siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 3334  
Biltr, Rnaxs 12   13   19   20   21   22   23   92   94   95   96   99   103   216   217   227   230   232   235   238  
259   261   262   295   305   306   307   331   362   380   382   383   384   385   391   409   410   439   440   492  
493   494   495   496   497   499   500   505   507   508   509   513   514   521   526   527   545   546   554   555  
556   564   590   591   592   594   595   612   613   615   616   617   618   660   661   663   664   666   667   669  
670   671   673   675   676   677   691   700   703   704   712   713   714   716   717   719   722   727   728   730  
731   732   733   734   735   736   744   766   767   768   769   770   771   777   778   779   792   793   815   816  
827   831   832   855   856   857   861   862   863   867   868   869   870   871   873   875   876   878   887   889  
890   907   908   909   910   911   913   914   915   918   919   921   927   949   984   985   986   987   988   1006  
1007   1008   1009   1010   1011   1013   1017   1018   1019   1020   1022   1023   1030   1031   1032   1033   1036   1037   1038   1039  
1040   1041   1042   1043   1044   1045   1046   1047   1050   1052   1070   1094   1095   1096   1097   1099   1100   1101   1128   1129  
1137   1138   1139   1146   1149   1150   1156   1157   1158   1160   1161   1162   1163   1167   1169   1181   1182   1185   1186   1191  
1192   1194   1195   1196   1223   1224   1225   1226   1227   1228   1229   1230   1231   1233   1234   1244   1248   1252   1253   1254  
1256   1262   1294   1295   1296   1297   1298   1302   1303   1304   1305   1306   1307   1308   1309   1310   1311   1312   1348   1349  
1351   1352   1353   1356   1357   1378   1380   1381   1388   1389   1390   1403   1404   1410   1411   1420   1421   1424   1425   1429  
1430   1433   1434   1474   1477   1483   1493   1494   1495   1496   1514   1517   1518   1519   1520   1521   1522   1523   1524   1525  
1526   1527   1529   1540   1541   1542   1543   1544   1545   1546   1547   1548   1549   1550   1553   1555   1584   1605   1606   1607  
1655   1657   1658   1659   1678   1679   1680   1681   1682   1686   1687   1688   1689   1708   1709   1710   1711   1723   1725   1726  
1729   1744   1745   1754   1755   1756   1797   1798   1801   1802   1807   1808   1810   1811   1820   1821   1863   1866   1867   1882  
1884   1885   1888   1889   1894   1895   1901   1926   1927   1928   1929   1930   1931   1952   1953   1954   1955   1956   1957   1958  
1959   1960   1961   1962   1963   1966   1967   1969   1970   1981   1982   2012   2013   2014   2015   2017   2027   2028   2031   2032  
2037   2038   2039   2042   2044   2045   2047   2052   2056   2057   2060   2061   2062   2063   2065   2066   2070   2071   2072   2073  
2074   2084   2186   2236   2237   2238   2239   2256   2257   2258   2259   2260   2261   2262   2263   2265   2266   2267   2272   2273  
2277   2302   2332   2333   2335   2336   2337   2338   2342   2344   2345   2346   2347   2348   2350   2351   2401   2402   2404   2405  
2406   2407   2408   2411   2412   2460   2461   2504   2551   2595   2596   2597   2598   2606   2607   2608   2612   2622   2623   2624  
2625   2626   2631   2632   2633   2634   2642   2643   2644   2646   2647   2648   2649   2670   2671   2672   2673   2676   2678   2681  
2704   2706   2710   2711   2713   2715   2727   2728   2735   2736   2738   2739   2741   2744   2745   2746   2748   2781   2782   2788  
2790   2791   2792   2793   2794   2799   2800   2801   2802   2810   2811   2812   2814   2815   2816   2818   2819   2820   2821   2822  
2824   2826   2828   2829   2830   2840   2841   2842   2850   2851   2852   2854   2859   2860   2861   2882   2886   2887   2888   2889  
2891   2899   2900   2907   2908   2909   2910   2911   2912   2913   2917   2918   2920   2921   2929   2930   2931   2934   2935   2939  
2940   2942   2949   2950   3012   3017   3019   3021   3022   3025   3026   3027   3048   3049   3053   3072   3077   3078   3082   3083  
3084   3085   3086   3087   3088   3089   3090   3092   3094   3095   3096   3114   3115   3117   3118   3119   3120   3121   3126   3127  
3129   3131   3134   3135   3138   3139   3140   3141   3142   3147   3148   3149   3151   3152   3154   3155   3172   3173   3174   3175  
3176   3177   3178   3179   3180   3181   3182   3183   3186   3187   3189   3190   3191   3192   3193   3194   3195   3196   3200   3208  
3209   3214   3215   3220   3221   3222   3228   3229   3230   3231   3232   3233   3234   3235   3239   3240   3242   3243   3244   3246  
3247   3248   3249   3250   3251   3252   3253   3254   3257   3259   3260   3261   3262   3263   3264   3265   3272   3278   3279   3280  
3281   3282   3283   3284   3299   3300   3301   3302   3303   3304   3305   3306   3307   3308   3311   3313   3314   3332   3333   3335  
3336   3337   3339   3340   3369   3370   3372   3374   3375   3378   3379   3380   3381   3382   3383   3384   3385   3386   3388   3391  
3392   3394   3399   3400   3401   3402   3406   3408   3411   3413   3414   3423   3424   3427   3430   3431   3432   3433   3434   3435  
3436   3437   3442   3443   3444   3445   3448   3449   3450   3457   3458   3459   3460   3462   3464   3468   3469   3471   3474   3475  
3476   3481   3482   3487   3501   3502   3505   3506   3507   3508   3509   3510   3511   3513   3515   3516   3519   3520   3521   3526  
3527   3532   3533   3534   3538   3539   3546   3547   3548   3549   3550   3551   3552   3556   3557   3558   3562   3563   3564   3566  
3567   3568   3569   3570   3579   3580   3581   3582   3589   3590   3591   3603   3604   3605   3606   3611   3612   3613   3616   3617  
3623   3626   3631   3634   3635   3642   3643   3644   3645   3646   3647   3648   3653   3654   3655   3660   3661   3662   3663   3664  
3666   3668   3669   3672   3674   3675   3679   3680   3681   3682   3683   3686   3687   3688   3690   3691  
Biltr, Ernai 790   1159   1582   2377  
Biltr, Ernai, Rnaxs, Sidirect 1255   2714   3245   3470   3665  
Biltr, Sidirect 221   241   273   319   321   674   682   738   874   1021   1024   1061   1124   1126   1323   1386   1497   2075   2409   2600  
2617   2653   2674   2783   2862   2865   2874   2893   2922   3036   3055   3091   3236   3287   3341   3376   3397   3479   3484   3525  
3619   3689   3694  
Biltr, Rnaxs, Sidirect 222   231   236   237   662   672   685   877   948   1012   1048   1051   1168   1232   1235   1257   1258   1551   1554   1822  
2018   2033   2043   2278   2349   2611   2620   2621   2645   2677   2712   2737   2740   2813   2823   2827   2853   2855   2881   2885  
2890   2941   3046   3047   3050   3093   3130   3150   3153   3184   3185   3188   3255   3256   3258   3285   3312   3338   3371   3373  
3387   3393   3395   3407   3412   3438   3463   3472   3473   3483   3512   3592   3618   3667   3673   3692  


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868UACCAUGCAGAAUACAAAU76.35671225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
587886TACCATGCAGAATACAAATATTTGTATTCTGCATGGTA0.189400.013800.672400.500001.000001.00000


Target Position: 3510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3510GUGGAUCUAUUUCAUGUUU81.2015781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7143528GTGGATCTATTTCATGTTTAAACATGAAATAGATCCAC0.122400.005300.793100.750001.000001.00000


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727UGUAAAUCUGCCACAAAAA84.2864527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152745TGTAAATCTGCCACAAAAATTTTTGTGGCAGATTTACA0.173200.003000.706900.750001.000001.00000


Target Position: 3120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120GACUCAAGAAGUGAAGAAU88.4621280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473138GACTCAAGAAGTGAAGAATATTCTTCACTTCTTGAGTC0.076000.002300.810300.750001.000001.00000


Target Position: 2273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2273GAUUACAAGAAACGGCUUU74.99041375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462291GATTACAAGAAACGGCTTTAAAGCCGTTTCTTGTAATC0.014000.012100.681000.750001.000001.00000


Target Position: 3397, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3397CUAAUUAAUUGUAAUCUGA90.4185164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3395-3417CTCTAATTAATTGTAATCTGAATUCAGAUUACAAUUAAUUAGAGCUAAUUAAUUGUAAUCUGAAUU13.4-7.523


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229CCCCAAGCUUUAGUAAAUA86.0388412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411247CCCCAAGCTTTAGTAAATATATTTACTAAAGCTTGGGG0.163700.020300.948301.000001.000001.00000


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420UCUCAGGAAUCUUUCAGAU77.48341114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001438TCTCAGGAATCTTTCAGATATCTGAAAGATTCCTGAGA0.040800.010800.543100.750001.000001.00000


Target Position: 3154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3154ACAAGAUGGAAUUUAUCAA89.509229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6023172ACAAGATGGAATTTATCAATTGATAAATTCCATCTTGT0.151900.027800.560300.750001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233AAGCUUUAGUAAAUAUAAU86.3416389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931251AAGCTTTAGTAAATATAATATTATATTTACTAAAGCTT0.312800.020000.629300.500001.000001.00000


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653ACGAUGCUUCAAGAGAAAA78.65881009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3763671ACGATGCTTCAAGAGAAAATTTTCTCTTGAAGCATCGT0.380700.052400.775900.750000.967400.62500


Target Position: 2671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2671UGCCUACAGAACUUCAGAA85.4363451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362689TGCCTACAGAACTTCAGAATTCTGAAGTTCTGTAGGCA0.161200.020700.681000.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGGUUAAUAAGGCUGCAGU69.15852006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
757786TGGTTAATAAGGCTGCAGTACTGCAGCCTTATTAACCA0.068000.006400.637900.500001.000001.00000


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141ACAAGAAUGGAUCACAAGA83.0715624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023159ACAAGAATGGATCACAAGATCTTGTGATCCATTCTTGT0.067700.038800.482800.500001.000001.00000


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527GCAAUGACUCGAGCUCAGA83.7692568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953545GCAATGACTCGAGCTCAGATCTGAGCTCGAGTCATTGC0.014300.001100.629300.750001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514UGAUGGACAGUAUGCAAUG70.64191845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
715532TGATGGACAGTATGCAATGCATTGCATACTGTCCATCA0.188800.046200.569000.500001.000001.00000


Target Position: 2617, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617CAUCCUUUAGGUAAGAAGU79.2258962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2615-2637ATCATCCTTTAGGTAAGAAGTTTACUUCUUACCUAAAGGAUGAUCAUCCUUUAGGUAAGAAGUUUU11.718.733


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038CAGAGGACUAAAUACCAUU87.4281328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142056CAGAGGACTAAATACCATTAATGGTATTTAGTCCTCTG0.179500.022200.775900.750000.967400.87500


