siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 129   154   328   336   340   351   441   456   465   603   612   614   616   662   674   756   796   832   842   924  
977   1006   1008   1015   1176   1245   1256  
Biltr, Ernai, Rnaxs 589   994  
Biltr, Ernai, Rnaxs, Sidirect 366   849   1054   1113   1152  
Biltr, Rnaxs, Sidirect 131   132   139   338   365   421   443   475   640   665   685   698   711   717   739   793   794   839   848   852  
859   863   872   903   907   913   960   961   968   1005   1021   1025   1028   1030   1035   1041   1049   1051   1063   1074  
1075   1098   1103   1108   1139   1184   1208   1222   1233   1243   1252   1253   1296   1297  
Biltr, Rnaxs 9   18   19   20   33   34   38   106   107   108   109   110   133   134   137   138   143   144   145   149  
150   151   152   158   161   162   163   167   173   174   175   176   177   178   196   197   203   204   205   228  
229   231   232   233   235   236   237   238   242   294   295   296   297   311   312   314   315   316   317   319  
320   321   322   325   326   327   329   331   334   337   339   345   357   358   360   361   362   363   364   370  
372   375   376   382   383   384   385   386   387   388   389   390   394   407   408   409   410   411   412   413  
415   416   417   418   419   420   422   430   445   449   450   451   452   453   454   455   461   462   469   476  
477   478   482   483   484   490   491   495   505   508   509   513   514   528   529   532   533   534   535   536  
537   538   548   552   555   565   566   567   569   570   590   591   592   597   623   624   627   628   652   653  
654   659   660   661   663   664   671   672   673   676   678   679   681   682   683   684   691   692   694   697  
704   705   706   710   712   713   716   718   719   725   736   737   738   754   755   772   778   779   780   781  
782   783   784   786   787   788   790   791   792   795   810   812   816   836   837   838   840   841   844   847  
850   851   853   855   858   860   862   867   868   871   873   874   879   880   881   892   893   894   895   898  
899   900   901   902   904   911   912   919   926   957   958   959   962   963   964   965   967   969   970   971  
972   973   974   979   980   981   982   991   992   993   1004   1007   1017   1020   1022   1024   1026   1027   1029   1034  
1036   1039   1040   1043   1044   1047   1048   1050   1052   1053   1055   1060   1061   1062   1064   1065   1066   1067   1068   1069  
1070   1071   1072   1073   1076   1084   1088   1089   1094   1095   1096   1097   1099   1101   1102   1104   1105   1107   1109   1110  
1111   1112   1114   1115   1116   1128   1132   1133   1134   1135   1136   1137   1138   1140   1141   1149   1150   1151   1156   1157  
1158   1159   1160   1161   1162   1163   1171   1172   1179   1180   1181   1182   1183   1185   1188   1195   1196   1197   1201   1202  
1203   1204   1205   1206   1207   1209   1210   1211   1212   1218   1219   1221   1224   1225   1226   1232   1237   1240   1241   1242  
1244   1247   1248   1249   1250   1251   1258   1261   1262   1266   1271   1272   1275   1276   1277   1281   1282   1283   1284   1285  
1286   1287   1288   1291   1292   1293   1294   1295   1299   1300   1301   1302   1307   1308   1309   1310   1311   1312   1313  
Biltr, Ernai 286   610  
Biltr, Ernai, Sidirect 1231  


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454AACUUUAACUGGAAAGAAU84.5197249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378472AACTTTAACTGGAAAGAATATTCTTTCCAGTTAAAGTT0.102000.014200.637900.500001.000001.00000


Target Position: 1176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176CAAAGACAGCAUCUAAGAA98.899619

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1174-1196ATCAAAGACAGCATCTAAGAAGTUUCUUAGAUGCUGUCUUUGAUCAAAGACAGCAUCUAAGAAGUU20.219.222


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171CACAUCAAAGACAGCAUCU78.6138458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511189CACATCAAAGACAGCATCTAGATGCTGTCTTTGATGTG0.016800.002000.569000.500001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913CUGUUUAUUUGCACUAUGA89.4962114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351931CTGTTTATTTGCACTATGATCATAGTGCAAATAAACAG0.100300.034500.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
911-933AACTGTTTATTTGCACTATGAGCUCAUAGUGCAAAUAAACAGUUCUGUUUAUUUGCACUAUGAGCU17.96.933


Target Position: 839, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839GAGCUUUUUGCAUGUAUCU80.9683371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
448857GAGCTTTTTGCATGTATCTAGATACATGCAAAAAGCTC0.231300.006600.586200.500000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
837-859TAGAGCTTTTTGCATGTATCTTCAGAUACAUGCAAAAAGCUCUAGAGCUUUUUGCAUGUAUCUUCU16.017.031


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288AGCAGUUCCCUUUUAAAUG66.4837911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941306AGCAGTTCCCTTTTAAATGCATTTAAAAGGGAACTGCT0.272300.042800.698300.500001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565CGCAAGCUUGCUGGUGAAA78.1977468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433583CGCAAGCTTGCTGGTGAAATTTCACCAGCAAGCTTGCG0.019900.002500.922401.000000.902200.62500


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372CUGUAGAUUUUAUCAGACU84.1415265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350390CTGTAGATTTTATCAGACTAGTCTGATAAAATCTACAG0.108300.006000.577600.500001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162AUCAUUAUGCUGAGGAUUU71.8676706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412180ATCATTATGCTGAGGATTTAAATCCTCAGCATAATGAT0.027000.011700.681000.500000.967400.62500


Target Position: 1054, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054GAUAUAUUAGUUUUUUAAU90.882795

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7105419GATATATTAGTTTTTTAAT1/1/0/093.97HPRT1NM_000194.21NANANAX:133634419..133634437(+)|11:29487699..29487717(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171072GATATATTAGTTTTTTAATATTAAAAAACTAATATATC0.024700.002800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1052-1074AAGATATATTAGTTTTTTAATTGAUUAAAAAACUAAUAUAUCUUGAUAUAUUAGUUUUUUAAUUGU-9.1-8.621


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967UGUUUAACUUGUAAAUGAA92.229471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318985TGTTTAACTTGTAAATGAATTCATTTACAAGTTAAACA0.260900.072900.534500.750001.000001.00000


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276UGAAUCUUUGUCAGCAGUU69.4085815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3261294TGAATCTTTGTCAGCAGTTAACTGCTGACAAAGATTCA0.067600.035000.577600.750001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478GAUUGUGGAAGAUAUAAUU92.321670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383496GATTGTGGAAGATATAATTAATTATATCTTCCACAATC0.079600.004100.672400.750001.000001.00000


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196UCCUCAUGGACUAAUUAUG64.3822982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366214TCCTCATGGACTAATTATGCATAATTAGTCCATGAGGA0.143800.004900.715500.500000.929300.62500


Target Position: 483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483UGGAAGAUAUAAUUGACAC71.4158728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351501TGGAAGATATAATTGACACGTGTCAATTATATCTTCCA0.055600.018500.551700.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610GCCAGACUUUGUUGGAUUU82.4098325

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_161019GCCAGACTTTGTTGGATTT1/1/0/0100.00HPRT1NM_000194.21NANANA11:93731851..93731869(-)00HPRT1(0.002)


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838AGAGCUUUUUGCAUGUAUC74.1284625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411856AGAGCTTTTTGCATGTATCGATACATGCAAAAAGCTCT0.146900.006600.543100.500000.978300.87500


Target Position: 150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
150UUUGCAUACCUAAUCAUUA82.2249327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478168TTTGCATACCTAATCATTATAATGATTAGGTATGCAAA0.098900.008200.465500.500001.000001.00000


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150AAGUAAGAAGCAGUCAAUU77.1697507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431168AAGTAAGAAGCAGTCAATTAATTGACTGCTTCTTACTT0.135600.046100.629300.500001.000001.00000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151UUGCAUACCUAAUCAUUAU78.0717476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324169TTGCATACCTAATCATTATATAATGATTAGGTATGCAA0.079900.007500.603400.500001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GACAUAAAAGUAAUUGGUG75.7849567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392440GACATAAAAGTAATTGGTGCACCAATTACTTTTATGTC0.033500.015600.525900.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685GGAUUUGAAUCAUGUUUGU84.5734246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388703GGATTTGAATCATGTTTGTACAAACATGATTCAAATCC0.036300.027500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
683-705AGGGATTTGAATCATGTTTGTGTACAAACAUGAUUCAAAUCCCUGGAUUUGAAUCAUGUUUGUGUU12.116.322


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892GUCAGUUGCUGCAUUCCUA94.572244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313910GTCAGTTGCTGCATTCCTATAGGAATGCAGCAACTGAC0.099100.008300.646600.750000.994600.75000


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262CAAAUUAUUACCAGUGAAU84.5135250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061280CAAATTATTACCAGTGAATATTCACTGGTAATAATTTG0.208800.043600.637900.750001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GUGUUAGAAAAGUAAGAAG77.818484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241159GTGTTAGAAAAGTAAGAAGCTTCTTACTTTTCTAACAC0.177300.056100.655200.500001.000001.00000


Target Position: 1006, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006CACUAUUGAGUGAAACAUU89.4458117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1004-1026AGCACTATTGAGTGAAACATTGAAAUGUUUCACUCAAUAGUGCUCACUAUUGAGUGAAACAUUGAU14.811.622


Target Position: 1115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115UUGAAUAUUGUUAAUUAUA79.6584415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641133TTGAATATTGTTAATTATATATAATTAACAATATTCAA0.014300.006300.603400.500001.000001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652AGGAUAUGCCCUUGACUAU83.5579283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443670AGGATATGCCCTTGACTATATAGTCAAGGGCATATCCT0.022200.001900.801700.750000.929300.62500


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981AUGAAAAAAUUCUCUUAAA87.7442158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364999ATGAAAAAATTCTCTTAAATTTAAGAGAATTTTTTCAT0.282200.182500.655200.500000.962000.75000


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390UGAAGAGCUAUUGUAAUGA77.215502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389408TGAAGAGCTATTGTAATGATCATTACAATAGCTCTTCA0.148100.115700.500000.500001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107AGAAGUGAUUGAAUAUUGU83.241294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451125AGAAGTGATTGAATATTGTACAATATTCAATCACTTCT0.161100.015600.517200.500001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663UUGACUAUAAUGAAUACUU73.2547662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352681TTGACTATAATGAATACTTAAGTATTCATTATAGTCAA0.057100.027600.508600.500001.000001.00000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716ACUGGAAAAGCAAAAUACA84.5875245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468734ACTGGAAAAGCAAAATACATGTATTTTGCTTTTCCAGT0.349600.119600.500000.500001.000001.00000


Target Position: 131, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131GGUUAUGACCUUGAUUUAU86.6171182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73149GGTTATGACCTTGATTTATATAAATCAAGGTCATAACC0.321200.101800.810301.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
129-151CAGGTTATGACCTTGATTTATTTAUAAAUCAAGGUCAUAACCUGGGUUAUGACCUUGAUUUAUUUU8.916.113


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GUGAUGAAGGAGAUGGGAG71.6194717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441260GTGATGAAGGAGATGGGAGCTCCCATCTCCTTCATCAC0.286000.003200.482800.500001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961GAUUGUUGUUUAACUUGUA99.48714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405979GATTGTTGTTTAACTTGTATACAAGTTAAACAACAATC0.176200.002900.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
959-981CGGATTGTTGTTTAACTTGTAAAUACAAGUUAAACAACAAUCCGGAUUGUUGUUUAACUUGUAAAU17.812.122


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681UCAGGGAUUUGAAUCAUGU73.4321653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425699TCAGGGATTTGAATCATGTACATGATTCAAATCCCTGA0.097700.011300.517200.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219UUAGUAGUGUUUCAGUAAU74.0769627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411237TTAGTAGTGTTTCAGTAATATTACTGAAACACTACTAA0.018500.005300.525900.500001.000001.00000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992CUCUUAAACCACAGCACUA92.172474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041010CTCTTAAACCACAGCACTATAGTGCTGTGGTTTAAGAG0.190300.084000.637900.750001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151AGUAAGAAGCAGUCAAUUU84.2058260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211169AGTAAGAAGCAGTCAATTTAAATTGACTGCTTCTTACT0.143200.043500.706900.750001.000001.00000


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238AGAUGUGAUGAAGGAGAUG70.5971766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378256AGATGTGATGAAGGAGATGCATCTCCTTCATCACATCT0.276800.004200.569000.500001.000001.00000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624GAUUUGAAAUUCCAGACAA97.77722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438642GATTTGAAATTCCAGACAATTGTCTGGAATTTCAAATC0.018700.013700.534500.750001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CGCCAGUAAAAUUAUCAAU83.8027278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64809CGCCAGTAAAATTATCAATATTGATAATTTTACTGGCG0.394000.103200.913801.000001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272CCAGUGAAUCUUUGUCAGC65.051959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131290CCAGTGAATCTTTGTCAGCGCTGACAAAGATTCACTGG0.151400.050800.491400.500001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971UAACUUGUAAAUGAAAAAA76.854520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312989TAACTTGTAAATGAAAAAATTTTTTCATTTACAAGTTA0.272800.215200.534500.500001.000001.00000


Target Position: 366, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366CUAUGACUGUAGAUUUUAU96.647830

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_936619CTATGACTGTAGATTTTAT1/1/0/093.44HPRT1NM_000194.21NANANAX:133609357..133609375(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329384CTATGACTGTAGATTTTATATAAAATCTACAGTCATAG0.333300.007100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
364-386TCCTATGACTGTAGATTTTATCAAUAAAAUCUACAGUCAUAGGACUAUGACUGUAGAUUUUAUCAU2.120.322


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837UAGAGCUUUUUGCAUGUAU73.6363643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406855TAGAGCTTTTTGCATGTATATACATGCAAAAAGCTCTA0.146600.002800.629300.500000.978301.00000


Target Position: 859, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859CUAAGAAUUUUAUCUGUUU86.3445191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161877CTAAGAATTTTATCTGTTTAAACAGATAAAATTCTTAG0.315900.078300.672400.750000.978300.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
857-879TTCTAAGAATTTTATCTGTTTTGAAACAGAUAAAAUUCUUAGAACUAAGAAUUUUAUCUGUUUUGU19.26.922


