCT0.016900.001700.534500.500000.989100.75000


Target Position: 4540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4540UUGCAAUGUACAUUUUAAA78.825780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8534558TTGCAATGTACATTTTAAATTTAAAATGTACATTGCAA0.500800.192300.646600.500001.000001.00000


Target Position: 3703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3703CACCUCCCUGUUUAUGCUG62.52582821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933721CACCTCCCTGTTTATGCTGCAGCATAAACAGGGAGGTG0.232200.023200.508600.500001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809AACUUUUUACUUAGCCUUU72.57991428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781827AACTTTTTACTTAGCCTTTAAAGGCTAAGTAAAAAGTT0.091600.078500.646600.500001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960ACCCACGACCGCCUGUGCU59.56613256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836978ACCCACGACCGCCTGTGCTAGCACAGGCGGTCGTGGGT0.016400.002000.500000.500000.907600.62500


Target Position: 4700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4700GACCUUCAUCUCUACAAAA98.264514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3624718GACCTTCATCTCTACAAAATTTTGTAGAGATGAAGGTC0.181700.066100.819000.750001.000001.00000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648GAGGACCCCAUGGACUACA77.5792877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687666GAGGACCCCATGGACTACATGTAGTCCATGGGGTCCTC0.157800.004400.603400.500000.962000.87500


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630CCGCCCAGUCCAUCACAAU78.7373785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441648CCGCCCAGTCCATCACAATATTGTGATGGACTGGGCGG0.589400.168700.905201.000001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613GCCUUGGCUGUUACAAUCU74.68811177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7942631GCCTTGGCTGTTACAATCTAGATTGTAACAGCCAAGGC0.231500.001700.775900.750000.983700.75000


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234CCUCGUCUUCAUAUUUGUA93.779849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6323252CCTCGTCTTCATATTTGTATACAAATATGAAGACGAGG0.060200.046800.663801.000001.000001.00000


Target Position: 3107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107CCAUCUCCUGUACUACACA90.6714109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5723125CCATCTCCTGTACTACACATGTGTAGTACAGGAGATGG0.080500.009200.637900.750001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441ACUCUACCCCCCUUAAACA81.2935561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
747459ACTCTACCCCCCTTAAACATGTTTAAGGGGGGTAGAGT0.847600.412800.500000.500001.000001.00000


Target Position: 4502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4502AAUCUUACCAAAUAAAUUU78.6799788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6814520AATCTTACCAAATAAATTTAAATTTATTTGGTAAGATT0.100700.027600.508600.500001.000001.00000


Target Position: 2872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2872ACGUGGGUGUGUGUGCAUG65.38962398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352890ACGTGGGTGTGTGTGCATGCATGCACACACACCCACGT0.037200.001500.620700.500001.000001.00000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008CCACUGUGAUCCAUGAGCU84.3717360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053026CCACTGTGATCCATGAGCTAGCTCATGGATCACAGTGG0.076900.018200.491400.750000.978300.62500


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GCAUGUCCUGCUGCCCUGA78.6367791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741260GCATGTCCTGCTGCCCTGATCAGGGCAGCAGGACATGC0.035600.005300.629300.750000.934800.62500


Target Position: 4678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4678ACCAGCCUGGGCAUCAUAG59.68993238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7734696ACCAGCCTGGGCATCATAGCTATGATGCCCAGGCTGGT0.085500.002000.681000.500000.934801.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412CCUCCCCACCAAACUGUCC55.18063867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8392430CCTCCCCACCAAACTGTCCGGACAGTTTGGTGGGGAGG0.156200.071400.474100.500001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862UCAUUGCCAAGGAUGAAGU64.28242582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736880TCATTGCCAAGGATGAAGTACTTCATCCTTGGCAATGA0.051100.003600.517200.500001.000001.00000


Target Position: 2678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2678GGGGUGGGCAUCUCUGGUA85.4529303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792696GGGGTGGGCATCTCTGGTATACCAGAGATGCCCACCCC0.076300.001900.810301.000001.000001.00000


Target Position: 4913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4913UAUUAAAAAAGACAGCAAA83.12435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6144931TATTAAAAAAGACAGCAAATTTGCTGTCTTTTTTAATA0.141500.084000.543100.500001.000001.00000


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058GUUUUAUGGUGCAGAGAUU86.5286249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6991076GTTTTATGGTGCAGAGATTAATCTCTGCACCATAAAAC0.044400.039100.637900.750001.000001.00000


Target Position: 2231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2231CCCCACCCGCUGUCCCCCU53.47134061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752249CCCCACCCGCTGTCCCCCTAGGGGGACAGCGGGTGGGG0.051200.022700.646600.750001.000001.00000


Target Position: 4929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4929AAAGCAGGAGUAUAAGAAA92.525671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7634947AAAGCAGGAGTATAAGAAATTTCTTATACTCCTGCTTT0.539400.237500.500000.500001.000001.00000


Target Position: 2796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2796UGAGUGCACGUCCAUGUCA80.1638670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342814TGAGTGCACGTCCATGTCATGACATGGACGTGCACTCA0.122100.001200.500000.500001.000001.00000


Target Position: 4564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4564CACACAUUCUUUUUUGUAU88.3257186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4562-4584TTCACACATTCTTTTTTGTATATAUACAAAAAAGAAUGUGUGAACACACAUUCUUUUUUGUAUAUU7.219.322


Target Position: 3288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288GGCCCAGCCUGCACUCACG71.85791528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993306GGCCCAGCCTGCACTCACGCGTGAGTGCAGGCTGGGCC0.051800.001700.724100.500000.918500.62500


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223GUCCAAUCCCCCACCCGCU66.67812223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452241GTCCAATCCCCCACCCGCTAGCGGGTGGGGGATTGGAC0.114400.029000.465500.500000.978300.75000


Target Position: 4156, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4156GUUUGGUUGGGGUUUUUUA85.5734297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6954174GTTTGGTTGGGGTTTTTTATAAAAAACCCCAACCAAAC0.078300.004200.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4154-4176TCGTTTGGTTGGGGTTTTTTAGTUAAAAAACCCCAACCAAACGAGUUUGGUUGGGGUUUUUUAGUU-1.818.822


Target Position: 3152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3152GGUUGGUUCGGGUGGGUGA82.026498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093170GGTTGGTTCGGGTGGGTGATCACCCACCCGAACCAACC0.041300.015700.629300.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GAACCUUUGGCAAAGUCAU83.5555398

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801GGGAACCTTTGGCAAAGTCATCCAUGACUUUGCCAAAGGUUCCCGAACCUUUGGCAAAGUCAUCCU19.217.322


Target Position: 5214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5214CCGCUUCAGCUGCCCCGUU66.89122191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5795232CCGCTTCAGCTGCCCCGTTAACGGGGCAGCTGAAGCGG0.074900.020800.767201.000000.940200.75000


Target Position: 3551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3551UGCUUAGGCUAAGAGAGGU67.91822056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7583569TGCTTAGGCTAAGAGAGGTACCTCTCTTAGCCTAAGCA0.091800.004700.500000.500000.983700.75000


Target Position: 4702, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4702CCUUCAUCUCUACAAAAAA94.60736

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7470219CCTTCATCTCTACAAAAAA1/1/0/094.96AKT2NM_001626.31NANANANA00AKT2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2054720CCTTCATCTCTACAAAAAATTTTTTGTAGAGATGAAGG0.512100.102700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4700-4722GACCTTCATCTCTACAAAAAATAUUUUUUGUAGAGAUGAAGGUCCCUUCAUCUCUACAAAAAAUAU5.620.410


Target Position: 4164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4164GGGGUUUUUUAGUUUGUCU83.15432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5304182GGGGTTTTTTAGTTTGTCTAGACAAACTAAAAAACCCC0.092600.018400.767200.750001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540ACCACAGUCAUCGAGAGGA72.98361368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831558ACCACAGTCATCGAGAGGATCCTCTCGATGACTGTGGT0.205700.024900.482800.500001.000001.00000


Target Position: 4065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4065CACCCAUUGAGUCUUUGAG72.26961466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8204083CACCCATTGAGTCTTTGAGCTCAAAGACTCAATGGGTG0.028000.011300.482800.500000.940200.62500


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213UCCGUCCCUACUGGCCUUU46.41674730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3333231TCCGTCCCTACTGGCCTTTAAAGGCCAGTAGGGACGGA0.204300.054100.870700.750000.967401.00000


Target Position: 2813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813CAGUGCUGUGGGACUCCUG72.59111427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302831CAGTGCTGTGGGACTCCTGCAGGAGTCCCACAGCACTG0.020800.001200.500000.500000.962000.75000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343GUGGUGAAUACAUCAAGAC72.65451419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832361GTGGTGAATACATCAAGACGTCTTGATGTATTCACCAC0.085600.002900.474100.500000.989101.00000


Target Position: 4993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4993CUGAUUACCUCUCUGCAAA88.9269161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2445011CTGATTACCTCTCTGCAAATTTGCAGAGAGGTAATCAG0.628600.079300.784500.750000.962000.62500


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439AGACUCUACCCCCCUUAAA80.9244593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276457AGACTCTACCCCCCTTAAATTTAAGGGGGGTAGAGTCT0.826700.381700.724100.750001.000001.00000


Target Position: 4560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4560AUUUCACACAUUCUUUUUU70.55321688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7364578ATTTCACACATTCTTTTTTAAAAAAGAATGTGTGAAAT0.036100.030800.508600.500001.000001.00000


Target Position: 4062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4062UCACACCCAUUGAGUCUUU69.79251786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7314080TCACACCCATTGAGTCTTTAAAGACTCAATGGGTGTGA0.036900.020000.724100.750000.907600.75000


Target Position: 4527, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4527GAAUAAUCGUCUUUUGCAA98.330813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484545GAATAATCGTCTTTTGCAATTGCAAAAGACGATTATTC0.258800.207400.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4525-4547TAGAATAATCGTCTTTTGCAATGUUGCAAAAGACGAUUAUUCUAGAAUAAUCGUCUUUUGCAAUGU20.01.823


Target Position: 4568, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4568CAUUCUUUUUUGUAUAUAA102.7526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844586CATTCTTTTTTGTATATAATTATATACAAAAAAGAATG0.082200.004500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4566-4588CACATTCTTTTTTGTATATAAAGUUAUAUACAAAAAAGAAUGUGCAUUCUUUUUUGUAUAUAAAGU2.85.321


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181CCUCUGUGUGCGAUGUUGU77.003922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033199CCTCTGTGTGCGATGTTGTACAACATCGCACACAGAGG0.021700.002700.637900.750001.000001.00000


Target Position: 4360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4360GCUACCUCAUCUUUUUAGU76.7815946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3614378GCTACCTCATCTTTTTAGTACTAAAAAGATGAGGTAGC0.343000.109800.646600.750001.000001.00000


Target Position: 4523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4523AGUAGAAUAAUCGUCUUUU79.5917711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3134541AGTAGAATAATCGTCTTTTAAAAGACGATTATTCTACT0.358400.047800.706900.750001.000001.00000


Target Position: 3608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3608GAAUGAGGAGGGUGCCUGU84.1633367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8633626GAATGAGGAGGGTGCCTGTACAGGCACCCTCCTCATTC0.030800.002700.465500.500000.967400.75000


Target Position: 4677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4677GACCAGCCUGGGCAUCAUA89.4576148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8364695GACCAGCCTGGGCATCATATATGATGCCCAGGCTGGTC0.111300.001200.775900.750000.934801.00000


Target Position: 4499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4499UAAAAUCUUACCAAAUAAA83.2732420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6254517TAAAATCTTACCAAATAAATTTATTTGGTAAGATTTTA0.070400.043300.534500.500001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506ACCCAACACCUUUGUCAUA82.5259476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567524ACCCAACACCTTTGTCATATATGACAAAGGTGTTGGGT0.080000.061200.810300.750000.967400.87500


Target Position: 4479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4479GUUUGAACUUAGAGUCUUA101.4098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4814497GTTTGAACTTAGAGTCTTATAAGACTCTAAGTTCAAAC0.283100.109800.612100.750001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437UCAGACUCUACCCCCCUUA69.07141893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248455TCAGACTCTACCCCCCTTATAAGGGGGGTAGAGTCTGA0.776400.344800.689700.750001.000001.00000


Target Position: 4083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4083GAUUUUAAGUGAAUGUAAG83.4954401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8334101GATTTTAAGTGAATGTAAGCTTACATTCACTTAAAATC0.140700.001200.543100.500001.000001.00000


Target Position: 4797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4797UCACUUGAGCCCAGGAGUU67.31932124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7194815TCACTTGAGCCCAGGAGTTAACTCCTGGGCTCAAGTGA0.229700.003300.577600.750001.000001.00000


Target Position: 4559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4559AAUUUCACACAUUCUUUUU74.55251193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844577AATTTCACACATTCTTTTTAAAAAGAATGTGTGAAATT0.219200.214300.508600.500001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465GCCAAACCUGCCUGCCUCC57.39493575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582483GCCAAACCTGCCTGCCTCCGGAGGCAGGCAGGTTTGGC0.283100.197900.629300.500000.983700.62500


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253CGGUACAAGCAAUAAAGAC75.68091059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023271CGGTACAAGCAATAAAGACGTCTTTATTGCTTGTACCG0.253700.071200.594800.750001.000001.00000


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928CCUCCAGCCUCACCUUUGU72.66051418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481946CCTCCAGCCTCACCTTTGTACAAAGGTGAGGCTGGAGG0.086300.044800.637900.750001.000001.00000


Target Position: 4220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4220UCUACCCUGGUGGUCAUAA70.7421665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6294238TCTACCCTGGTGGTCATAATTATGACCACCAGGGTAGA0.192900.006200.689700.750000.902200.87500


Target Position: 4846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4846UGCACUGCAGCCUGGGACA71.59291560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7654864TGCACTGCAGCCTGGGACATGTCCCAGGCTGCAGTGCA0.042400.006700.646600.500000.918500.75000


Target Position: 4534, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4534CGUCUUUUGCAAUGUACAU85.1938312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4584552CGTCTTTTGCAATGTACATATGTACATTGCAAAAGACG0.396400.178300.620701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4532-4554ATCGTCTTTTGCAATGTACATTTAUGUACAUUGCAAAAGACGAUCGUCUUUUGCAAUGUACAUUUU20.413.322


Target Position: 4446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446UGGUUAUCCUGUAGAGCUU77.7251869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6244464TGGTTATCCTGTAGAGCTTAAGCTCTACAGGATAACCA0.061400.021500.706900.750000.983700.75000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GCCAAGGAUGAAGUCGCUC59.64423246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516885GCCAAGGATGAAGTCGCTCGAGCGACTTCATCCTTGGC0.097700.019000.689700.750001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536GUGGACCACAGUCAUCGAG66.16642290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857554GTGGACCACAGTCATCGAGCTCGATGACTGTGGTCCAC0.096400.015000.482800.500000.956500.87500


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GGUUCUUCCUCAGCAUCAA93.922245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941537GGTTCTTCCTCAGCATCAATTGATGCTGAGGAAGAACC0.300600.049500.706901.000001.000001.00000


Target Position: 5287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5287GCUAUCCAUCUGUAAAAAA91.654288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755305GCTATCCATCTGTAAAAAATTTTTTACAGATGGATAGC0.729700.682500.853401.000001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784CCUUUGGCAAAGUCAUCCU73.10091354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717802CCTTTGGCAAAGTCATCCTAGGATGACTTTGCCAAAGG0.060500.003400.500000.750001.000001.00000


Target Position: 4799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4799ACUUGAGCCCAGGAGUUUG64.15362601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8414817ACTTGAGCCCAGGAGTTTGCAAACTCCTGGGCTCAAGT0.305200.011900.560300.500001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654CCCAUGGACUACAAGUGUG72.99591367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790672CCCATGGACTACAAGTGTGCACACTTGTAGTCCATGGG0.025000.002400.698300.750001.000001.00000


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619GCUGUUACAAUCUUACACC70.80691651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312637GCTGTTACAATCTTACACCGGTGTAAGATTGTAACAGC0.643700.010400.500000.500001.000001.00000


Target Position: 4225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4225CCUGGUGGUCAUAAAAUAG78.0491846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5534243CCTGGTGGTCATAAAATAGCTATTTTATGACCACCAGG0.163200.010000.672400.750001.000001.00000


Target Position: 4022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4022CACAGAUGAAUUUGAGAUU84.1987365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4814040CACAGATGAATTTGAGATTAATCTCAAATTCATCTGTG0.118100.068800.784500.750001.000001.00000