Target Position: 2347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2347UGCUGAUCUUGGACUUGAU84.2819528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3062365TGCTGATCTTGGACTTGATATCAAGTCCAAGATCAGCA0.219200.052900.672400.750001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010GUGGAUUCUGUGUUGUUUU80.1297877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511028GTGGATTCTGTGTTGTTTTAAAACAACACAGAATCCAC0.081600.004100.793100.750001.000001.00000


Target Position: 3272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272UUUUUUUUUUUUGCAGUAA66.64322299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373290TTTTTTTTTTTTGCAGTAATTACTGCAAAAAAAAAAAA0.070600.075700.465500.500001.000001.00000


Target Position: 235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235ACCAUACAACUGUUUUGAA86.9603356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446253ACCATACAACTGTTTTGAATTCAAAACAGTTGTATGGT0.403800.227000.681000.750001.000001.00000


Target Position: 2377, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377GGGAGAACCCCUUGGAUAU85.3868456

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5237719GGGAGAACCCCTTGGATAT1/1/0/097.75CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41279539..41279557(+)00CTNNB1(0.002)


Target Position: 2027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027CGAAUUGUUAUCAGAGGAC71.88121706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212045CGAATTGTTATCAGAGGACGTCCTCTGATAACAATTCG0.070000.027800.474100.750001.000001.00000


Target Position: 3249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3249GAAGUAGCUCUUUUUUUUU85.4737448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4373267GAAGTAGCTCTTTTTTTTTAAAAAAAAAGAGCTACTTC0.924800.060400.672400.750001.000001.00000


Target Position: 3308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3308CGUAGUGUUAAGUUAUAGU85.7138432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603326CGTAGTGTTAAGTTATAGTACTATAACTTAACACTACG0.359600.003900.569000.750001.000001.00000


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607ACCUGUAAAUCAUCCUUUA89.8272203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962625ACCTGTAAATCATCCTTTATAAAGGATGATTTACAGGT0.083000.017500.819000.750001.000001.00000


Target Position: 3460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460AUAGAAAAUGGUCCAAUUA84.4114517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343478ATAGAAAATGGTCCAATTATAATTGGACCATTTTCTAT0.354300.027600.508600.500000.967400.62500


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935UAUUGUCUGAACUUGCAUU76.74541193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212953TATTGTCTGAACTTGCATTAATGCAAGTTCAGACAATA0.128800.037600.534500.500001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591AGAUCCCAUCUACACAGUU79.5277933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566609AGATCCCATCTACACAGTTAACTGTGTAGATGGGATCT0.136200.046200.577600.750000.962000.75000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494UGGGUUCAGAUGAUAUAAA84.6246502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621512TGGGTTCAGATGATATAAATTTATATCATCTGAACCCA0.070100.007000.844800.750001.000001.00000


Target Position: 3382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3382UAAUUCAUAAUCACUCUAA85.2887460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873400TAATTCATAATCACTCTAATTAGAGTGATTATGAATTA0.300100.071400.500000.500001.000001.00000


Target Position: 2062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062GUUUGUGCAGCUGCUUUAU76.06931253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512080GTTTGTGCAGCTGCTTTATATAAAGCAGCTGCACAAAC0.158700.012600.603400.750000.956501.00000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886AUUUGCUGUUUUAAACAUU73.18821571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452904ATTTGCTGTTTTAAACATTAATGTTTAAAACAGCAAAT0.561000.001800.500000.500000.989100.62500


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497GAACAAGUAGCUGAUAUUG77.581102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878515GAACAAGTAGCTGATATTGCAATATCAGCTACTTGTTC0.025400.026200.525900.500001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878AAUACAAAUGAUGUAGAAA89.5348226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
766896AATACAAATGATGTAGAAATTTCTACATCATTTGTATT0.044900.019000.508600.500000.923900.75000


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934GUAUUGUCUGAACUUGCAU82.5132668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7012952GTATTGTCTGAACTTGCATATGCAAGTTCAGACAATAC0.121100.030800.525900.750001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625AGGUAAGAAGUUUUAAAAA90.6849153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2662643AGGTAAGAAGTTTTAAAAATTTTTAAAACTTCTTACCT0.516400.041400.844800.750001.000001.00000


Target Position: 2409, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409CUAGCUAUCGUUCUUUUCA84.7035499

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2407-2429TCCTAGCTATCGTTCTTTTCACTUGAAAAGAACGAUAGCUAGGACUAGCUAUCGUUCUUUUCACUU14.819.523


Target Position: 1126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CAACAAAACAAAUGUUAAA94.011374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1124-1146CTCAACAAAACAAATGTTAAATTUUUAACAUUUGUUUUGUUGAGCAACAAAACAAAUGUUAAAUUU6.95.622


Target Position: 3185, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185CUUGUUAAAUUUUUUUUUU75.91271269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4443203CTTGTTAAATTTTTTTTTTAAAAAAAAAATTTAACAAG0.383300.111000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3183-3205TGCTTGTTAAATTTTTTTTTTTTAAAAAAAAAAUUUAACAAGCACUUGUUAAAUUUUUUUUUUUUU-11.37.211


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193AUUUUUUUUUUUUUUUUUU67.94142148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673211ATTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAT0.459700.227400.508600.500001.000001.00000


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251AGUAGCUCUUUUUUUUUUU73.94331493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2003269AGTAGCTCTTTTTTTTTTTAAAAAAAAAAAGAGCTACT0.977200.113600.706900.750001.000001.00000


Target Position: 92, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
92CCGGGAGCGGAGAGCGAGG53.58443343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926110CCGGGAGCGGAGAGCGAGGCCTCGCTCTCCGCTCCCGG0.020800.001200.569000.500000.951100.62500


Target Position: 3474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474AAUUAGUUUCCUUUUUAAU79.9696893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953492AATTAGTTTCCTTTTTAATATTAAAAAGGAAACTAATT0.302500.131400.500000.500001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529GCUGGAAUUCUUUCUAACC70.76071831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381547GCTGGAATTCTTTCTAACCGGTTAGAAAGAATTCCAGC0.034000.002400.500000.500001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867UCCACGACUAGUUCAGUUG59.21533016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101885TCCACGACTAGTTCAGTTGCAACTGAACTAGTCGTGGA0.022500.001400.724100.500001.000001.00000


Target Position: 3548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548GAUAUGUAUGGGUAGGGUA95.804852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533566GATATGTATGGGTAGGGTATACCCTACCCATACATATC0.133700.058500.500000.750001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235GCUUUAGUAAAUAUAAUGA91.5332136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651253GCTTTAGTAAATATAATGATCATTATATTTACTAAAGC0.197400.023300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1233-1255AAGCTTTAGTAAATATAATGAGGUCAUUAUAUUUACUAAAGCUUGCUUUAGUAAAUAUAAUGAGGU0.09.822


Target Position: 2942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942UGAACUUGCAUUGUGAUUG59.45113000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582960TGAACTTGCATTGTGATTGCAATCACAATGCAAGTTCA0.119700.020400.577600.500001.000001.00000


Target Position: 3375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3375AGAACACUAAUUCAUAAUC70.38271878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683393AGAACACTAATTCATAATCGATTATGAATTAGTGTTCT0.302300.068100.543100.500000.934800.62500


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CAGGAUACCCAGCGCCGUA86.2748395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691919CAGGATACCCAGCGCCGTATACGGCGCTGGGTATCCTG0.044700.007200.603400.750000.972800.62500


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927ACCUUUCCCAUCAUCGUGA71.95011700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824945ACCTTTCCCATCATCGTGATCACGATGATGGGAAAGGT0.145600.040800.629300.500001.000001.00000


Target Position: 3378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3378ACACUAAUUCAUAAUCACU83.3544607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173396ACACTAATTCATAATCACTAGTGATTATGAATTAGTGT0.644000.105900.500000.500001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801UGGAUUGAUUCGAAAUCUU76.57211212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5291819TGGATTGATTCGAAATCTTAAGATTTCGAATCAATCCA0.246700.013700.706900.750001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522CUGUGCAGCUGGAAUUCUU83.335610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961540CTGTGCAGCTGGAATTCTTAAGAATTCCAGCTGCACAG0.041200.004400.646600.750001.000001.00000


Target Position: 2645, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645CCAGUUUGGGUAAAAUACU76.38941223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362663CCAGTTTGGGTAAAATACTAGTATTTTACCCAAACTGG0.159100.004400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2643-2665AGCCAGTTTGGGTAAAATACTTTAGUAUUUUACCCAAACUGGCUCCAGUUUGGGUAAAAUACUUUU-0.316.733


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521CCUGUGCAGCUGGAAUUCU72.26771670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461539CCTGTGCAGCTGGAATTCTAGAATTCCAGCTGCACAGG0.032600.003700.620700.750001.000001.00000


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887UUUGCUGUUUUAAACAUUA77.63521093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412905TTTGCTGTTTTAAACATTATAATGTTTAAAACAGCAAA0.240200.001500.465500.500000.989100.62500


Target Position: 3515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3515UCUAUUUCAUGUUUUUGAU74.82971395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183533TCTATTTCATGTTTTTGATATCAAAAACATGAAATAGA0.071400.005200.543100.750001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617GCUCAUCCCACUAAUGUCC64.17742563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
896635GCTCATCCCACTAATGTCCGGACATTAGTGGGATGAGC0.033500.016700.482800.500000.972800.75000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827GCUAUCAUGCGUUCUCCUC66.95852269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691845GCTATCATGCGTTCTCCTCGAGGAGAACGCATGATAGC0.111200.006200.543100.750001.000001.00000


Target Position: 3476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476UUAGUUUCCUUUUUAAUAU73.16881576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643494TTAGTTTCCTTTTTAATATATATTAAAAAGGAAACTAA0.106300.064800.491400.500001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863GUACGUACCAUGCAGAAUA92.4127113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828881GTACGTACCATGCAGAATATATTCTGCATGGTACGTAC0.084700.002600.637900.750001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GUUAAUAAGGCUGCAGUUA81.7877725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
628788GTTAATAAGGCTGCAGTTATAACTGCAGCCTTATTAAC0.075700.029900.612100.750001.000001.00000


Target Position: 3690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3690UUCAGAAUUAAACUUUUAA76.9571172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5593708TTCAGAATTAAACTTTTAATTAAAAGTTTAATTCTGAA0.097600.076100.637900.500001.000001.00000


Target Position: 1821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1821CCCUUUGUCCCGCAAAUCA79.1388968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441839CCCTTTGTCCCGCAAATCATGATTTGCGGGACAAAGGG0.099100.027500.767200.750001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GGUGAAAAUGCUUGGUUCA89.6454215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531006GGTGAAAATGCTTGGTTCATGAACCAAGCATTTTCACC0.013000.003700.629300.750001.000001.00000


Target Position: 21, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
21CGACUUAUAAGAGCUCCUU79.8062908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64639CGACTTATAAGAGCTCCTTAAGGAGCTCTTATAAGTCG0.071100.009700.655201.000001.000001.00000