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705UCAUUAGUGAAACUGGAAA78.6844454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198723TCATTAGTGAAACTGGAAATTTCCAGTTTCACTAATGA0.158000.031400.724100.750001.000001.00000


Target Position: 614, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614GACUUUGUUGGAUUUGAAA92.175973

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
612-634CAGACTTTGTTGGATTTGAAATTUUUCAAAUCCAACAAAGUCUGGACUUUGUUGGAUUUGAAAUUU7.417.822


Target Position: 421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GGACAUAAAAGUAAUUGGU82.5673319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373439GGACATAAAAGTAATTGGTACCAATTACTTTTATGTCC0.042200.019500.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
419-441GGGGACATAAAAGTAATTGGTGGACCAAUUACUUUUAUGUCCCCGGACAUAAAAGUAAUUGGUGGU12.816.132


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476UUGAUUGUGGAAGAUAUAA74.0591628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435494TTGATTGTGGAAGATATAATTATATCTTCCACAATCAA0.107100.002000.612100.500001.000001.00000


Target Position: 872, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872CUGUUUUGUACUUUAGAAA88.0506153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384890CTGTTTTGTACTTTAGAAATTTCTAAAGTACAAAACAG0.038000.007900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
870-892ATCTGTTTTGTACTTTAGAAATGUUUCUAAAGUACAAAACAGAUCUGUUUUGUACUUUAGAAAUGU7.112.222


Target Position: 1245, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245GUAUUUUCCAACUUGUUCA86.335192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1243-1265CTGTATTTTCCAACTTGTTCAAAUGAACAAGUUGGAAAAUACAGGUAUUUUCCAACUUGUUCAAAU19.22.121


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CCACCGUGUGUUAGAAAAG71.7236711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1381152CCACCGTGTGTTAGAAAAGCTTTTCTAACACACGGTGG0.255300.060100.706900.750000.972800.62500


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337ACUGAAUAGAAAUAGUGAU81.9213343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437355ACTGAATAGAAATAGTGATATCACTATTTCTATTCAGT0.032500.002000.525900.750001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247AUUUUCCAACUUGUUCAAA71.2404736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731265ATTTTCCAACTTGTTCAAATTTGAACAAGTTGGAAAAT0.226600.154400.508600.500001.000001.00000


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107GUCGUGAUUAGUGAUGAUG66.8601897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475125GTCGTGATTAGTGATGATGCATCATCACTAATCACGAC0.012500.001400.663800.500001.000001.00000


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683AGGGAUUUGAAUCAUGUUU72.6384679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370701AGGGATTTGAATCATGTTTAAACATGATTCAAATCCCT0.074000.004800.844800.750001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237UGUUGACUGUAUUUUCCAA91.843278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821255TGTTGACTGTATTTTCCAATTGGAAAATACAGTCAACA0.306400.035100.560300.750001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297GCUAUAAAUUCUUUGCUGA90.967694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379315GCTATAAATTCTTTGCTGATCAGCAAAGAATTTATAGC0.087500.004200.629300.750001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469GAAUGUCUUGAUUGUGGAA97.38424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470487GAATGTCTTGATTGTGGAATTCCACAATCAAGACATTC0.013100.001600.500000.750001.000001.00000


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251UCCAACUUGUUCAAAUUAU69.6629803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951269TCCAACTTGTTCAAATTATATAATTTGAACAAGTTGGA0.267000.137300.827600.750001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101AAGAAUAGAAGUGAUUGAA85.168223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711119AAGAATAGAAGTGATTGAATTCAATCACTTCTATTCTT0.077200.031700.465500.500001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096CAGGAAAGAAUAGAAGUGA85.1095227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291114CAGGAAAGAATAGAAGTGATCACTTCTATTCTTTCCTG0.061100.052900.560300.500001.000001.00000


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316CCUGCUGGAUUACAUCAAA93.052259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413334CCTGCTGGATTACATCAAATTTGATGTAATCCAGCAGG0.127100.002600.844801.000001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GAAGAUAUAUUAGUUUUUU88.6407137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441069GAAGATATATTAGTTTTTTAAAAAACTAATATATCTTC0.017900.003900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1049-1071GAGAAGATATATTAGTTTTTTAAAAAAAACUAAUAUAUCUUCUCGAAGAUAUAUUAGUUUUUUAAU3.26.622


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855UCUUCUAAGAAUUUUAUCU72.6109680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398873TCTTCTAAGAATTTTATCTAGATAAAATTCTTAGAAGA0.315300.077000.500000.500001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505CAAAACAAUGCAGACUUUG65.6857942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426523CAAAACAATGCAGACTTTGCAAAGTCTGCATTGTTTTG0.022200.002500.500000.500001.000001.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297CUUUUAAAUGCAAAUCAAU82.8217312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271315CTTTTAAATGCAAATCAATATTGATTTGCATTTAAAAG0.587100.245100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317CCCTTTTAAATGCAAATCAATAAAUUGAUUUGCAUUUAAAAGGGCUUUUAAAUGCAAAUCAAUAAU7.4-9.121


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GUCAAUUUUCACAUCAAAG74.2457622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521180GTCAATTTTCACATCAAAGCTTTGATGTGAAAATTGAC0.016700.009100.681000.500001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GUUUUGUUCUGUCCUGGAA87.3027171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691213GTTTTGTTCTGTCCTGGAATTCCAGGACAGAACAAAAC0.013600.001100.474100.750001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960GGAUUGUUGUUUAACUUGU83.2904293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427978GGATTGTTGTTTAACTTGTACAAGTTAAACAACAATCC0.150100.002200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
958-980GCGGATTGTTGTTTAACTTGTAAACAAGUUAAACAACAAUCCGCGGAUUGUUGUUUAACUUGUAAU11.814.833


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737GCCUAAGAUGAGAGUUCAA95.764538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420755GCCTAAGATGAGAGTTCAATTGAACTCTCATCTTAGGC0.023000.020700.853401.000001.000001.00000


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788CAUCGCCAGUAAAAUUAUC72.368688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446806CATCGCCAGTAAAATTATCGATAATTTTACTGGCGATG0.415000.058600.474100.500001.000001.00000


Target Position: 1256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256CUUGUUCAAAUUAUUACCA76.8924519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1254-1276AACTTGTTCAAATTATTACCAGTUGGUAAUAAUUUGAACAAGUUCUUGUUCAAAUUAUUACCAGUU15.320.523


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228GUCUUGCUCGAGAUGUGAU84.4665253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396246GTCTTGCTCGAGATGTGATATCACATCTCGAGCAAGAC0.156700.003400.637900.750001.000001.00000


Target Position: 1088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088UAUAUAUGCAGGAAAGAAU80.3328395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491106TATATATGCAGGAAAGAATATTCTTTCCTGCATATATA0.329900.220000.534500.500001.000001.00000


Target Position: 851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851UGUAUCUUCUAAGAAUUUU71.0706743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256869TGTATCTTCTAAGAATTTTAAAATTCTTAGAAGATACA0.107200.068400.706900.750001.000001.00000


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GGAUUUGAAAUUCCAGACA85.8489203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449641GGATTTGAAATTCCAGACATGTCTGGAATTTCAAATCC0.017000.015600.663800.750000.972800.62500


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874GUUUUGUACUUUAGAAAUG72.9426666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419892GTTTTGTACTTTAGAAATGCATTTCTAAAGTACAAAAC0.027100.006700.491400.500001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627UUGAAAUUCCAGACAAGUU71.3741732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401645TTGAAATTCCAGACAAGTTAACTTGTCTGGAATTTCAA0.031700.004000.500000.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CAGUAAUGUUGACUGUAUU92.988260

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2123119CAGTAATGTTGACTGTATT1/1/0/097.21HPRT1NM_000194.21NANANAX:133634596..133634614(+)00HPRT1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1229-1251TTCAGTAATGTTGACTGTATTTTAAUACAGUCAACAUUACUGAACAGUAAUGUUGACUGUAUUUUU19.011.632


Target Position: 1253, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CAACUUGUUCAAAUUAUUA95.571140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331271CAACTTGTTCAAATTATTATAATAATTTGAACAAGTTG0.205600.059300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1251-1273TCCAACTTGTTCAAATTATTACCUAAUAAUUUGAACAAGUUGGACAACUUGUUCAAAUUAUUACCU-10.317.822


Target Position: 616, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616CUUUGUUGGAUUUGAAAUU75.0692589

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
614-636GACTTTGTTGGATTTGAAATTCCAAUUUCAAAUCCAACAAAGUCCUUUGUUGGAUUUGAAAUUCCU7.412.221


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209UGGAAUUAUUUUAGUAGUG66.1376922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541227TGGAATTATTTTAGTAGTGCACTACTAAAATAATTCCA0.070100.011500.551700.500001.000001.00000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462CUGGAAAGAAUGUCUUGAU83.9188272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477480CTGGAAAGAATGTCTTGATATCAAGACATTCTTTCCAG0.012400.010500.603400.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GCAGUCAAUUUUCACAUCA88.002154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181177GCAGTCAATTTTCACATCATGATGTGAAAATTGACTGC0.609900.077000.629300.750001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052AAGAUAUAUUAGUUUUUUA96.794628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421070AAGATATATTAGTTTTTTATAAAAAACTAATATATCTT0.018400.003500.603400.500001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075GUAUUUUAAUUUUUAUAUA97.322926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991093GTATTTTAATTTTTATATATATATAAAAATTAAAATAC0.163500.033500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1073-1095TGGTATTTTAATTTTTATATATGUAUAUAAAAAUUAAAAUACCAGUAUUUUAAUUUUUAUAUAUGU-8.0-7.511


Target Position: 1025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025GAACUCAUAUCUGUAAGAA96.714429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841043GAACTCATATCTGTAAGAATTCTTACAGATATGAGTTC0.165800.046400.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1023-1045TTGAACTCATATCTGTAAGAAATUUCUUACAGAUAUGAGUUCAAGAACUCAUAUCUGUAAGAAAUU20.319.223


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477UGAUUGUGGAAGAUAUAAU83.0358301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
395495TGATTGTGGAAGATATAATATTATATCTTCCACAATCA0.089600.003400.715500.750001.000001.00000


Target Position: 235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235UCGAGAUGUGAUGAAGGAG63.30551017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435253TCGAGATGTGATGAAGGAGCTCCTTCATCACATCTCGA0.079100.014600.482800.500001.000001.00000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660CCCUUGACUAUAAUGAAUA89.6222113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373678CCCTTGACTATAATGAATATATTCATTATAGTCAAGGG0.175900.004500.948301.000001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411AGUCAACAGGGGACAUAAA91.14289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79429AGTCAACAGGGGACATAAATTTATGTCCCCTGTTGACT0.486500.103600.706900.750000.967400.62500


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325UUACAUCAAAGCACUGAAU70.5836767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333343TTACATCAAAGCACTGAATATTCAGTGCTTTGATGTAA0.133800.042700.525900.500000.956500.75000


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383AUCAGACUGAAGAGCUAUU75.4274575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376401ATCAGACTGAAGAGCTATTAATAGCTCTTCAGTCTGAT0.150400.025600.672400.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CCCACGAAGUGUUGGAUAU81.8112349

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_858919CCCACGAAGTGTTGGATAT1/1/0/093.71HPRT1NM_000194.21NANANAX:133632438..133632456(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382607CCCACGAAGTGTTGGATATATATCCAACACTTCGTGGG0.055100.004100.948301.000000.907600.62500


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029UCAUAUCUGUAAGAAAUAA86.9936177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831047TCATATCTGTAAGAAATAATTATTTCTTACAGATATGA0.778900.114200.689700.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204UGUCCUGGAAUUAUUUUAG65.295954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801222TGTCCTGGAATTATTTTAGCTAAAATAATTCCAGGACA0.181900.006200.534500.500001.000001.00000


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250UUCCAACUUGUUCAAAUUA73.5552647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791268TTCCAACTTGTTCAAATTATAATTTGAACAAGTTGGAA0.267600.137300.637900.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266UUAUUACCAGUGAAUCUUU74.1295624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041284TTATTACCAGTGAATCTTTAAAGATTCACTGGTAATAA0.188000.028100.534500.500001.000001.00000


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965GUUGUUUAACUUGUAAAUG66.4569912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471983GTTGTTTAACTTGTAAATGCATTTACAAGTTAAACAAC0.255300.047900.491400.500001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449CUCUCAACUUUAACUGGAA92.377369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267467CTCTCAACTTTAACTGGAATTCCAGTTAAAGTTGAGAG0.106200.012600.637900.750001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020ACAUUGAACUCAUAUCUGU81.9135344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991038ACATTGAACTCATATCTGTACAGATATGAGTTCAATGT0.083900.032000.500000.500001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244UGUAUUUUCCAACUUGUUC59.50221106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391262TGTATTTTCCAACTTGTTCGAACAAGTTGGAAAATACA0.164300.067000.534500.500001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528CCUUGGUCAGGCAGUAUAA92.655765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388546CCTTGGTCAGGCAGTATAATTATACTGCCTGACCAAGG0.516700.003800.810301.000000.923900.62500


Target Position: 132, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GUUAUGACCUUGAUUUAUU85.8729202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197150GTTATGACCTTGATTTATTAATAAATCAAGGTCATAAC0.314300.117200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
130-152AGGTTATGACCTTGATTTATTTTAAUAAAUCAAGGUCAUAACCUGUUAUGACCUUGAUUUAUUUUU1.816.113


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958GCGGAUUGUUGUUUAACUU84.645238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436976GCGGATTGTTGTTTAACTTAAGTTAAACAACAATCCGC0.131700.002000.784501.000001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203GGACUAAUUAUGGACAGGA89.2147127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454221GGACTAATTATGGACAGGATCCTGTCCATAATTAGTCC0.016600.010200.500000.750001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408ACCAGUCAACAGGGGACAU69.2861818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344426ACCAGTCAACAGGGGACATATGTCCCCTGTTGACTGGT0.476900.006300.698300.750000.951100.75000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320CUGGAUUACAUCAAAGCAC67.9653859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417338CTGGATTACATCAAAGCACGTGCTTTGATGTAATCCAG0.077200.018600.491400.500000.972800.62500