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802UCCCCCUAACUUUUUACUU61.83162906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711820TCCCCCTAACTTTTTACTTAAGTAAAAAGTTAGGGGGA0.413600.225000.732800.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240CGGAGUACCUGGCGCCUGA83.8021385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491258CGGAGTACCTGGCGCCTGATCAGGCGCCAGGTACTCCG0.014500.009300.689700.750000.962000.75000


Target Position: 3445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3445AGGCUGGAGAGGGUGGGUG52.59514156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6163463AGGCTGGAGAGGGTGGGTGCACCCACCCTCTCCAGCCT0.082800.006500.551700.500001.000001.00000


Target Position: 4112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4112CAGAUCCAAUUUACAGAAA89.0477156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4904130CAGATCCAATTTACAGAAATTTCTGTAAATTGGATCTG0.263300.149700.784500.750001.000001.00000


Target Position: 4303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4303ACGUUGCUGCUCCUCACAC63.69512665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8234321ACGTTGCTGCTCCTCACACGTGTGAGGAGCAGCAACGT0.170100.022600.482800.500000.983700.62500


Target Position: 3686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3686GCAUUCCUAUCCUGCCCCA81.3262559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6953704GCATTCCTATCCTGCCCCATGGGGCAGGATAGGAATGC0.138100.044800.508600.750000.983700.62500


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253GCCUGAGGUGCUGGAGGAC64.44262556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721271GCCTGAGGTGCTGGAGGACGTCCTCCAGCACCTCAGGC0.051900.004800.681000.750001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146GGGUGGGGUUGGUUCGGGU75.0411133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5403164GGGTGGGGTTGGTTCGGGTACCCGAACCAACCCCACCC0.088700.076300.637900.750001.000001.00000


Target Position: 4723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4723CAAAAAUUAGCUGGGCAUG63.80452650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7974741CAAAAATTAGCTGGGCATGCATGCCCAGCTAATTTTTG0.025300.026200.491400.500001.000001.00000


Target Position: 4438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4438AGCAUGUGUGGUUAUCCUG68.56051971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6424456AGCATGTGTGGTTATCCTGCAGGATAACCACACATGCT0.209100.009200.569000.500000.983700.75000


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185UGUGUGCGAUGUUGUUAUC66.4122261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6493203TGTGTGCGATGTTGTTATCGATAACAACATCGCACACA0.118100.007900.525900.500000.994600.62500


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GCCUCCAGCCUCCAGCCUC60.46263113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491938GCCTCCAGCCTCCAGCCTCGAGGCTGGAGGCTGGAGGC0.286500.095500.689700.750000.907600.75000


Target Position: 3846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3846GCCCUCCCCUAGUCACUGC58.65933388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8463864GCCCTCCCCTAGTCACTGCGCAGTGACTAGGGGAGGGC0.047400.001100.646600.500001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567UGCCACCCUUCAAACCUCA71.55641564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051585TGCCACCCTTCAAACCTCATGAGGTTTGAAGGGTGGCA0.120900.001600.629300.500001.000001.00000


Target Position: 4021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4021GCACAGAUGAAUUUGAGAU87.3539217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4264039GCACAGATGAATTTGAGATATCTCAAATTCATCTGTGC0.146300.071000.672401.000001.000001.00000


Target Position: 4533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4533UCGUCUUUUGCAAUGUACA76.3392989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5264551TCGTCTTTTGCAATGTACATGTACATTGCAAAAGACGA0.402200.181100.586200.500001.000001.00000


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976GCUUUGUGAUGGAGUAUGC71.55861563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790994GCTTTGTGATGGAGTATGCGCATACTCCATCACAAAGC0.031400.006200.500000.500001.000001.00000


Target Position: 5271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5271GUCCUGUAAUAAACUAGCU80.6155622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8675289GTCCTGTAATAAACTAGCTAGCTAGTTTATTACAGGAC0.522900.053200.465500.500001.000001.00000


Target Position: 5293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5293CAUCUGUAAAAAAAAAAAA89.5176145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3505311CATCTGTAAAAAAAAAAAATTTTTTTTTTTTACAGATG0.986100.711600.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5291-5313TCCATCTGTAAAAAAAAAAAAAAUUUUUUUUUUUUACAGAUGGACAUCUGUAAAAAAAAAAAAAAU-11.320.31


Target Position: 4448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4448GUUAUCCUGUAGAGCUUUU78.2054835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484466GTTATCCTGTAGAGCTTTTAAAAGCTCTACAGGATAAC0.057200.013700.646600.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737AGUGACCAUGAAUGACUUC66.41562260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801755AGTGACCATGAATGACTTCGAAGTCATTCATGGTCACT0.190700.027800.534500.500000.967400.62500


Target Position: 4703, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4703CUUCAUCUCUACAAAAAAU88.3591184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4504721CTTCATCTCTACAAAAAATATTTTTTGTAGAGATGAAG0.931600.118100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4701-4723ACCTTCATCTCTACAAAAAATACAUUUUUUGUAGAGAUGAAGGUCUUCAUCUCUACAAAAAAUACU-2.920.411


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602GACACAAGGUACUUCGAUG84.7911332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371620GACACAAGGTACTTCGATGCATCGAAGTACCTTGTGTC0.036000.005700.663800.500001.000001.00000


Target Position: 2253, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2253GGGGCAGAAAAGCAAUAAU85.6985286

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5225319GGGGCAGAAAAGCAATAAT1/1/0/094.96AKT2NM_001626.31NANANA19:40739253..40739271(-)00AKT2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782271GGGGCAGAAAAGCAATAATATTATTGCTTTTCTGCCCC0.461100.014900.982801.000000.951100.87500


Target Position: 3447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3447GCUGGAGAGGGUGGGUGGA72.1851485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8193465GCTGGAGAGGGTGGGTGGATCCACCCACCCTCTCCAGC0.062900.016200.482800.750001.000001.00000


Target Position: 4542, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4542GCAAUGUACAUUUUAAAAA89.7399140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734560GCAATGTACATTTTAAAAATTTTTAAAATGTACATTGC0.667700.329000.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4540-4562TTGCAATGTACATTTTAAAAATTUUUUUAAAAUGUACAUUGCAAGCAAUGUACAUUUUAAAAAUUU-9.113.521


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443UCUACCCCCCUUAAACAAC52.12094207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622461TCTACCCCCCTTAAACAACGTTGTTTAAGGGGGGTAGA0.401700.320200.577600.500001.000001.00000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745UGAAUGACUUCGACUAUCU79.081751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792763TGAATGACTTCGACTATCTAGATAGTCGAAGTCATTCA0.643100.149300.500000.500000.978300.62500


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498CCAAGGAGGUCAUGGAGCA86.2987254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081516CCAAGGAGGTCATGGAGCATGCTCCATGACCTCCTTGG0.052600.046300.491400.750000.972800.62500


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226GCCUUUCUCCUCGUCUUCA81.09573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3703244GCCTTTCTCCTCGTCTTCATGAAGACGAGGAGAAAGGC0.176900.178000.775900.750001.000001.00000


Target Position: 3024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024GCUGCCCUGCCCACGCCUC55.06313880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103042GCTGCCCTGCCCACGCCTCGAGGCGTGGGCAGGGCAGC0.262400.010600.543100.750000.913000.87500


Target Position: 1927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927GCCUCCAGCCUCACCUUUG66.65622228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711945GCCTCCAGCCTCACCTTTGCAAAGGTGAGGCTGGAGGC0.121000.066100.853400.750001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410CUCCUCCCCACCAAACUGU61.48032950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892428CTCCTCCCCACCAAACTGTACAGTTTGGTGGGGAGGAG0.209900.034200.603400.500001.000001.00000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170AGGGUCUUUUUCCUCUGUG62.75822793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8193188AGGGTCTTTTTCCTCTGTGCACAGAGGAAAAAGACCCT0.019200.003900.551700.500000.929300.62500


Target Position: 4455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4455UGUAGAGCUUUUCCCAAGA76.23311001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8244473TGTAGAGCTTTTCCCAAGATCTTGGGAAAAGCTCTACA0.060800.021100.482800.500000.978301.00000


Target Position: 3574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3574UGGAGGGACAGGGCUGGAA68.95981912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4473592TGGAGGGACAGGGCTGGAATTCCAGCCCTGTCCCTCCA0.133800.019300.672400.750001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743CAUGAAUGACUUCGACUAU89.4832147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482761CATGAATGACTTCGACTATATAGTCGAAGTCATTCATG0.623200.107500.612100.750000.978300.87500


Target Position: 4901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4901CAUGAUACAUGCUAUUAAA104.9514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4899-4921AACATGATACATGCTATTAAAAAUUUAAUAGCAUGUAUCAUGUUCAUGAUACAUGCUAUUAAAAAU-2.316.032


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081CGGCUCUUGAGUACUUGCA79.9532683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421099CGGCTCTTGAGTACTTGCATGCAAGTACTCAAGAGCCG0.072600.001200.560300.750001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921CCUCCAGCCUCCAGCCUCA83.9533378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651939CCTCCAGCCTCCAGCCTCATGAGGCTGGAGGCTGGAGG0.316300.095600.620700.750000.907600.87500


Target Position: 3842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3842GUCAGCCCUCCCCUAGUCA75.78871049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383860GTCAGCCCTCCCCTAGTCATGACTAGGGGAGGGCTGAC0.047100.001200.594800.500001.000001.00000


Target Position: 5032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5032GGUAGUUUCCUGCUCUUUU85.423306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7295050GGTAGTTTCCTGCTCTTTTAAAAGAGCAGGAAACTACC0.037000.006000.853401.000001.000001.00000


Target Position: 2779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2779AGCCUUAAGGUUGAACAUG61.69182927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412797AGCCTTAAGGTTGAACATGCATGTTCAACCTTAAGGCT0.015900.001900.698300.500001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933CUCACUGCGCUGAAGUAUG68.8061937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786951CTCACTGCGCTGAAGTATGCATACTTCAGCGCAGTGAG0.025500.010200.655200.500000.962000.62500


Target Position: 3547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3547GUGCUGCUUAGGCUAAGAG70.27111731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133565GTGCTGCTTAGGCTAAGAGCTCTTAGCCTAAGCAGCAC0.351200.001600.482800.500000.983701.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927CCGUUCCUCACUGCGCUGA66.39332265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
647945CCGTTCCTCACTGCGCTGATCAGCGCAGTGAGGAACGG0.057500.010900.689700.750000.972800.62500


Target Position: 3188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188GUGCGAUGUUGUUAUCUGA94.728135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7483206GTGCGATGTTGTTATCTGATCAGATAACAACATCGCAC0.071300.002500.569000.500001.000001.00000


Target Position: 5033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5033GUAGUUUCCUGCUCUUUUU83.1809429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6835051GTAGTTTCCTGCTCTTTTTAAAAAGAGCAGGAAACTAC0.048800.008800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5031-5053TGGTAGTTTCCTGCTCTTTTTGTAAAAAGAGCAGGAAACUACCAGUAGUUUCCUGCUCUUUUUGUU10.314.622


Target Position: 2251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2251UGGGGGCAGAAAAGCAAUA73.17231346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482269TGGGGGCAGAAAAGCAATATATTGCTTTTCTGCCCCCA0.604600.005600.801700.750000.951101.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513AGCACAGGUUCUUCCUCAG72.31931459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641531AGCACAGGTTCTTCCTCAGCTGAGGAAGAACCTGTGCT0.072500.002100.569000.500000.918500.87500


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288CCGUGGACUGGUGGGGGCU59.93153194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6731306CCGTGGACTGGTGGGGGCTAGCCCCCACCAGTCCACGG0.051300.005500.560300.750001.000001.00000


Target Position: 3106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106CCCAUCUCCUGUACUACAC66.89682188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923124CCCATCTCCTGTACTACACGTGTAGTACAGGAGATGGG0.024800.012500.698300.750001.000001.00000


Target Position: 4970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4970GGCCUUGAGUACUCAUUUU88.3013187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6694988GGCCTTGAGTACTCATTTTAAAATGAGTACTCAAGGCC0.168000.004901.000001.000001.000001.00000


Target Position: 5126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5126CGGCAGUGCGAUUCCCUUU77.5116881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4435144CGGCAGTGCGATTCCCTTTAAAGGGAATCGCACTGCCG0.137900.022000.913801.000000.967400.62500


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GCUCCUGCCACCCUUCAAA84.4567353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421580GCTCCTGCCACCCTTCAAATTTGAAGGGTGGCAGGAGC0.231600.005800.853401.000001.000001.00000


Target Position: 4872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4872UGUGUCUCUAAAAAUAAAA79.0342756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4884890TGTGTCTCTAAAAATAAAATTTTATTTTTAGAGACACA0.980900.035300.706900.750001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653CCCCAUGGACUACAAGUGU72.07591499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771671CCCCATGGACTACAAGTGTACACTTGTAGTCCATGGGG0.028000.005600.784500.750001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502GGAGGUCAUGGAGCACAGG66.34882269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211520GGAGGTCATGGAGCACAGGCCTGTGCTCCATGACCTCC0.018700.012400.525900.500001.000001.00000


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216GUCCCUACUGGCCUUUCUC64.91672477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193234GTCCCTACTGGCCTTTCTCGAGAAAGGCCAGTAGGGAC0.648600.103400.508600.500000.967400.87500


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797UUUUUUCCCCCUAACUUUU60.14123160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441815TTTTTTCCCCCTAACTTTTAAAAGTTAGGGGGAAAAAA0.716200.396000.500000.500001.000001.00000


Target Position: 4928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4928CAAAGCAGGAGUAUAAGAA93.164458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8334946CAAAGCAGGAGTATAAGAATTCTTATACTCCTGCTTTG0.377500.235700.474100.750001.000001.00000


Target Position: 5201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5201GUAGACCCCUCAACCGCUU70.95981637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6125219GTAGACCCCTCAACCGCTTAAGCGGTTGAGGGGTCTAC0.315700.008000.543100.750001.000001.00000


Target Position: 4850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4850CUGCAGCCUGGGACAAUGA79.3652728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7724868CTGCAGCCTGGGACAATGATCATTGTCCCAGGCTGCAG0.109300.002000.560300.500001.000001.00000


Target Position: 3474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474UGUGGGGCUGAGGGGUAUG52.57824160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643492TGTGGGGCTGAGGGGTATGCATACCCCTCAGCCCCACA0.186000.001000.551700.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634CCAGUCCAUCACAAUCACA88.7262170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981652CCAGTCCATCACAATCACATGTGATTGTGATGGACTGG0.767500.197500.637900.750001.000001.00000


Target Position: 4673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4673UCGAGACCAGCCUGGGCAU65.09322450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614691TCGAGACCAGCCTGGGCATATGCCCAGGCTGGTCTCGA0.028500.001000.637900.750000.934800.75000


Target Position: 1936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1936CUCACCUUUGUGCCCAGAC57.55583542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441954CTCACCTTTGTGCCCAGACGTCTGGGCACAAAGGTGAG0.015200.013300.491400.500000.923900.75000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312UGGUCAUGUACGAGAUGAU83.3761409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531330TGGTCATGTACGAGATGATATCATCTCGTACATGACCA0.484200.001100.663800.750001.000001.00000


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873CGUGGGUGUGUGUGCAUGU81.6342529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812891CGTGGGTGTGTGTGCATGTACATGCACACACACCCACG0.032300.001900.569000.750001.000001.00000


Target Position: 4270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4270CUCUUCCAUCUCGUCCCAG59.82033216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6884288CTCTTCCATCTCGTCCCAGCTGGGACGAGATGGAAGAG0.131400.119300.525900.500001.000001.00000


Target Position: 4380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4380CCUCUCUCCUCUUCCACAG67.99252044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6464398CCTCTCTCCTCTTCCACAGCTGTGGAAGAGGAGAGAGG0.057700.027000.560300.750001.000001.00000


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950CAGACUCGCAUUUGGAAGA80.7129608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6241968CAGACTCGCATTTGGAAGATCTTCCAAATGCGAGTCTG0.103700.021900.560300.500001.000001.00000


Target Position: 4472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4472GAAGGGUGUUUGAACUUAG83.9516379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7874490GAAGGGTGTTTGAACTTAGCTAAGTTCAAACACCCTTC0.156100.002300.500000.500001.000001.00000


Target Position: 3548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548UGCUGCUUAGGCUAAGAGA75.97241029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083566TGCTGCTTAGGCTAAGAGATCTCTTAGCCTAAGCAGCA0.094100.001500.629300.500000.983701.00000