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410GUCUUUGGACUCUCAGGAA90.8199150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921428GTCTTTGGACTCTCAGGAATTCCTGAGAGTCCAAAGAC0.099500.006200.646600.750000.989100.62500


Target Position: 2595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GGUUUGAUACUGACCUGUA99.813813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822613GGTTTGATACTGACCTGTATACAGGTCAGTATCAAACC0.042700.020900.672401.000001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139GCACAAGAAUGGAUCACAA102.4575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6393157GCACAAGAATGGATCACAATTGTGATCCATTCTTGTGC0.072100.030000.706901.000001.000001.00000


Target Position: 1956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1956GGGUCCGCAUGGAAGAAAU84.2216531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081974GGGTCCGCATGGAAGAAATATTTCTTCCATGCGGACCC0.561300.003200.982801.000000.902200.87500


Target Position: 3188, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188GUUAAAUUUUUUUUUUUUU76.18371244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3923206GTTAAATTTTTTTTTTTTTAAAAAAAAAAAAATTTAAC0.486000.201700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3186-3208TTGTTAAATTTTTTTTTTTTTTTAAAAAAAAAAAAAUUUAACAAGUUAAAUUUUUUUUUUUUUUUU-11.3-9.710


Target Position: 3437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3437GCCUUUUUGUAUAAAAUAG77.07641160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3893455GCCTTTTTGTATAAAATAGCTATTTTATACAAAAAGGC0.340300.032300.827600.750001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CCUGAACUGACAAAACUGC63.45792634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876746CCTGAACTGACAAAACTGCGCAGTTTTGTCAGTTCAGG0.418900.180200.491400.500001.000001.00000


Target Position: 3569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3569UCAGUAAGAGGUGUUAUUU73.16671578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853587TCAGTAAGAGGTGTTATTTAAATAACACCTCTTACTGA0.024800.009200.724100.750001.000001.00000


Target Position: 1543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543UAACCUCACUUGCAAUAAU80.893811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611561TAACCTCACTTGCAATAATATTATTGCAAGTGAGGTTA0.196400.020500.525900.500001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608CCUGUAAAUCAUCCUUUAG75.451324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992626CCTGTAAATCATCCTTTAGCTAAAGGATGATTTACAGG0.059200.013000.672400.750001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310UCUGUCUGCUCUAGUAAUA81.1893784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781328TCTGTCTGCTCTAGTAATATATTACTAGAGCAGACAGA0.155400.006500.681000.750001.000001.00000


Target Position: 2057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057CCAUUGUUUGUGCAGCUGC61.31192831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8812075CCATTGTTTGTGCAGCTGCGCAGCTGCACAAACAATGG0.025000.005100.491400.500000.945700.75000


Target Position: 2739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739ACAAAAACAGGUAUAUACU79.6207925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7772757ACAAAAACAGGTATATACTAGTATATACCTGTTTTTGT0.131400.088100.500000.500001.000001.00000


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056UCCAUUGUUUGUGCAGCUG52.32623392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822074TCCATTGTTTGTGCAGCTGCAGCTGCACAAACAATGGA0.024900.005100.586200.500001.000001.00000


Target Position: 3689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689GUUCAGAAUUAAACUUUUA93.378886

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3687-3709TGGTTCAGAATTAAACTTTTAATUAAAAGUUUAAUUCUGAACCAGUUCAGAAUUAAACUUUUAAUU3.220.422


Target Position: 1959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959UCCGCAUGGAAGAAAUAGU65.86712396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331977TCCGCATGGAAGAAATAGTACTATTTCTTCCATGCGGA0.583800.051800.663800.500000.929300.62500


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181CUUGCUUGUUAAAUUUUUU79.6977918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4773199CTTGCTTGTTAAATTTTTTAAAAAATTTAACAAGCAAG0.396500.076100.637900.750001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043CUCCACAACCUUUUAUUAC66.18112352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721061CTCCACAACCTTTTATTACGTAATAAAAGGTTGTGGAG0.172400.013300.629300.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440GAUACCUCCCAAGUCCUGU71.44691759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
920458GATACCTCCCAAGTCCTGTACAGGACTTGGGAGGTATC0.078800.001600.474100.500001.000001.00000


Target Position: 2643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643AGCCAGUUUGGGUAAAAUA86.5784373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892661AGCCAGTTTGGGTAAAATATATTTTACCCAAACTGGCT0.042000.004100.810300.750000.989100.75000


Target Position: 3386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386UCAUAAUCACUCUAAUUAA93.41485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2533404TCATAATCACTCTAATTAATTAATTAGAGTGATTATGA0.219100.160500.689700.750001.000001.00000


Target Position: 3402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3402UAAUUGUAAUCUGAAUAAA86.2032403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813420TAATTGTAATCTGAATAAATTTATTCAGATTACAATTA0.074300.020100.534500.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744UGCUAAAUGACGAGGACCA77.10711154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933762TGCTAAATGACGAGGACCATGGTCCTCGTCATTTAGCA0.016300.009100.508600.500001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624UAGGUAAGAAGUUUUAAAA85.4749447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772642TAGGTAAGAAGTTTTAAAATTTTAAAACTTCTTACCTA0.438700.023400.672400.500001.000001.00000


Target Position: 2236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236UGCUGUUUUGUUCCGAAUG57.34783127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662254TGCTGTTTTGTTCCGAATGCATTCGGAACAAAACAGCA0.028000.003700.698300.500001.000001.00000


Target Position: 2850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CCACAGCUUUUGCAACUUA91.5387135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5832868CCACAGCTTTTGCAACTTATAAGTTGCAAAAGCTGTGG0.086800.017700.810301.000000.913000.75000


Target Position: 3399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3399AAUUAAUUGUAAUCUGAAU86.5228380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133417AATTAATTGTAATCTGAATATTCAGATTACAATTAATT0.084100.036000.500000.500001.000001.00000


Target Position: 3255, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255GCUCUUUUUUUUUUUUUUU75.93311267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293273GCTCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGAGC0.992200.797800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3253-3275TAGCTCTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGAGCUAGCUCUUUUUUUUUUUUUUUUUU-11.310.300


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808AUUCGAAAUCUUGCCCUUU67.05632255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701826ATTCGAAATCTTGCCCTTTAAAGGGCAAGATTTCGAAT0.178700.119300.508600.500001.000001.00000


Target Position: 3472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472CCAAUUAGUUUCCUUUUUA90.7997151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2983490CCAATTAGTTTCCTTTTTATAAAAAGGAAACTAATTGG0.189200.157000.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3470-3492GTCCAATTAGTTTCCTTTTTAATUAAAAAGGAAACUAAUUGGACCCAAUUAGUUUCCUUUUUAAUU9.53.522


Target Position: 95, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
95GGAGCGGAGAGCGAGGGGA73.00281592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
869113GGAGCGGAGAGCGAGGGGATCCCCTCGCTCTCCGCTCC0.026400.003300.500000.750000.972800.87500


Target Position: 3244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3244GCUUUGAAGUAGCUCUUUU86.5425378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4383262GCTTTGAAGTAGCTCTTTTAAAAGAGCTACTTCAAAGC0.233200.020500.853401.000000.989100.62500


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GCAAGCUUUAGGACUUCAC67.84222164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531375GCAAGCTTTAGGACTTCACGTGAAGTCCTAAAGCTTGC0.048800.025500.560300.750000.945700.62500


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434CAGAUGCUGCAACUAAACA88.2659290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261452CAGATGCTGCAACTAAACATGTTTAGTTGCAGCATCTG0.191600.021900.577600.500000.978300.62500


Target Position: 1386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386CAAGUCAACGUCUUGUUCA87.8323308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1384-1406TCCAAGTCAACGTCTTGTTCAGAUGAACAAGACGUUGACUUGGACAAGUCAACGUCUUGUUCAGAU19.219.233


Target Position: 685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685GAUUAACUAUCAAGAUGAU97.335433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824703GATTAACTATCAAGATGATATCATCTTGATAGTTAATC0.041300.005500.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
683-705TTGATTAACTATCAAGATGATGCAUCAUCUUGAUAGUUAAUCAAGAUUAACUAUCAAGAUGAUGCU20.44.623


Target Position: 2910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2910CAGCCUUUCUCUCUUUAUA94.693867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132928CAGCCTTTCTCTCTTTATATATAAAGAGAGAAAGGCTG0.436100.108800.741400.750001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231ACUGACUUUGCUUGCUUUG57.30373134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393249ACTGACTTTGCTTGCTTTGCAAAGCAAGCAAAGTCAGT0.042800.014800.560300.500001.000001.00000


Target Position: 3606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606GUUUACCAGUUGCCUUUUA82.8859640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5133624GTTTACCAGTTGCCTTTTATAAAAGGCAACTGGTAAAC0.314700.084200.612100.750001.000001.00000


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524GUGCAGCUGGAAUUCUUUC67.25142237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521542GTGCAGCTGGAATTCTTTCGAAAGAATTCCAGCTGCAC0.100400.004000.620700.500001.000001.00000


Target Position: 3672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3672UGCGGUUAUAAAAAAUGGU63.86542596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7683690TGCGGTTATAAAAAATGGTACCATTTTTTATAACCGCA0.393600.037300.500000.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GUAAACUUGAUUAACUAUC64.98252488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917695GTAAACTTGATTAACTATCGATAGTTAATCAAGTTTAC0.018900.003000.500000.500001.000001.00000


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725GCCUUCACUAUGGACUACC58.5773050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291743GCCTTCACTATGGACTACCGGTAGTCCATAGTGAAGGC0.016800.001300.646600.500000.945700.75000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GUGCAGCUGCUUUAUUCUC67.95282144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042084GTGCAGCTGCTTTATTCTCGAGAATAAAGCAGCTGCAC0.200700.014100.482800.500000.956500.75000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052CUUUUAUUACAUCAAGAAG74.60311422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001070CTTTTATTACATCAAGAAGCTTCTTGATGTAATAAAAG0.140200.047000.500000.500001.000001.00000


Target Position: 3470, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3470GUCCAAUUAGUUUCCUUUU76.71921201

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8347019GTCCAATTAGTTTCCTTTT1/1/0/097.75CTNNB1NM_001904.3+NM_001098210.1+NM_001098209.11+1+1NANANA3:41281689..41281707(+)00CTNNB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2973488GTCCAATTAGTTTCCTTTTAAAAGGAAACTAATTGGAC0.189400.160000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3468-3490TGGTCCAATTAGTTTCCTTTTTAAAAAGGAAACUAAUUGGACCAGUCCAAUUAGUUUCCUUUUUAU18.720.122


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383GCCACUACCACAGCUCCUU71.711726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772401GCCACTACCACAGCTCCTTAAGGAGCTGTGGTAGTGGC0.316800.003700.862101.000000.972800.62500


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632AAGUUUUAAAAAGCCAGUU66.30322336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482650AAGTTTTAAAAAGCCAGTTAACTGGCTTTTTAAAACTT0.113500.077300.491400.500001.000001.00000