Target Position: 475, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475CUUGAUUGUGGAAGAUAUA90.4922101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478493CTTGATTGTGGAAGATATATATATCTTCCACAATCAAG0.058400.001000.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
473-495GTCTTGATTGTGGAAGATATAATUAUAUCUUCCACAAUCAAGACCUUGAUUGUGGAAGAUAUAAUU6.613.813


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AUUGACAUCGCCAGUAAAA78.0448477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408801ATTGACATCGCCAGTAAAATTTTACTGGCGATGTCAAT0.184200.010900.508600.500000.934800.75000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491AUAAUUGACACUGGCAAAA72.2316692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361509ATAATTGACACTGGCAAAATTTTGCCAGTGTCAATTAT0.063600.006200.543100.500001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836GUAGAGCUUUUUGCAUGUA86.4934186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475854GTAGAGCTTTTTGCATGTATACATGCAAAAAGCTCTAC0.180900.001000.500000.750000.978301.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110AGUGAUUGAAUAUUGUUAA90.0113107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551128AGTGATTGAATATTGTTAATTAACAATATTCAATCACT0.052400.024800.672400.750001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072UUGGUAUUUUAAUUUUUAU74.0543629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291090TTGGTATTTTAATTTTTATATAAAAATTAAAATACCAA0.189400.015100.603400.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048AGAGAAGAUAUAUUAGUUU86.4485187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191066AGAGAAGATATATTAGTTTAAACTAATATATCTTCTCT0.024100.012400.724100.750001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GGCAGUAUAAUCCAAAGAU88.3512145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105555GGCAGTATAATCCAAAGATATCTTTGGATTATACTGCC0.263400.130000.819001.000001.000001.00000


Target Position: 1180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180GACAGCAUCUAAGAAGUUU83.1419296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301198GACAGCATCTAAGAAGTTTAAACTTCTTAGATGCTGTC0.221800.002100.819000.750001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844UUUUGCAUGUAUCUUCUAA80.4423390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468862TTTTGCATGTATCTTCTAATTAGAAGATACATGCAAAA0.102500.029400.465500.500001.000001.00000


Target Position: 662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662CUUGACUAUAAUGAAUACU71.688714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
660-682CCCTTGACTATAATGAATACTTCAGUAUUCAUUAUAGUCAAGGGCUUGACUAUAAUGAAUACUUCU16.120.323


Target Position: 294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
294GGGGCUAUAAAUUCUUUGC64.8589962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402312GGGGCTATAAATTCTTTGCGCAAAGAATTTATAGCCCC0.121400.003100.637900.500001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365CCUAUGACUGUAGAUUUUA87.5852164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345383CCTATGACTGTAGATTTTATAAAATCTACAGTCATAGG0.356100.006300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
363-385TTCCTATGACTGTAGATTTTATCUAAAAUCUACAGUCAUAGGAACCUAUGACUGUAGAUUUUAUCU5.320.322


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207CCUGGAAUUAUUUUAGUAG76.8416522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471225CCTGGAATTATTTTAGTAGCTACTAAAATAATTCCAGG0.185800.006300.672400.750001.000001.00000


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570GCUUGCUGGUGAAAAGGAC71.3397734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449588GCTTGCTGGTGAAAAGGACGTCCTTTTCACCAGCAAGC0.181400.001600.534500.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780CCUAUUGACAUCGCCAGUA80.9522373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281798CCTATTGACATCGCCAGTATACTGGCGATGTCAATAGG0.122200.011400.663801.000000.934800.87500


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053AGAUAUAUUAGUUUUUUAA95.633439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161071AGATATATTAGTTTTTTAATTAAAAAACTAATATATCT0.025000.003200.689700.750001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455ACUUUAACUGGAAAGAAUG68.9597832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379473ACTTTAACTGGAAAGAATGCATTCTTTCCAGTTAAAGT0.065500.014900.551700.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211GAAUUAUUUUAGUAGUGUU97.112527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381229GAATTATTTTAGTAGTGTTAACACTACTAAAATAATTC0.086600.022600.525900.750001.000001.00000


Target Position: 315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315ACCUGCUGGAUUACAUCAA78.6222457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176333ACCTGCTGGATTACATCAATTGATGTAATCCAGCAGGT0.173700.036400.706900.750001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055AUAUAUUAGUUUUUUAAUU80.1799399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031073ATATATTAGTTTTTTAATTAATTAAAAAACTAATATAT0.038000.003100.534500.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137GACCUUGAUUUAUUUUGCA89.6808111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467155GACCTTGATTTATTTTGCATGCAAAATAAATCAAGGTC0.075900.017300.465500.500001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904AUUCCUAAACUGUUUAUUU78.6719455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355922ATTCCTAAACTGTTTATTTAAATAAACAGTTTAGGAAT0.095800.011500.508600.500001.000001.00000


Target Position: 358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358AUCCAUUCCUAUGACUGUA81.1969364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459376ATCCATTCCTATGACTGTATACAGTCATAGGAATGGAT0.014800.010000.500000.500001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795AGUAAAAUUAUCAAUGUUC70.8976750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333813AGTAAAATTATCAATGTTCGAACATTGATAATTTTACT0.558900.121400.534500.500001.000001.00000


Target Position: 1041, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041GAAAUAAAGAGAAGAUAUA99.347715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951059GAAATAAAGAGAAGATATATATATCTTCTCTTTATTTC0.087300.074100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1039-1061AAGAAATAAAGAGAAGATATATTUAUAUCUUCUCUUUAUUUCUUGAAAUAAAGAGAAGAUAUAUUU6.6-9.722


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084UUUUUAUAUAUGCAGGAAA76.214546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001102TTTTTATATATGCAGGAAATTTCCTGCATATATAAAAA0.479100.132900.500000.500001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452UCAACUUUAACUGGAAAGA65.3101953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385470TCAACTTTAACTGGAAAGATCTTTCCAGTTAAAGTTGA0.106800.029400.500000.500001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555UGGUCAAGGUCGCAAGCUU77.5709491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477573TGGTCAAGGTCGCAAGCTTAAGCTTGCGACCTTGACCA0.014200.001000.706900.750001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161AGUCAAUUUUCACAUCAAA93.496755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771179AGTCAATTTTCACATCAAATTTGATGTGAAAATTGACT0.653900.109900.706900.750001.000001.00000


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064UUUUUUAAUUGGUAUUUUA81.901345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661082TTTTTTAATTGGTATTTTATAAAATACCAATTAAAAAA0.038000.012300.465500.500001.000001.00000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GACCAGUCAACAGGGGACA76.0347551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369425GACCAGTCAACAGGGGACATGTCCCCTGTTGACTGGTC0.478300.004800.612100.500000.951100.75000


Target Position: 1172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172ACAUCAAAGACAGCAUCUA85.4448217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281190ACATCAAAGACAGCATCTATAGATGCTGTCTTTGATGT0.030800.002200.534500.750001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CAAAUCAAUAAAUUCCCAA87.3541169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821325CAAATCAATAAATTCCCAATTGGGAATTTATTGATTTG0.924800.633300.500000.750000.989100.62500


Target Position: 229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
229UCUUGCUCGAGAUGUGAUG57.03761157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339247TCTTGCTCGAGATGTGATGCATCACATCTCGAGCAAGA0.142700.006600.569000.500001.000001.00000


Target Position: 972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
972AACUUGUAAAUGAAAAAAU77.4059498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381990AACTTGTAAATGAAAAAATATTTTTTCATTTACAAGTT0.269900.208500.637900.500001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321UGGAUUACAUCAAAGCACU74.4265613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409339TGGATTACATCAAAGCACTAGTGCTTTGATGTAATCCA0.103200.025500.637900.500000.972800.75000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327ACAUCAAAGCACUGAAUAG79.4762419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315345ACATCAAAGCACTGAATAGCTATTCAGTGCTTTGATGT0.254200.052600.534500.500000.956500.87500


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484GGAAGAUAUAAUUGACACU90.0656105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356502GGAAGATATAATTGACACTAGTGTCAATTATATCTTCC0.051300.022100.663800.750001.000001.00000


Target Position: 1135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1135CACCGUGUGUUAGAAAAGU75.3866576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741153CACCGTGTGTTAGAAAAGTACTTTTCTAACACACGGTG0.283300.059400.586200.500001.000001.00000


Target Position: 1015, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GUGAAACAUUGAACUCAUA95.896337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1013-1035GAGTGAAACATTGAACTCATATCUAUGAGUUCAAUGUUUCACUCGUGAAACAUUGAACUCAUAUCU19.220.523


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816GUUCUGUGGCCAUCUGCUU76.5667534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470834GTTCTGTGGCCATCTGCTTAAGCAGATGGCCACAGAAC0.058500.001100.508600.750000.994600.75000


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299UUUAAAUGCAAAUCAAUAA78.1063473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771317TTTAAATGCAAATCAATAATTATTGATTTGCATTTAAA0.609500.258700.465500.500001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786GACAUCGCCAGUAAAAUUA85.5392212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159804GACATCGCCAGTAAAATTATAATTTTACTGGCGATGTC0.352300.089300.784500.750001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979AAAUGAAAAAAUUCUCUUA91.099891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479997AAATGAAAAAATTCTCTTATAAGAGAATTTTTTCATTT0.253400.158500.465500.500000.962000.87500


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862AGAAUUUUAUCUGUUUUGU70.7542759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357880AGAATTTTATCTGTTTTGTACAAAACAGATAAAATTCT0.306500.219600.517200.500000.994600.62500


Target Position: 9, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9CGCCUCCGCCUCCUCCUCU65.5732946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39727CGCCTCCGCCTCCTCCTCTAGAGGAGGAGGCGGAGGCG0.033100.003200.698300.750000.902200.75000


Target Position: 18, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18CUCCUCCUCUGCUCCGCCA72.65678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46436CTCCTCCTCTGCTCCGCCATGGCGGAGCAGAGGAGGAG0.018500.002200.465500.500001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CAGUCAAUUUUCACAUCAA103.4675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911178CAGTCAATTTTCACATCAATTGATGTGAAAATTGACTG0.612300.091800.637900.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284UGUCAGCAGUUCCCUUUUA80.9125374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231302TGTCAGCAGTTCCCTTTTATAAAAGGGAACTGCTGACA0.734000.051400.672400.750001.000001.00000


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175GGAUUUGGAAAGGGUGUUU75.8512561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197193GGATTTGGAAAGGGTGTTTAAACACCCTTTCCAAATCC0.158300.142600.870701.000001.000001.00000


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552AGAUGGUCAAGGUCGCAAG71.3769731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
472570AGATGGTCAAGGTCGCAAGCTTGCGACCTTGACCATCT0.050800.001100.586200.500001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GCAUUCCUAAACUGUUUAU81.2733361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212920GCATTCCTAAACTGTTTATATAAACAGTTTAGGAATGC0.149200.036900.810301.000001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970UUAACUUGUAAAUGAAAAA77.1001511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413988TTAACTTGTAAATGAAAAATTTTTCATTTACAAGTTAA0.276300.176400.534500.500001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900CUGCAUUCCUAAACUGUUU78.9605440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374918CTGCATTCCTAAACTGTTTAAACAGTTTAGGAATGCAG0.048400.004500.784500.750001.000001.00000


Target Position: 1103, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103GAAUAGAAGUGAUUGAAUA105.172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171121GAATAGAAGTGATTGAATATATTCAATCACTTCTATTC0.154900.027000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1101-1123AAGAATAGAAGTGATTGAATATTUAUUCAAUCACUUCUAUUCUUGAAUAGAAGUGAUUGAAUAUUU7.26.912


Target Position: 1065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1065UUUUUAAUUGGUAUUUUAA79.3662423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721083TTTTTAATTGGTATTTTAATTAAAATACCAATTAAAAA0.024600.010300.465500.500001.000001.00000


Target Position: 1291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291AGUUCCCUUUUAAAUGCAA82.9584304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841309AGTTCCCTTTTAAATGCAATTGCATTTAAAAGGGAACT0.241400.102400.560300.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GAGAAGAUAUAUUAGUUUU94.464246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341067GAGAAGATATATTAGTTTTAAAACTAATATATCTTCTC0.019600.008500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1047-1069AAGAGAAGATATATTAGTTTTTTAAAACUAAUAUAUCUUCUCUUGAGAAGAUAUAUUAGUUUUUUU4.919.122


Target Position: 236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236CGAGAUGUGAUGAAGGAGA87.223173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325254CGAGATGTGATGAAGGAGATCTCCTTCATCACATCTCG0.068500.012000.569000.750001.000001.00000


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183AGCAUCUAAGAAGUUUUGU62.92151025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141201AGCATCTAAGAAGTTTTGTACAAAACTTCTTAGATGCT0.126100.023300.646600.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GUUGAGUUUGGAAACAUCU77.8742481

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
754-776AAGTTGAGTTTGGAAACATCTGGAGAUGUUUCCAAACUCAACUUGUUGAGUUUGGAAACAUCUGGU14.819.232


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109AAGUGAUUGAAUAUUGUUA90.6698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441127AAGTGATTGAATATTGTTATAACAATATTCAATCACTT0.061500.011600.603400.500001.000001.00000


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218UUUAGUAGUGUUUCAGUAA81.4063357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631236TTTAGTAGTGTTTCAGTAATTACTGAAACACTACTAAA0.014400.004900.465500.500001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880UACUUUAGAAAUGUCAGUU70.5376770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371898TACTTTAGAAATGTCAGTTAACTGACATTTCTAAAGTA0.043100.009700.534500.500001.000001.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671AAUGAAUACUUCAGGGAUU80.6834384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407689AATGAATACTTCAGGGATTAATCCCTGAAGTATTCATT0.029600.003200.500000.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050AGAAGAUAUAUUAGUUUUU82.7067314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461068AGAAGATATATTAGTTTTTAAAAACTAATATATCTTCT0.017200.005400.724100.750001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104AAUAGAAGUGAUUGAAUAU89.4467116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611122AATAGAAGTGATTGAATATATATTCAATCACTTCTATT0.136700.023400.465500.500001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417CAGGGGACAUAAAAGUAAU90.1891103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139435CAGGGGACATAAAAGTAATATTACTTTTATGTCCCCTG0.205200.088800.775900.750001.000001.00000