Target Position: 3544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3544UCAGUGCUGCUUAGGCUAA76.6929956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7353562TCAGTGCTGCTTAGGCTAATTAGCCTAAGCAGCACTGA0.068100.003000.689700.750000.983700.87500


Target Position: 4537, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4537CUUUUGCAAUGUACAUUUU80.1803666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4374555CTTTTGCAATGTACATTTTAAAATGTACATTGCAAAAG0.418500.189800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4535-4557GTCTTTTGCAATGTACATTTTAAAAAAUGUACAUUGCAAAAGACCUUUUGCAAUGUACAUUUUAAU6.920.022


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CCCCCUUUCCAGUUCUUCU74.41781211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961876CCCCCTTTCCAGTTCTTCTAGAAGAACTGGAAAGGGGG0.634800.580700.767200.750001.000001.00000


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171GGGUCUUUUUCCUCUGUGU83.016443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063189GGGTCTTTTTCCTCTGTGTACACAGAGGAAAAAGACCC0.021100.006300.784500.750001.000001.00000


Target Position: 4365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4365CUCAUCUUUUUAGUGCCUC55.90833775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8134383CTCATCTTTTTAGTGCCTCGAGGCACTAAAAAGATGAG0.127700.129300.500000.500001.000001.00000


Target Position: 4023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023ACAGAUGAAUUUGAGAUUU75.02291136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4934041ACAGATGAATTTGAGATTTAAATCTCAAATTCATCTGT0.113100.065700.706900.750001.000001.00000


Target Position: 4163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4163UGGGGUUUUUUAGUUUGUC56.22983728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7064181TGGGGTTTTTTAGTTTGTCGACAAACTAAAAAACCCCA0.092500.015700.525900.500001.000001.00000


Target Position: 3852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3852CCCUAGUCACUGCCCUUUA84.3255362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4013870CCCTAGTCACTGCCCTTTATAAAGGGCAGTGACTAGGG0.225900.022600.956901.000001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132UGGAAAACCUCAUGCUGGA77.2032909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281150TGGAAAACCTCATGCTGGATCCAGCATGAGGTTTTCCA0.074900.016000.474100.500000.956500.75000


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604CACAAGGUACUUCGAUGAU81.194567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131622CACAAGGTACTTCGATGATATCATCGAAGTACCTTGTG0.020600.003500.612100.750001.000001.00000


Target Position: 4478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4478UGUUUGAACUUAGAGUCUU74.17781241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5424496TGTTTGAACTTAGAGTCTTAAGACTCTAAGTTCAAACA0.259700.101600.569000.750001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CAGACUCUACCCCCCUUAA88.8754163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147456CAGACTCTACCCCCCTTAATTAAGGGGGGTAGAGTCTG0.815700.369600.750000.750001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187CUGCAAAGAGGGCAUCAGU76.2796998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621205CTGCAAAGAGGGCATCAGTACTGATGCCCTCTTTGCAG0.107800.009800.577600.500000.967400.62500


Target Position: 4160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4160GGUUGGGGUUUUUUAGUUU85.2991309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6574178GGTTGGGGTTTTTTAGTTTAAACTAAAAAACCCCAACC0.146200.005300.853401.000001.000001.00000


Target Position: 5127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5127GGCAGUGCGAUUCCCUUUU71.18841613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4745145GGCAGTGCGATTCCCTTTTAAAAGGGAATCGCACTGCC0.120300.020701.000001.000001.000001.00000


Target Position: 3047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047CCCUGUAGCAACACCUCUG72.0411505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373065CCCTGTAGCAACACCTCTGCAGAGGTGTTGCTACAGGG0.016300.001500.706900.750001.000001.00000


Target Position: 4298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4298GACCCACGUUGCUGCUCCU83.2496423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8404316GACCCACGTTGCTGCTCCTAGGAGCAGCAACGTGGGTC0.069900.050500.474100.500001.000001.00000


Target Position: 3156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3156GGUUCGGGUGGGUGAGGGU73.14961349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563174GGTTCGGGTGGGTGAGGGTACCCTCACCCACCCGAACC0.013100.005000.500000.750001.000001.00000


Target Position: 3132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3132GGCAGGGUGGGGAGGGGUG56.55723689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5143150GGCAGGGTGGGGAGGGGTGCACCCCTCCCCACCCTGCC0.198500.012100.706900.750001.000001.00000


Target Position: 4553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4553UUUAAAAAUUUCACACAUU72.83681395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7884571TTTAAAAATTTCACACATTAATGTGTGAAATTTTTAAA0.335700.249800.491400.500001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508CCUUCCAGCUGGCCUUACC60.50173104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072526CCTTCCAGCTGGCCTTACCGGTAAGGCCAGCTGGAAGG0.035700.003700.491400.500000.913000.62500


Target Position: 4902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4902AUGAUACAUGCUAUUAAAA86.3526253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7864920ATGATACATGCTATTAAAATTTTAATAGCATGTATCAT0.168300.020800.655200.500001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703CCACUUCCCCCAGUUCUCC54.9053901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291721CCACTTCCCCCAGTTCTCCGGAGAACTGGGGGAAGTGG0.068200.060600.474100.500000.945700.75000


Target Position: 5283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5283ACUAGCUAUCCAUCUGUAA85.8904276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4895301ACTAGCTATCCATCTGTAATTACAGATGGATAGCTAGT0.671700.543300.672400.750001.000001.00000


Target Position: 3192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192GAUGUUGUUAUCUGACAGU82.0188500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313210GATGTTGTTATCTGACAGTACTGTCAGATAACAACATC0.018700.006600.474100.500001.000001.00000


Target Position: 4263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4263CCUUUUACUCUUCCAUCUC67.89222060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6144281CCTTTTACTCTTCCATCTCGAGATGGAAGAGTAAAAGG0.335500.206700.534500.750001.000001.00000


Target Position: 4712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4712UACAAAAAAUACAAAAAUU79.29732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6614730TACAAAAAATACAAAAATTAATTTTTGTATTTTTTGTA0.610700.560500.672400.500001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861CCUUUCCAGUUCUUCUUCA84.1392372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641879CCTTTCCAGTTCTTCTTCATGAAGAAGAACTGGAAAGG0.532500.473300.620700.750001.000001.00000


Target Position: 4093, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4093GAAUGUAAGCAGAAAAAGU89.5669144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8644111GAATGTAAGCAGAAAAAGTACTTTTTCTGCTTACATTC0.227300.041700.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4091-4113GTGAATGTAAGCAGAAAAAGTCAACUUUUUCUGCUUACAUUCACGAAUGUAAGCAGAAAAAGUCAU5.56.922


Target Position: 4193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4193AUGUGGACCUUAAUUUAAU80.8892596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6004211ATGTGGACCTTAATTTAATATTAAATTAAGGTCCACAT0.736500.007400.646600.500001.000001.00000


Target Position: 4722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4722ACAAAAAUUAGCUGGGCAU73.10771353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7474740ACAAAAATTAGCTGGGCATATGCCCAGCTAATTTTTGT0.034100.036400.551700.750001.000001.00000


Target Position: 3958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3958AGCAAGGGACCAGGGACCA66.58012239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283976AGCAAGGGACCAGGGACCATGGTCCCTGGTCCCTTGCT0.020700.001800.508600.500000.989100.75000


Target Position: 3249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3249UGUACGGUACAAGCAAUAA81.5772539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3773267TGTACGGTACAAGCAATAATTATTGCTTGTACCGTACA0.174400.036400.672400.750001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826GCUACUACGCCAUGAAGAU86.2765257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649844GCTACTACGCCATGAAGATATCTTCATGGCGTAGTAGC0.056800.029000.672401.000000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
824-846CCGCTACTACGCCATGAAGATCCAUCUUCAUGGCGUAGUAGCGGGCUACUACGCCAUGAAGAUCCU20.418.803


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215CGUCCCUACUGGCCUUUCU75.16361121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943233CGTCCCTACTGGCCTTTCTAGAAAGGCCAGTAGGGACG0.357200.064700.551700.750000.967401.00000


Target Position: 4879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4879CUAAAAAUAAAAAAAAAAA86.8885239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2914897CTAAAAATAAAAAAAAAAATTTTTTTTTTTATTTTTAG0.983400.966200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4877-4899CTCTAAAAATAAAAAAAAAAAAAUUUUUUUUUUUAUUUUUAGAGCUAAAAAUAAAAAAAAAAAAAU-11.3-9.710


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142GGAGGGGUGGGGUUGGUUC65.13882435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4533160GGAGGGGTGGGGTTGGTTCGAACCAACCCCACCCCTCC0.142900.086700.698300.750001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CCACCCCCACCUCCUCACC49.80964452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931859CCACCCCCACCTCCTCACCGGTGAGGAGGTGGGGGTGG0.883800.428600.491400.500001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218CCCUACUGGCCUUUCUCCU67.26792134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4313236CCCTACTGGCCTTTCTCCTAGGAGAAAGGCCAGTAGGG0.816700.120000.646600.750000.967400.75000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803CCCCCUAACUUUUUACUUA91.0228101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151821CCCCCTAACTTTTTACTTATAAGTAAAAAGTTAGGGGG0.219000.127000.956901.000001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GACCCAACACCUUUGUCAU88.0216194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572523GACCCAACACCTTTGTCATATGACAAAGGTGTTGGGTC0.078400.060400.663800.750000.967400.75000


Target Position: 4364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4364CCUCAUCUUUUUAGUGCCU74.1981239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7544382CCTCATCTTTTTAGTGCCTAGGCACTAAAAAGATGAGG0.135400.137000.500000.750001.000001.00000


Target Position: 3701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3701CCCACCUCCCUGUUUAUGC54.85283908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523719CCCACCTCCCTGTTTATGCGCATAAACAGGGAGGTGGG0.207200.021700.637900.500001.000001.00000


Target Position: 2740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2740CCCCUCACCCCUCCCUCUC48.55744562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3112758CCCCTCACCCCTCCCTCTCGAGAGGGAGGGGTGAGGGG0.446500.369200.681000.750001.000001.00000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345CCUUCUACAACCAGGACCA82.9106450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401363CCTTCTACAACCAGGACCATGGTCCTGGTTGTAGAAGG0.180700.119000.500000.750000.967400.62500


Target Position: 4528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4528AAUAAUCGUCUUUUGCAAU77.7604867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7194546AATAATCGTCTTTTGCAATATTGCAAAAGACGATTATT0.246100.209500.500000.500001.000001.00000


Target Position: 2484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484CAGCCCCGUGCCUUACUAG70.13131747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8592502CAGCCCCGTGCCTTACTAGCTAGTAAGGCACGGGGCTG0.012800.005700.612100.500000.934800.62500


Target Position: 4500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4500AAAAUCUUACCAAAUAAAU75.80811047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7864518AAAATCTTACCAAATAAATATTTATTTGGTAAGATTTT0.086700.037900.491400.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859CCCCUUUCCAGUUCUUCUU69.65071805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831877CCCCTTTCCAGTTCTTCTTAAGAAGAACTGGAAAGGGG0.645900.532400.853401.000001.000001.00000


Target Position: 4121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4121UUUACAGAAAUCAGAGUUA78.1239841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464139TTTACAGAAATCAGAGTTATAACTCTGATTTCTGTAAA0.087100.041900.465500.500001.000001.00000


Target Position: 5052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5052GUGUAAUCUUUUCCAGUUA91.467590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3835070GTGTAATCTTTTCCAGTTATAACTGGAAAAGATTACAC0.170900.118000.758600.750001.000001.00000


Target Position: 4878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4878UCUAAAAAUAAAAAAAAAA79.0186758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2214896TCTAAAAATAAAAAAAAAATTTTTTTTTTATTTTTAGA0.986400.937700.724100.750001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CCUGAGGUGCUGGAGGACA76.9978923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061272CCTGAGGTGCTGGAGGACATGTCCTCCAGCACCTCAGG0.088100.007200.637900.750001.000001.00000


Target Position: 4857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4857CUGGGACAAUGAGACUGUG72.42341445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8654875CTGGGACAATGAGACTGTGCACAGTCTCATTGTCCCAG0.012100.013000.491400.500000.972800.62500


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GGACCACAGUCAUCGAGAG84.8049331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572556GGACCACAGTCATCGAGAGCTCTCGATGACTGTGGTCC0.507400.016600.560300.750000.956500.62500


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CGGGAAACACAAGGAAAGG61.15343004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717145CGGGAAACACAAGGAAAGGCCTTTCCTTGTGTTTCCCG0.446000.230800.569000.500001.000001.00000


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793GUGGUUUUUUCCCCCUAAC62.99382763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781811GTGGTTTTTTCCCCCTAACGTTAGGGGGAAAAAACCAC0.497900.064200.646600.500000.907600.75000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883CCCUCCCAGACGCACCCCA66.84712197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211901CCCTCCCAGACGCACCCCATGGGGTGCGTCTGGGAGGG0.149300.097700.646600.750001.000001.00000


Target Position: 3571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3571GGGUGGAGGGACAGGGCUG68.0392035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313589GGGTGGAGGGACAGGGCTGCAGCCCTGTCCCTCCACCC0.119000.011000.706900.750001.000001.00000


Target Position: 4498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4498AUAAAAUCUUACCAAAUAA90.6634111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7744516ATAAAATCTTACCAAATAATTATTTGGTAAGATTTTAT0.131300.105800.508600.500001.000001.00000


Target Position: 4881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4881AAAAAUAAAAAAAAAAAAA84.6221345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7654899AAAAATAAAAAAAAAAAAATTTTTTTTTTTTTATTTTT0.970900.954200.500000.500001.000001.00000


Target Position: 3566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3566AGGUGGGGUGGAGGGACAG57.22283606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923584AGGTGGGGTGGAGGGACAGCTGTCCCTCCACCCCACCT0.072200.007900.560300.500001.000001.00000


Target Position: 4522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4522GAGUAGAAUAAUCGUCUUU86.4161252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5074540GAGTAGAATAATCGTCTTTAAAGACGATTATTCTACTC0.382700.012500.810300.750001.000001.00000


Target Position: 4197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4197GGACCUUAAUUUAAUUACA96.720322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3204215GGACCTTAATTTAATTACATGTAATTAAATTAAGGTCC0.733900.040400.663800.750001.000001.00000


Target Position: 4357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4357CUGGCUACCUCAUCUUUUU81.0429579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4404375CTGGCTACCTCATCTTTTTAAAAAGATGAGGTAGCCAG0.594100.035200.784500.750001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GGUUUUAUGGUGCAGAGAU87.2616221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601075GGTTTTATGGTGCAGAGATATCTCTGCACCATAAAACC0.052700.051700.672401.000001.000001.00000


Target Position: 4440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4440CAUGUGUGGUUAUCCUGUA95.268429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8374458CATGTGTGGTTATCCTGTATACAGGATAACCACACATG0.155800.011800.474100.750000.983701.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516ACAGGUUCUUCCUCAGCAU81.0524577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851534ACAGGTTCTTCCTCAGCATATGCTGAGGAAGAACCTGT0.114200.008600.551700.750000.918500.75000


Target Position: 2739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739CCCCCUCACCCCUCCCUCU64.15892599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812757CCCCCTCACCCCTCCCTCTAGAGGGAGGGGTGAGGGGG0.462300.380800.767200.750001.000001.00000


Target Position: 3027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3027GCCCUGCCCACGCCUCCCC43.02374931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863045GCCCTGCCCACGCCTCCCCGGGGAGGCGTGGGCAGGGC0.297800.197900.508600.500000.913001.00000


Target Position: 4067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4067CCCAUUGAGUCUUUGAGAU81.194568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8254085CCCATTGAGTCTTTGAGATATCTCAAAGACTCAATGGG0.018100.008100.810301.000001.000001.00000


Target Position: 3549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3549GCUGCUUAGGCUAAGAGAG73.02961363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513567GCTGCTTAGGCTAAGAGAGCTCTCTTAGCCTAAGCAGC0.068500.001100.543100.750000.983700.87500


Target Position: 3473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473CUGUGGGGCUGAGGGGUAU71.31351594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393491CTGTGGGGCTGAGGGGTATATACCCCTCAGCCCCACAG0.200900.001200.741400.750001.000001.00000


Target Position: 3709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3709CCUGUUUAUGCUGCCACCU65.97852317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7623727CCTGTTTATGCTGCCACCTAGGTGGCAGCATAAACAGG0.062700.046500.500000.750000.962000.75000


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124UGCCGGGAAACACAAGGAA72.41581446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488142TGCCGGGAAACACAAGGAATTCCTTGTGTTTCCCGGCA0.572700.013700.681000.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845CCCCACCUCCUCACCCCCU57.45043562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781863CCCCACCTCCTCACCCCCTAGGGGGTGAGGAGGTGGGG0.836000.575500.646600.750001.000001.00000