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263CAAGCCACAAGAUUACAAG74.86971389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372281CAAGCCACAAGATTACAAGCTTGTAATCTTGTGGCTTG0.557300.045900.508600.500001.000001.00000


Target Position: 3645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645GCUGUGAUACGAUGCUUCA91.2537143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943663GCTGTGATACGATGCTTCATGAAGCATCGTATCACAGC0.084200.040300.629300.750001.000001.00000


Target Position: 3300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3300AAGUCUCUCGUAGUGUUAA85.5176445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773318AAGTCTCTCGTAGTGTTAATTAACACTACGAGAGACTT0.025500.001700.603400.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679CUGACCAGCCGACACCAAG65.80492404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291697CTGACCAGCCGACACCAAGCTTGGTGTCGGCTGGTCAG0.305100.115500.646600.500000.967400.62500


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918CCUUGCAUAACCUUUCCCA80.4456850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789936CCTTGCATAACCTTTCCCATGGGAAAGGTTATGCAAGG0.226700.026000.500000.750001.000001.00000


Target Position: 2891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891CUGUUUUAAACAUUAAUAG72.59341625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372909CTGTTTTAAACATTAATAGCTATTAATGTTTAAAACAG0.016000.011700.612100.500001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735UGACAAAACUGCUAAAUGA90.1821177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831753TGACAAAACTGCTAAATGATCATTTAGCAGTTTTGTCA0.462900.335800.500000.500001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277ACAAGAAACGGCUUUCAGU75.16191359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042295ACAAGAAACGGCTTTCAGTACTGAAAGCCGTTTCTTGT0.021800.007200.500000.500000.951100.87500


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380CAGAUCCAAGUCAACGUCU75.68631296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251398CAGATCCAAGTCAACGTCTAGACGTTGACTTGGATCTG0.056100.012800.560300.500001.000001.00000


Target Position: 915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915GGACCUUGCAUAACCUUUC71.57331747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494933GGACCTTGCATAACCTTTCGAAAGGTTATGCAAGGTCC0.304300.032400.698300.750001.000001.00000


Target Position: 3258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3258CUUUUUUUUUUUUUUUUUU70.15911899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4503276CTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAG0.972600.910300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3256-3278CTCTTTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAGAGCUUUUUUUUUUUUUUUUUUUUU-11.3-11.300


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250AAGUAGCUCUUUUUUUUUU77.38741127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073268AAGTAGCTCTTTTTTTTTTAAAAAAAAAAGAGCTACTT0.936200.077500.637900.500001.000001.00000


Target Position: 3183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183UGCUUGUUAAAUUUUUUUU66.79422282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2263201TGCTTGTTAAATTTTTTTTAAAAAAAATTTAACAAGCA0.441200.095100.853400.750001.000001.00000


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227UGAAGUAUACCAUACAACU81.1363792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
837245TGAAGTATACCATACAACTAGTTGTATGGTATACTTCA0.422800.048600.517200.500000.956500.75000


Target Position: 2899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899AACAUUAAUAGCAGCCUUU74.15111470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8732917AACATTAATAGCAGCCTTTAAAGGCTGCTATTAATGTT0.026100.002500.646600.500001.000001.00000


Target Position: 3512, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3512GGAUCUAUUUCAUGUUUUU93.520984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6533530GGATCTATTTCATGTTTTTAAAAACATGAAATAGATCC0.122100.007300.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3510-3532GTGGATCTATTTCATGTTTTTGAAAAAACAUGAAAUAGAUCCACGGAUCUAUUUCAUGUUUUUGAU5.315.913


Target Position: 2782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2782UGGAAUGUUCUCAGAUUUC63.95312589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342800TGGAATGTTCTCAGATTTCGAAATCTGAGAACATTCCA0.016200.001600.672400.500001.000001.00000


Target Position: 3605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3605AGUUUACCAGUUGCCUUUU69.80091938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2033623AGTTTACCAGTTGCCTTTTAAAAGGCAACTGGTAAACT0.315500.086500.706900.750001.000001.00000


Target Position: 2853, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2853CAGCUUUUGCAACUUAAUA89.7839205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922871CAGCTTTTGCAACTTAATATATTAAGTTGCAAAAGCTG0.159300.016200.741400.750000.913000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2851-2873CACAGCTTTTGCAACTTAATACTUAUUAAGUUGCAAAAGCUGUGCAGCUUUUGCAACUUAAUACUU4.617.022


Target Position: 3019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3019CACACUAACCAAGCUGAGU74.27261460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933037CACACTAACCAAGCTGAGTACTCAGCTTGGTTAGTGTG0.145000.031500.586200.500001.000001.00000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284GCAGUAACUGUUUUUUAAG76.87731183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003302GCAGTAACTGTTTTTTAAGCTTAAAAAACAGTTACTGC0.190600.015800.715500.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CAGAUCCCAUCUACACAGU77.10061156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718608CAGATCCCATCTACACAGTACTGTGTAGATGGGATCTG0.131700.054300.577600.500000.962000.62500


Target Position: 3568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3568AUCAGUAAGAGGUGUUAUU75.17021357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523586ATCAGTAAGAGGTGTTATTAATAACACCTCTTACTGAT0.027000.010700.672400.500001.000001.00000


Target Position: 231, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231GUAUACCAUACAACUGUUU78.04651056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332249GTATACCATACAACTGTTTAAACAGTTGTATGGTATAC0.446500.055400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
229-251AAGTATACCATACAACTGTTTTGAAACAGUUGUAUGGUAUACUUGUAUACCAUACAACUGUUUUGU17.821.132


Target Position: 3533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3533UCAAAAACUAUUUGGGAUA75.19041350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6023551TCAAAAACTATTTGGGATATATCCCAAATAGTTTTTGA0.103500.010000.681000.750000.951100.62500


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429UCUUUCAGAUGCUGCAACU70.83941826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8011447TCTTTCAGATGCTGCAACTAGTTGCAGCATCTGAAAGA0.087100.015500.517200.500000.994601.00000


Target Position: 3662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3662CAAGAGAAAAUGCGGUUAU80.1655873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643680CAAGAGAAAATGCGGTTATATAACCGCATTTTCTCTTG0.045600.030900.603400.750001.000001.00000


Target Position: 3248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248UGAAGUAGCUCUUUUUUUU79.8041910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3423266TGAAGTAGCTCTTTTTTTTAAAAAAAAGAGCTACTTCA0.912000.048800.724100.750001.000001.00000


Target Position: 3618, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3618CCUUUUAUCCCAAAGUUGU73.99291488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103636CCTTTTATCCCAAAGTTGTACAACTTTGGGATAAAAGG0.107600.093200.637900.750000.913000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3616-3638TGCCTTTTATCCCAAAGTTGTTGACAACUUUGGGAUAAAAGGCACCUUUUAUCCCAAAGUUGUUGU10.3-4.321


Target Position: 2745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2745ACAGGUAUAUACUUUGAAA97.274135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3842763ACAGGTATATACTTTGAAATTTCAAAGTATATACCTGT0.276300.075100.706900.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719CGUGCAAUCCCUGAACUGA87.257341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630737CGTGCAATCCCTGAACTGATCAGTTCAGGGATTGCACG0.321800.033900.551700.750000.972800.62500


Target Position: 3339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3339AGCAAUUUCUAAUUUUUAA89.1759249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2253357AGCAATTTCTAATTTTTAATTAAAAATTAGAAATTGCT0.234600.093300.819000.750001.000001.00000


Target Position: 1255, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255GACCUAUACUUACGAAAAA96.260145

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10125519GACCTATACTTACGAAAAA1/1/0/097.21CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41268749..41268767(+)00CTNNB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691273GACCTATACTTACGAAAAATTTTTCGTAAGTATAGGTC0.354500.074700.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1253-1275AGGACCTATACTTACGAAAAACTUUUUUCGUAAGUAUAGGUCCUGACCUAUACUUACGAAAAACUU15.319.832


Target Position: 662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662CUGAAACAUGCAGUUGUAA84.9351483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526680CTGAAACATGCAGTTGTAATTACAACTGCATGTTTCAG0.119200.013900.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
660-682TGCTGAAACATGCAGTTGTAAACUUACAACUGCAUGUUUCAGCACUGAAACAUGCAGUUGUAAACU19.020.532


Target Position: 3407, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3407GUAAUCUGAAUAAAGUGUA86.0109416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113425GTAATCTGAATAAAGTGTATACACTTTATTCAGATTAC0.061400.030400.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3405-3427TTGTAATCTGAATAAAGTGTAACUACACUUUAUUCAGAUUACAAGUAAUCUGAAUAAAGUGUAACU17.813.412


Target Position: 1024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024GUUUUAUGCCAUUACAACU83.186617

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1022-1044TTGTTTTATGCCATTACAACTCTAGUUGUAAUGGCAUAAAACAAGUUUUAUGCCAUUACAACUCUU14.7-1.432


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658GCCAUCUGUGCUCUUCGUC62.2852749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181676GCCATCTGTGCTCTTCGTCGACGAAGAGCACAGATGGC0.018900.017700.681000.750001.000001.00000


Target Position: 3301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301AGUCUCUCGUAGUGUUAAG72.46411645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9023319AGTCTCTCGTAGTGTTAAGCTTAACACTACGAGAGACT0.053000.001500.569000.500001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889UGUAGAAACAGCUCGUUGU72.93241599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852907TGTAGAAACAGCTCGTTGTACAACGAGCTGTTTCTACA0.030800.007500.500000.500001.000001.00000


Target Position: 3550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550UAUGUAUGGGUAGGGUAAA76.33051227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803568TATGTATGGGTAGGGTAAATTTACCCTACCCATACATA0.125600.069100.543100.500001.000001.00000


Target Position: 2706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2706GUGGGAGUGGUUUAGGCUA84.8522488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322724GTGGGAGTGGTTTAGGCTATAGCCTAAACCACTCCCAC0.016400.002500.620700.750001.000001.00000


Target Position: 3688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3688GGUUCAGAAUUAAACUUUU91.9557125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3393706GGTTCAGAATTAAACTTTTAAAAGTTTAATTCTGAACC0.170900.098300.853401.000000.929300.62500


Target Position: 3526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3526UUUUUGAUCAAAAACUAUU67.1822245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733544TTTTTGATCAAAAACTATTAATAGTTTTTGATCAAAAA0.040700.011600.491400.500001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044ACUAAAUACCAUUCCAUUG69.26221993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852062ACTAAATACCATTCCATTGCAATGGAATGGTATTTAGT0.101000.040800.560300.500001.000001.00000


Target Position: 3612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3612CAGUUGCCUUUUAUCCCAA90.2115176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4403630CAGTTGCCTTTTATCCCAATTGGGATAAAAGGCAACTG0.245200.100200.637900.750001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682ACCAGCCGACACCAAGAAG60.22382917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561700ACCAGCCGACACCAAGAAGCTTCTTGGTGTCGGCTGGT0.214200.122800.715500.500000.967400.62500