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116UGAAUAUUGUUAAUUAUAC72.7504673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551134TGAATATTGTTAATTATACGTATAATTAACAATATTCA0.016600.006800.543100.500001.000001.00000


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109CGUGAUUAGUGAUGAUGAA100.4499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464127CGTGATTAGTGATGATGAATTCATCATCACTAATCACG0.017000.001300.603401.000001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461ACUGGAAAGAAUGUCUUGA76.7177528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460479ACTGGAAAGAATGTCTTGATCAAGACATTCTTTCCAGT0.014700.012100.482800.500001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282UUUGUCAGCAGUUCCCUUU59.97011094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811300TTTGTCAGCAGTTCCCTTTAAAGGGAACTGCTGACAAA0.510100.036200.500000.500001.000001.00000


Target Position: 1008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008CUAUUGAGUGAAACAUUGA88.1834147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1006-1028CACTATTGAGTGAAACATTGAACUCAAUGUUUCACUCAAUAGUGCUAUUGAGUGAAACAUUGAACU12.113.432


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653GGAUAUGCCCUUGACUAUA93.959750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423671GGATATGCCCTTGACTATATATAGTCAAGGGCATATCC0.041600.002300.827601.000000.994601.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233GCUCGAGAUGUGAUGAAGG72.7596672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357251GCTCGAGATGTGATGAAGGCCTTCATCACATCTCGAGC0.251100.025100.508600.500001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225GUGUUUCAGUAAUGUUGAC74.3465619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501243GTGTTTCAGTAATGTTGACGTCAACATTACTGAAACAC0.180500.002600.474100.500001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901UGCAUUCCUAAACUGUUUA74.7909599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343919TGCATTCCTAAACTGTTTATAAACAGTTTAGGAATGCA0.079900.006300.819000.750001.000001.00000


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114AUUGAAUAUUGUUAAUUAU85.0947230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691132ATTGAATATTGTTAATTATATAATTAACAATATTCAAT0.013200.006600.465500.500001.000001.00000


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140UGUGUUAGAAAAGUAAGAA82.0787334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081158TGTGTTAGAAAAGTAAGAATTCTTACTTTTCTAACACA0.149000.036200.534500.750001.000001.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659GCCCUUGACUAUAAUGAAU86.1753195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434677GCCCTTGACTATAATGAATATTCATTATAGTCAAGGGC0.173700.002100.991401.000001.000001.00000


Target Position: 796, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796GUAAAAUUAUCAAUGUUCU84.0608269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
794-816CAGTAAAATTATCAATGTTCTAGAGAACAUUGAUAAUUUUACUGGUAAAAUUAUCAAUGUUCUAGU14.8-9.722


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067UUUAAUUGGUAUUUUAAUU70.1295794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161085TTTAATTGGTATTTTAATTAATTAAAATACCAATTAAA0.046300.009700.491400.500001.000001.00000


Target Position: 1292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292GUUCCCUUUUAAAUGCAAA85.1749222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1721310GTTCCCTTTTAAATGCAAATTTGCATTTAAAAGGGAAC0.242800.201800.646600.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GCUGCAUUCCUAAACUGUU85.103229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376917GCTGCATTCCTAAACTGTTAACAGTTTAGGAATGCAGC0.040000.004300.706901.000001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654GAUAUGCCCUUGACUAUAA98.901918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466672GATATGCCCTTGACTATAATTATAGTCAAGGGCATATC0.026500.001200.646600.750000.994601.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419GGGGACAUAAAAGUAAUUG68.1919851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302437GGGGACATAAAAGTAATTGCAATTACTTTTATGTCCCC0.080500.039400.844800.750001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277GAAUCUUUGUCAGCAGUUC73.9634631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801295GAATCTTTGTCAGCAGTTCGAACTGCTGACAAAGATTC0.068500.038400.500000.500001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592ACGAAGUGUUGGAUAUAAG75.0105593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459610ACGAAGTGTTGGATATAAGCTTATATCCAACACTTCGT0.091000.011500.637900.500001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286UCAGCAGUUCCCUUUUAAA83.9103273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1521304TCAGCAGTTCCCTTTTAAATTTAAAAGGGAACTGCTGA0.696200.084500.724100.750001.000001.00000


Target Position: 20, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
20CCUCCUCUGCUCCGCCACC55.38141174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45238CCTCCTCTGCTCCGCCACCGGTGGCGGAGCAGAGGAGG0.027400.001600.491400.500001.000001.00000


Target Position: 495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495UUGACACUGGCAAAACAAU70.1258795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377513TTGACACTGGCAAAACAATATTGTTTTGCCAGTGTCAA0.308900.004200.637900.500001.000001.00000


Target Position: 231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231UUGCUCGAGAUGUGAUGAA72.5402682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451249TTGCTCGAGATGTGATGAATTCATCACATCTCGAGCAA0.186900.018100.474100.500001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679CUUCAGGGAUUUGAAUCAU78.0193478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438697CTTCAGGGATTTGAATCATATGATTCAAATCCCTGAAG0.215600.016300.482800.750000.956500.62500


Target Position: 328, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328CAUCAAAGCACUGAAUAGA87.5546166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
326-348TACATCAAAGCACTGAATAGAAAUCUAUUCAGUGCUUUGAUGUACAUCAAAGCACUGAAUAGAAAU13.412.022


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149AAAGUAAGAAGCAGUCAAU84.1434264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701167AAAGTAAGAAGCAGTCAATATTGACTGCTTCTTACTTT0.116300.059100.491400.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718UGGAAAAGCAAAAUACAAA84.6098241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101736TGGAAAAGCAAAATACAAATTTGTATTTTGCTTTTCCA0.460500.177200.844800.750001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533GUCAGGCAGUAUAAUCCAA93.150258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163551GTCAGGCAGTATAATCCAATTGGATTATACTGCCTGAC0.422700.038200.672400.750001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047AAGAGAAGAUAUAUUAGUU92.659464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781065AAGAGAAGATATATTAGTTAACTAATATATCTTCTCTT0.022500.016300.491400.500001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962AUUGUUGUUUAACUUGUAA82.4827323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447980ATTGTTGTTTAACTTGTAATTACAAGTTAAACAACAAT0.309100.005900.474100.500001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739CUAAGAUGAGAGUUCAAGU84.6079242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470757CTAAGATGAGAGTTCAAGTACTTGAACTCTCATCTTAG0.016100.013200.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
737-759GCCTAAGATGAGAGTTCAAGTTGACUUGAACUCUCAUCUUAGGCCUAAGAUGAGAGUUCAAGUUGU19.213.431


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232UGCUCGAGAUGUGAUGAAG69.4437814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432250TGCTCGAGATGTGATGAAGCTTCATCACATCTCGAGCA0.187100.020700.715500.500001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509ACAAUGCAGACUUUGCUUU70.297783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417527ACAATGCAGACTTTGCTTTAAAGCAAAGTCTGCATTGT0.037200.002500.706900.750000.902200.87500


Target Position: 1098, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GGAAAGAAUAGAAGUGAUU86.1598196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431116GGAAAGAATAGAAGTGATTAATCACTTCTATTCTTTCC0.060400.038700.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118CAGGAAAGAATAGAAGTGATTGAAAUCACUUCUAUUCUUUCCUGGGAAAGAAUAGAAGUGAUUGAU19.214.822


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790UCGCCAGUAAAAUUAUCAA81.4724356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166808TCGCCAGTAAAATTATCAATTGATAATTTTACTGGCGA0.393700.093800.646600.750001.000001.00000


Target Position: 1302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302AAAUGCAAAUCAAUAAAUU81.6835352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181320AAATGCAAATCAATAAATTAATTTATTGATTTGCATTT0.708100.299700.491400.500001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102AGAAUAGAAGUGAUUGAAU86.1192197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411120AGAATAGAAGTGATTGAATATTCAATCACTTCTATTCT0.129800.028200.715500.750001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111GUGAUUGAAUAUUGUUAAU85.554210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661129GTGATTGAATATTGTTAATATTAACAATATTCAATCAC0.047300.026300.784500.750001.000001.00000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850AUGUAUCUUCUAAGAAUUU77.1996503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307868ATGTATCTTCTAAGAATTTAAATTCTTAGAAGATACAT0.107100.065400.655200.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313AAUAAAUUCCCAAAAAUUU76.6047531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531331AATAAATTCCCAAAAATTTAAATTTTTGGGAATTTATT0.861300.814000.508600.500001.000001.00000


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360CCAUUCCUAUGACUGUAGA84.9219233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458378CCATTCCTATGACTGTAGATCTACAGTCATAGGAATGG0.015000.005700.620700.750001.000001.00000


Target Position: 569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
569AGCUUGCUGGUGAAAAGGA77.1214510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467587AGCTTGCTGGTGAAAAGGATCCTTTTCACCAGCAAGCT0.085500.001200.482800.500001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179AGACAGCAUCUAAGAAGUU82.579316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651197AGACAGCATCTAAGAAGTTAACTTCTTAGATGCTGTCT0.228600.001200.577600.750001.000001.00000


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418AGGGGACAUAAAAGUAAUU78.7656453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207436AGGGGACATAAAAGTAATTAATTACTTTTATGTCCCCT0.151300.080300.836200.750001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847UGCAUGUAUCUUCUAAGAA83.8235275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288865TGCATGTATCTTCTAAGAATTCTTAGAAGATACATGCA0.092800.057300.681000.750001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895AGUUGCUGCAUUCCUAAAC61.40671065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319913AGTTGCTGCATTCCTAAACGTTTAGGAATGCAGCAACT0.173200.020900.560300.500001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281CUUUGUCAGCAGUUCCCUU81.3718358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861299CTTTGTCAGCAGTTCCCTTAAGGGAACTGCTGACAAAG0.458600.037200.500000.750001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GCAGGAAAGAAUAGAAGUG76.676529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441113GCAGGAAAGAATAGAAGTGCACTTCTATTCTTTCCTGC0.060200.046700.560300.750001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017GAAACAUUGAACUCAUAUC80.3164396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211035GAAACATTGAACTCATATCGATATGAGTTCAATGTTTC0.049200.024100.491400.500001.000001.00000


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969UUUAACUUGUAAAUGAAAA73.7003639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393987TTTAACTTGTAAATGAAAATTTTCATTTACAAGTTAAA0.274600.094600.500000.500001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GUUUUUUAAUUGGUAUUUU77.7424488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941081GTTTTTTAATTGGTATTTTAAAATACCAATTAAAAAAC0.032600.010700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1061-1083TAGTTTTTTAATTGGTATTTTAAAAAAUACCAAUUAAAAAACUAGUUUUUUAAUUGGUAUUUUAAU13.9-9.122


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039AAGAAAUAAAGAGAAGAUA84.6231240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851057AAGAAATAAAGAGAAGATATATCTTCTCTTTATTTCTT0.133000.121200.594800.500001.000001.00000


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388ACUGAAGAGCUAUUGUAAU81.9747338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235406ACTGAAGAGCTATTGTAATATTACAATAGCTCTTCAGT0.177600.019800.698300.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384UCAGACUGAAGAGCUAUUG55.14121178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465402TCAGACTGAAGAGCTATTGCAATAGCTCTTCAGTCTGA0.143400.023500.577600.500001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513UGCAGACUUUGCUUUCCUU77.8639482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425531TGCAGACTTTGCTTTCCTTAAGGAAAGCAAAGTCTGCA0.064700.002200.715500.750000.902200.62500


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300UUAAAUGCAAAUCAAUAAA73.5984646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111318TTAAATGCAAATCAATAAATTTATTGATTTGCATTTAA0.662700.269100.534500.500001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974CUUGUAAAUGAAAAAAUUC70.3123782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465992CTTGTAAATGAAAAAATTCGAATTTTTTCATTTACAAG0.338600.196900.465500.500000.967400.62500


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108UCGUGAUUAGUGAUGAUGA82.93305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461126TCGTGATTAGTGATGATGATCATCATCACTAATCACGA0.062600.001300.569000.500001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370GACUGUAGAUUUUAUCAGA99.751913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463388GACTGTAGATTTTATCAGATCTGATAAAATCTACAGTC0.097400.001300.594800.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991UCUCUUAAACCACAGCACU68.0162855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461009TCTCTTAAACCACAGCACTAGTGCTGTGGTTTAAGAGA0.192800.070900.517200.500000.989100.75000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GUCAGCAGUUCCCUUUUAA88.1184150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301303GTCAGCAGTTCCCTTTTAATTAAAAGGGAACTGCTGAC0.690400.052100.784500.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GUCAUUAGUGAAACUGGAA89.0851129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
214722GTCATTAGTGAAACTGGAATTCCAGTTTCACTAATGAC0.148300.024600.646600.750001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204GACUAAUUAUGGACAGGAC83.6055282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478222GACTAATTATGGACAGGACGTCCTGTCCATAATTAGTC0.011900.008000.500000.500001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294UCCCUUUUAAAUGCAAAUC45.99141273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621312TCCCTTTTAAATGCAAATCGATTTGCATTTAAAAGGGA0.248100.220500.689700.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793CCAGUAAAAUUAUCAAUGU84.1448263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207811CCAGTAAAATTATCAATGTACATTGATAATTTTACTGG0.226300.083300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
791-813CGCCAGTAAAATTATCAATGTTCACAUUGAUAAUUUUACUGGCGCCAGUAAAAUUAUCAAUGUUCU13.611.822


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858UCUAAGAAUUUUAUCUGUU75.359578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
260876TCTAAGAATTTTATCTGTTAACAGATAAAATTCTTAGA0.311800.072600.577600.750000.978300.87500