Target Position: 3042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042CCCCUCCCUGUAGCAACAC51.99424218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6203060CCCCTCCCTGTAGCAACACGTGTTGCTACAGGGAGGGG0.063700.011500.698300.750001.000001.00000


Target Position: 3708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3708CCCUGUUUAUGCUGCCACC66.05842304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273726CCCTGTTTATGCTGCCACCGGTGGCAGCATAAACAGGG0.139100.108500.637900.500000.962000.62500


Target Position: 5288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5288CUAUCCAUCUGUAAAAAAA94.41738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3325306CTATCCATCTGTAAAAAAATTTTTTTACAGATGGATAG0.794400.685700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5286-5308AGCTATCCATCTGTAAAAAAAAAUUUUUUUACAGAUGGAUAGCUCUAUCCAUCUGUAAAAAAAAAU-9.121.2


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913GUCCUCCAGUGUGCAUGGU64.64642526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582931GTCCTCCAGTGTGCATGGTACCATGCACACTGGAGGAC0.060700.001100.465500.500000.956500.62500


Target Position: 4016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4016GCCUGGCACAGAUGAAUUU80.4506642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6234034GCCTGGCACAGATGAATTTAAATTCATCTGTGCCAGGC0.187000.006401.000001.000000.978300.62500


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19GGGGGCUGGGGGGAGGGGG32.90445240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84137GGGGGCTGGGGGGAGGGGGCCCCCTCCCCCCAGCCCCC0.028600.001200.500000.500001.000001.00000


Target Position: 3565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3565GAGGUGGGGUGGAGGGACA82.4533481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6463583GAGGTGGGGTGGAGGGACATGTCCCTCCACCCCACCTC0.137900.025700.603400.500001.000001.00000


Target Position: 4178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4178UGUCUUUCUAAAGUCAUGU64.59112532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8104196TGTCTTTCTAAAGTCATGTACATGACTTTAGAAAGACA0.028900.010600.500000.500001.000001.00000


Target Position: 2001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2001CGGUUGGAGAUUCAGGUUU73.64481290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022019CGGTTGGAGATTCAGGTTTAAACCTGAATCTCCAACCG0.332200.007300.913801.000001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430CCCCUGAUCAGACUCUACC61.73562920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848448CCCCTGATCAGACTCTACCGGTAGAGTCTGATCAGGGG0.420900.160000.637900.500001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473AGAAUGCCAGCUGAUGAAG63.11522749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700491AGAATGCCAGCTGATGAAGCTTCATCAGCTGGCATTCT0.043400.012100.586200.500001.000001.00000


Target Position: 5035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5035AGUUUCCUGCUCUUUUUGU68.58081968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7225053AGTTTCCTGCTCTTTTTGTACAAAAAGAGCAGGAAACT0.185100.014600.500000.500001.000001.00000


Target Position: 3853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3853CCUAGUCACUGCCCUUUAG74.22271232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393871CCTAGTCACTGCCCTTTAGCTAAAGGGCAGTGACTAGG0.035700.008100.672400.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854GGAAGUCAUCAUUGCCAAG79.8749689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865872GGAAGTCATCATTGCCAAGCTTGGCAATGATGACTTCC0.164700.001000.732800.750001.000001.00000


Target Position: 4546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4546UGUACAUUUUAAAAAUUUC68.49821977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6294564TGTACATTTTAAAAATTTCGAAATTTTTAAAATGTACA0.449400.254800.534500.500001.000001.00000


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880GUGUGUGCAUGUGUGUUUG73.41121317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352898GTGTGTGCATGTGTGTTTGCAAACACACATGCACACAC0.016400.003400.646600.500001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CCUUACCUCCCGCUGGACC51.99924217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982538CCTTACCTCCCGCTGGACCGGTCCAGCGGGAGGTAAGG0.053300.006600.491400.500000.902200.75000


Target Position: 4379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4379GCCUCUCUCCUCUUCCACA89.5705143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4994397GCCTCTCTCCTCTTCCACATGTGGAAGAGGAGAGAGGC0.110100.030900.793100.750001.000001.00000


Target Position: 3041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041UCCCCUCCCUGUAGCAACA70.46941703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153059TCCCCTCCCTGTAGCAACATGTTGCTACAGGGAGGGGA0.065900.012400.663800.500001.000001.00000


Target Position: 4571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4571UCUUUUUUGUAUAUAAAGA78.9881761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7164589TCTTTTTTGTATATAAAGATCTTTATATACAAAAAAGA0.113700.014100.500000.500001.000001.00000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212CUCCGUCCCUACUGGCCUU73.20911342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4243230CTCCGTCCCTACTGGCCTTAAGGCCAGTAGGGACGGAG0.147700.052200.672400.750000.967401.00000


Target Position: 5238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5238GAAUUGACUUGGUUUCGUU91.722684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8565256GAATTGACTTGGTTTCGTTAACGAAACCAAGTCAATTC0.019400.001000.525900.750001.000001.00000


Target Position: 4190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4190GUCAUGUGGACCUUAAUUU78.9878762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6824208GTCATGTGGACCTTAATTTAAATTAAGGTCCACATGAC0.289500.004600.819000.750001.000001.00000


Target Position: 4973, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4973CUUGAGUACUCAUUUUGGU74.44681205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4971-4993GCCTTGAGTACTCATTTTGGTGCACCAAAAUGAGUACUCAAGGCCUUGAGUACUCAUUUUGGUGCU11.320.322


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105UCCCAUCUCCUGUACUACA78.9674764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733123TCCCATCTCCTGTACTACATGTAGTACAGGAGATGGGA0.027200.015900.663800.500001.000001.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151GGGUUGGUUCGGGUGGGUG62.09042875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6813169GGGTTGGTTCGGGTGGGTGCACCCACCCGAACCAACCC0.049100.020300.698300.750001.000001.00000


Target Position: 2416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416CCCACCAAACUGUCCUCAC64.79852497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5112434CCCACCAAACTGTCCTCACGTGAGGACAGTTTGGTGGG0.100400.106200.698300.750001.000001.00000


Target Position: 4968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4968AGGGCCUUGAGUACUCAUU70.59221683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454986AGGGCCTTGAGTACTCATTAATGAGTACTCAAGGCCCT0.219200.010400.836200.750001.000001.00000


Target Position: 3575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3575GGAGGGACAGGGCUGGAAG71.4271582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343593GGAGGGACAGGGCTGGAAGCTTCCAGCCCTGTCCCTCC0.155600.020200.732800.750001.000001.00000


Target Position: 4471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4471AGAAGGGUGUUUGAACUUA85.4965300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7784489AGAAGGGTGTTTGAACTTATAAGTTCAAACACCCTTCT0.162300.002000.689700.750001.000001.00000


Target Position: 4293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4293GAGUUGACCCACGUUGCUG72.25661471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6794311GAGTTGACCCACGTTGCTGCAGCAACGTGGGTCAACTC0.117500.004600.525900.500001.000001.00000


Target Position: 5124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5124GGCGGCAGUGCGAUUCCCU72.88381386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4355142GGCGGCAGTGCGATTCCCTAGGGAATCGCACTGCCGCC0.143900.021300.655200.750000.967400.62500


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653CCCCCUGACCGCUAUGACA82.8409461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7491671CCCCCTGACCGCTATGACATGTCATAGCGGTCAGGGGG0.033800.022400.784500.750001.000001.00000


Target Position: 4260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260AGGCCUUUUACUCUUCCAU73.71051283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5334278AGGCCTTTTACTCTTCCATATGGAAGAGTAAAAGGCCT0.388700.010900.689700.750001.000001.00000


Target Position: 5017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5017ACGGCAUCAUAAAUUGGUA87.2393222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8495035ACGGCATCATAAATTGGTATACCAATTTATGATGCCGT0.074100.001100.594800.750001.000001.00000


Target Position: 4538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4538UUUUGCAAUGUACAUUUUA73.0461360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614556TTTTGCAATGTACATTTTATAAAATGTACATTGCAAAA0.470600.188900.465500.500001.000001.00000


Target Position: 4616, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4616CCUGUAAUCCCAGCAAUUU76.7974944

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4614-4636TGCCTGTAATCCCAGCAATTTGGAAAUUGCUGGGAUUACAGGCACCUGUAAUCCCAGCAAUUUGGU18.511.600


Target Position: 4924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4924ACAGCAAAGCAGGAGUAUA87.7999204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3364942ACAGCAAAGCAGGAGTATATATACTCCTGCTTTGCTGT0.404400.090500.663800.750001.000001.00000


Target Position: 4301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4301CCACGUUGCUGCUCCUCAC76.07791014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5794319CCACGTTGCTGCTCCTCACGTGAGGAGCAGCAACGTGG0.175600.029900.551700.750001.000001.00000


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561AGCUCCUGCCACCCUUCAA79.3954724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291579AGCTCCTGCCACCCTTCAATTGAAGGGTGGCAGGAGCT0.513700.038700.706900.750000.940200.62500


Target Position: 4103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103AGAAAAAGUCAGAUCCAAU90.2661122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3184121AGAAAAAGTCAGATCCAATATTGGATCTGACTTTTTCT0.218400.099900.715500.750001.000001.00000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264GCAAUAAUGUCCAGGGGCA85.7227284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042282GCAATAATGTCCAGGGGCATGCCCCTGGACATTATTGC0.021500.002900.500000.750001.000001.00000


Target Position: 4567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4567ACAUUCUUUUUUGUAUAUA81.6599526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7094585ACATTCTTTTTTGTATATATATATACAAAAAAGAATGT0.084400.003600.663800.750001.000001.00000


Target Position: 1358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GGACCACGAGCGCCUCUUC73.04191361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6711376GGACCACGAGCGCCTCTTCGAAGAGGCGCTCGTGGTCC0.152800.004800.698300.750000.923900.62500


Target Position: 4025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4025AGAUGAAUUUGAGAUUUUG77.0732916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8454043AGATGAATTTGAGATTTTGCAAAATCTCAAATTCATCT0.065500.040000.577600.500001.000001.00000


Target Position: 4505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4505CUUACCAAAUAAAUUUUGA81.2511563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4503-4525ATCTTACCAAATAAATTTTGAGTUCAAAAUUUAUUUGGUAAGAUCUUACCAAAUAAAUUUUGAGUU-3.320.022


Target Position: 4063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4063CACACCCAUUGAGUCUUUG66.90452187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7674081CACACCCATTGAGTCTTTGCAAAGACTCAATGGGTGTG0.042300.018800.646600.500000.907600.62500


Target Position: 4938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4938GUAUAAGAAAGGAAAUUCA92.868965

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4936-4958GAGTATAAGAAAGGAAATTCACCUGAAUUUCCUUUCUUAUACUCGUAUAAGAAAGGAAAUUCACCU10.48.422


Target Position: 650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650GGACCCCAUGGACUACAAG73.1231351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734668GGACCCCATGGACTACAAGCTTGTAGTCCATGGGGTCC0.058300.003000.732800.750000.962000.75000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337ACAAGCGUGGUGAAUACAU74.66481179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819355ACAAGCGTGGTGAATACATATGTATTCACCACGCTTGT0.109300.001400.551700.750001.000001.00000


Target Position: 5272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5272UCCUGUAAUAAACUAGCUA81.3378556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2205290TCCTGTAATAAACTAGCTATAGCTAGTTTATTACAGGA0.519700.118100.698300.750001.000001.00000


Target Position: 3269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GACACUCAUUUCAGACCAG80.9048595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133287GACACTCATTTCAGACCAGCTGGTCTGAAATGAGTGTC0.089200.096600.534500.500000.994600.75000


Target Position: 223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
223CCUGUCCACGGUGCCUCCU58.37063432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854241CCTGTCCACGGTGCCTCCTAGGAGGCACCGTGGACAGG0.026000.001100.500000.750000.994600.75000


Target Position: 4454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4454CUGUAGAGCUUUUCCCAAG73.52411304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7434472CTGTAGAGCTTTTCCCAAGCTTGGGAAAAGCTCTACAG0.071200.021300.646600.500000.978300.87500


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635CAGUCCAUCACAAUCACAC74.37011218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901653CAGTCCATCACAATCACACGTGTGATTGTGATGGACTG0.738300.292100.491400.500001.000001.00000


Target Position: 4218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4218AGUCUACCCUGGUGGUCAU83.0925438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7274236AGTCTACCCTGGTGGTCATATGACCACCAGGGTAGACT0.112900.003200.551700.750000.902200.87500


Target Position: 3707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3707UCCCUGUUUAUGCUGCCAC51.07234333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5623725TCCCTGTTTATGCTGCCACGTGGCAGCATAAACAGGGA0.172400.131100.577600.500000.983700.62500


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974GUGCUUUGUGAUGGAGUAU77.5423880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
659992GTGCTTTGTGATGGAGTATATACTCCATCACAAAGCAC0.052800.005500.750000.750001.000001.00000


Target Position: 5038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5038UUCCUGCUCUUUUUGUGUA73.90021268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8065056TTCCTGCTCTTTTTGTGTATACACAAAAAGAGCAGGAA0.199800.022400.491400.500001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950UGCCUUCCAGACCCACGAC56.2443725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783968TGCCTTCCAGACCCACGACGTCGTGGGTCTGGAAGGCA0.087900.008900.534500.500000.913000.62500


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365GAGGCCACGGUACUUCCUG64.72922514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
845383GAGGCCACGGTACTTCCTGCAGGAAGTACCGTGGCCTC0.036500.001100.525900.500000.951100.62500


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369CCUGUACUAGCCGUUCCCU70.53441691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643387CCTGTACTAGCCGTTCCCTAGGGAACGGCTAGTACAGG0.222000.074800.500000.750001.000001.00000


Target Position: 4434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4434GUUGAGCAUGUGUGGUUAU82.287491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8214452GTTGAGCATGTGTGGTTATATAACCACACATGCTCAAC0.051300.001400.603400.750001.000001.00000


Target Position: 4922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4922AGACAGCAAAGCAGGAGUA86.5536248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6064940AGACAGCAAAGCAGGAGTATACTCCTGCTTTGCTGTCT0.321600.078700.543100.750001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705ACUUCCCCCAGUUCUCCUA73.29881332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6311723ACTTCCCCCAGTTCTCCTATAGGAGAACTGGGGGAAGT0.071300.039800.534500.750000.989100.62500


Target Position: 2417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2417CCACCAAACUGUCCUCACC69.76861788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002435CCACCAAACTGTCCTCACCGGTGAGGACAGTTTGGTGG0.095000.094400.491400.500001.000001.00000


Target Position: 2871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2871CACGUGGGUGUGUGUGCAU81.6364528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582889CACGTGGGTGTGTGTGCATATGCACACACACCCACGTG0.035900.001000.637900.750000.951100.62500


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219CCUACUGGCCUUUCUCCUC64.98542465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273237CCTACTGGCCTTTCTCCTCGAGGAGAAAGGCCAGTAGG0.778700.124300.534500.750000.994600.75000


Target Position: 4912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4912CUAUUAAAAAAGACAGCAA91.86182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6704930CTATTAAAAAAGACAGCAATTGCTGTCTTTTTTAATAG0.389900.363900.525900.750001.000001.00000


Target Position: 4089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4089AAGUGAAUGUAAGCAGAAA91.331793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6724107AAGTGAATGTAAGCAGAAATTTCTGCTTACATTCACTT0.310900.010000.637900.500001.000001.00000


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193AUGUUGUUAUCUGACAGUU74.17641242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993211ATGTTGTTATCTGACAGTTAACTGTCAGATAACAACAT0.026100.008700.508600.500001.000001.00000


Target Position: 4166, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4166GGUUUUUUAGUUUGUCUUU81.6333531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3664184GGTTTTTTAGTTTGTCTTTAAAGACAAACTAAAAAACC0.448100.028300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4164-4186GGGGTTTTTTAGTTTGTCTTTCTAAAGACAAACUAAAAAACCCCGGUUUUUUAGUUUGUCUUUCUU19.2-1.822


Target Position: 4101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4101GCAGAAAAAGUCAGAUCCA91.681387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7114119GCAGAAAAAGTCAGATCCATGGATCTGACTTTTTCTGC0.208300.164700.508600.750001.000001.00000