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CCACUACCACAGCUCCUUC72.59251626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
633402CCACTACCACAGCTCCTTCGAAGGAGCTGTGGTAGTGG0.313100.008200.672400.750001.000001.00000


Target Position: 3153, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153CACAAGAUGGAAUUUAUCA90.4883163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5953171CACAAGATGGAATTTATCATGATAAATTCCATCTTGTG0.154800.033300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3151-3173ATCACAAGATGGAATTTATCAAAUGAUAAAUUCCAUCUUGUGAUCACAAGAUGGAAUUUAUCAAAU1.819.223


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351GAUCUUGGACUUGAUAUUG74.8491392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312369GATCTTGGACTTGATATTGCAATATCAAGTCCAAGATC0.077300.007800.534500.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686GCCGACACCAAGAAGCAGA78.10151053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541704GCCGACACCAAGAAGCAGATCTGCTTCTTGGTGTCGGC0.096100.041900.775900.750000.989100.87500


Target Position: 3242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242UUGCUUUGAAGUAGCUCUU63.06532671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413260TTGCTTTGAAGTAGCTCTTAAGAGCTACTTCAAAGCAA0.075000.011300.508600.500000.918500.75000


Target Position: 2799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799UCUGGUUGUUAUGUGAUCA79.0765972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632817TCTGGTTGTTATGTGATCATGATCACATAACAACCAGA0.179800.076800.500000.500001.000001.00000


Target Position: 2711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2711AGUGGUUUAGGCUAUUUGU76.5811210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912729AGTGGTTTAGGCTATTTGTACAAATAGCCTAAACCACT0.033000.001600.500000.500001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830AUUAACUUUAAUGUUUUUU59.38713004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402848ATTAACTTTAATGTTTTTTAAAAAACATTAAAGTTAAT0.106700.032700.508600.500001.000001.00000


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149UGGCUAUUACGACAGACUG66.7492285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501167TGGCTATTACGACAGACTGCAGTCTGTCGTAATAGCCA0.050200.006700.560300.500000.994600.62500


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174CCCUAGCCUUGCUUGUUAA90.382166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5043192CCCTAGCCTTGCTTGTTAATTAACAAGCAAGGCTAGGG0.110400.042000.956901.000000.967401.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CCUGCCAUCUGUGCUCUUC63.9592588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211673CCTGCCATCTGTGCTCTTCGAAGAGCACAGATGGCAGG0.056800.002800.672400.750000.983700.87500


Target Position: 23, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
23ACUUAUAAGAGCUCCUUGU73.15461582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
81941ACTTATAAGAGCTCCTTGTACAAGGAGCTCTTATAAGT0.062500.004900.500000.500001.000001.00000


Target Position: 2882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882UAACAUUUGCUGUUUUAAA84.1811534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032900TAACATTTGCTGTTTTAAATTTAAAACAGCAAATGTTA0.078500.003200.534500.500000.934800.62500


Target Position: 2670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2670CUGCCUACAGAACUUCAGA83.7608570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8542688CTGCCTACAGAACTTCAGATCTGAAGTTCTGTAGGCAG0.165100.010700.560300.500001.000001.00000


Target Position: 3521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3521UCAUGUUUUUGAUCAAAAA86.7445366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5573539TCATGTTTTTGATCAAAAATTTTTGATCAAAAACATGA0.109000.012400.724100.750001.000001.00000


Target Position: 2266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2266GCCACAAGAUUACAAGAAA96.005647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352284GCCACAAGATTACAAGAAATTTCTTGTAATCTTGTGGC0.670200.457401.000001.000001.000001.00000


Target Position: 3387, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3387CAUAAUCACUCUAAUUAAU92.5971108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3933405CATAATCACTCTAATTAATATTAATTAGAGTGATTATG0.212500.147800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3385-3407TTCATAATCACTCTAATTAATTGAUUAAUUAGAGUGAUUAUGAACAUAAUCACUCUAAUUAAUUGU-7.58.732


Target Position: 2941, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2941CUGAACUUGCAUUGUGAUU72.70761616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3902959CTGAACTTGCATTGTGATTAATCACAATGCAAGTTCAG0.146800.034700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2939-2961GTCTGAACTTGCATTGTGATTGGAAUCACAAUGCAAGUUCAGACCUGAACUUGCAUUGUGAUUGGU20.519.223


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CUUAUGGCAACCAAGAAAG64.55852536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701200CTTATGGCAACCAAGAAAGCTTTCTTGGTTGCCATAAG0.130100.010500.500000.500000.983701.00000


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493UCAAGAACAAGUAGCUGAU75.87751277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656511TCAAGAACAAGTAGCTGATATCAGCTACTTGTTCTTGA0.086200.081700.543100.750001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691CUAUCAAGAUGAUGCAGAA102.5744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851709CTATCAAGATGATGCAGAATTCTGCATCATCTTGATAG0.040900.002900.500000.750001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548UCACUUGCAAUAAUUAUAA80.827813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421566TCACTTGCAATAATTATAATTATAATTATTGCAAGTGA0.770000.020100.689700.750001.000001.00000


Target Position: 2060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2060UUGUUUGUGCAGCUGCUUU65.70052411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962078TTGTTTGTGCAGCTGCTTTAAAGCAGCTGCACAAACAA0.111000.015500.646600.500000.956500.87500


Target Position: 3334, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3334GCUACAGCAAUUUCUAAUU81.7537726

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7333419GCTACAGCAATTTCTAATT1/1/0/097.75CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41281553..41281571(+)00CTNNB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3183352GCTACAGCAATTTCTAATTAATTAGAAATTGCTGTAGC0.181000.085100.844801.000001.000001.00000


Target Position: 3408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3408UAAUCUGAAUAAAGUGUAA90.6647154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943426TAATCTGAATAAAGTGTAATTACACTTTATTCAGATTA0.041200.016500.500000.500001.000001.00000


Target Position: 3087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3087CGAGGAGUAACAAUACAAA99.404616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123105CGAGGAGTAACAATACAAATTTGTATTGTTACTCCTCG0.222200.009400.793101.000000.983700.87500


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666AACAUGCAGUUGUAAACUU79.3169955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888684AACATGCAGTTGTAAACTTAAGTTTACAACTGCATGTT0.024500.002300.508600.500001.000001.00000


Target Position: 3665, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3665GAGAAAAUGCGGUUAUAAA100.10611

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9366519GAGAAAATGCGGTTATAAA1/1/0/097.75CTNNB1NM_001904.3+NM_001098210.1+NM_001098209.11+1+1NANANA3:41281884..41281902(+)00CTNNB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6723683GAGAAAATGCGGTTATAAATTTATAACCGCATTTTCTC0.066500.035000.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3663-3685AAGAGAAAATGCGGTTATAAAAAUUUAUAACCGCAUUUUCUCUUGAGAAAAUGCGGUUAUAAAAAU1.45.322


Target Position: 2713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2713UGGUUUAGGCUAUUUGUAA85.4947446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8512731TGGTTTAGGCTATTTGTAATTACAAATAGCCTAAACCA0.088500.002200.810300.750001.000001.00000


Target Position: 2791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791CUCAGAUUUCUGGUUGUUA85.9471422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292809CTCAGATTTCTGGTTGTTATAACAACCAGAAATCTGAG0.211900.002600.775900.750000.913000.75000


Target Position: 664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664GAAACAUGCAGUUGUAAAC77.62311095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846682GAAACATGCAGTTGTAAACGTTTACAACTGCATGTTTC0.037900.003400.525900.500001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554GCUGCUAUGUUCCCUGAGA86.1693406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928572GCTGCTATGTTCCCTGAGATCTCAGGGAACATAGCAGC0.017000.001400.629300.750001.000001.00000


Target Position: 3449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3449AAAAUAGACAAAUAGAAAA89.1522251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013467AAAATAGACAAATAGAAAATTTTCTATTTGTCTATTTT0.070600.016100.500000.500001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670UGCAGUUGUAAACUUGAUU70.94391817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738688TGCAGTTGTAAACTTGATTAATCAAGTTTACAACTGCA0.052600.013000.844800.750001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259AGCGUGGACAAUGGCUACU63.03652675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916277AGCGTGGACAATGGCTACTAGTAGCCATTGTCCACGCT0.019000.003700.646600.500001.000001.00000


Target Position: 3582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3582UUAUUUGGAACCUUGUUUU65.63522418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243600TTATTTGGAACCTTGTTTTAAAACAAGGTTCCAAATAA0.017700.001500.534500.500001.000001.00000


Target Position: 3509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3509GGUGGAUCUAUUUCAUGUU88.172294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7043527GGTGGATCTATTTCATGTTAACATGAAATAGATCCACC0.124800.005700.706901.000001.000001.00000


Target Position: 3482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3482UCCUUUUUAAUAUGCUUAA74.67491411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7213500TCCTTTTTAATATGCTTAATTAAGCATATTAAAAAGGA0.055900.024600.836200.750001.000001.00000


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215GAAUAUCUGUAAUGGUACU90.1706180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533233GAATATCTGTAATGGTACTAGTACCATTACAGATATTC0.114700.059400.465500.500001.000001.00000


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982GGUUGUACCGGAGCCCUUC66.25882344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092000GGTTGTACCGGAGCCCTTCGAAGGGCTCCGGTACAACC0.114400.003100.681000.750000.978301.00000


Target Position: 616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616UGCUCAUCCCACUAAUGUC71.2351782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755634TGCTCATCCCACTAATGTCGACATTAGTGGGATGAGCA0.142700.101000.534500.500000.972800.75000


Target Position: 3256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256CUCUUUUUUUUUUUUUUUU71.25171781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3523274CTCTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGAG0.991700.902200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3254-3276AGCTCTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGAGCUCUCUUUUUUUUUUUUUUUUUUU-11.35.500


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756GCUCUUACACCCACCAUCC67.83972166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981774GCTCTTACACCCACCATCCGGATGGTGGGTGTAAGAGC0.099500.083700.482800.500001.000001.00000


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097GGUGGGCUGCAGAAAAUGG69.57391965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461115GGTGGGCTGCAGAAAATGGCCATTTTCTGCAGCCCACC0.191000.005700.508600.500001.000001.00000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716ACACGUGCAAUCCCUGAAC60.62822893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797734ACACGTGCAATCCCTGAACGTTCAGGGATTGCACGTGT0.269400.018100.560300.500000.962000.62500


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709GCCCAGAAUGCAGUUCGCC56.62323175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571727GCCCAGAATGCAGTTCGCCGGCGAACTGCATTCTGGGC0.017700.011000.500000.500000.967400.75000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545AGGGUACGAGCUGCUAUGU68.23762108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915563AGGGTACGAGCTGCTATGTACATAGCAGCTCGTACCCT0.023600.001400.637900.500001.000001.00000


Target Position: 2033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033GUUAUCAGAGGACUAAAUA89.6353216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352051GTTATCAGAGGACTAAATATATTTAGTCCTCTGATAAC0.214900.031300.603400.750000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2031-2053TTGTTATCAGAGGACTAAATACCUAUUUAGUCCUCUGAUAACAAGUUAUCAGAGGACUAAAUACCU4.613.423