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691GAAUCAUGUUUGUGUCAUU97.481523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399709GAATCATGTTTGTGTCATTAATGACACAAACATGATTC0.032100.004200.663800.750001.000001.00000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692AAUCAUGUUUGUGUCAUUA87.6163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445710AATCATGTTTGTGTCATTATAATGACACAAACATGATT0.035300.003600.474100.500001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GGCGGAUUGUUGUUUAACU85.7919205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442975GGCGGATTGTTGTTTAACTAGTTAAACAACAATCCGCC0.084600.001900.793100.750001.000001.00000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177AUUUGGAAAGGGUGUUUAU76.0086553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473195ATTTGGAAAGGGTGTTTATATAAACACCCTTTCCAAAT0.142400.143200.465500.500001.000001.00000


Target Position: 840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
840AGCUUUUUGCAUGUAUCUU73.2736659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167858AGCTTTTTGCATGTATCTTAAGATACATGCAAAAAGCT0.203500.036600.715500.750000.978300.75000


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110GUGAUUAGUGAUGAUGAAC70.5124771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475128GTGATTAGTGATGATGAACGTTCATCATCACTAATCAC0.014000.001100.646600.500001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301UAAAUGCAAAUCAAUAAAU73.6792641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941319TAAATGCAAATCAATAAATATTTATTGATTTGCATTTA0.687000.286900.525900.500001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482GUGGAAGAUAUAAUUGACA87.7362159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426500GTGGAAGATATAATTGACATGTCAATTATATCTTCCAC0.167200.033700.586200.500001.000001.00000


Target Position: 357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
357GAUCCAUUCCUAUGACUGU86.5491184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463375GATCCATTCCTATGACTGTACAGTCATAGGAATGGATC0.014400.005800.474100.500001.000001.00000


Target Position: 237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237GAGAUGUGAUGAAGGAGAU91.455581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310255GAGATGTGATGAAGGAGATATCTCCTTCATCACATCTC0.301300.008500.629300.750001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678ACUUCAGGGAUUUGAAUCA80.8316377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437696ACTTCAGGGATTTGAATCATGATTCAAATCCCTGAAGT0.258800.015400.482800.500000.956500.62500


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535CAGGCAGUAUAAUCCAAAG81.7188350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463553CAGGCAGTATAATCCAAAGCTTTGGATTATACTGCCTG0.374800.232400.646600.500001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021CAUUGAACUCAUAUCUGUA104.7593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491039CATTGAACTCATATCTGTATACAGATATGAGTTCAATG0.131200.035400.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1019-1041AACATTGAACTCATATCTGTAAGUACAGAUAUGAGUUCAAUGUUCAUUGAACUCAUAUCUGUAAGU20.314.832


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UAUCAGACUGAAGAGCUAU76.7747526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435400TATCAGACTGAAGAGCTATATAGCTCTTCAGTCTGATA0.152200.024300.500000.500001.000001.00000


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725GCAAAAUACAAAGCCUAAG67.8817864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197743GCAAAATACAAAGCCTAAGCTTAGGCTTTGTATTTTGC0.180800.079400.715500.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258UGUUCAAAUUAUUACCAGU80.1654400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911276TGTTCAAATTATTACCAGTACTGGTAATAATTTGAACA0.106100.040500.500000.500001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248UUUUCCAACUUGUUCAAAU70.8919751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221266TTTTCCAACTTGTTCAAATATTTGAACAAGTTGGAAAA0.224600.153800.491400.500001.000001.00000


Target Position: 924, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924CACUAUGAGCCUAUAGACU85.1373225

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
922-944TGCACTATGAGCCTATAGACTATAGUCUAUAGGCUCAUAGUGCACACUAUGAGCCUAUAGACUAUU15.820.332


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024UGAACUCAUAUCUGUAAGA81.362359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771042TGAACTCATATCTGTAAGATCTTACAGATATGAGTTCA0.152800.042900.500000.500001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698GUUUGUGUCAUUAGUGAAA88.4677143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431716GTTTGTGTCATTAGTGAAATTTCACTAATGACACAAAC0.070900.002100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
696-718ATGTTTGTGTCATTAGTGAAACTUUUCACUAAUGACACAAACAUGUUUGUGUCAUUAGUGAAACUU20.319.332


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212AAUUAUUUUAGUAGUGUUU76.2083547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451230AATTATTTTAGTAGTGTTTAAACACTACTAAAATAATT0.104700.029000.508600.500001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661CCUUGACUAUAAUGAAUAC83.8186276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275679CCTTGACTATAATGAATACGTATTCATTATAGTCAAGG0.186200.011800.663800.750001.000001.00000


Target Position: 149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
149UUUUGCAUACCUAAUCAUU69.4788812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429167TTTTGCATACCTAATCATTAATGATTAGGTATGCAAAA0.131800.009100.491400.500001.000001.00000


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329AUCAAAGCACUGAAUAGAA86.3214193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
359347ATCAAAGCACTGAATAGAATTCTATTCAGTGCTTTGAT0.286400.078100.508600.500000.956500.62500


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684GGGAUUUGAAUCAUGUUUG73.487650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368702GGGATTTGAATCATGTTTGCAAACATGATTCAAATCCC0.045600.030400.844800.750001.000001.00000


Target Position: 832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CUUAGUAGAGCUUUUUGCA83.3533289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
830-852TGCTTAGTAGAGCTTTTTGCATGUGCAAAAAGCUCUACUAAGCACUUAGUAGAGCUUUUUGCAUGU14.111.332


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CAGCAUCUAAGAAGUUUUG71.4536726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541200CAGCATCTAAGAAGTTTTGCAAAACTTCTTAGATGCTG0.108000.020600.637900.500001.000001.00000


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293UUCCCUUUUAAAUGCAAAU61.50411063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701311TTCCCTTTTAAATGCAAATATTTGCATTTAAAAGGGAA0.246900.213200.663800.500001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233GUAAUGUUGACUGUAUUUU75.0676590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331251GTAATGTTGACTGTATTTTAAAATACAGTCAACATTAC0.428600.086300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1231-1253CAGTAATGTTGACTGTATTTTCCAAAAUACAGUCAACAUUACUGGUAAUGUUGACUGUAUUUUCCU6.96.922


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810GUUCUAGUUCUGUGGCCAU83.1407297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456828GTTCTAGTTCTGTGGCCATATGGCCACAGAACTAGAAC0.018600.001500.491400.750001.000001.00000


Target Position: 1222, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1222GUAGUGUUUCAGUAAUGUU88.5263140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571240GTAGTGTTTCAGTAATGTTAACATTACTGAAACACTAC0.015300.002500.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1220-1242TAGTAGTGTTTCAGTAATGTTGAAACAUUACUGAAACACUACUAGUAGUGUUUCAGUAAUGUUGAU14.619.022


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CCAGUCAACAGGGGACAUA80.785378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289427CCAGTCAACAGGGGACATATATGTCCCCTGTTGACTGG0.490400.010800.801701.000000.967400.75000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973ACUUGUAAAUGAAAAAAUU83.1526295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
135991ACTTGTAAATGAAAAAATTAATTTTTTCATTTACAAGT0.287400.203800.698300.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CUAUUGACAUCGCCAGUAA93.412857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285799CTATTGACATCGCCAGTAATTACTGGCGATGTCAATAG0.168300.011200.637900.750000.934801.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784UUGACAUCGCCAGUAAAAU66.388916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430802TTGACATCGCCAGTAAAATATTTTACTGGCGATGTCAA0.195500.018200.637900.500000.934800.62500


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156GAAGCAGUCAAUUUUCACA94.261148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761174GAAGCAGTCAATTTTCACATGTGAAAATTGACTGCTTC0.576600.035400.465500.500001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532GGUCAGGCAGUAUAAUCCA91.783380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354550GGTCAGGCAGTATAATCCATGGATTATACTGCCTGACC0.406600.021700.508600.750001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548CCAAAGAUGGUCAAGGUCG64.4804979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473566CCAAAGATGGTCAAGGTCGCGACCTTGACCATCTTTGG0.012700.001900.551700.500000.918500.62500


Target Position: 612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612CAGACUUUGUUGGAUUUGA84.411255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
610-632GCCAGACTTTGTTGGATTTGAAAUCAAAUCCAACAAAGUCUGGCCAGACUUUGUUGGAUUUGAAAU20.117.722


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163UCAAUUUUCACAUCAAAGA71.5335721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471181TCAATTTTCACATCAAAGATCTTTGATGTGAAAATTGA0.017100.006700.500000.500001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271ACCAGUGAAUCUUUGUCAG69.161823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161289ACCAGTGAATCTTTGTCAGCTGACAAAGATTCACTGGT0.123400.063000.569000.500001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331CAAAGCACUGAAUAGAAAU85.8062204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341349CAAAGCACTGAATAGAAATATTTCTATTCAGTGCTTTG0.060600.019500.637900.750001.000001.00000


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226UGUUUCAGUAAUGUUGACU64.8641961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091244TGTTTCAGTAATGTTGACTAGTCAACATTACTGAAACA0.167700.002700.500000.500001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322GGAUUACAUCAAAGCACUG81.6176354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251340GGATTACATCAAAGCACTGCAGTGCTTTGATGTAATCC0.113800.032100.586200.750000.972800.87500


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853UAUCUUCUAAGAAUUUUAU76.8195523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368871TATCTTCTAAGAATTTTATATAAAATTCTTAGAAGATA0.331000.075600.500000.500001.000001.00000


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860UAAGAAUUUUAUCUGUUUU77.1827504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337878TAAGAATTTTATCTGTTTTAAAACAGATAAAATTCTTA0.320900.098200.534500.500000.978300.75000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242ACUGUAUUUUCCAACUUGU75.6967568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661260ACTGTATTTTCCAACTTGTACAAGTTGGAAAATACAGT0.181800.050100.500000.500001.000001.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912ACUGUUUAUUUGCACUAUG69.0121828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427930ACTGTTTATTTGCACTATGCATAGTGCAAATAAACAGT0.094900.027600.551700.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673UGAAUACUUCAGGGAUUUG63.77591001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
418691TGAATACTTCAGGGATTTGCAAATCCCTGAAGTATTCA0.044100.005300.577600.500001.000001.00000


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334AGCACUGAAUAGAAAUAGU82.0843333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433352AGCACTGAATAGAAATAGTACTATTTCTATTCAGTGCT0.059900.004200.646600.500001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529CUUGGUCAGGCAGUAUAAU77.1801505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318547CTTGGTCAGGCAGTATAATATTATACTGCCTGACCAAG0.589100.007900.629300.750001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451CUCAACUUUAACUGGAAAG61.68081058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422469CTCAACTTTAACTGGAAAGCTTTCCAGTTAAAGTTGAG0.098500.025600.672400.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412GUCAACAGGGGACAUAAAA82.8847308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123430GTCAACAGGGGACATAAAATTTTATGTCCCCTGTTGAC0.363700.222000.819000.750001.000001.00000


Target Position: 628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628UGAAAUUCCAGACAAGUUU70.1966787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404646TGAAATTCCAGACAAGTTTAAACTTGTCTGGAATTTCA0.035400.003100.724100.750001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364UCCUAUGACUGUAGAUUUU75.9512555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356382TCCTATGACTGTAGATTTTAAAATCTACAGTCATAGGA0.083400.005700.870700.750001.000001.00000


Target Position: 1184, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GCAUCUAAGAAGUUUUGUU87.9337156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831202GCATCTAAGAAGTTTTGTTAACAAAACTTCTTAGATGC0.095300.023800.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1182-1204CAGCATCTAAGAAGTTTTGTTCTAACAAAACUUCUUAGAUGCUGGCAUCUAAGAAGUUUUGUUCUU13.313.423


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158CCUAAUCAUUAUGCUGAGG62.0211052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432176CCTAATCATTATGCTGAGGCCTCAGCATAATGATTAGG0.022700.002100.500000.500000.967400.75000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310AUCAAUAAAUUCCCAAAAA80.5723385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001328ATCAATAAATTCCCAAAAATTTTTGGGAATTTATTGAT0.929300.693500.681000.500001.000001.00000


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CGUGUGUUAGAAAAGUAAG76.2807545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271156CGTGTGTTAGAAAAGTAAGCTTACTTTTCTAACACACG0.151100.030400.637900.750001.000001.00000


Target Position: 139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139CCUUGAUUUAUUUUGCAUA90.624699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313157CCTTGATTTATTTTGCATATATGCAAAATAAATCAAGG0.076300.021700.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
137-159GACCTTGATTTATTTTGCATACCUAUGCAAAAUAAAUCAAGGUCCCUUGAUUUAUUUUGCAUACCU20.012.012


Target Position: 129, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129CAGGUUAUGACCUUGAUUU83.1324298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
127-149ACCAGGTTATGACCTTGATTTATAAAUCAAGGUCAUAACCUGGUCAGGUUAUGACCUUGAUUUAUU12.018.512


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066UUUUAAUUGGUAUUUUAAU70.4204779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251084TTTTAATTGGTATTTTAATATTAAAATACCAATTAAAA0.032500.010300.491400.500001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GGUAUUUUAAUUUUUAUAU86.4313189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221092GGTATTTTAATTTTTATATATATAAAAATTAAAATACC0.169900.023000.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1072-1094TTGGTATTTTAATTTTTATATATAUAUAAAAAUUAAAAUACCAAGGUAUUUUAAUUUUUAUAUAUU-7.5-0.311


Target Position: 603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603GAUAUAAGCCAGACUUUGU87.5234167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
601-623TGGATATAAGCCAGACTTTGTTGACAAAGUCUGGCUUAUAUCCAGAUAUAAGCCAGACUUUGUUGU19.2-2.712


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311UCAAUAAAUUCCCAAAAAU76.2808544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1561329TCAATAAATTCCCAAAAATATTTTTGGGAATTTATTGA0.914800.736100.715500.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GCAUGUAUCUUCUAAGAAU98.615320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280866GCATGTATCTTCTAAGAATATTCTTAGAAGATACATGC0.096500.061000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
846-868TTGCATGTATCTTCTAAGAATTTAUUCUUAGAAGAUACAUGCAAGCAUGUAUCUUCUAAGAAUUUU11.713.331


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755AGUUGAGUUUGGAAACAUC78.8683447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468773AGTTGAGTTTGGAAACATCGATGTTTCCAAACTCAACT0.032500.001200.525900.500000.994600.62500