Target Position: 4221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4221CUACCCUGGUGGUCAUAAA90.5385113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4584239CTACCCTGGTGGTCATAAATTTATGACCACCAGGGTAG0.164100.017100.672400.750000.902200.75000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450CCCUUAAACAACUUCUCCG66.4462257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
690468CCCTTAAACAACTTCTCCGCGGAGAAGTTGTTTAAGGG0.141900.130200.577600.500001.000001.00000


Target Position: 3040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3040CUCCCCUCCCUGUAGCAAC60.28153140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6683058CTCCCCTCCCTGTAGCAACGTTGCTACAGGGAGGGGAG0.052100.012900.663800.500001.000001.00000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916CUCCAGUGUGCAUGGUGUG66.64072230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7642934CTCCAGTGTGCATGGTGTGCACACCATGCACACTGGAG0.043300.014800.517200.500000.956500.75000


Target Position: 3038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038GCCUCCCCUCCCUGUAGCA76.06141019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143056GCCTCCCCTCCCTGTAGCATGCTACAGGGAGGGGAGGC0.065400.020900.646600.750001.000001.00000


Target Position: 5297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5297UGUAAAAAAAAAAAAAAAA79.1936739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3405315TGTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTACA0.994600.947800.706900.750001.000001.00000


Target Position: 4483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4483GAACUUAGAGUCUUAAUAA105.1913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4084501GAACTTAGAGTCTTAATAATTATTAAGACTCTAAGTTC0.571400.157600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4481-4503TTGAACTTAGAGTCTTAATAAAAUUAUUAAGACUCUAAGUUCAAGAACUUAGAGUCUUAAUAAAAU-2.39.822


Target Position: 4061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061UUCACACCCAUUGAGUCUU58.56913403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304079TTCACACCCATTGAGTCTTAAGACTCAATGGGTGTGAA0.051300.009100.534500.500000.907600.62500


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336CACAAGCGUGGUGAAUACA83.5469399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801354CACAAGCGTGGTGAATACATGTATTCACCACGCTTGTG0.078700.001700.586200.500000.972800.62500


Target Position: 4572, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4572CUUUUUUGUAUAUAAAGAA89.9398134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8494590CTTTTTTGTATATAAAGAATTCTTTATATACAAAAAAG0.119500.021200.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4570-4592TTCTTTTTTGTATATAAAGAACAUUCUUUAUAUACAAAAAAGAACUUUUUUGUAUAUAAAGAACAU6.9-2.912


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444CUACCCCCCUUAAACAACU70.36921718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859462CTACCCCCCTTAAACAACTAGTTGTTTAAGGGGGGTAG0.381700.285800.465500.500001.000001.00000


Target Position: 3695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3695UCCUGCCCCACCUCCCUGU49.60484473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5013713TCCTGCCCCACCTCCCTGTACAGGGAGGTGGGGCAGGA0.247700.161300.663800.500001.000001.00000


Target Position: 4378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4378UGCCUCUCUCCUCUUCCAC54.08593997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8554396TGCCTCTCTCCTCTTCCACGTGGAAGAGGAGAGAGGCA0.127100.022300.560300.500001.000001.00000


Target Position: 4056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4056AGCACUUCACACCCAUUGA80.5535628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6794074AGCACTTCACACCCATTGATCAATGGGTGTGAAGTGCT0.049800.009100.629300.500001.000001.00000


Target Position: 1857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857ACCCCCUUUCCAGUUCUUC48.83664542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591875ACCCCCTTTCCAGTTCTTCGAAGAACTGGAAAGGGGGT0.640400.587700.681000.500001.000001.00000


Target Position: 5282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5282AACUAGCUAUCCAUCUGUA94.136143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8535300AACTAGCTATCCATCTGTATACAGATGGATAGCTAGTT0.657900.522900.465500.500001.000001.00000


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813CGUUUGGUUAGAACCCUGU73.38541320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8263831CGTTTGGTTAGAACCCTGTACAGGGTTCTAACCAAACG0.017900.001400.569000.750000.918501.00000


Target Position: 5296, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5296CUGUAAAAAAAAAAAAAAA86.7219243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2455314CTGTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTACAG0.993900.790600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5294-5316ATCTGTAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUACAGAUCUGUAAAAAAAAAAAAAAAAAU-11.37.200


Target Position: 5289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5289UAUCCAUCUGUAAAAAAAA85.9273273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6005307TATCCATCTGTAAAAAAAATTTTTTTTACAGATGGATA0.952300.697300.543100.500001.000001.00000


Target Position: 4877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4877CUCUAAAAAUAAAAAAAAA93.826247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1364895CTCTAAAAATAAAAAAAAATTTTTTTTTATTTTTAGAG0.990500.932400.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4875-4897GTCTCTAAAAATAAAAAAAAAAAUUUUUUUUUAUUUUUAGAGACCUCUAAAAAUAAAAAAAAAAAU-11.37.110


Target Position: 3238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3238GUCUUCAUAUUUGUACGGU70.47771700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663256GTCTTCATATTTGTACGGTACCGTACAAATATGAAGAC0.013700.006000.465500.500000.994600.75000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286GGCCGUGGACUGGUGGGGG52.62194153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841304GGCCGTGGACTGGTGGGGGCCCCCACCAGTCCACGGCC0.041000.001900.508600.500001.000001.00000


Target Position: 4159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4159UGGUUGGGGUUUUUUAGUU70.3631720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6224177TGGTTGGGGTTTTTTAGTTAACTAAAAAACCCCAACCA0.184600.006400.698300.750001.000001.00000


Target Position: 2745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2745CACCCCUCCCUCUCCCCAG58.60723394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162763CACCCCTCCCTCTCCCCAGCTGGGGAGAGGGAGGGGTG0.019900.018700.508600.500001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CUACUACGCCAUGAAGAUC69.15711881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791845CTACTACGCCATGAAGATCGATCTTCATGGCGTAGTAG0.084300.028800.491400.500001.000001.00000


Target Position: 4543, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4543CAAUGUACAUUUUAAAAAU93.943544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4094561CAATGTACATTTTAAAAATATTTTTAAAATGTACATTG0.677000.339200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4541-4563TGCAATGTACATTTTAAAAATTTAUUUUUAAAAUGUACAUUGCACAAUGUACAUUUUAAAAAUUUU-9.114.622


Target Position: 4932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4932GCAGGAGUAUAAGAAAGGA90.4775115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8144950GCAGGAGTATAAGAAAGGATCCTTTCTTATACTCCTGC0.479000.187600.482800.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360ACCACGAGCGCCUCUUCGA72.77481404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911378ACCACGAGCGCCTCTTCGATCGAAGAGGCGCTCGTGGT0.148500.002000.560300.500000.972801.00000


Target Position: 4484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484AACUUAGAGUCUUAAUAAA95.26730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8514502AACTTAGAGTCTTAATAAATTTATTAAGACTCTAAGTT0.583700.178200.646600.500001.000001.00000


Target Position: 2234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2234CACCCGCUGUCCCCCUAUG64.4422557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572252CACCCGCTGTCCCCCTATGCATAGGGGGACAGCGGGTG0.012900.006900.637900.500001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232GGUGCCUCCUGCAUGUCCU79.0481755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691250GGTGCCTCCTGCATGTCCTAGGACATGCAGGAGGCACC0.132400.012500.508600.750000.929300.75000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UUUUUCCCCCUAACUUUUU54.55723942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251816TTTTTCCCCCTAACTTTTTAAAAAGTTAGGGGGAAAAA0.507500.282400.500000.500001.000001.00000


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411UCCUCCCCACCAAACUGUC50.3474403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242429TCCTCCCCACCAAACTGTCGACAGTTTGGTGGGGAGGA0.176800.071400.551700.500001.000001.00000


Target Position: 4477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4477GUGUUUGAACUUAGAGUCU78.2512830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6754495GTGTTTGAACTTAGAGTCTAGACTCTAAGTTCAAACAC0.231300.098700.569000.500001.000001.00000


Target Position: 4456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4456GUAGAGCUUUUCCCAAGAA90.0881127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8474474GTAGAGCTTTTCCCAAGAATTCTTGGGAAAAGCTCTAC0.030300.001100.508600.750000.978300.87500


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165CAGUGGUGCUGCCUUCCAG78.4266807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612183CAGTGGTGCTGCCTTCCAGCTGGAAGGCAGCACCACTG0.071200.003200.500000.500000.940200.62500


Target Position: 3260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3260AGCAAUAAAGACACUCAUU81.7829514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1983278AGCAATAAAGACACTCATTAATGAGTGTCTTTATTGCT0.361900.235700.844800.750001.000001.00000


Target Position: 5129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5129CAGUGCGAUUCCCUUUUAG73.35761326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8425147CAGTGCGATTCCCTTTTAGCTAAAAGGGAATCGCACTG0.015800.009600.612100.500001.000001.00000


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652ACCCCCUGACCGCUAUGAC57.09733630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221670ACCCCCTGACCGCTATGACGTCATAGCGGTCAGGGGGT0.038700.030100.534500.500001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228CUUUCUCCUCGUCUUCAUA88.9246162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5033246CTTTCTCCTCGTCTTCATATATGAAGACGAGGAGAAAG0.163200.158700.594800.750001.000001.00000


Target Position: 4072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4072UGAGUCUUUGAGAUUUUAA83.9753377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7744090TGAGTCTTTGAGATTTTAATTAAAATCTCAAAGACTCA0.026700.005000.689700.750001.000001.00000


Target Position: 4020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4020GGCACAGAUGAAUUUGAGA91.1434100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4324038GGCACAGATGAATTTGAGATCTCAAATTCATCTGTGCC0.152300.040600.775900.750001.000001.00000


Target Position: 5013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5013GGACACGGCAUCAUAAAUU83.6134395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8685031GGACACGGCATCATAAATTAATTTATGATGCCGTGTCC0.015000.001000.862101.000001.000001.00000


Target Position: 4714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4714CAAAAAAUACAAAAAUUAG80.7363604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344732CAAAAAATACAAAAATTAGCTAATTTTTGTATTTTTTG0.256900.273500.474100.500001.000001.00000


Target Position: 3225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225GGCCUUUCUCCUCGUCUUC65.10092446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573243GGCCTTTCTCCTCGTCTTCGAAGACGAGGAGAAAGGCC0.186000.160300.827600.750001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GAGGAGCCCCACUGUGAUC71.50341574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983018GAGGAGCCCCACTGTGATCGATCACAGTGGGGCTCCTC0.144800.004100.629300.500000.978300.75000


Target Position: 3570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3570GGGGUGGAGGGACAGGGCU64.77212508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6193588GGGGTGGAGGGACAGGGCTAGCCCTGTCCCTCCACCCC0.118800.006400.637900.750001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GUGGUAUACCGCGACAUCA86.2356259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051128GTGGTATACCGCGACATCATGATGTCGCGGTATACCAC0.021200.002100.569000.500000.983700.75000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231UCUCCUCGUCUUCAUAUUU72.34451454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4003249TCTCCTCGTCTTCATATTTAAATATGAAGACGAGGAGA0.162100.099700.724100.750001.000001.00000


Target Position: 5295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5295UCUGUAAAAAAAAAAAAAA77.691870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4095313TCTGTAAAAAAAAAAAAAATTTTTTTTTTTTTTACAGA0.990900.726300.724100.750001.000001.00000


Target Position: 3100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3100CCCUAUCCCAUCUCCUGUA84.7493337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253118CCCTATCCCATCTCCTGTATACAGGAGATGGGATAGGG0.061100.031000.810301.000001.000001.00000


Target Position: 4282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4282GUCCCAGCCCCGAGUUGAC64.75092511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8304300GTCCCAGCCCCGAGTTGACGTCAACTCGGGGCTGGGAC0.017400.001900.500000.500000.945700.75000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121CGACAUCAAGCUGGAAAAC67.69052090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851139CGACATCAAGCTGGAAAACGTTTTCCAGCTTGATGTCG0.073200.013200.646600.750001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415CCCCACCAAACUGUCCUCA68.56441969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922433CCCCACCAAACTGTCCTCATGAGGACAGTTTGGTGGGG0.113500.120000.767200.750001.000001.00000


Target Position: 3044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044CCUCCCUGUAGCAACACCU72.36811449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503062CCTCCCTGTAGCAACACCTAGGTGTTGCTACAGGGAGG0.064400.010600.500000.750001.000001.00000


Target Position: 4106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4106AAAAGUCAGAUCCAAUUUA85.4059308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8544124AAAAGTCAGATCCAATTTATAAATTGGATCTGACTTTT0.421500.081200.465500.500001.000001.00000


Target Position: 3737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3737GAGGCCCCCAAAUUCCAGU65.66092354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433755GAGGCCCCCAAATTCCAGTACTGGAATTTGGGGGCCTC0.093200.010100.603400.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CAAGCUGGAAAACCUCAUG70.13351746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7991145CAAGCTGGAAAACCTCATGCATGAGGTTTTCCAGCTTG0.036800.003200.491400.500000.945700.62500


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837GUCCCCACCCCCACCUCCU60.03633172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351855GTCCCCACCCCCACCTCCTAGGAGGTGGGGGTGGGGAC0.679600.437700.474100.500001.000001.00000


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009CACUGUGAUCCAUGAGCUG76.9948925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513027CACTGTGATCCATGAGCTGCAGCTCATGGATCACAGTG0.065800.015800.508600.500001.000001.00000


Target Position: 3261, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261GCAAUAAAGACACUCAUUU83.2776419

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6326119GCAATAAAGACACTCATTT1/1/0/094.96AKT2NM_001626.31NANANA19:40738245..40738263(-)00AKT2(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3259-3281AAGCAATAAAGACACTCATTTCAAAAUGAGUGUCUUUAUUGCUUGCAAUAAAGACACUCAUUUCAU19.2-1.423


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882CCCCUCCCAGACGCACCCC40.47575062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231900CCCCTCCCAGACGCACCCCGGGGTGCGTCTGGGAGGGG0.270200.076100.500000.500001.000001.00000


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186GUGUGCGAUGUUGUUAUCU72.26221469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093204GTGTGCGATGTTGTTATCTAGATAACAACATCGCACAC0.122900.008400.569000.500001.000001.00000


Target Position: 4476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4476GGUGUUUGAACUUAGAGUC73.86151270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6224494GGTGTTTGAACTTAGAGTCGACTCTAAGTTCAAACACC0.219900.089600.534500.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871AGGAUGAAGUCGCUCACAC71.39961585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861889AGGATGAAGTCGCTCACACGTGTGAGCGACTTCATCCT0.131400.016100.551700.500000.940200.62500


Target Position: 4514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4514UAAAUUUUGAGUAGAAUAA81.282562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8144532TAAATTTTGAGTAGAATAATTATTCTACTCAAAATTTA0.020200.003300.500000.500001.000001.00000


Target Position: 649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649AGGACCCCAUGGACUACAA84.3833358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702667AGGACCCCATGGACTACAATTGTAGTCCATGGGGTCCT0.181500.003900.698300.750000.962000.87500


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614CCUUGGCUGUUACAAUCUU81.5616541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962632CCTTGGCTGTTACAATCTTAAGATTGTAACAGCCAAGG0.702400.001700.706901.000001.000001.00000


Target Position: 1929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1929CUCCAGCCUCACCUUUGUG64.97062469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451947CTCCAGCCTCACCTTTGTGCACAAAGGTGAGGCTGGAG0.058300.032800.517200.500000.934800.62500


Target Position: 4015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4015GGCCUGGCACAGAUGAAUU83.8307384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5984033GGCCTGGCACAGATGAATTAATTCATCTGTGCCAGGCC0.140900.007600.991401.000000.978300.75000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740GACCAUGAAUGACUUCGAC77.9136857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721758GACCATGAATGACTTCGACGTCGAAGTCATTCATGGTC0.222800.041000.500000.500000.978300.87500


Target Position: 5058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5058UCUUUUCCAGUUAAUGUGA71.03811632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7365076TCTTTTCCAGTTAATGTGATCACATTAACTGGAAAAGA0.313300.084800.500000.500001.000001.00000


Target Position: 3706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3706CUCCCUGUUUAUGCUGCCA74.63791185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523724CTCCCTGTTTATGCTGCCATGGCAGCATAAACAGGGAG0.182200.140600.465500.500001.000001.00000


Target Position: 1633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633CCCAGUCCAUCACAAUCAC71.12431620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191651CCCAGTCCATCACAATCACGTGATTGTGATGGACTGGG0.647100.186300.698300.750001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260GUGCUGGAGGACAAUGACU77.6662874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871278GTGCTGGAGGACAATGACTAGTCATTGTCCTCCAGCAC0.160000.012000.586200.500001.000001.00000