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634UGUUGUAACCUGCUGUGAU81.1859786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8583652TGTTGTAACCTGCTGTGATATCACAGCAGGTTACAACA0.028500.003500.525900.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GCUGCAGUUAUGGUCCAUC68.76632053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644797GCTGCAGTTATGGTCCATCGATGGACCATAACTGCAGC0.071200.026800.672400.750001.000001.00000


Target Position: 2349, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349CUGAUCUUGGACUUGAUAU79.5034935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072367CTGATCTTGGACTTGATATATATCAAGTCCAAGATCAG0.253200.057100.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2347-2369TGCTGATCTTGGACTTGATATTGAUAUCAAGUCCAAGAUCAGCACUGAUCUUGGACUUGAUAUUGU13.420.422


Target Position: 2842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2842GUUUUUUGCCACAGCUUUU77.30261134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482860GTTTTTTGCCACAGCTTTTAAAAGCTGTGGCAAAAAAC0.099000.021000.646600.750000.983701.00000


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344GACUGCUGAUCUUGGACUU84.6885501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742362GACTGCTGATCTTGGACTTAAGTCCAAGATCAGCAGTC0.456300.062500.681000.750001.000001.00000


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252GUAGCUCUUUUUUUUUUUU79.5693931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2783270GTAGCTCTTTTTTTTTTTTAAAAAAAAAAAAGAGCTAC0.984900.237200.681000.750001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966GGAAGAAAUAGUUGAAGGU83.997548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291984GGAAGAAATAGTTGAAGGTACCTTCAACTATTTCTTCC0.053900.056800.517200.750001.000001.00000


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930UGGGACACAGCAGCAAUUU63.20722661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451948TGGGACACAGCAGCAATTTAAATTGCTGCTGTGTCCCA0.071100.012100.844800.750001.000001.00000


Target Position: 3473, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473CAAUUAGUUUCCUUUUUAA100.00112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5143491CAATTAGTTTCCTTTTTAATTAAAAAGGAAACTAATTG0.197500.134700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3471-3493TCCAATTAGTTTCCTTTTTAATAUUAAAAAGGAAACUAAUUGGACAAUUAGUUUCCUUUUUAAUAU-3.84.622


Target Position: 3239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3239UGCUUGCUUUGAAGUAGCU70.13791903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883257TGCTTGCTTTGAAGTAGCTAGCTACTTCAAAGCAAGCA0.034600.004000.500000.500000.918500.62500


Target Position: 3072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3072CUGGUCCUUUUUGGUCGAG55.2253251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483090CTGGTCCTTTTTGGTCGAGCTCGACCAAAAAGGACCAG0.036500.001100.474100.500000.989101.00000


Target Position: 3567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3567AAUCAGUAAGAGGUGUUAU79.5752930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9323585AATCAGTAAGAGGTGTTATATAACACCTCTTACTGATT0.038400.009000.465500.500001.000001.00000


Target Position: 2860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860UGCAACUUAAUACUCAAAU66.8112280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632878TGCAACTTAATACTCAAATATTTGAGTATTAAGTTGCA0.045600.043600.844800.750000.956500.62500


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433UCAGAUGCUGCAACUAAAC60.87642872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431451TCAGATGCTGCAACTAAACGTTTAGTTGCAGCATCTGA0.182400.021000.577600.500000.994600.62500


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050ACCUUUUAUUACAUCAAGA84.1491539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791068ACCTTTTATTACATCAAGATCTTGATGTAATAAAAGGT0.159600.068300.629300.500001.000001.00000


Target Position: 3687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3687UGGUUCAGAAUUAAACUUU70.62281846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3453705TGGTTCAGAATTAAACTTTAAAGTTTAATTCTGAACCA0.164400.046500.844800.750000.929300.62500


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UGAGGGUAUUUGAAGUAUA91.3667141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942235TGAGGGTATTTGAAGTATATATACTTCAAATACCCTCA0.136000.001100.681000.750001.000001.00000


Target Position: 2746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2746CAGGUAUAUACUUUGAAAG77.8611073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132764CAGGTATATACTTTGAAAGCTTTCAAAGTATATACCTG0.288500.077900.646600.500001.000001.00000


Target Position: 2949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2949GCAUUGUGAUUGGCCUGUA90.3269170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302967GCATTGTGATTGGCCTGTATACAGGCCAATCACAATGC0.016500.003600.672401.000001.000001.00000


Target Position: 3027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3027CCAAGCUGAGUUUCCUAUG66.95332270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653045CCAAGCTGAGTTTCCTATGCATAGGAAACTCAGCTTGG0.067500.030700.689700.750001.000001.00000


Target Position: 2931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931GCUGUAUUGUCUGAACUUG75.17141356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262949GCTGTATTGTCTGAACTTGCAAGTTCAGACAATACAGC0.090200.002700.706900.750001.000001.00000


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353GAAUGCAAGCUUUAGGACU80.7735821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481371GAATGCAAGCTTTAGGACTAGTCCTAAAGCTTGCATTC0.065200.008000.465500.500001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733ACUGACAAAACUGCUAAAU66.68812292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427751ACTGACAAAACTGCTAAATATTTAGCAGTTTTGTCAGT0.445400.327200.698300.750001.000001.00000


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704GGGUGGGAGUGGUUUAGGC69.02142017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092722GGGTGGGAGTGGTTTAGGCGCCTAAACCACTCCCACCC0.020700.004300.491400.500001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100GGGCUGCAGAAAAUGGUUG66.98932265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641118GGGCTGCAGAAAATGGTTGCAACCATTTTCTGCAGCCC0.030600.002000.844800.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234AGCUUUAGUAAAUAUAAUG74.87791387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041252AGCTTTAGTAAATATAATGCATTATATTTACTAAAGCT0.221700.013500.698300.500001.000001.00000


Target Position: 3195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3195UUUUUUUUUUUUUUUUUUA71.81371715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353213TTTTTTTTTTTTTTTTTTATAAAAAAAAAAAAAAAAAA0.326100.264000.465500.500001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022UUGUUUUAUGCCAUUACAA77.82451074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071040TTGTTTTATGCCATTACAATTGTAATGGCATAAAACAA0.142100.037100.500000.500001.000001.00000


Target Position: 2918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2918CUCUCUUUAUACAGCUGUA95.10756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9432936CTCTCTTTATACAGCTGTATACAGCTGTATAAAGAGAG0.014400.015100.629300.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424AGGAAUCUUUCAGAUGCUG65.10882477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071442AGGAATCTTTCAGATGCTGCAGCATCTGAAAGATTCCT0.039800.004900.560300.500001.000001.00000


Target Position: 1963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1963CAUGGAAGAAAUAGUUGAA96.67941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881981CATGGAAGAAATAGTTGAATTCAACTATTTCTTCCATG0.132200.083300.482800.750001.000001.00000


Target Position: 3394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3394ACUCUAAUUAAUUGUAAUC68.34642094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123412ACTCTAATTAATTGTAATCGATTACAATTAATTAGAGT0.124400.082900.525900.500001.000001.00000


Target Position: 2893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2893GUUUUAAACAUUAAUAGCA84.7705493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2891-2913CTGTTTTAAACATTAATAGCAGCUGCUAUUAAUGUUUAAAACAGGUUUUAAACAUUAAUAGCAGCU14.9-9.122


Target Position: 1957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957GGUCCGCAUGGAAGAAAUA92.0316124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741975GGTCCGCATGGAAGAAATATATTTCTTCCATGCGGACC0.579600.006600.810301.000000.902200.75000


Target Position: 2818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2818UGUGUGGAAGUUAUUAACU71.04371802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422836TGTGTGGAAGTTATTAACTAGTTAATAACTTCCACACA0.033400.004200.500000.500001.000001.00000


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191AAAUUUUUUUUUUUUUUUU74.33011450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363209AAATTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAATTT0.485200.273500.500000.500001.000001.00000


Target Position: 3527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3527UUUUGAUCAAAAACUAUUU68.79972047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373545TTTTGATCAAAAACTATTTAAATAGTTTTTGATCAAAA0.034200.018800.500000.500001.000001.00000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542CUAACCUCACUUGCAAUAA80.8217814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181560CTAACCTCACTTGCAATAATTATTGCAAGTGAGGTTAG0.189000.021800.637900.750001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969AGAAAUAGUUGAAGGUUGU77.59341099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231987AGAAATAGTTGAAGGTTGTACAACCTTCAACTATTTCT0.072700.038600.517200.500001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527CAGCUGGAAUUCUUUCUAA97.475730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071545CAGCTGGAATTCTTTCTAATTAGAAAGAATTCCAGCTG0.055100.003200.750000.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871CAUGCAGAAUACAAAUGAU97.392532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917889CATGCAGAATACAAATGATATCATTTGTATTCTGCATG0.056100.014300.474100.750001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494CAAGAACAAGUAGCUGAUA90.1658182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631512CAAGAACAAGTAGCTGATATATCAGCTACTTGTTCTTG0.074600.073400.603400.750001.000001.00000


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229GUACUGACUUUGCUUGCUU82.5711663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863247GTACTGACTTTGCTTGCTTAAGCAAGCAAAGTCAGTAC0.042300.007700.543100.750001.000001.00000


Target Position: 1223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223GGUGGACCCCAAGCUUUAG70.48821864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871241GGTGGACCCCAAGCTTTAGCTAAAGCTTGGGGTCCACC0.052900.003500.681000.750000.978300.75000


Target Position: 3085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3085GUCGAGGAGUAACAAUACA88.4005282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093103GTCGAGGAGTAACAATACATGTATTGTTACTCCTCGAC0.179300.005500.612100.500000.983700.62500


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042GGACUAAAUACCAUUCCAU93.109995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2812060GGACTAAATACCATTCCATATGGAATGGTATTTAGTCC0.269200.039700.715501.000001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708GGCCCAGAAUGCAGUUCGC66.97782266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071726GGCCCAGAATGCAGTTCGCGCGAACTGCATTCTGGGCC0.021300.014800.577600.500000.951100.75000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862UGUACGUACCAUGCAGAAU73.16711577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853880TGTACGTACCATGCAGAATATTCTGCATGGTACGTACA0.030600.004800.698300.750001.000001.00000


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182UUGCUUGUUAAAUUUUUUU61.14492846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943200TTGCTTGTTAAATTTTTTTAAAAAAATTTAACAAGCAA0.379000.088100.646600.500001.000001.00000


Target Position: 3448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448UAAAAUAGACAAAUAGAAA89.714211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053466TAAAATAGACAAATAGAAATTTCTATTTGTCTATTTTA0.057900.015500.534500.500001.000001.00000


Target Position: 3220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220UCUGUAAUGGUACUGACUU71.81621713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463238TCTGTAATGGTACTGACTTAAGTCAGTACCATTACAGA0.125200.045900.586200.750001.000001.00000