Target Position: 1152, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152GUAAGAAGCAGUCAAUUUU84.5947244

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6115219GTAAGAAGCAGTCAATTTT1/1/0/094.96HPRT1NM_000194.21NANANANA00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001170GTAAGAAGCAGTCAATTTTAAAATTGACTGCTTCTTAC0.156300.042500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1150-1172AAGTAAGAAGCAGTCAATTTTCAAAAAUUGACUGCUUCUUACUUGUAAGAAGCAGUCAAUUUUCAU7.411.733


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375UAGAUUUUAUCAGACUGAA83.03302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469393TAGATTTTATCAGACTGAATTCAGTCTGATAAAATCTA0.098500.049800.500000.500001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACCACCGUGUGUUAGAAAA79.9581408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1451151ACCACCGTGTGTTAGAAAATTTTCTAACACACGGTGGT0.264000.066700.853400.750000.972800.75000


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AAGUUGAGUUUGGAAACAU80.8353376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462772AAGTTGAGTTTGGAAACATATGTTTCCAAACTCAACTT0.055300.001300.482800.500001.000001.00000


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311GCUGACCUGCUGGAUUACA79.9691406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281329GCTGACCTGCTGGATTACATGTAATCCAGCAGGTCAGC0.096300.036500.646600.750001.000001.00000


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33GCCACCGGCUUCCUCCUCC53.89141200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26651GCCACCGGCTTCCTCCTCCGGAGGAGGAAGCCGGTGGC0.395500.012700.629300.500000.918500.62500


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416ACAGGGGACAUAAAAGUAA84.42254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193434ACAGGGGACATAAAAGTAATTACTTTTATGTCCCCTGT0.241400.107500.672400.750001.000001.00000


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387GACUGAAGAGCUAUUGUAA103.2058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230405GACTGAAGAGCTATTGTAATTACAATAGCTCTTCAGTC0.169800.021000.784500.750001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536AGGCAGUAUAAUCCAAAGA78.85448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286554AGGCAGTATAATCCAAAGATCTTTGGATTATACTGCCT0.372100.238600.620700.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GCCAGUAAAAUUAUCAAUG71.9789702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147810GCCAGTAAAATTATCAATGCATTGATAATTTTACTGGC0.189500.064700.844800.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240UGACUGUAUUUUCCAACUU74.558607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531258TGACTGTATTTTCCAACTTAAGTTGGAAAATACAGTCA0.285800.046300.586200.750001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490UAUAAUUGACACUGGCAAA85.3294219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331508TATAATTGACACTGGCAAATTTGCCAGTGTCAATTATA0.070400.006900.543100.500001.000001.00000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376AGAUUUUAUCAGACUGAAG77.4304495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307394AGATTTTATCAGACTGAAGCTTCAGTCTGATAAAATCT0.078900.044400.586200.500001.000001.00000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181ACAGCAUCUAAGAAGUUUU79.8175411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011199ACAGCATCTAAGAAGTTTTAAAACTTCTTAGATGCTGT0.165400.003200.706900.750001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070AAUUGGUAUUUUAAUUUUU79.9559409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071088AATTGGTATTTTAATTTTTAAAAATTAAAATACCAATT0.159500.010700.508600.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158AGCAGUCAAUUUUCACAUC70.287785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021176AGCAGTCAATTTTCACATCGATGTGAAAATTGACTGCT0.611000.063400.672400.500001.000001.00000


Target Position: 664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664UGACUAUAAUGAAUACUUC76.5938532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460682TGACTATAATGAATACTTCGAAGTATTCATTATAGTCA0.029500.006900.551700.500001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028CUCAUAUCUGUAAGAAAUA89.8975108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021046CTCATATCTGTAAGAAATATATTTCTTACAGATATGAG0.807400.084800.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1026-1048AACTCATATCTGTAAGAAATAAAUAUUUCUUACAGAUAUGAGUUCUCAUAUCUGUAAGAAAUAAAU5.317.422


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004AGCACUAUUGAGUGAAACA88.5429139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711022AGCACTATTGAGTGAAACATGTTTCACTCAATAGTGCT0.013000.001800.646600.500000.929300.75000


Target Position: 441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441GAGAUGAUCUCUCAACUUU91.343683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
439-461TGGAGATGATCTCTCAACTTTAAAAAGUUGAGAGAUCAUCUCCAGAGAUGAUCUCUCAACUUUAAU19.220.423


Target Position: 1060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060UUAGUUUUUUAAUUGGUAU71.664716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201078TTAGTTTTTTAATTGGTATATACCAATTAAAAAACTAA0.047700.005000.491400.500001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027ACUCAUAUCUGUAAGAAAU86.669180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921045ACTCATATCTGTAAGAAATATTTCTTACAGATATGAGT0.420100.056500.698300.750001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389CUGAAGAGCUAUUGUAAUG76.0978550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363407CTGAAGAGCTATTGTAATGCATTACAATAGCTCTTCAG0.176500.118900.629300.500001.000001.00000


Target Position: 38, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
38CGGCUUCCUCCUCCUGAGC54.76071184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42956CGGCTTCCTCCTCCTGAGCGCTCAGGAGGAGGAAGCCG0.021200.002500.560300.500000.913000.62500


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069UAAUUGGUAUUUUAAUUUU76.8059524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131087TAATTGGTATTTTAATTTTAAAATTAAAATACCAATTA0.132100.010000.534500.500001.000001.00000


Target Position: 567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
567CAAGCUUGCUGGUGAAAAG79.9688407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422585CAAGCTTGCTGGTGAAAAGCTTTTCACCAGCAAGCTTG0.031900.002300.508600.500001.000001.00000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152UGCAUACCUAAUCAUUAUG63.69721005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347170TGCATACCTAATCATTATGCATAATGATTAGGTATGCA0.077900.007700.698300.500001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868UUAUCUGUUUUGUACUUUA86.1032198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443886TTATCTGTTTTGTACTTTATAAAGTACAAAACAGATAA0.047600.024700.500000.500001.000001.00000


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314GACCUGCUGGAUUACAUCA90.1042104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261332GACCTGCTGGATTACATCATGATGTAATCCAGCAGGTC0.164800.036200.594800.500001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CAAGUUUGUUGUAGGAUAU89.3935119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473658CAAGTTTGTTGTAGGATATATATCCTACAACAAACTTG0.095000.001100.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
638-660GACAAGTTTGTTGTAGGATATGCAUAUCCUACAACAAACUUGUCCAAGUUUGUUGUAGGAUAUGCU21.010.323


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445UGAUCUCUCAACUUUAACU78.4087461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344463TGATCTCTCAACTTTAACTAGTTAAAGTTGAGAGATCA0.131800.014300.517200.500001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308AAAUCAAUAAAUUCCCAAA89.3754121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721326AAATCAATAAATTCCCAAATTTGGGAATTTATTGATTT0.933000.673300.500000.500001.000001.00000


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136ACCGUGUGUUAGAAAAGUA88.8624134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661154ACCGTGTGTTAGAAAAGTATACTTTTCTAACACACGGT0.333400.059400.672400.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GAAGUGAUUGAAUAUUGUU90.669997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3461126GAAGTGATTGAATATTGTTAACAATATTCAATCACTTC0.059000.012000.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1106-1128TAGAAGTGATTGAATATTGTTAAAACAAUAUUCAAUCACUUCUAGAAGUGAUUGAAUAUUGUUAAU6.719.223


Target Position: 336, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336CACUGAAUAGAAAUAGUGA96.258533

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
334-356AGCACTGAATAGAAATAGTGATAUCACUAUUUCUAUUCAGUGCUCACUGAAUAGAAAUAGUGAUAU11.619.223


Target Position: 794, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794CAGUAAAAUUAUCAAUGUU92.96361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189812CAGTAAAATTATCAATGTTAACATTGATAATTTTACTG0.567900.123700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
792-814GCCAGTAAAATTATCAATGTTCTAACAUUGAUAAUUUUACUGGCCAGUAAAAUUAUCAAUGUUCUU20.54.922


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GUACUUUAGAAAUGUCAGU75.8752559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459897GTACTTTAGAAATGTCAGTACTGACATTTCTAAAGTAC0.049600.003600.474100.500001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105AUAGAAGUGAUUGAAUAUU72.7251674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371123ATAGAAGTGATTGAATATTAATATTCAATCACTTCTAT0.135700.021900.534500.500001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453CAACUUUAACUGGAAAGAA91.201387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460471CAACTTTAACTGGAAAGAATTCTTTCCAGTTAAAGTTG0.149500.021500.474100.750001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317CUGCUGGAUUACAUCAAAG76.5682533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366335CTGCTGGATTACATCAAAGCTTTGATGTAATCCAGCAG0.122400.005800.646600.500001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GAAAGAAUAGAAGUGAUUG79.1058436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851117GAAAGAATAGAAGTGATTGCAATCACTTCTATTCTTTC0.063000.036600.525900.500001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208CUGGAAUUAUUUUAGUAGU79.1497434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581226CTGGAATTATTTTAGTAGTACTACTAAAATAATTCCAG0.190100.007000.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1206-1228TCCTGGAATTATTTTAGTAGTGTACUACUAAAAUAAUUCCAGGACUGGAAUUAUUUUAGUAGUGUU11.320.122


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203CUGUCCUGGAAUUAUUUUA84.2935258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541221CTGTCCTGGAATTATTTTATAAAATAATTCCAGGACAG0.053600.007300.750000.750001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295GGGCUAUAAAUUCUUUGCU77.668489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394313GGGCTATAAATTCTTTGCTAGCAAAGAATTTATAGCCC0.107700.003500.637900.750001.000001.00000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071AUUGGUAUUUUAAUUUUUA85.1932221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561089ATTGGTATTTTAATTTTTATAAAAATTAAAATACCAAT0.189400.011300.474100.500001.000001.00000


Target Position: 1243, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243CUGUAUUUUCCAACUUGUU78.4625459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021261CTGTATTTTCCAACTTGTTAACAAGTTGGAAAATACAG0.167600.069200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1241-1263GACTGTATTTTCCAACTTGTTCAAACAAGUUGGAAAAUACAGUCCUGUAUUUUCCAACUUGUUCAU17.86.922


Target Position: 1252, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CCAACUUGUUCAAAUUAUU85.1054228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1411270CCAACTTGTTCAAATTATTAATAATTTGAACAAGTTGG0.197500.062100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1250-1272TTCCAACTTGTTCAAATTATTACAAUAAUUUGAACAAGUUGGAACCAACUUGUUCAAAUUAUUACU-10.316.722


Target Position: 852, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852GUAUCUUCUAAGAAUUUUA95.946136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232870GTATCTTCTAAGAATTTTATAAAATTCTTAGAAGATAC0.133300.071800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
850-872ATGTATCTTCTAAGAATTTTATCUAAAAUUCUUAGAAGAUACAUGUAUCUUCUAAGAAUUUUAUCU0.416.022


Target Position: 1030, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CAUAUCUGUAAGAAAUAAA94.589943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121048CATATCTGTAAGAAATAAATTTATTTCTTACAGATATG0.685400.102000.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1028-1050CTCATATCTGTAAGAAATAAAGAUUUAUUUCUUACAGAUAUGAGCAUAUCUGUAAGAAAUAAAGAU2.113.322


Target Position: 597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597GUGUUGGAUAUAAGCCAGA80.4815386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447615GTGTTGGATATAAGCCAGATCTGGCTTATATCCAACAC0.017500.001700.569000.500000.978300.75000


Target Position: 465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465GAAAGAAUGUCUUGAUUGU88.0792152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
463-485TGGAAAGAATGTCTTGATTGTGGACAAUCAAGACAUUCUUUCCAGAAAGAAUGUCUUGAUUGUGGU13.85.332


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007ACUAUUGAGUGAAACAUUG70.1578791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591025ACTATTGAGTGAAACATTGCAATGTTTCACTCAATAGT0.734600.001400.560300.500001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GGCUAUAAAUUCUUUGCUG80.1185402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385314GGCTATAAATTCTTTGCTGCAGCAAAGAATTTATAGCC0.094500.003900.715500.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787ACAUCGCCAGUAAAAUUAU79.2244429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139805ACATCGCCAGTAAAATTATATAATTTTACTGGCGATGT0.344400.060100.663800.750001.000001.00000


Target Position: 674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GAAUACUUCAGGGAUUUGA82.5262321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
672-694ATGAATACTTCAGGGATTTGAATUCAAAUCCCUGAAGUAUUCAUGAAUACUUCAGGGAUUUGAAUU20.14.622


Target Position: 154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154CAUACCUAAUCAUUAUGCU82.0359335

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
152-174TGCATACCTAATCATTATGCTGAAGCAUAAUGAUUAGGUAUGCACAUACCUAAUCAUUAUGCUGAU15.219.823


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CAGUCAACAGGGGACAUAA96.400632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
213428CAGTCAACAGGGGACATAATTATGTCCCCTGTTGACTG0.483200.024600.750000.750000.967400.75000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450UCUCAACUUUAACUGGAAA81.8607346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268468TCTCAACTTTAACTGGAAATTTCCAGTTAAAGTTGAGA0.102000.018300.724100.750001.000001.00000


Target Position: 161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
161AAUCAUUAUGCUGAGGAUU72.4902683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433179AATCATTATGCTGAGGATTAATCCTCAGCATAATGATT0.037300.002100.500000.500000.967400.75000


Target Position: 338, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338CUGAAUAGAAAUAGUGAUA90.0327106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441356CTGAATAGAAATAGTGATATATCACTATTTCTATTCAG0.026600.001900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
336-358CACTGAATAGAAATAGTGATAGAUAUCACUAUUUCUAUUCAGUGCUGAAUAGAAAUAGUGAUAGAU20.313.422


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779UCCUAUUGACAUCGCCAGU62.99861024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348797TCCTATTGACATCGCCAGTACTGGCGATGTCAATAGGA0.119300.010400.663800.500000.934800.75000