Target Position: 1844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1844CCCCCACCUCCUCACCCCC47.87384620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391862CCCCCACCTCCTCACCCCCGGGGGTGAGGAGGTGGGGG0.828000.554300.500000.500001.000001.00000


Target Position: 3577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3577AGGGACAGGGCUGGAAGAU64.922475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273595AGGGACAGGGCTGGAAGATATCTTCCAGCCCTGTCCCT0.067400.006300.663800.750001.000001.00000


Target Position: 4851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4851UGCAGCCUGGGACAAUGAG56.10143745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514869TGCAGCCTGGGACAATGAGCTCATTGTCCCAGGCTGCA0.097300.002500.543100.500001.000001.00000


Target Position: 4057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4057GCACUUCACACCCAUUGAG72.69171416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844075GCACTTCACACCCATTGAGCTCAATGGGTGTGAAGTGC0.047800.009300.543100.750001.000001.00000


Target Position: 2, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2GGGAGGGGGCGGUAAGCGG56.3583712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61920GGGAGGGGGCGGTAAGCGGCCGCTTACCGCCCCCTCCC0.197500.040400.577600.500000.989100.75000


Target Position: 4102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4102CAGAAAAAGUCAGAUCCAA93.742750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4664120CAGAAAAAGTCAGATCCAATTGGATCTGACTTTTTCTG0.229600.133200.637900.750001.000001.00000


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138GUGGGGAGGGGUGGGGUUG49.91414440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6043156GTGGGGAGGGGTGGGGTTGCAACCCCACCCCTCCCCAC0.332600.030300.646600.500001.000001.00000


Target Position: 4201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4201CUUAAUUUAAUUACAAAAG66.49562249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7374219CTTAATTTAATTACAAAAGCTTTTGTAATTAAATTAAG0.114100.099400.500000.500001.000001.00000


Target Position: 3172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3172GGUCUUUUUCCUCUGUGUG72.74921409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003190GGTCTTTTTCCTCTGTGTGCACACAGAGGAAAAAGACC0.022000.006300.560300.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413CUCCCCACCAAACUGUCCU61.53972944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512431CTCCCCACCAAACTGTCCTAGGACAGTTTGGTGGGGAG0.139900.137000.465500.500001.000001.00000


Target Position: 4707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4707AUCUCUACAAAAAAUACAA85.0074320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6244725ATCTCTACAAAAAATACAATTGTATTTTTTGTAGAGAT0.943700.181400.534500.500001.000001.00000


Target Position: 4544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4544AAUGUACAUUUUAAAAAUU81.4122550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8644562AATGTACATTTTAAAAATTAATTTTTAAAATGTACATT0.677600.341000.500000.500001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CAGAAUGCCAGCUGAUGAA91.700286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694490CAGAATGCCAGCTGATGAATTCATCAGCTGGCATTCTG0.044900.012500.612100.750001.000001.00000


Target Position: 3691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3691CCUAUCCUGCCCCACCUCC50.93014346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503709CCTATCCTGCCCCACCTCCGGAGGTGGGGCAGGATAGG0.202800.110900.474100.500001.000001.00000


Target Position: 5063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5063UCCAGUUAAUGUGAAGCCU63.40072696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6515081TCCAGTTAATGTGAAGCCTAGGCTTCACATTAACTGGA0.168800.010400.525900.500001.000001.00000


Target Position: 4994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4994UGAUUACCUCUCUGCAAAU81.2993560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3905012TGATTACCTCTCTGCAAATATTTGCAGAGAGGTAATCA0.641900.069900.715500.750000.962000.62500


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611UACUUCGAUGAUGAAUUUA75.10611126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551629TACTTCGATGATGAATTTATAAATTCATCATCGAAGTA0.040200.002400.646600.500001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126UCAAGCUGGAAAACCUCAU64.51092545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811144TCAAGCTGGAAAACCTCATATGAGGTTTTCCAGCTTGA0.051100.004600.569000.750000.945700.62500


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GGGGAGGGGUGGGGUUGGU61.25552986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4153158GGGGAGGGGTGGGGTTGGTACCAACCCCACCCCTCCCC0.323400.114100.637900.750001.000001.00000


Target Position: 4261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4261GGCCUUUUACUCUUCCAUC73.13411350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6074279GGCCTTTTACTCTTCCATCGATGGAAGAGTAAAAGGCC0.351700.007200.819000.750001.000001.00000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973UGUGCUUUGUGAUGGAGUA85.5438298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688991TGTGCTTTGTGATGGAGTATACTCCATCACAAAGCACA0.052000.004400.525900.750001.000001.00000


Target Position: 4439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4439GCAUGUGUGGUUAUCCUGU80.5369631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5304457GCATGTGTGGTTATCCTGTACAGGATAACCACACATGC0.174900.011100.646600.750000.983700.87500


Target Position: 4521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4521UGAGUAGAAUAAUCGUCUU81.671524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6264539TGAGTAGAATAATCGTCTTAAGACGATTATTCTACTCA0.387800.006300.586200.750001.000001.00000


Target Position: 2012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2012UCAGGUUUUAAUCCACACA74.21871235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082030TCAGGTTTTAATCCACACATGTGTGGATTAAAACCTGA0.168800.054800.517200.500001.000001.00000


Target Position: 5229, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5229CGUUAACAGGAAUUGACUU86.1117266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8545247CGTTAACAGGAATTGACTTAAGTCAATTCCTGTTAACG0.013500.009000.637901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5227-5249CCCGTTAACAGGAATTGACTTGGAAGUCAAUUCCUGUUAACGGGCGUUAACAGGAAUUGACUUGGU19.214.733


Target Position: 3850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3850UCCCCUAGUCACUGCCCUU68.6331961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803868TCCCCTAGTCACTGCCCTTAAGGGCAGTGACTAGGGGA0.218500.001900.732800.750001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799UUUUCCCCCUAACUUUUUA68.87661924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561817TTTTCCCCCTAACTTTTTATAAAAAGTTAGGGGGAAAA0.427400.229700.465500.500001.000001.00000


Target Position: 3223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223CUGGCCUUUCUCCUCGUCU66.29242276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843241CTGGCCTTTCTCCTCGTCTAGACGAGGAGAAAGGCCAG0.194600.081300.560300.500000.994600.75000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646GCGAGGACCCCAUGGACUA85.672289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822664GCGAGGACCCCATGGACTATAGTCCATGGGGTCCTCGC0.038400.001400.750001.000000.962000.87500


Target Position: 4926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4926AGCAAAGCAGGAGUAUAAG66.99912171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8304944AGCAAAGCAGGAGTATAAGCTTATACTCCTGCTTTGCT0.343100.108900.715500.500001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230UUCUCCUCGUCUUCAUAUU66.78922208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793248TTCTCCTCGTCTTCATATTAATATGAAGACGAGGAGAA0.174000.113200.663800.500001.000001.00000


Target Position: 4223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4223ACCCUGGUGGUCAUAAAAU72.97921370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4914241ACCCTGGTGGTCATAAAATATTTTATGACCACCAGGGT0.172400.013600.844800.750000.940200.62500


Target Position: 4875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4875GUCUCUAAAAAUAAAAAAA91.0123102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4873-4895GTGTCTCTAAAAATAAAAAAAAAUUUUUUUAUUUUUAGAGACACGUCUCUAAAAAUAAAAAAAAAU-9.120.200


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729CGGGCUAAAGUGACCAUGA86.4461251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728747CGGGCTAAAGTGACCATGATCATGGTCACTTTAGCCCG0.054700.003200.689700.750000.956500.75000


Target Position: 3366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366CCUCCUGUACUAGCCGUUC61.56122942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3263384CCTCCTGTACTAGCCGTTCGAACGGCTAGTACAGGAGG0.247800.039400.672400.750001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868CCAAGGAUGAAGUCGCUCA86.0666268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525886CCAAGGATGAAGTCGCTCATGAGCGACTTCATCCTTGG0.094700.018000.620700.750001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610GUACUUCGAUGAUGAAUUU87.2362223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601628GTACTTCGATGATGAATTTAAATTCATCATCGAAGTAC0.030700.003100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1608-1630AGGTACTTCGATGATGAATTTACAAAUUCAUCAUCGAAGUACCUGUACUUCGAUGAUGAAUUUACU7.220.933


Target Position: 4299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4299ACCCACGUUGCUGCUCCUC46.00934761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6934317ACCCACGTTGCTGCTCCTCGAGGAGCAGCAACGTGGGT0.054000.039300.543100.500001.000001.00000


Target Position: 4161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4161GUUGGGGUUUUUUAGUUUG67.69132089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7604179GTTGGGGTTTTTTAGTTTGCAAACTAAAAAACCCCAAC0.121200.009700.500000.500001.000001.00000


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013CAGGUUUUAAUCCACACAA88.1067189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072031CAGGTTTTAATCCACACAATTGTGTGGATTAAAACCTG0.159500.051200.637900.750001.000001.00000


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345GGUGAAUACAUCAAGACCU85.831279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713363GGTGAATACATCAAGACCTAGGTCTTGATGTATTCACC0.060600.046900.508600.750000.989100.75000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257GAGGUGCUGGAGGACAAUG69.91191774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191275GAGGTGCTGGAGGACAATGCATTGTCCTCCAGCACCTC0.198100.014000.655200.500001.000001.00000


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701ACCCACUUCCCCCAGUUCU58.8773367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381719ACCCACTTCCCCCAGTTCTAGAACTGGGGGAAGTGGGT0.083500.081200.629300.500000.945700.87500


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516CUGGCCUUACCUCCCGCUG51.11584327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642534CTGGCCTTACCTCCCGCTGCAGCGGGAGGTAAGGCCAG0.012200.001700.500000.500000.923900.75000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188UGCAAAGAGGGCAUCAGUG63.68392668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091206TGCAAAGAGGGCATCAGTGCACTGATGCCCTCTTTGCA0.120100.016200.560300.500000.994600.62500


Target Position: 3697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697CUGCCCCACCUCCCUGUUU63.57972678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2473715CTGCCCCACCTCCCTGTTTAAACAGGGAGGTGGGGCAG0.302400.181400.784500.750001.000001.00000


Target Position: 1699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699GGACCCACUUCCCCCAGUU77.3188897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151717GGACCCACTTCCCCCAGTTAACTGGGGGAAGTGGGTCC0.098100.104400.724101.000000.945700.62500


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741ACCAUGAAUGACUUCGACU73.59011301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754759ACCATGAATGACTTCGACTAGTCGAAGTCATTCATGGT0.234100.096100.646600.500000.978301.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CCUUCAAACCUCAGGUCAC73.45871309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851591CCTTCAAACCTCAGGTCACGTGACCTGAGGTTTGAAGG0.025600.017500.551700.750000.923900.75000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679CCAGUGACUCCUCCACGAC69.75631790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838697CCAGTGACTCCTCCACGACGTCGTGGAGGAGTCACTGG0.016200.002200.525900.750000.902200.75000


Target Position: 3035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035CACGCCUCCCCUCCCUGUA74.46421202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803053CACGCCTCCCCTCCCTGTATACAGGGAGGGGAGGCGTG0.164700.053900.612100.750001.000001.00000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794UGGUUUUUUCCCCCUAACU63.37942702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981812TGGTTTTTTCCCCCTAACTAGTTAGGGGGAAAAAACCA0.525100.169600.637900.500000.907600.75000


Target Position: 4127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4127GAAAUCAGAGUUAGCUACA88.581177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8444145GAAATCAGAGTTAGCTACATGTAGCTAACTCTGATTTC0.022600.017000.465500.500001.000001.00000


Target Position: 2224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224UCCAAUCCCCCACCCGCUG40.61235054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282242TCCAATCCCCCACCCGCTGCAGCGGGTGGGGGATTGGA0.100800.022900.586200.500000.978300.62500


Target Position: 4710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4710UCUACAAAAAAUACAAAAA81.4079551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3514728TCTACAAAAAATACAAAAATTTTTGTATTTTTTGTAGA0.905200.500100.724100.750001.000001.00000


Target Position: 4489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4489AGAGUCUUAAUAAAAUCUU75.98471028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5094507AGAGTCTTAATAAAATCTTAAGATTTTATTAAGACTCT0.286200.085200.586200.750001.000001.00000


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795GGUUUUUUCCCCCUAACUU80.0418674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881813GGTTTTTTCCCCCTAACTTAAGTTAGGGGGAAAAAACC0.533800.442200.715501.000000.983700.75000


Target Position: 4018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4018CUGGCACAGAUGAAUUUGA83.176430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6914036CTGGCACAGATGAATTTGATCAAATTCATCTGTGCCAG0.592000.004200.560300.500001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043CCCUCCCUGUAGCAACACC60.97323039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7953061CCCTCCCTGTAGCAACACCGGTGTTGCTACAGGGAGGG0.063600.012300.637900.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449CCCCUUAAACAACUUCUCC61.77582913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868467CCCCTTAAACAACTTCTCCGGAGAAGTTGTTTAAGGGG0.229700.222100.620700.500001.000001.00000


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232CCCACCCGCUGUCCCCCUA69.63891808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042250CCCACCCGCTGTCCCCCTATAGGGGGACAGCGGGTGGG0.042500.020600.819001.000001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853CCUCACCCCCUUUCCAGUU66.96832177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211871CCTCACCCCCTTTCCAGTTAACTGGAAAGGGGGTGAGG0.743100.674000.698301.000000.972800.62500


Target Position: 5042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5042UGCUCUUUUUGUGUAAUCU71.77431537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6475060TGCTCTTTTTGTGTAATCTAGATTACACAAAAAGAGCA0.299400.085600.629300.500001.000001.00000


Target Position: 4852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4852GCAGCCUGGGACAAUGAGA81.8442509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7334870GCAGCCTGGGACAATGAGATCTCATTGTCCCAGGCTGC0.085800.003000.629300.750001.000001.00000


Target Position: 4656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4656CUCUUGAGGCCAGGGGUUC52.2854188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8534674CTCTTGAGGCCAGGGGTTCGAACCCCTGGCCTCAAGAG0.013600.001800.637900.500001.000001.00000


Target Position: 3480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3480GCUGAGGGGUAUGGGAAGG55.22783860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413498GCTGAGGGGTATGGGAAGGCCTTCCCATACCCCTCAGC0.113900.013300.508600.500001.000001.00000


Target Position: 4194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4194UGUGGACCUUAAUUUAAUU81.0324583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5634212TGTGGACCTTAATTTAATTAATTAAATTAAGGTCCACA0.753600.009600.698300.750001.000001.00000


Target Position: 3446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3446GGCUGGAGAGGGUGGGUGG62.94752769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923464GGCTGGAGAGGGTGGGTGGCCACCCACCCTCTCCAGCC0.072300.010000.655200.500001.000001.00000


Target Position: 5217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5217CUUCAGCUGCCCCGUUAAC60.02173175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8015235CTTCAGCTGCCCCGTTAACGTTAACGGGGCAGCTGAAG0.176500.030700.491400.500000.940200.87500


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409CCUCCUCCCCACCAAACUG65.62592360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672427CCTCCTCCCCACCAAACTGCAGTTTGGTGGGGAGGAGG0.236500.027100.560300.750001.000001.00000


Target Position: 3098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098CUCCCUAUCCCAUCUCCUG66.92232184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173116CTCCCTATCCCATCTCCTGCAGGAGATGGGATAGGGAG0.039500.016100.525900.500001.000001.00000


Target Position: 4452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4452UCCUGUAGAGCUUUUCCCA75.85141042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8184470TCCTGTAGAGCTTTTCCCATGGGAAAAGCTCTACAGGA0.026100.001400.525900.500000.978300.62500


Target Position: 2669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669GGAGGGGUGGGGGUGGGCA69.18251875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632687GGAGGGGTGGGGGTGGGCATGCCCACCCCCACCCCTCC0.012300.002400.517200.750001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442CUCUACCCCCCUUAAACAA79.8404690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485460CTCTACCCCCCTTAAACAATTGTTTAAGGGGGGTAGAG0.851100.681000.663800.750001.000001.00000


Target Position: 3851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3851CCCCUAGUCACUGCCCUUU66.47232252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113869CCCCTAGTCACTGCCCTTTAAAGGGCAGTGACTAGGGG0.233800.003600.991401.000001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501CCGCGACCCAACACCUUUG65.0082460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568519CCGCGACCCAACACCTTTGCAAAGGTGTTGGGTCGCGG0.079700.027400.767200.750000.907600.75000


Target Position: 4090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090AGUGAAUGUAAGCAGAAAA91.0065103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5574108AGTGAATGTAAGCAGAAAATTTTCTGCTTACATTCACT0.275300.009700.706900.750001.000001.00000