Target Position: 3661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661UCAAGAGAAAAUGCGGUUA70.97541814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593679TCAAGAGAAAATGCGGTTATAACCGCATTTTCTCTTGA0.047200.033100.689700.750001.000001.00000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811CGAAAUCUUGCCCUUUGUC67.36422221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101829CGAAATCTTGCCCTTTGTCGACAAAGGGCAAGATTTCG0.349800.071600.474100.750001.000001.00000


Target Position: 3643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643CUGCUGUGAUACGAUGCUU79.429947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523661CTGCTGTGATACGATGCTTAAGCATCGTATCACAGCAG0.064000.002200.646600.750001.000001.00000


Target Position: 2855, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855GCUUUUGCAACUUAAUACU77.8681071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282873GCTTTTGCAACTTAATACTAGTATTAAGTTGCAAAAGC0.112000.013800.646600.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2853-2875CAGCTTTTGCAACTTAATACTCAAGUAUUAAGUUGCAAAAGCUGGCUUUUGCAACUUAAUACUCAU1.418.623


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962GCAUGGAAGAAAUAGUUGA89.7059212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741980GCATGGAAGAAATAGTTGATCAACTATTTCTTCCATGC0.135000.084000.629300.750001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252GAGGACCUAUACUUACGAA99.641415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451270GAGGACCTATACTTACGAATTCGTAAGTATAGGTCCTC0.256000.036300.637900.750001.000001.00000


Target Position: 1657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657UGCCAUCUGUGCUCUUCGU69.3271989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981675TGCCATCTGTGCTCTTCGTACGAAGAGCACAGATGGCA0.023100.012400.577600.500000.983700.75000


Target Position: 3414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3414GAAUAAAGUGUAACAAUUG83.6598585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7073432GAATAAAGTGTAACAATTGCAATTGTTACACTTTATTC0.064600.021000.525900.500001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262GUGGACAAUGGCUACUCAA90.1171184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834280GTGGACAATGGCTACTCAATTGAGTAGCCATTGTCCAC0.034700.003600.646600.750001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337GGAAUGAGACUGCUGAUCU88.0988299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202355GGAATGAGACTGCTGATCTAGATCAGCAGTCTCATTCC0.159900.009100.646600.750001.000001.00000


Target Position: 2802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802GGUUGUUAUGUGAUCAUGU88.5927273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662820GGTTGTTATGTGATCATGTACATGATCACATAACAACC0.067400.060000.646600.750001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913UGGGACCUUGCAUAACCUU66.07132366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339931TGGGACCTTGCATAACCTTAAGGTTATGCAAGGTCCCA0.641800.032500.706900.750001.000001.00000


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859UUGCAACUUAAUACUCAAA77.7531079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232877TTGCAACTTAATACTCAAATTTGAGTATTAAGTTGCAA0.099000.006700.646600.500000.956500.75000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873UGCAGAAUACAAAUGAUGU75.88871274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745891TGCAGAATACAAATGATGTACATCATTTGTATTCTGCA0.051400.011000.646600.500001.000001.00000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253AGGACCUAUACUUACGAAA83.2529615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721271AGGACCTATACTTACGAAATTTCGTAAGTATAGGTCCT0.280000.059400.844800.750001.000001.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298CUGAAGGUGCUAUCUGUCU74.75811400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8851316CTGAAGGTGCTATCTGTCTAGACAGATAGCACCTTCAG0.142800.001600.560300.500001.000001.00000


Target Position: 2735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735UGCCACAAAAACAGGUAUA75.68861294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222753TGCCACAAAAACAGGTATATATACCTGTTTTTGTGGCA0.194900.009000.810300.750000.994600.75000


Target Position: 3012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3012UGCCUGACACACUAACCAA88.2275291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3793030TGCCTGACACACTAACCAATTGGTTAGTGTGTCAGGCA0.150000.030500.706900.750001.000001.00000


Target Position: 2823, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2823GGAAGUUAUUAACUUUAAU93.595283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902841GGAAGTTATTAACTTTAATATTAAAGTTAATAACTTCC0.062100.007500.862101.000000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2821-2843GTGGAAGTTATTAACTTTAATGTAUUAAAGUUAAUAACUUCCACGGAAGUUAUUAACUUUAAUGUU4.914.612


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UCAUGCGUUCUCCUCAGAU72.82821607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822849TCATGCGTTCTCCTCAGATATCTGAGGAGAACGCATGA0.094300.002800.543100.750000.962000.62500


Target Position: 3194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194UUUUUUUUUUUUUUUUUUU61.69032794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293212TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.512400.233000.500000.500001.000001.00000


Target Position: 2043, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2043GACUAAAUACCAUUCCAUU92.475112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3872061GACTAAATACCATTCCATTAATGGAATGGTATTTAGTC0.147600.050600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2041-2063AGGACTAAATACCATTCCATTGTAAUGGAAUGGUAUUUAGUCCUGACUAAAUACCAUUCCAUUGUU20.14.633


Target Position: 3142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3142CAAGAAUGGAUCACAAGAU89.4659235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273160CAAGAATGGATCACAAGATATCTTGTGATCCATTCTTG0.078200.039700.465500.750001.000001.00000


Target Position: 3053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3053UUGAAGUAAACUUUUUGUU62.77722697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213071TTGAAGTAAACTTTTTGTTAACAAAAAGTTTACTTCAA0.037300.022600.500000.500001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840AUGUUUUUUGCCACAGCUU67.73032179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972858ATGTTTTTTGCCACAGCTTAAGCTGTGGCAAAAAACAT0.091600.014700.517200.500000.967400.62500


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150GGCUAUUACGACAGACUGC71.68821727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621168GGCTATTACGACAGACTGCGCAGTCTGTCGTAATAGCC0.045800.016300.646600.500001.000001.00000


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460UGGACCCCAUGAUGGAACA72.57031631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502478TGGACCCCATGATGGAACATGTTCCATCATGGGGTCCA0.194600.002200.637900.500000.913000.75000


Target Position: 3200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3200UUUUUUUUUUUUUAAGAAU65.3312453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693218TTTTTTTTTTTTTAAGAATATTCTTAAAAAAAAAAAAA0.136900.117300.491400.500001.000001.00000


Target Position: 3025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3025AACCAAGCUGAGUUUCCUA87.118346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443043AACCAAGCTGAGTTTCCTATAGGAAACTCAGCTTGGTT0.095100.036400.474100.500001.000001.00000


Target Position: 3175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175CCUAGCCUUGCUUGUUAAA81.388770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4673193CCTAGCCTTGCTTGTTAAATTTAACAAGCAAGGCTAGG0.120100.042300.844801.000000.967400.87500


Target Position: 2922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2922CUUUAUACAGCUGUAUUGU74.00011486

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2920-2942CTCTTTATACAGCTGTATTGTCTACAAUACAGCUGUAUAAAGAGCUUUAUACAGCUGUAUUGUCUU13.51.423


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262ACUUACGAAAAACUACUGU65.81072402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7971280ACTTACGAAAAACTACTGTACAGTAGTTTTTCGTAAGT0.188100.096900.500000.500001.000001.00000


Target Position: 2854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854AGCUUUUGCAACUUAAUAC70.40051876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662872AGCTTTTGCAACTTAATACGTATTAAGTTGCAAAAGCT0.127300.015300.672400.500000.945700.62500


Target Position: 3675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675GGUUAUAAAAAAUGGUUCA89.6582214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4663693GGTTATAAAAAATGGTTCATGAACCATTTTTTATAACC0.360500.075000.629300.750001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676UGUAAACUUGAUUAACUAU82.6925655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900694TGTAAACTTGATTAACTATATAGTTAATCAAGTTTACA0.022900.005100.663800.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GGAUUCUGUGUUGUUUUAU81.4565764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711030GGATTCTGTGTTGTTTTATATAAAACAACACAGAATCC0.090000.055700.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1010-1032GTGGATTCTGTGTTGTTTTATGCAUAAAACAACACAGAAUCCACGGAUUCUGUGUUGUUUUAUGCU7.220.422


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464AAAAUGGUCCAAUUAGUUU76.92591177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8353482AAAATGGTCCAATTAGTTTAAACTAATTGGACCATTTT0.499900.046100.500000.500001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812UGAUCAUGUGUGGAAGUUA88.3074288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422830TGATCATGTGTGGAAGTTATAACTTCCACACATGATCA0.052200.010600.689700.750001.000001.00000


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149GGAUCACAAGAUGGAAUUU86.6311371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7973167GGATCACAAGATGGAATTTAAATTCCATCTTGTGATCC0.059900.003300.870701.000000.994600.75000


Target Position: 3392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392UCACUCUAAUUAAUUGUAA82.2307691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783410TCACTCTAATTAATTGTAATTACAATTAATTAGAGTGA0.116100.103200.689700.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678UCUGACCAGCCGACACCAA74.34971446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781696TCTGACCAGCCGACACCAATTGGTGTCGGCTGGTCAGA0.456800.092600.577600.750000.978300.75000


Target Position: 3287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287GUAACUGUUUUUUAAGUCU81.2587779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3285-3307CAGTAACTGTTTTTTAAGTCTCTAGACUUAAAAAACAGUUACUGGUAACUGUUUUUUAAGUCUCUU14.619.022


Target Position: 3304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3304CUCUCGUAGUGUUAAGUUA93.830778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553322CTCTCGTAGTGTTAAGTTATAACTTAACACTACGAGAG0.084300.001100.775900.750001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714CCACACGUGCAAUCCCUGA78.7651996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545732CCACACGTGCAATCCCTGATCAGGGATTGCACGTGTGG0.158900.012900.620700.750000.962000.62500


Target Position: 1545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1545ACCUCACUUGCAAUAAUUA88.0053300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241563ACCTCACTTGCAATAATTATAATTATTGCAAGTGAGGT0.720400.021200.819000.750001.000001.00000


Target Position: 3655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655GAUGCUUCAAGAGAAAAUG71.7811718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283673GATGCTTCAAGAGAAAATGCATTTTCTCTTGAAGCATC0.112200.011800.525900.500000.967400.87500


Target Position: 1544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1544AACCUCACUUGCAAUAAUU77.9711063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201562AACCTCACTTGCAATAATTAATTATTGCAAGTGAGGTT0.681400.022500.637900.500001.000001.00000


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546CCUCACUUGCAAUAAUUAU82.9083636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341564CCTCACTTGCAATAATTATATAATTATTGCAAGTGAGG0.769100.020800.801701.000001.000001.00000


Target Position: 3373, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373GUAGAACACUAAUUCAUAA102.7923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623391GTAGAACACTAATTCATAATTATGAATTAGTGTTCTAC0.278000.039500.646600.750000.934800.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3371-3393GTGTAGAACACTAATTCATAATCUUAUGAAUUAGUGUUCUACACGUAGAACACUAAUUCAUAAUCU8.720.332


Target Position: 3234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3234GACUUUGCUUGCUUUGAAG78.13151051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9513252GACTTTGCTTGCTTTGAAGCTTCAAAGCAAGCAAAGTC0.026000.002400.681000.500001.000001.00000


Target Position: 3121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121ACUCAAGAAGUGAAGAAUG70.70651837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403139ACTCAAGAAGTGAAGAATGCATTCTTCACTTCTTGAGT0.112200.002400.551700.500001.000001.00000