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205ACUAAUUAUGGACAGGACU70.6476764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476223ACTAATTATGGACAGGACTAGTCCTGTCCATAATTAGT0.012500.006700.500000.500001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712UGAAACUGGAAAAGCAAAA73.2597661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226730TGAAACTGGAAAAGCAAAATTTTGCTTTTCCAGTTTCA0.240400.083600.724100.750001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443GAUGAUCUCUCAACUUUAA100.25410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198461GATGATCTCTCAACTTTAATTAAAGTTGAGAGATCATC0.223500.028400.646600.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
441-463GAGATGATCTCTCAACTTTAACTUUAAAGUUGAGAGAUCAUCUCGAUGAUCUCUCAACUUUAACUU4.920.423


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963UUGUUGUUUAACUUGUAAA77.1534508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292981TTGTTGTTTAACTTGTAAATTTACAAGTTAAACAACAA0.371800.051800.646600.500001.000001.00000


Target Position: 1035, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035CUGUAAGAAAUAAAGAGAA90.986693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341053CTGTAAGAAATAAAGAGAATTCTCTTTATTTCTTACAG0.306600.067300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1033-1055ATCTGTAAGAAATAAAGAGAAGAUUCUCUUUAUUUCUUACAGAUCUGUAAGAAAUAAAGAGAAGAU19.120.322


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CAGUUGCUGCAUUCCUAAA91.961477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247912CAGTTGCTGCATTCCTAAATTTAGGAATGCAGCAACTG0.135400.016300.784500.750001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GAUUUGGAAAGGGUGUUUA85.485215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225194GATTTGGAAAGGGTGTTTATAAACACCCTTTCCAAATC0.142200.142900.646600.750001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206UCCUGGAAUUAUUUUAGUA86.8797179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341224TCCTGGAATTATTTTAGTATACTAAAATAATTCCAGGA0.185000.006700.689700.750001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062AGUUUUUUAAUUGGUAUUU67.8369866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021080AGTTTTTTAATTGGTATTTAAATACCAATTAAAAAACT0.031300.005800.706900.750001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711GUGAAACUGGAAAAGCAAA87.4201168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187729GTGAAACTGGAAAAGCAAATTTGCTTTTCCAGTTTCAC0.243000.076500.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
709-731TAGTGAAACTGGAAAAGCAAAATUUUGCUUUUCCAGUUUCACUAGUGAAACUGGAAAAGCAAAAUU18.619.221


Target Position: 968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968GUUUAACUUGUAAAUGAAA91.274985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174986GTTTAACTTGTAAATGAAATTTCATTTACAAGTTAAAC0.273900.080800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
966-988TTGTTTAACTTGTAAATGAAAAAUUUCAUUUACAAGUUAAACAAGUUUAACUUGUAAAUGAAAAAU7.44.922


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719GGAAAAGCAAAAUACAAAG77.0579514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129737GGAAAAGCAAAATACAAAGCTTTGTATTTTGCTTTTCC0.506100.182900.732800.750001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782UAUUGACAUCGCCAGUAAA88.7926135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
403800TATTGACATCGCCAGTAAATTTACTGGCGATGTCAATA0.177700.011000.543100.500000.934800.87500


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UGAAAAAAUUCUCUUAAAC67.8881863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281000TGAAAAAATTCTCTTAAACGTTTAAGAGAATTTTTTCA0.396400.203100.577600.500000.962000.62500


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022AUUGAACUCAUAUCUGUAA85.0023232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571040ATTGAACTCATATCTGTAATTACAGATATGAGTTCAAT0.142400.038900.474100.500001.000001.00000


Target Position: 351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GUGAUAGAUCCAUUCCUAU89.3613122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
349-371TAGTGATAGATCCATTCCTATGAAUAGGAAUGGAUCUAUCACUAGUGAUAGAUCCAUUCCUAUGAU19.921.423


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GCAAGCUUGCUGGUGAAAA82.1459329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422584GCAAGCTTGCTGGTGAAAATTTTCACCAGCAAGCTTGC0.022600.002500.853401.000000.967400.62500


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362AUUCCUAUGACUGUAGAUU71.372733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405380ATTCCTATGACTGTAGATTAATCTACAGTCATAGGAAT0.029900.005100.500000.500001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133UUAUGACCUUGAUUUAUUU78.9438441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410151TTATGACCTTGATTTATTTAAATAAATCAAGGTCATAA0.385600.120000.534500.500001.000001.00000


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GACUGUAUUUUCCAACUUG82.577317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341259GACTGTATTTTCCAACTTGCAAGTTGGAAAATACAGTC0.182500.049900.672400.500001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361CAUUCCUAUGACUGUAGAU89.2666125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458379CATTCCTATGACTGTAGATATCTACAGTCATAGGAATG0.021100.006000.474100.750001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134UAUGACCUUGAUUUAUUUU70.9519745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325152TATGACCTTGATTTATTTTAAAATAAATCAAGGTCATA0.390600.124400.543100.500001.000001.00000


Target Position: 178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
178UUUGGAAAGGGUGUUUAUU62.76011031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450196TTTGGAAAGGGTGTTTATTAATAAACACCCTTTCCAAA0.016800.004900.491400.500001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196UUUUGUUCUGUCCUGGAAU66.5984906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741214TTTTGTTCTGTCCTGGAATATTCCAGGACAGAACAAAA0.012700.001100.491400.500001.000001.00000


Target Position: 144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144AUUUAUUUUGCAUACCUAA84.6405239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
448162ATTTATTTTGCATACCTAATTAGGTATGCAAAATAAAT0.074000.009000.474100.500001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863GAAUUUUAUCUGUUUUGUA98.999217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414881GAATTTTATCTGTTTTGTATACAAAACAGATAAAATTC0.363400.225800.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
861-883AAGAATTTTATCTGTTTTGTACTUACAAAACAGAUAAAAUUCUUGAAUUUUAUCUGUUUUGUACUU13.3-9.712


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CCACGAAGUGUUGGAUAUA90.5266100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358608CCACGAAGTGTTGGATATATATATCCAACACTTCGTGG0.060600.005700.801701.000000.972800.62500


Target Position: 1295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295CCCUUUUAAAUGCAAAUCA79.677414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061313CCCTTTTAAATGCAAATCATGATTTGCATTTAAAAGGG0.258800.227300.767200.750001.000001.00000


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261UCAAAUUAUUACCAGUGAA84.5992243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931279TCAAATTATTACCAGTGAATTCACTGGTAATAATTTGA0.107100.036600.551700.750001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283UUGUCAGCAGUUCCCUUUU63.51811010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231301TTGTCAGCAGTTCCCTTTTAAAAGGGAACTGCTGACAA0.582300.042400.646600.500001.000001.00000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CUAAGAAGUUUUGUUCUGU77.6159490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751206CTAAGAAGTTTTGTTCTGTACAGAACAAAACTTCTTAG0.099400.016200.465500.500000.983700.62500


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959CGGAUUGUUGUUUAACUUG71.8119708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429977CGGATTGTTGTTTAACTTGCAAGTTAAACAACAATCCG0.145400.002200.767200.750001.000001.00000


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309AAUCAAUAAAUUCCCAAAA81.0668367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461327AATCAATAAATTCCCAAAATTTTGGGAATTTATTGATT0.935400.687300.508600.500001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911AACUGUUUAUUUGCACUAU78.9342442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467929AACTGTTTATTTGCACTATATAGTGCAAATAAACAGTT0.091900.031600.603400.500001.000001.00000


Target Position: 849, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849CAUGUAUCUUCUAAGAAUU91.01692

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1084919CATGTATCTTCTAAGAATT1/1/0/093.44HPRT1NM_000194.21NANANAX:133634214..133634232(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267867CATGTATCTTCTAAGAATTAATTCTTAGAAGATACATG0.102300.061300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
847-869TGCATGTATCTTCTAAGAATTTTAAUUCUUAGAAGAUACAUGCACAUGUAUCUUCUAAGAAUUUUU6.916.022


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964UGUUGUUUAACUUGUAAAU75.2226585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230982TGTTGTTTAACTTGTAAATATTTACAAGTTAAACAACA0.365400.050800.698300.750001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993UCUUAAACCACAGCACUAU71.4065729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321011TCTTAAACCACAGCACTATATAGTGCTGTGGTTTAAGA0.163800.100500.681000.750001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296CCUUUUAAAUGCAAAUCAA94.988842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041314CCTTTTAAATGCAAATCAATTGATTTGCATTTAAAAGG0.263800.238400.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1294-1316TCCCTTTTAAATGCAAATCAATAUUGAUUUGCAUUUAAAAGGGACCUUUUAAAUGCAAAUCAAUAU13.8-3.822


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174AGGAUUUGGAAAGGGUGUU62.84761027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325192AGGATTTGGAAAGGGTGTTAACACCCTTTCCAAATCCT0.163500.007500.698300.750001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197UUUGUUCUGUCCUGGAAUU66.3487917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761215TTTGTTCTGTCCTGGAATTAATTCCAGGACAGAACAAA0.038500.001000.491400.500001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163UCAUUAUGCUGAGGAUUUG64.6381971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
403181TCATTATGCTGAGGATTTGCAAATCCTCAGCATAATGA0.031200.011400.577600.500001.000001.00000


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710AGUGAAACUGGAAAAGCAA89.2745124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290728AGTGAAACTGGAAAAGCAATTGCTTTTCCAGTTTCACT0.224500.068800.560300.750001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CAGGGAUUUGAAUCAUGUU87.0491176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340700CAGGGATTTGAATCATGTTAACATGATTCAAATCCCTG0.064400.006600.637900.750001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GGGACAUAAAAGUAAUUGG74.4608610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389438GGGACATAAAAGTAATTGGCCAATTACTTTTATGTCCC0.066900.028500.646600.500001.000001.00000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363UUCCUAUGACUGUAGAUUU74.9711595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363381TTCCTATGACTGTAGATTTAAATCTACAGTCATAGGAA0.048300.005500.672400.500001.000001.00000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706CAUUAGUGAAACUGGAAAA93.584153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196724CATTAGTGAAACTGGAAAATTTTCCAGTTTCACTAATG0.158500.036200.655200.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286GCUCAAGGGGGGCUAUAAA88.8924132

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_428619GCTCAAGGGGGGCTATAAA1/1/0/094.96HPRT1NM_000194.21NANANANA00HPRT1(0.002)


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167UAUGCUGAGGAUUUGGAAA80.0809403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451185TATGCTGAGGATTTGGAAATTTCCAAATCCTCAGCATA0.185200.001600.543100.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210GGAAUUAUUUUAGUAGUGU82.0064336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981228GGAATTATTTTAGTAGTGTACACTACTAAAATAATTCC0.085400.018500.663800.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224AGUGUUUCAGUAAUGUUGA81.02369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361242AGTGTTTCAGTAATGTTGATCAACATTACTGAAACACT0.194100.002600.482800.500001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173GAGGAUUUGGAAAGGGUGU70.9358747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376191GAGGATTTGGAAAGGGTGTACACCCTTTCCAAATCCTC0.207200.004200.603400.500001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137CCGUGUGUUAGAAAAGUAA91.787179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611155CCGTGTGTTAGAAAAGTAATTACTTTTCTAACACACGG0.185300.038600.879301.000001.000001.00000


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112UGAUUGAAUAUUGUUAAUU72.4277687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151130TGATTGAATATTGTTAATTAATTAACAATATTCAATCA0.026000.014300.715500.750001.000001.00000


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232AGUAAUGUUGACUGUAUUU82.5676318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961250AGTAATGTTGACTGTATTTAAATACAGTCAACATTACT0.366600.097400.706900.750001.000001.00000


Target Position: 34, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
34CCACCGGCUUCCUCCUCCU71.185741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39452CCACCGGCTTCCTCCTCCTAGGAGGAGGAAGCCGGTGG0.405000.012200.500000.750000.967401.00000


Target Position: 1275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1275GUGAAUCUUUGUCAGCAGU76.4124537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531293GTGAATCTTTGTCAGCAGTACTGCTGACAAAGATTCAC0.064400.035500.586200.500001.000001.00000


Target Position: 842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CUUUUUGCAUGUAUCUUCU79.1833431

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
840-862AGCTTTTTGCATGTATCTTCTAAAGAAGAUACAUGCAAAAAGCUCUUUUUGCAUGUAUCUUCUAAU16.014.132


Target Position: 197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
197CCUCAUGGACUAAUUAUGG68.7462838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464215CCTCATGGACTAATTATGGCCATAATTAGTCCATGAGG0.069200.003600.500000.500001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157AAGCAGUCAAUUUUCACAU76.3878538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391175AAGCAGTCAATTTTCACATATGTGAAAATTGACTGCTT0.583100.046200.482800.500001.000001.00000


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287CAGCAGUUCCCUUUUAAAU83.508285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301305CAGCAGTTCCCTTTTAAATATTTAAAAGGGAACTGCTG0.286800.053000.775900.750001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CUGACCUGCUGGAUUACAU83.055300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287330CTGACCTGCTGGATTACATATGTAATCCAGCAGGTCAG0.093800.036900.629300.750001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094UGCAGGAAAGAAUAGAAGU70.4993774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671112TGCAGGAAAGAATAGAAGTACTTCTATTCTTTCCTGCA0.071300.055200.646600.500001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898UGCUGCAUUCCUAAACUGU68.97830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387916TGCTGCATTCCTAAACTGTACAGTTTAGGAATGCAGCA0.039500.003800.646600.500001.000001.00000


Target Position: 994, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994CUUAAACCACAGCACUAUU81.6221353

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_599419CTTAAACCACAGCACTATT1/1/0/094.96HPRT1NM_000194.21NANANA13:107556374..107556392(-)|X:133634359..133634377(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791012CTTAAACCACAGCACTATTAATAGTGCTGTGGTTTAAG0.097000.069700.629300.750001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CUGGAAAAGCAAAAUACAA90.4026102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190735CTGGAAAAGCAAAATACAATTGTATTTTGCTTTTCCAG0.414100.148900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
715-737AACTGGAAAAGCAAAATACAAAGUUGUAUUUUGCUUUUCCAGUUCUGGAAAAGCAAAAUACAAAGU6.920.122


Target Position: 145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
145UUUAUUUUGCAUACCUAAU67.1817886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415163TTTATTTTGCATACCTAATATTAGGTATGCAAAATAAA0.073800.008400.491400.500001.000001.00000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073UGGUAUUUUAAUUUUUAUA83.45286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511091TGGTATTTTAATTTTTATATATAAAAATTAAAATACCA0.166100.015900.801700.750001.000001.00000