Target Position: 4171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4171UUUAGUUUGUCUUUCUAAA80.1246671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8404189TTTAGTTTGTCTTTCTAAATTTAGAAAGACAAACTAAA0.122300.041800.500000.500001.000001.00000


Target Position: 3558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3558GCUAAGAGAGGUGGGGUGG54.5213947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7263576GCTAAGAGAGGTGGGGTGGCCACCCCACCTCTCTTAGC0.037600.017100.508600.500001.000001.00000


Target Position: 1629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629ACCGCCCAGUCCAUCACAA78.4942802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921647ACCGCCCAGTCCATCACAATTGTGATGGACTGGGCGGT0.603000.179700.706900.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046GGAGCGGGCCCGGUUUUAU74.7811161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871064GGAGCGGGCCCGGTTTTATATAAAACCGGGCCCGCTCC0.074800.001800.827601.000000.989100.62500


Target Position: 3552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3552GCUUAGGCUAAGAGAGGUG71.12411621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933570GCTTAGGCTAAGAGAGGTGCACCTCTCTTAGCCTAAGC0.087100.004200.560300.750001.000001.00000


Target Position: 4856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4856CCUGGGACAAUGAGACUGU76.06511017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6514874CCTGGGACAATGAGACTGTACAGTCTCATTGTCCCAGG0.055300.021300.637900.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414UCCCCACCAAACUGUCCUC53.50624057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492432TCCCCACCAAACTGTCCTCGAGGACAGTTTGGTGGGGA0.125700.133600.560300.500001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134GAAAACCUCAUGCUGGACA80.6861612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681152GAAAACCTCATGCTGGACATGTCCAGCATGAGGTTTTC0.098200.021500.465500.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677CCCCAGUGACUCCUCCACG62.50342823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
820695CCCCAGTGACTCCTCCACGCGTGGAGGAGTCACTGGGG0.044900.003200.715500.500000.902200.62500


Target Position: 4125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4125CAGAAAUCAGAGUUAGCUA98.072715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7204143CAGAAATCAGAGTTAGCTATAGCTAACTCTGATTTCTG0.039300.026600.612100.750001.000001.00000


Target Position: 4578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4578UGUAUAUAAAGAACAGUGA80.065672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614596TGTATATAAAGAACAGTGATCACTGTTCTTTATATACA0.012300.002000.482800.500001.000001.00000


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631CGCCCAGUCCAUCACAAUC72.33921456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1521649CGCCCAGTCCATCACAATCGATTGTGATGGACTGGGCG0.583900.171300.741400.750001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436AUCAGACUCUACCCCCCUU71.89461524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
602454ATCAGACTCTACCCCCCTTAAGGGGGGTAGAGTCTGAT0.716100.333900.543100.500001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975UGCUUUGUGAUGGAGUAUG57.91683496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824993TGCTTTGTGATGGAGTATGCATACTCCATCACAAAGCA0.018100.005800.698300.500001.000001.00000


Target Position: 3572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3572GGUGGAGGGACAGGGCUGG54.73273920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7823590GGTGGAGGGACAGGGCTGGCCAGCCCTGTCCCTCCACC0.129300.013900.508600.500001.000001.00000


Target Position: 4105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4105AAAAAGUCAGAUCCAAUUU74.12941251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7594123AAAAAGTCAGATCCAATTTAAATTGGATCTGACTTTTT0.362000.077800.500000.500001.000001.00000


Target Position: 4358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4358UGGCUACCUCAUCUUUUUA82.6054473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3224376TGGCTACCTCATCTTTTTATAAAAAGATGAGGTAGCCA0.561200.040300.810300.750001.000001.00000


Target Position: 4474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4474AGGGUGUUUGAACUUAGAG68.03352037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6214492AGGGTGTTTGAACTTAGAGCTCTAAGTTCAAACACCCT0.213100.007900.534500.500001.000001.00000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263CUGGAGGACAAUGACUAUG64.81252495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471281CTGGAGGACAATGACTATGCATAGTCATTGTCCTCCAG0.131400.014500.629300.500001.000001.00000


Target Position: 3371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371UGUACUAGCCGUUCCCUUC63.58582676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6163389TGTACTAGCCGTTCCCTTCGAAGGGAACGGCTAGTACA0.197000.157800.534500.500001.000001.00000


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136AAACCUCAUGCUGGACAAA81.0703574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451154AAACCTCATGCTGGACAAATTTGTCCAGCATGAGGTTT0.127300.024800.500000.500001.000001.00000


Target Position: 4262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4262GCCUUUUACUCUUCCAUCU79.7826693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4174280GCCTTTTACTCTTCCATCTAGATGGAAGAGTAAAAGGC0.345200.035800.775900.750001.000001.00000


Target Position: 4683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4683CCUGGGCAUCAUAGGGAGA77.9916850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8224701CCTGGGCATCATAGGGAGATCTCCCTATGATGCCCAGG0.018700.001500.620700.750001.000001.00000


Target Position: 4545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4545AUGUACAUUUUAAAAAUUU74.22631231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5394563ATGTACATTTTAAAAATTTAAATTTTTAAAATGTACAT0.510200.258200.655200.500001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480CUCCCAGCCCCGUGCCUUA78.0858844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362498CTCCCAGCCCCGTGCCTTATAAGGCACGGGGCTGGGAG0.143700.020100.775900.750000.934800.87500


Target Position: 3028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3028CCCUGCCCACGCCUCCCCU57.67353526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3703046CCCTGCCCACGCCTCCCCTAGGGGAGGCGTGGGCAGGG0.324000.199400.646600.750000.913001.00000


Target Position: 3102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3102CUAUCCCAUCUCCUGUACU75.95261031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553120CTATCCCATCTCCTGTACTAGTACAGGAGATGGGATAG0.048900.027300.465500.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CCCGUUCCUCACUGCGCUG61.70962924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601944CCCGTTCCTCACTGCGCTGCAGCGCAGTGAGGAACGGG0.070200.007400.706900.750001.000001.00000


Target Position: 4504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4504UCUUACCAAAUAAAUUUUG54.2613979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7284522TCTTACCAAATAAATTTTGCAAAATTTATTTGGTAAGA0.112500.023900.577600.500001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620GAUGAAUUUACCGCCCAGU71.58491561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301638GATGAATTTACCGCCCAGTACTGGGCGGTAAATTCATC0.179100.032700.474100.500001.000001.00000


Target Position: 5030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5030UUGGUAGUUUCCUGCUCUU69.28551856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8555048TTGGTAGTTTCCTGCTCTTAAGAGCAGGAAACTACCAA0.023600.001000.508600.500000.972800.75000


Target Position: 3133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3133GCAGGGUGGGGAGGGGUGG45.16334819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6893151GCAGGGTGGGGAGGGGTGGCCACCCCTCCCCACCCTGC0.269800.013700.508600.500001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130GAAACACAAGGAAAGGGAA92.752866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
752148GAAACACAAGGAAAGGGAATTCCCTTTCCTTGTGTTTC0.488100.335700.500000.750001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255CUGAGGUGCUGGAGGACAA90.061128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671273CTGAGGTGCTGGAGGACAATTGTCCTCCAGCACCTCAG0.095500.009500.637900.750001.000001.00000


Target Position: 3183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183UCUGUGUGCGAUGUUGUUA75.18331116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343201TCTGTGTGCGATGTTGTTATAACAACATCGCACACAGA0.129200.006100.689700.750001.000001.00000


Target Position: 4280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4280UCGUCCCAGCCCCGAGUUG46.71454712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8504298TCGTCCCAGCCCCGAGTTGCAACTCGGGGCTGGGACGA0.014000.001200.646600.500000.945700.87500


Target Position: 4081, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4081GAGAUUUUAAGUGAAUGUA89.284151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4079-4101TTGAGATTTTAAGTGAATGTAAGUACAUUCACUUAAAAUCUCAAGAGAUUUUAAGUGAAUGUAAGU20.55.322


Target Position: 4558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4558AAAUUUCACACAUUCUUUU76.5005971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8664576AAATTTCACACATTCTTTTAAAAGAATGTGTGAAATTT0.212000.225600.500000.500001.000001.00000


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145GGGGUGGGGUUGGUUCGGG52.35284180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463163GGGGTGGGGTTGGTTCGGGCCCGAACCAACCCCACCCC0.093300.069200.500000.500001.000001.00000


Target Position: 2451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451GAGGAACAUUUGGGGCCAA85.1036316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592469GAGGAACATTTGGGGCCAATTGGCCCCAAATGTTCCTC0.037000.002400.663800.750001.000001.00000


Target Position: 4713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4713ACAAAAAAUACAAAAAUUA85.2744310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2944731ACAAAAAATACAAAAATTATAATTTTTGTATTTTTTGT0.594700.540800.672400.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769CACGUUCUGCAGCCUUAAG69.91311773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662787CACGTTCTGCAGCCTTAAGCTTAAGGCTGCAGAACGTG0.012000.002900.655200.500001.000001.00000


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623CUGUGCUGUCACUGAAUGA87.8342201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7363641CTGTGCTGTCACTGAATGATCATTCAGTGACAGCACAG0.078900.003000.560300.500000.918500.75000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811CUUUUUACUUAGCCUUUUU78.6189795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6311829CTTTTTACTTAGCCTTTTTAAAAAGGCTAAGTAAAAAG0.060500.048700.637900.750001.000001.00000


Target Position: 4995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4995GAUUACCUCUCUGCAAAUG71.23531602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8025013GATTACCTCTCTGCAAATGCATTTGCAGAGAGGTAATC0.082000.052900.525900.500000.962000.62500


Target Position: 4224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4224CCCUGGUGGUCAUAAAAUA93.695551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5224242CCCTGGTGGTCATAAAATATATTTTATGACCACCAGGG0.478500.011500.948301.000000.956500.75000


Target Position: 4706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4706CAUCUCUACAAAAAAUACA87.0346231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4704-4726TTCATCTCTACAAAAAATACAAAUGUAUUUUUUGUAGAGAUGAACAUCUCUACAAAAAAUACAAAU-0.320.200


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608AGGUACUUCGAUGAUGAAU74.37181217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8311626AGGTACTTCGATGATGAATATTCATCATCGAAGTACCT0.017000.004900.836200.750001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CGCCUGAGGUGCUGGAGGA83.2553421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461270CGCCTGAGGTGCTGGAGGATCCTCCAGCACCTCAGGCG0.043200.002600.551700.750000.989100.75000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678CCCAGUGACUCCUCCACGA82.9075451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847696CCCAGTGACTCCTCCACGATCGTGGAGGAGTCACTGGG0.014800.003000.698300.750000.902200.75000


Target Position: 3698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3698UGCCCCACCUCCCUGUUUA72.4691441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1183716TGCCCCACCTCCCTGTTTATAAACAGGGAGGTGGGGCA0.669300.197000.819000.750001.000001.00000


Target Position: 3076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3076GUUUAGCUUUUGUGGGUUU77.3275896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183094GTTTAGCTTTTGTGGGTTTAAACCCACAAAAGCTAAAC0.019300.004500.646600.750001.000001.00000


Target Position: 4068, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068CCAUUGAGUCUUUGAGAUU84.6864339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8554086CCATTGAGTCTTTGAGATTAATCTCAAAGACTCAATGG0.013100.005400.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4066-4088ACCCATTGAGTCTTTGAGATTTTAAUCUCAAAGACUCAAUGGGUCCAUUGAGUCUUUGAGAUUUUU20.418.132


Target Position: 4903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4903UGAUACAUGCUAUUAAAAA87.8274202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4504921TGATACATGCTATTAAAAATTTTTAATAGCATGTATCA0.533000.019100.724100.750001.000001.00000


Target Position: 2112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2112GCUGCUGCAUCUGGACGAA87.8035203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862130GCTGCTGCATCTGGACGAATTCGTCCAGATGCAGCAGC0.066000.004500.681001.000001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GUCAUGUACGAGAUGAUGU78.9183771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621332GTCATGTACGAGATGATGTACATCATCTCGTACATGAC0.046200.004200.612100.500001.000001.00000


Target Position: 3699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3699GCCCCACCUCCCUGUUUAU79.0513754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1903717GCCCCACCTCCCTGTTTATATAAACAGGGAGGTGGGGC0.483600.111600.956901.000001.000001.00000


Target Position: 4071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4071UUGAGUCUUUGAGAUUUUA76.862941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8074089TTGAGTCTTTGAGATTTTATAAAATCTCAAAGACTCAA0.021000.005400.612100.500001.000001.00000


Target Position: 4701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4701ACCUUCAUCUCUACAAAAA84.5809347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4734719ACCTTCATCTCTACAAAAATTTTTGTAGAGATGAAGGT0.262300.082500.853400.750001.000001.00000


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407GGCCUCCUCCCCACCAAAC60.47753108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982425GGCCTCCTCCCCACCAAACGTTTGGTGGGGAGGAGGCC0.419400.047700.853400.750000.972800.62500


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CCAUGAAUGACUUCGACUA93.623954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300760CCATGAATGACTTCGACTATAGTCGAAGTCATTCATGG0.307500.100700.672401.000000.978301.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921AGGCACCCGUUCCUCACUG59.73313231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847939AGGCACCCGTTCCTCACTGCAGTGAGGAACGGGTGCCT0.099000.003400.560300.500000.940200.62500


Target Position: 2000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2000GCGGUUGGAGAUUCAGGUU76.9803927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352018GCGGTTGGAGATTCAGGTTAACCTGAATCTCCAACCGC0.364500.001200.775901.000001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768GCACGCUCGCUGCCAUCAC66.28132277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921786GCACGCTCGCTGCCATCACGTGATGGCAGCGAGCGTGC0.169700.004200.560300.750000.945700.75000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693ACGACUGAGGAGAUGGAAG66.65162229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623711ACGACTGAGGAGATGGAAGCTTCCATCTCCTCAGTCGT0.114100.013000.637900.500001.000001.00000


Target Position: 4934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4934AGGAGUAUAAGAAAGGAAA88.7174171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3554952AGGAGTATAAGAAAGGAAATTTCCTTTCTTATACTCCT0.381700.194900.844800.750001.000001.00000


Target Position: 4366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4366UCAUCUUUUUAGUGCCUCU75.02871135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7534384TCATCTTTTTAGTGCCTCTAGAGGCACTAAAAAGATGA0.122300.123600.500000.500001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651GACCCCAUGGACUACAAGU77.8223864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859669GACCCCATGGACTACAAGTACTTGTAGTCCATGGGGTC0.031200.002600.612100.500001.000001.00000


Target Position: 5040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5040CCUGCUCUUUUUGUGUAAU78.1336840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3385058CCTGCTCTTTTTGTGTAATATTACACAAAAAGAGCAGG0.253600.035300.836201.000001.000001.00000


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618GGCUGUUACAAUCUUACAC76.05781020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172636GGCTGTTACAATCTTACACGTGTAAGATTGTAACAGCC0.654000.011900.706900.750001.000001.00000


Target Position: 3478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3478GGGCUGAGGGGUAUGGGAA85.589295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6113496GGGCTGAGGGGTATGGGAATTCCCATACCCCTCAGCCC0.211500.006900.819001.000001.000001.00000


Target Position: 5064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5064CCAGUUAAUGUGAAGCCUC70.46451704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8585082CCAGTTAATGTGAAGCCTCGAGGCTTCACATTAACTGG0.012900.010500.534500.750001.000001.00000


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189GCAAAGAGGGCAUCAGUGA84.5882346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371207GCAAAGAGGGCATCAGTGATCACTGATGCCCTCTTTGC0.160000.024600.629300.750001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CUGCGCUGAAGUAUGCCUU71.52031569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794955CTGCGCTGAAGTATGCCTTAAGGCATACTTCAGCGCAG0.024200.004300.646600.750000.945700.87500


Target Position: 5054, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5054GUAAUCUUUUCCAGUUAAU80.8585599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3925072GTAATCTTTTCCAGTTAATATTAACTGGAAAAGATTAC0.166500.122700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5052-5074GTGTAATCTTTTCCAGTTAATGTAUUAACUGGAAAAGAUUACACGUAAUCUUUUCCAGUUAAUGUU11.86.922


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069GUUUGGAGUUUAGCUUUUG69.13731884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453087GTTTGGAGTTTAGCTTTTGCAAAAGCTAAACTCCAAAC0.136800.002600.500000.500001.000001.00000


