Input target sequence

Length: 1331
TCTTGCTGCGCCTCCGCCTCCTCCTCTGCTCCGCCACCGGCTTCCTCCTCCTGAGCAGTCAGCCCGCGCGCCGGCCGGCTCCGTTATGGCGACCCGCAGCCCTGGCGTCGTGATTAGTGATGATGAACCAGGTTATGACCTTGATTTATTTTGCATACCTAATCATTATGCTGAGGATTTGGAAAGGGTGTTTATTCCTCATGGACTAATTATGGACAGGACTGAACGTCTTGCTCGAGATGTGATGAAGGAGATGGGAGGCCATCACATTGTAGCCCTCTGTGTGCTCAAGGGGGGCTATAAATTCTTTGCTGACCTGCTGGATTACATCAAAGCACTGAATAGAAATAGTGATAGATCCATTCCTATGACTGTAGATTTTATCAGACTGAAGAGCTATTGTAATGACCAGTCAACAGGGGACATAAAAGTAATTGGTGGAGATGATCTCTCAACTTTAACTGGAAAGAATGTCTTGATTGTGGAAGATATAATTGACACTGGCAAAACAATGCAGACTTTGCTTTCCTTGGTCAGGCAGTATAATCCAAAGATGGTCAAGGTCGCAAGCTTGCTGGTGAAAAGGACCCCACGAAGTGTTGGATATAAGCCAGACTTTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATTTGAATCATGTTTGTGTCATTAGTGAAACTGGAAAAGCAAAATACAAAGCCTAAGATGAGAGTTCAAGTTGAGTTTGGAAACATCTGGAGTCCTATTGACATCGCCAGTAAAATTATCAATGTTCTAGTTCTGTGGCCATCTGCTTAGTAGAGCTTTTTGCATGTATCTTCTAAGAATTTTATCTGTTTTGTACTTTAGAAATGTCAGTTGCTGCATTCCTAAACTGTTTATTTGCACTATGAGCCTATAGACTATCAGTTCCCTTTGGGCGGATTGTTGTTTAACTTGTAAATGAAAAAATTCTCTTAAACCACAGCACTATTGAGTGAAACATTGAACTCATATCTGTAAGAAATAAAGAGAAGATATATTAGTTTTTTAATTGGTATTTTAATTTTTATATATGCAGGAAAGAATAGAAGTGATTGAATATTGTTAATTATACCACCGTGTGTTAGAAAAGTAAGAAGCAGTCAATTTTCACATCAAAGACAGCATCTAAGAAGTTTTGTTCTGTCCTGGAATTATTTTAGTAGTGTTTCAGTAATGTTGACTGTATTTTCCAACTTGTTCAAATTATTACCAGTGAATCTTTGTCAGCAGTTCCCTTTTAAATGCAAATCAATAAATTCCCAAAAATTT