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106CGUCGUGAUUAGUGAUGAU95.997835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467124CGTCGTGATTAGTGATGATATCATCACTAATCACGACG0.013700.001800.594801.000001.000001.00000


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394GAGCUAUUGUAAUGACCAG83.8184277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437412GAGCTATTGTAATGACCAGCTGGTCATTACAATAGCTC0.018800.004700.525900.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CAGACUGAAGAGCUAUUGU82.4938322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
262403CAGACTGAAGAGCTATTGTACAATAGCTCTTCAGTCTG0.156200.023100.577600.500001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185CAUCUAAGAAGUUUUGUUC75.2491583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441203CATCTAAGAAGTTTTGTTCGAACAAAACTTCTTAGATG0.077400.007400.482800.500001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713GAAACUGGAAAAGCAAAAU78.8089450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211731GAAACTGGAAAAGCAAAATATTTTGCTTTTCCAGTTTC0.246200.090400.663800.750001.000001.00000


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694UCAUGUUUGUGUCAUUAGU72.6083681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410712TCATGTTTGTGTCATTAGTACTAATGACACAAACATGA0.042400.002700.517200.500001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841GCUUUUUGCAUGUAUCUUC72.8334670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181859GCTTTTTGCATGTATCTTCGAAGATACATGCAAAAAGC0.187900.058300.681000.750001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143GAUUUAUUUUGCAUACCUA103.3956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443161GATTTATTTTGCATACCTATAGGTATGCAAAATAAATC0.018200.011200.508600.750001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138ACCUUGAUUUAUUUUGCAU77.848483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312156ACCTTGATTTATTTTGCATATGCAAAATAAATCAAGGT0.077200.017000.698300.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508AACAAUGCAGACUUUGCUU74.3675618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436526AACAATGCAGACTTTGCTTAAGCAAAGTCTGCATTGTT0.039000.002400.508600.500000.902200.75000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514GCAGACUUUGCUUUCCUUG67.2809883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455532GCAGACTTTGCTTTCCTTGCAAGGAAAGCAAAGTCTGC0.238800.001600.706900.750000.972800.62500


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980AAUGAAAAAAUUCUCUUAA85.5324213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454998AATGAAAAAATTCTCTTAATTAAGAGAATTTTTTCATT0.264400.167200.474100.500000.962000.87500


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076UAUUUUAAUUUUUAUAUAU87.9468155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871094TATTTTAATTTTTATATATATATATAAAAATTAAAATA0.183800.057700.500000.500001.000001.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326UACAUCAAAGCACUGAAUA76.3218540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340344TACATCAAAGCACTGAATATATTCAGTGCTTTGATGTA0.183700.047100.637900.500000.956500.87500


Target Position: 665, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665GACUAUAAUGAAUACUUCA99.280216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427683GACTATAATGAATACTTCATGAAGTATTCATTATAGTC0.022000.005000.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
663-685TTGACTATAATGAATACTTCAGGUGAAGUAUUCAUUAUAGUCAAGACUAUAAUGAAUACUUCAGGU14.56.332


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676AUACUUCAGGGAUUUGAAU74.4799609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339694ATACTTCAGGGATTTGAATATTCAAATCCCTGAAGTAT0.248500.013400.534500.500000.956500.62500


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345GAAAUAGUGAUAGAUCCAU85.5449211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479363GAAATAGTGATAGATCCATATGGATCTATCACTATTTC0.021900.001000.517200.750001.000001.00000


Target Position: 907, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907CCUAAACUGUUUAUUUGCA86.6407181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428925CCTAAACTGTTTATTTGCATGCAAATAAACAGTTTAGG0.089500.007400.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
905-927TTCCTAAACTGTTTATTTGCACTUGCAAAUAAACAGUUUAGGAACCUAAACUGUUUAUUUGCACUU15.39.832


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19UCCUCCUCUGCUCCGCCAC44.62621277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44837TCCTCCTCTGCTCCGCCACGTGGCGGAGCAGAGGAGGA0.022300.001700.577600.500001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068UUAAUUGGUAUUUUAAUUU65.9265932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531086TTAATTGGTATTTTAATTTAAATTAAAATACCAATTAA0.132800.009700.534500.500001.000001.00000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GCUGGAUUACAUCAAAGCA92.201172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388337GCTGGATTACATCAAAGCATGCTTTGATGTAATCCAGC0.069500.013200.500000.750000.972800.62500


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CUAUGAGCCUAUAGACUAU95.522341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479944CTATGAGCCTATAGACTATATAGTCTATAGGCTCATAG0.011700.001600.629300.750000.918500.75000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UCUGGAGUCCUAUUGACAU77.9321480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407790TCTGGAGTCCTATTGACATATGTCAATAGGACTCCAGA0.111400.002800.569000.750000.918500.75000


Target Position: 1061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061UAGUUUUUUAAUUGGUAUU68.9661831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771079TAGTTTTTTAATTGGTATTAATACCAATTAAAAAACTA0.039800.004600.663800.500001.000001.00000


Target Position: 386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386AGACUGAAGAGCUAUUGUA93.952751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303404AGACTGAAGAGCTATTGTATACAATAGCTCTTCAGTCT0.167900.022900.543100.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736AGCCUAAGAUGAGAGUUCA87.1081175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410754AGCCTAAGATGAGAGTTCATGAACTCTCATCTTAGGCT0.027400.024200.629300.500001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132UACCACCGUGUGUUAGAAA78.9123444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761150TACCACCGTGTGTTAGAAATTTCTAACACACGGTGGTA0.130700.057900.681000.500000.972800.87500


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034UCUGUAAGAAAUAAAGAGA78.3588465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831052TCTGTAAGAAATAAAGAGATCTCTTTATTTCTTACAGA0.469200.206500.500000.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812UCUAGUUCUGUGGCCAUCU63.26071019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457830TCTAGTTCTGTGGCCATCTAGATGGCCACAGAACTAGA0.032600.001500.500000.500001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871UCUGUUUUGUACUUUAGAA85.7877206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461889TCTGTTTTGTACTTTAGAATTCTAAAGTACAAAACAGA0.014600.009500.551700.750001.000001.00000


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097AGGAAAGAAUAGAAGUGAU88.8723133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381115AGGAAAGAATAGAAGTGATATCACTTCTATTCTTTCCT0.062500.042500.663800.750001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672AUGAAUACUUCAGGGAUUU69.0311827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451690ATGAATACTTCAGGGATTTAAATCCCTGAAGTATTCAT0.050200.003800.655200.500001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339UGAAUAGAAAUAGUGAUAG66.21920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432357TGAATAGAAATAGTGATAGCTATCACTATTTCTATTCA0.020400.002200.551700.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977GUAAAUGAAAAAAUUCUCU76.9239517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
975-997TTGTAAATGAAAAAATTCTCTTAAGAGAAUUUUUUCAUUUACAAGUAAAUGAAAAAAUUCUCUUAU14.88.932


Target Position: 1113, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113GAUUGAAUAUUGUUAAUUA109.4681

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3111319GATTGAATATTGTTAATTA1/1/0/096.22HPRT1NM_000194.21NANANAX:133634478..133634496(+)00HPRT1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531131GATTGAATATTGTTAATTATAATTAACAATATTCAATC0.016700.008700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1111-1133GTGATTGAATATTGTTAATTATAUAAUUAACAAUAUUCAAUCACGAUUGAAUAUUGUUAAUUAUAU-0.37.222


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249UUUCCAACUUGUUCAAAUU72.7194675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311267TTTCCAACTTGTTCAAATTAATTTGAACAAGTTGGAAA0.230700.151300.491400.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903CAUUCCUAAACUGUUUAUU75.0617591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230921CATTCCTAAACTGTTTATTAATAAACAGTTTAGGAATG0.134300.041200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
901-923TGCATTCCTAAACTGTTTATTTGAAUAAACAGUUUAGGAAUGCACAUUCCUAAACUGUUUAUUUGU6.919.932


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881ACUUUAGAAAUGUCAGUUG68.2351848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375899ACTTTAGAAATGTCAGTTGCAACTGACATTTCTAAAGT0.040300.007600.560300.500001.000001.00000


Target Position: 340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340GAAUAGAAAUAGUGAUAGA103.3017

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
338-360CTGAATAGAAATAGTGATAGATCUCUAUCACUAUUUCUAUUCAGGAAUAGAAAUAGUGAUAGAUCU20.36.912


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591CACGAAGUGUUGGAUAUAA94.463447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327609CACGAAGTGTTGGATATAATTATATCCAACACTTCGTG0.067200.008600.758600.750001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919AUUUGCACUAUGAGCCUAU73.3042658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469937ATTTGCACTATGAGCCTATATAGGCTCATAGTGCAAAT0.019500.008200.465500.500000.951101.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044AUAAAGAGAAGAUAUAUUA91.17988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691062ATAAAGAGAAGATATATTATAATATATCTTCTCTTTAT0.055900.047800.508600.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089AUAUAUGCAGGAAAGAAUA86.4446188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921107ATATATGCAGGAAAGAATATATTCTTTCCTGCATATAT0.341500.222600.500000.500001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873UGUUUUGUACUUUAGAAAU76.9652515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391891TGTTTTGTACTTTAGAAATATTTCTAAAGTACAAAACA0.034700.007800.698300.750001.000001.00000


Target Position: 456, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456CUUUAACUGGAAAGAAUGU74.4223614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
454-476AACTTTAACTGGAAAGAATGTCTACAUUCUUUCCAGUUAAAGUUCUUUAACUGGAAAGAAUGUCUU12.04.923


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415AACAGGGGACAUAAAAGUA87.6336161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474433AACAGGGGACATAAAAGTATACTTTTATGTCCCCTGTT0.286600.180100.465500.500001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867UUUAUCUGUUUUGUACUUU61.9751053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390885TTTATCTGTTTTGTACTTTAAAGTACAAAACAGATAAA0.044000.033600.500000.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534UCAGGCAGUAUAAUCCAAA79.6532416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131552TCAGGCAGTATAATCCAAATTTGGATTATACTGCCTGA0.423100.164700.724100.750001.000001.00000


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697UGUUUGUGUCAUUAGUGAA88.9925130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439715TGTTTGTGTCATTAGTGAATTCACTAATGACACAAACA0.064300.002000.534500.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GCAGUAUAAUCCAAAGAUG82.7837313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385556GCAGTATAATCCAAAGATGCATCTTTGGATTATACTGC0.037600.035200.698300.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026AACUCAUAUCUGUAAGAAA97.373525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401044AACTCATATCTGTAAGAAATTTCTTACAGATATGAGTT0.372200.051200.646600.500001.000001.00000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128AUUAUACCACCGUGUGUUA82.5338320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551146ATTATACCACCGTGTGTTATAACACACGGTGGTATAAT0.107100.010400.474100.500000.972800.87500


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312CAAUAAAUUCCCAAAAAUU89.4634115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921330CAATAAATTCCCAAAAATTAATTTTTGGGAATTTATTG0.890600.834500.637900.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GCACUAUUGAGUGAAACAU83.3106290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451023GCACTATTGAGTGAAACATATGTTTCACTCAATAGTGC0.029700.001800.698301.000000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1003-1025CAGCACTATTGAGTGAAACATTGAUGUUUCACUCAAUAGUGCUGGCACUAUUGAGUGAAACAUUGU20.511.622


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205GUCCUGGAAUUAUUUUAGU75.9279556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221223GTCCTGGAATTATTTTAGTACTAAAATAATTCCAGGAC0.183800.007600.612100.500001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040AGAAAUAAAGAGAAGAUAU89.2613126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701058AGAAATAAAGAGAAGATATATATCTTCTCTTTATTTCT0.100900.090400.681000.750001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201UUCUGUCCUGGAAUUAUUU68.7011840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601219TTCTGTCCTGGAATTATTTAAATAATTCCAGGACAGAA0.039600.001400.672400.500001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043AAUAAAGAGAAGAUAUAUU85.4712216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761061AATAAAGAGAAGATATATTAATATATCTTCTCTTTATT0.063000.057500.500000.500001.000001.00000


Target Position: 1221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1221AGUAGUGUUUCAGUAAUGU76.9267516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721239AGTAGTGTTTCAGTAATGTACATTACTGAAACACTACT0.013000.002600.500000.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893UCAGUUGCUGCAUUCCUAA80.3675394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290911TCAGTTGCTGCATTCCTAATTAGGAATGCAGCAACTGA0.091100.011900.689700.750000.994600.62500


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430AGUAAUUGGUGGAGAUGAU85.9305201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450448AGTAATTGGTGGAGATGATATCATCTCCACCAATTACT0.019100.001600.525900.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413UCAACAGGGGACAUAAAAG66.9897893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309431TCAACAGGGGACATAAAAGCTTTTATGTCCCCTGTTGA0.238600.206900.586200.500001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGUAAGAAAUAAAGAGAAG70.8798752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711054TGTAAGAAATAAAGAGAAGCTTCTCTTTATTTCTTACA0.240000.208900.569000.500001.000001.00000


Target Position: 1139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139GUGUGUUAGAAAAGUAAGA84.5367248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491157GTGTGTTAGAAAAGTAAGATCTTACTTTTCTAACACAC0.154800.031300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1137-1159CCGTGTGTTAGAAAAGTAAGAAGUCUUACUUUUCUAACACACGGGUGUGUUAGAAAAGUAAGAAGU9.820.432


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GUCCUAUUGACAUCGCCAG67.3051882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360796GTCCTATTGACATCGCCAGCTGGCGATGTCAATAGGAC0.113400.009600.534500.500000.934800.62500


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202UCUGUCCUGGAAUUAUUUU65.7055940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581220TCTGTCCTGGAATTATTTTAAAATAATTCCAGGACAGA0.050700.008200.724100.750001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CCUAAGAUGAGAGUUCAAG69.4785813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431756CCTAAGATGAGAGTTCAAGCTTGAACTCTCATCTTAGG0.021000.016600.706900.750001.000001.00000