Target Position: 3232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232CUCCUCGUCUUCAUAUUUG68.4331986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003250CTCCTCGTCTTCATATTTGCAAATATGAAGACGAGGAG0.087300.063600.663800.500001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520GUUCUUCCUCAGCAUCAAC72.02171509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661538GTTCTTCCTCAGCATCAACGTTGATGCTGAGGAAGAAC0.313700.064000.500000.500001.000001.00000


Target Position: 3545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3545CAGUGCUGCUUAGGCUAAG69.66661803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7533563CAGTGCTGCTTAGGCTAAGCTTAGCCTAAGCAGCACTG0.348300.002400.646600.500000.983701.00000


Target Position: 4151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4151GACUCGUUUGGUUGGGGUU75.94751032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7964169GACTCGTTTGGTTGGGGTTAACCCCAACCAAACGAGTC0.022800.002300.672400.750001.000001.00000


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110GCGCUGCUGCAUCUGGACG61.97382890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912128GCGCTGCTGCATCTGGACGCGTCCAGATGCAGCAGCGC0.044700.001800.646600.500000.956500.75000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214CCGUCCCUACUGGCCUUUC55.07093878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3213232CCGTCCCTACTGGCCTTTCGAAAGGCCAGTAGGGACGG0.213500.058700.741400.750000.967401.00000


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605ACAAGGUACUUCGAUGAUG67.53922103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281623ACAAGGTACTTCGATGATGCATCATCGAAGTACCTTGT0.017900.001500.551700.500001.000001.00000


Target Position: 2767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2767CCCACGUUCUGCAGCCUUA86.4467250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8432785CCCACGTTCTGCAGCCTTATAAGGCTGCAGAACGTGGG0.015200.005100.956901.000000.918500.62500


Target Position: 2781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781CCUUAAGGUUGAACAUGAG79.7011697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662799CCTTAAGGTTGAACATGAGCTCATGTTCAACCTTAAGG0.118600.005000.534500.750001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256GCAGAAAAGCAAUAAUGUC78.5253801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952274GCAGAAAAGCAATAATGTCGACATTATTGCTTTTCTGC0.096300.001700.534500.750000.994600.75000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045AGGAGCGGGCCCGGUUUUA64.952470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621063AGGAGCGGGCCCGGTTTTATAAAACCGGGCCCGCTCCT0.032300.001000.810300.750000.962000.62500


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055CCGGUUUUAUGGUGCAGAG71.21591607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111073CCGGTTTTATGGTGCAGAGCTCTGCACCATAAAACCGG0.073000.001500.603400.750001.000001.00000


Target Position: 3029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3029CCUGCCCACGCCUCCCCUC51.5074276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6303047CCTGCCCACGCCTCCCCTCGAGGGGAGGCGTGGGCAGG0.410200.200500.534500.750000.913000.87500


Target Position: 4936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4936GAGUAUAAGAAAGGAAAUU82.3628489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2084954GAGTATAAGAAAGGAAATTAATTTCCTTTCTTATACTC0.344600.193200.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4934-4956AGGAGTATAAGAAAGGAAATTCAAAUUUCCUUUCUUAUACUCCUGAGUAUAAGAAAGGAAAUUCAU18.76.322


Target Position: 3032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032GCCCACGCCUCCCCUCCCU57.56193541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3993050GCCCACGCCTCCCCTCCCTAGGGAGGGGAGGCGTGGGC0.462800.228100.655200.750000.989100.75000


Target Position: 5044, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5044CUCUUUUUGUGUAAUCUUU80.693611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4015062CTCTTTTTGTGTAATCTTTAAAGATTACACAAAAAGAG0.434900.145500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5042-5064TGCTCTTTTTGTGTAATCTTTTCAAAGAUUACACAAAAAGAGCACUCUUUUUGUGUAAUCUUUUCU6.95.532


Target Position: 4524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4524GUAGAAUAAUCGUCUUUUG79.5676714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7944542GTAGAATAATCGTCTTTTGCAAAAGACGATTATTCTAC0.347500.079500.534500.500001.000001.00000


Target Position: 2002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002GGUUGGAGAUUCAGGUUUU89.9341135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972020GGTTGGAGATTCAGGTTTTAAAACCTGAATCTCCAACC0.384600.007600.853401.000001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854CUCACCCCCUUUCCAGUUC52.78474134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981872CTCACCCCCTTTCCAGTTCGAACTGGAAAGGGGGTGAG0.730500.662400.637900.500000.972800.62500


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252ACGGUACAAGCAAUAAAGA79.0703752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5783270ACGGTACAAGCAATAAAGATCTTTATTGCTTGTACCGT0.242700.059000.551700.500001.000001.00000


Target Position: 2737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2737GCCCCCCUCACCCCUCCCU51.10544328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512755GCCCCCCTCACCCCTCCCTAGGGAGGGGTGAGGGGGGC0.475900.031400.655200.750001.000001.00000


Target Position: 2879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2879UGUGUGUGCAUGUGUGUUU74.27121228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912897TGTGTGTGCATGTGTGTTTAAACACACATGCACACACA0.024800.003200.706900.750001.000001.00000


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110GUCAGAUCCAAUUUACAGA86.9216237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8234128GTCAGATCCAATTTACAGATCTGTAAATTGGATCTGAC0.376300.130800.594800.500001.000001.00000


Target Position: 4077, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4077CUUUGAGAUUUUAAGUGAA94.49937

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4075-4097GTCTTTGAGATTTTAAGTGAATGUUCACUUAAAAUCUCAAAGACCUUUGAGAUUUUAAGUGAAUGU20.320.422


Target Position: 5274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5274CUGUAAUAAACUAGCUAUC71.32311591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7855292CTGTAATAAACTAGCTATCGATAGCTAGTTTATTACAG0.564900.497000.603400.500001.000001.00000


Target Position: 3233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3233UCCUCGUCUUCAUAUUUGU69.62681811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5743251TCCTCGTCTTCATATTTGTACAAATATGAAGACGAGGA0.077700.057400.663800.500001.000001.00000


Target Position: 4302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4302CACGUUGCUGCUCCUCACA81.5979535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5724320CACGTTGCTGCTCCTCACATGTGAGGAGCAGCAACGTG0.175500.026000.586200.500000.983700.62500


Target Position: 647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647CGAGGACCCCAUGGACUAC70.63921678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745665CGAGGACCCCATGGACTACGTAGTCCATGGGGTCCTCG0.034900.005000.612100.750000.913000.62500


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133GGAAAACCUCAUGCUGGAC69.58681814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911151GGAAAACCTCATGCTGGACGTCCAGCATGAGGTTTTCC0.085600.018500.551700.750001.000001.00000


Target Position: 2111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111CGCUGCUGCAUCUGGACGA79.371726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732129CGCTGCTGCATCTGGACGATCGTCCAGATGCAGCAGCG0.054500.004800.629300.750000.956500.75000


Target Position: 4064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4064ACACCCAUUGAGUCUUUGA78.9621765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8254082ACACCCATTGAGTCTTTGATCAAAGACTCAATGGGTGT0.036900.015900.482800.500000.940200.75000


Target Position: 4165, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4165GGGUUUUUUAGUUUGUCUU80.554627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4334183GGGTTTTTTAGTTTGTCTTAAGACAAACTAAAAAACCC0.446300.020200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4163-4185TGGGGTTTTTTAGTTTGTCTTTCAAGACAAACUAAAAAACCCCAGGGUUUUUUAGUUUGUCUUUCU19.212.622


Target Position: 4557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4557AAAAUUUCACACAUUCUUU79.5565715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7754575AAAATTTCACACATTCTTTAAAGAATGTGTGAAATTTT0.220300.232300.500000.500001.000001.00000


Target Position: 4481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4481UUGAACUUAGAGUCUUAAU68.88991922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8044499TTGAACTTAGAGTCTTAATATTAAGACTCTAAGTTCAA0.427400.149400.637900.500001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GCCCGAGGCCCCUGAUCAG67.93362054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
621440GCCCGAGGCCCCTGATCAGCTGATCAGGGGCCTCGGGC0.274400.006400.715500.750000.929300.62500


Target Position: 4199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4199ACCUUAAUUUAAUUACAAA93.132359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4214217ACCTTAATTTAATTACAAATTTGTAATTAAATTAAGGT0.538800.325200.853400.750001.000001.00000


Target Position: 3243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243CAUAUUUGUACGGUACAAG72.71221411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6723261CATATTTGTACGGTACAAGCTTGTACCGTACAAATATG0.058700.006400.517200.500000.940200.62500


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512GAGCACAGGUUCUUCCUCA92.916163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601530GAGCACAGGTTCTTCCTCATGAGGAAGAACCTGTGCTC0.059700.001000.586200.500000.918500.75000


Target Position: 4019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4019UGGCACAGAUGAAUUUGAG68.84071930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7714037TGGCACAGATGAATTTGAGCTCAAATTCATCTGTGCCA0.562400.010400.534500.500001.000001.00000


Target Position: 4017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4017CCUGGCACAGAUGAAUUUG64.68072521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6604035CCTGGCACAGATGAATTTGCAAATTCATCTGTGCCAGG0.188800.005100.698300.750000.983700.62500


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259GGUGCUGGAGGACAAUGAC76.3569985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6201277GGTGCTGGAGGACAATGACGTCATTGTCCTCCAGCACC0.173500.009500.534500.750001.000001.00000


Target Position: 3814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3814GUUUGGUUAGAACCCUGUU76.9294935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093832GTTTGGTTAGAACCCTGTTAACAGGGTTCTAACCAAAC0.025000.001500.500000.750000.918501.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258AGGUGCUGGAGGACAAUGA79.2474736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161276AGGTGCTGGAGGACAATGATCATTGTCCTCCAGCACCT0.241200.012000.620700.500001.000001.00000


Target Position: 4541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4541UGCAAUGUACAUUUUAAAA83.236425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4714559TGCAATGTACATTTTAAAATTTTAAAATGTACATTGCA0.670100.332900.853400.750001.000001.00000


Target Position: 5292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5292CCAUCUGUAAAAAAAAAAA90.0529129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545310CCATCTGTAAAAAAAAAAATTTTTTTTTTTACAGATGG0.984000.710300.844801.000001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612ACUUCGAUGAUGAAUUUAC69.23091867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501630ACTTCGATGATGAATTTACGTAAATTCATCATCGAAGT0.058000.002500.525900.500001.000001.00000


Target Position: 4855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4855GCCUGGGACAAUGAGACUG65.45742387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7324873GCCTGGGACAATGAGACTGCAGTCTCATTGTCCCAGGC0.282000.003100.715500.750001.000001.00000


Target Position: 5294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5294AUCUGUAAAAAAAAAAAAA81.1282570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6845312ATCTGTAAAAAAAAAAAAATTTTTTTTTTTTTACAGAT0.989500.715500.681000.500001.000001.00000


Target Position: 4708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708UCUCUACAAAAAAUACAAA83.0524441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4864726TCTCTACAAAAAATACAAATTTGTATTTTTTGTAGAGA0.944600.200300.724100.750001.000001.00000


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141GGGAGGGGUGGGGUUGGUU68.84371929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3363159GGGAGGGGTGGGGTTGGTTAACCAACCCCACCCCTCCC0.202500.099400.844801.000001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726GCACGGGCUAAAGUGACCA78.3409821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
826744GCACGGGCTAAAGTGACCATGGTCACTTTAGCCCGTGC0.026100.001300.508600.750000.956500.62500


Target Position: 541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541CCACAGUCAUCGAGAGGAC75.22271109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654559CCACAGTCATCGAGAGGACGTCCTCTCGATGACTGTGG0.058000.010800.525900.750000.940200.62500


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603ACACAAGGUACUUCGAUGA80.197663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211621ACACAAGGTACTTCGATGATCATCGAAGTACCTTGTGT0.026400.005100.482800.500001.000001.00000


Target Position: 1934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1934GCCUCACCUUUGUGCCCAG72.75781407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341952GCCTCACCTTTGTGCCCAGCTGGGCACAAAGGTGAGGC0.016900.017700.715500.750000.923901.00000


Target Position: 4908, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4908CAUGCUAUUAAAAAAGACA90.3249120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4906-4928TACATGCTATTAAAAAAGACAGCUGUCUUUUUUAAUAGCAUGUACAUGCUAUUAAAAAAGACAGCU13.319.722


Target Position: 126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126CCGGGAAACACAAGGAAAG66.23952282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289144CCGGGAAACACAAGGAAAGCTTTCCTTGTGTTTCCCGG0.541200.051500.775900.750001.000001.00000


Target Position: 4433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4433AGUUGAGCAUGUGUGGUUA89.922136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8294451AGTTGAGCATGTGTGGTTATAACCACACATGCTCAACT0.047800.001300.672400.750001.000001.00000


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838UCCCCACCCCCACCUCCUC42.94194933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531856TCCCCACCCCCACCTCCTCGAGGAGGTGGGGGTGGGGA0.673100.400400.560300.500001.000001.00000


Target Position: 3621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621GCCUGUGCUGUCACUGAAU84.786333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073639GCCTGTGCTGTCACTGAATATTCAGTGACAGCACAGGC0.038200.001500.991401.000000.918501.00000


Target Position: 4219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4219GUCUACCCUGGUGGUCAUA77.3857888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7004237GTCTACCCTGGTGGTCATATATGACCACCAGGGTAGAC0.120600.004000.775900.750000.902201.00000


Target Position: 3370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3370CUGUACUAGCCGUUCCCUU74.88641147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3653388CTGTACTAGCCGTTCCCTTAAGGGAACGGCTAGTACAG0.223000.089600.646600.750001.000001.00000


Target Position: 4453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4453CCUGUAGAGCUUUUCCCAA87.9578198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6984471CCTGTAGAGCTTTTCCCAATTGGGAAAAGCTCTACAGG0.044600.021300.698301.000000.978300.75000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446ACCCCCCUUAAACAACUUC50.63194373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504464ACCCCCCTTAAACAACTTCGAAGTTGTTTAAGGGGGGT0.295200.288900.681000.500001.000001.00000


Target Position: 4155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4155CGUUUGGUUGGGGUUUUUU71.94921517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6994173CGTTTGGTTGGGGTTTTTTAAAAAACCCCAACCAAACG0.053100.004100.775901.000001.000001.00000


Target Position: 2917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2917UCCAGUGUGCAUGGUGUGU58.24543456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242935TCCAGTGTGCATGGTGTGTACACACCATGCACACTGGA0.039800.010800.663800.500000.956500.62500


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056CGGUUUUAUGGUGCAGAGA79.1058744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191074CGGTTTTATGGTGCAGAGATCTCTGCACCATAAAACCG0.063800.064700.689700.750001.000001.00000


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653CCAUGGACUUGGUCAGGGA88.097190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672671CCATGGACTTGGTCAGGGATCCCTGACCAAGTCCATGG0.011800.002000.474100.750000.956500.62500


Target Position: 4486, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486CUUAGAGUCUUAAUAAAAU90.2121125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4344504CTTAGAGTCTTAATAAAATATTTTATTAAGACTCTAAG0.401300.145600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4484-4506AACTTAGAGTCTTAATAAAATCTAUUUUAUUAAGACUCUAAGUUCUUAGAGUCUUAAUAAAAUCUU-9.718.932


Target Position: 733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733CUAAAGUGACCAUGAAUGA85.606294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
731-753GGCTAAAGTGACCATGAATGACTUCAUUCAUGGUCACUUUAGCCCUAAAGUGACCAUGAAUGACUU13.611.823


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147GGUGGGGUUGGUUCGGGUG63.59442674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5773165GGTGGGGTTGGTTCGGGTGCACCCGAACCAACCCCACC0.082700.073900.560300.750001.000001.00000


Target Position: 4871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4871CUGUGUCUCUAAAAAUAAA97.524520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5064889CTGTGTCTCTAAAAATAAATTTATTTTTAGAGACACAG0.980200.012500.784500.750001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004AGCCCCACUGUGAUCCAUG64.42142559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223022AGCCCCACTGTGATCCATGCATGGATCACAGTGGGGCT0.223000.013600.698300.500000.989100.62500


Target Position: 1120, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GCGACAUCAAGCUGGAAAA89.8822137

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1112019GCGACATCAAGCTGGAAAA1/1/0/097.75AKT2NM_001626.31NANANA19:40742285,40743876..40742292,40743886(-)00AKT2(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451138GCGACATCAAGCTGGAAAATTTTCCAGCTTGATGTCGC0.057700.008400.922401.000001.000001.00000


Target Position: 5291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5291UCCAUCUGUAAAAAAAAAA71.27021600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1855309TCCATCTGTAAAAAAAAAATTTTTTTTTTACAGATGGA0.981200.705600.870700.750001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result