Input target sequence

Length: 2182
AGGTAAGAGGAAACTCCATTGGATAAATGGCGAGGAAACGTATACTCCCTCTTAAGGAACACGGTGTCTTCCTTCGTCTCCGGGTTCCCGAGACCCCAGAGTCACTGACCTCCGTCCCTCAGCTTTCGGGGTTCGGCAGCAGAAGGGGCGGGCCCGGGCCTGGGATTGGCTGGCGTCGTCCGACCCCCTTCGCTGCTCTCCATTCGCAATCGCCCGCGGGCGCCTGCGCGATGGGTCGGCCGTGGGGAGCGGGGCGGGAAGCGCTTCAGGGCAGCGGATCCCATGTCGGCCCTGAGGCGCTCGGGCTACGGCCCCAGTGACGGTCCGTCCTACGGCCGCTACTACGGGCCTGGGGGTGGAGATGTGCCGGTACACCCACCTCCACCCTTATATCCTCTTCGCCCTGAACCTCCCCAGCCTCCCATTTCCTGGCGGGTGCGCGGGGGCGGCCCGGCGGAGACCACCTGGCTGGGAGAAGGCGGAGGAGGCGATGGCTACTATCCCTCGGGAGGCGCCTGGCCAGAGCCTGGTCGAGCCGGAGGAAGCCACCAGGAGCAGCCACCATATCCTAGCTACAATTCTAACTATTGGAATTCTACTGCGAGATCTAGGGCTCCTTACCCAAGTACATATCCTGTAAGACCAGAATTGCAAGGCCAGAGTTTGAATTCTTATACAAATGGAGCGTATGGTCCAACATACCCCCCAGGCCCTGGGGCAAATACTGCCTCATACTCAGGGGCTTATTATGCACCTGGTTATACTCAGACCAGTTACTCCACAGAAGTTCCAAGTACTTACCGTTCATCTGGCAACAGCCCAACTCCAGTCTCTCGTTGGATCTATCCCCAGCAGGACTGTCAGACTGAAGCACCCCCTCTTAGGGGGCAGGTTCCAGGATATCCGCCTTCACAGAACCCTGGAATGACCCTGCCCCATTATCCTTATGGAGATGGTAATCGTAGTGTTCCACAATCAGGACCGACTGTACGACCACAAGAAGATGCGTGGGCTTCTCCTGGTGCTTATGGAATGGGTGGCCGTTATCCCTGGCCTTCATCAGCGCCCTCAGCACCACCCGGCAATCTCTACATGACTGAAAGTACTTCACCATGGCCTAGCAGTGGCTCTCCCCAGTCACCCCCTTCACCCCCAGTCCAGCAGCCCAAGGATTCTTCATACCCCTATAGCCAATCAGATCAAAGCATGAACCGGCACAACTTTCCTTGCAGTGTCCATCAGTACGAATCCTCGGGGACAGTGAACAATGATGATTCAGATCTTTTGGATTCCCAAGTCCAGTATAGTGCTGAGCCTCAGCTGTATGGTAATGCCACCAGTGACCATCCCAACAATCAAGATCAAAGTAGCAGTCTTCCTGAAGAATGTGTACCTTCAGATGAAAGTACTCCTCCGAGTATTAAAAAAATCATACATGTGCTGGAGAAGGTCCAGTATCTTGAACAAGAAGTAGAAGAATTTGTAGGAAAAAAGACAGACAAAGCATACTGGCTTCTGGAAGAAATGCTAACCAAGGAACTTTTGGAACTGGATTCAGTTGAAACTGGGGGCCAGGACTCTGTACGGCAGGCCAGAAAAGAGGCTGTTTGTAAGATTCAGGCCATACTGGAAAAATTAGAAAAAAAAGGATTATGAAAGGATTTAGAACAAAGTGGAAGCCTGTTACTAACTTGACCAAAGAACACTTGATTTGGTTAATTACCCTCTTTTTGAAATGCCTGTTGATGACAAGAAGCAATACATTCCAGCTTTCCTTTGATTTTATACTTGAAAAACTGGCAAAGGAATGGAAGAATATTTTAGTCATGAGTTGTTTTCAGTTTTCAGACGAATGAATGTAATAGGAAACTATGGAGTTACCAATATTGCCAAGTAGACTCACTCCTTAAAAAATTTATGGATATCTACAAGCTGCTTCTTACCAGCAGGAGGGAAACACACTTCACACAACAGGCTTATCAGAAACCTACCAGATGAAACTGGATATAATCTGAGACAAACAGGATGTGTTTTTTTAAACATCTGGATATCTTGTCACATTTTTGTACATTGTGACTGCTTTCAACATATACTTCATGTGTAATTATAGCTTAGACTTTAGCCTTCTTGGACTTCTGTTTTGTTTTGTTATTTGCAGTTTACAAATATAGTATTATTCTCT