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332CUGCUACAGCAAUUUCUAA93.267292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6603350CTGCTACAGCAATTTCTAATTAGAAATTGCTGTAGCAG0.200700.007100.750000.750000.923900.62500


Target Position: 3208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3208UUUUUAAGAAUAUCUGUAA80.7813819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263226TTTTTAAGAATATCTGTAATTACAGATATTCTTAAAAA0.136100.037900.465500.500001.000001.00000


Target Position: 1421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421CUCAGGAAUCUUUCAGAUG70.78921828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231439CTCAGGAATCTTTCAGATGCATCTGAAAGATTCCTGAG0.055700.010800.655200.500001.000001.00000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129AGUGAAGAAUGCACAAGAA97.080636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6893147AGTGAAGAATGCACAAGAATTCTTGTGCATTCTTCACT0.123100.042500.534500.750001.000001.00000


Target Position: 2793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2793CAGAUUUCUGGUUGUUAUG71.68731728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442811CAGATTTCTGGTTGTTATGCATAACAACCAGAAATCTG0.203800.005800.629300.500000.978300.62500


Target Position: 3487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3487UUUAAUAUGCUUAAAAUAA79.8217905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573505TTTAATATGCTTAAAATAATTATTTTAAGCATATTAAA0.034700.008700.465500.500001.000001.00000


Target Position: 3694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3694GAAUUAAACUUUUAAUUCA99.147918

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3692-3714CAGAATTAAACTTTTAATTCATTUGAAUUAAAAGUUUAAUUCUGGAAUUAAACUUUUAAUUCAUUU2.1-9.722


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244AAUAUAAUGAGGACCUAUA92.1427119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251262AATATAATGAGGACCTATATATAGGTCCTCATTATATT0.587900.048700.465500.500001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CACGUGCAAUCCCUGAACU77.88251069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894735CACGTGCAATCCCTGAACTAGTTCAGGGATTGCACGTG0.316900.020700.586200.500000.994600.62500


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866UUCCACGACUAGUUCAGUU69.19711997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501884TTCCACGACTAGTTCAGTTAACTGAACTAGTCGTGGAA0.013400.005300.525900.500001.000001.00000


Target Position: 3091, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3091GAGUAACAAUACAAAUGGA99.813614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3089-3111AGGAGTAACAATACAAATGGATTUCCAUUUGUAUUGUUACUCCUGAGUAACAAUACAAAUGGAUUU17.719.032


Target Position: 3333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3333UGCUACAGCAAUUUCUAAU74.2741459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4583351TGCTACAGCAATTTCTAATATTAGAAATTGCTGTAGCA0.191300.091600.844800.750000.967400.62500


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011UGGAUUCUGUGUUGUUUUA82.0435704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171029TGGATTCTGTGTTGTTTTATAAAACAACACAGAATCCA0.077500.064800.810300.750001.000001.00000


Target Position: 2815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815UCAUGUGUGGAAGUUAUUA80.6858829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132833TCATGTGTGGAAGTTATTATAATAACTTCCACACATGA0.038700.015900.689700.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214AGAAUAUCUGUAAUGGUAC72.8611602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443232AGAATATCTGTAATGGTACGTACCATTACAGATATTCT0.105900.035300.543100.500001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099UGGGCUGCAGAAAAUGGUU68.01552134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101117TGGGCTGCAGAAAATGGTTAACCATTTTCTGCAGCCCA0.086500.003100.698300.750001.000001.00000


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591ACCUUGUUUUGGACAGUUU75.05791368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8603609ACCTTGTTTTGGACAGTTTAAACTGTCCAAAACAAGGT0.112200.002100.853400.750001.000001.00000


Target Position: 3547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3547GGAUAUGUAUGGGUAGGGU83.1247621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333565GGATATGTATGGGTAGGGTACCCTACCCATACATATCC0.126500.043200.517200.750001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GUGGUUAAUAAGGCUGCAG64.08472575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791785GTGGTTAATAAGGCTGCAGCTGCAGCCTTATTAACCAC0.185300.003400.508600.500001.000001.00000


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644GCCAGUUUGGGUAAAAUAC69.39171977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552662GCCAGTTTGGGTAAAATACGTATTTTACCCAAACTGGC0.051300.004000.819000.750000.989100.62500


Target Position: 3507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CAGGUGGAUCUAUUUCAUG76.57811211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693525CAGGTGGATCTATTTCATGCATGAAATAGATCCACCTG0.117500.004300.629300.500001.000001.00000


Target Position: 3187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187UGUUAAAUUUUUUUUUUUU74.50381429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2853205TGTTAAATTTTTTTTTTTTAAAAAAAAAAAATTTAACA0.484200.167200.706900.750001.000001.00000


Target Position: 3336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3336UACAGCAAUUUCUAAUUUU75.31161336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233354TACAGCAATTTCTAATTTTAAAATTAGAAATTGCTGTA0.188900.075800.681000.500001.000001.00000


Target Position: 3557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3557GGGUAGGGUAAAUCAGUAA95.942849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6403575GGGTAGGGTAAATCAGTAATTACTGATTTACCCTACCC0.071800.030900.956901.000001.000001.00000


Target Position: 3021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3021CACUAACCAAGCUGAGUUU83.4933597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4233039CACTAACCAAGCTGAGTTTAAACTCAGCTTGGTTAGTG0.136800.032400.793100.750000.983700.62500


Target Position: 3484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484CUUUUUAAUAUGCUUAAAA86.828363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3482-3504TCCTTTTTAATATGCTTAAAATAUUUUAAGCAUAUUAAAAAGGACUUUUUAAUAUGCUUAAAAUAU13.7-9.112


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GGCUGCAGUUAUGGUCCAU82.2412689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657796GGCTGCAGTTATGGTCCATATGGACCATAACTGCAGCC0.069800.019700.844801.000001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161CAGACUGCCUUCAAAUUUU85.7367430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971179CAGACTGCCTTCAAATTTTAAAATTTGAAGGCAGTCTG0.592400.037500.784500.750001.000001.00000


Target Position: 321, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321GAAAAGCGGCUGUUAGUCA90.5749161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
319-341CAGAAAAGCGGCTGTTAGTCACTUGACUAACAGCCGCUUUUCUGGAAAAGCGGCUGUUAGUCACUU21.419.123


Target Position: 3667, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3667GAAAAUGCGGUUAUAAAAA89.6272218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3733685GAAAATGCGGTTATAAAAATTTTTATAACCGCATTTTC0.153000.036200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3665-3687GAGAAAATGCGGTTATAAAAAATUUUUUAUAACCGCAUUUUCUCGAAAAUGCGGUUAUAAAAAAUU-7.514.032


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607CUUGUGCGUACUGUCCUUC59.85152963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471625CTTGTGCGTACTGTCCTTCGAAGGACAGTACGCACAAG0.043300.006800.465500.500001.000001.00000


Target Position: 790, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790GGUCCAUCAGCUUUCUAAA97.9526

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_279019GGTCCATCAGCTTTCTAAA1/1/0/097.75CTNNB1NM_001904.3+NM_001098210.1+NM_001098209.11+1+1NANANA3:41266851..41266869(+)00CTNNB1(0.002)


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907UACCGCUGGGACCUUGCAU63.022677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947925TACCGCTGGGACCTTGCATATGCAAGGTCCCAGCGGTA0.465100.001100.525900.500001.000001.00000


Target Position: 2600, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2600GAUACUGACCUGUAAAUCA99.016219

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2598-2620TTGATACTGACCTGTAAATCATCUGAUUUACAGGUCAGUAUCAAGAUACUGACCUGUAAAUCAUCU10.020.323


Target Position: 3666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3666AGAAAAUGCGGUUAUAAAA90.1073185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5333684AGAAAATGCGGTTATAAAATTTTATAACCGCATTTTCT0.101500.035900.724100.750001.000001.00000


Target Position: 2031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031UUGUUAUCAGAGGACUAAA79.5846929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912049TTGTTATCAGAGGACTAAATTTAGTCCTCTGATAACAA0.062000.026100.646600.500000.962000.62500


Target Position: 2740, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2740CAAAAACAGGUAUAUACUU87.047350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542758CAAAAACAGGTATATACTTAAGTATATACCTGTTTTTG0.159200.081200.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2738-2760CACAAAAACAGGTATATACTTTGAAGUAUAUACCUGUUUUUGUGCAAAAACAGGUAUAUACUUUGU6.15.622


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949CUUACUGGCCAUCUUUAAG69.78581942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951967CTTACTGGCCATCTTTAAGCTTAAAGATGGCCAGTAAG0.099100.001100.500000.500001.000001.00000


Target Position: 3337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3337ACAGCAAUUUCUAAUUUUU81.7458729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2513355ACAGCAATTTCTAATTTTTAAAAATTAGAAATTGCTGT0.218600.068700.706900.750001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500CAAGUAGCUGAUAUUGAUG79.2967957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879518CAAGTAGCTGATATTGATGCATCAATATCAGCTACTTG0.054400.006300.491400.500001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985CCUGGUGAAAAUGCUUGGU64.20662561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711003CCTGGTGAAAATGCTTGGTACCAAGCATTTTCACCAGG0.132700.002700.491400.750001.000001.00000


Target Position: 682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CUUGAUUAACUAUCAAGAU85.2091468

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
680-702AACTTGATTAACTATCAAGATGAAUCUUGAUAGUUAAUCAAGUUCUUGAUUAACUAUCAAGAUGAU20.48.933


Target Position: 1297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GCUGAAGGUGCUAUCUGUC74.68261409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201315GCTGAAGGTGCTATCTGTCGACAGATAGCACCTTCAGC0.132300.001300.534500.750001.000001.00000


Target Position: 3117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3117AGUGACUCAAGAAGUGAAG64.82282503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443135AGTGACTCAAGAAGTGAAGCTTCACTTCTTGAGTCACT0.047200.001100.569000.500001.000001.00000


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807GAUUCGAAAUCUUGCCCUU85.4003455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611825GATTCGAAATCTTGCCCTTAAGGGCAAGATTTCGAATC0.187800.129500.543100.750001.000001.00000


Target Position: 3078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3078CUUUUUGGUCGAGGAGUAA81.496754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943096CTTTTTGGTCGAGGAGTAATTACTCCTCGACCAAAAAG0.026200.001600.603400.750001.000001.00000


Target Position: 3279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3279UUUUUGCAGUAACUGUUUU65.64872416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303297TTTTTGCAGTAACTGTTTTAAAACAGTTACTGCAAAAA0.035500.020000.500000.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CACUACCACAGCUCCUUCU76.19071241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672403CACTACCACAGCTCCTTCTAGAAGGAGCTGTGGTAGTG0.530900.006600.569000.500001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312UGUCUGCUCUAGUAAUAAG77.12451150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741330TGTCTGCTCTAGTAATAAGCTTATTACTAGAGCAGACA0.066000.011300.569000.500001.000001.00000


Target Position: 2929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929CAGCUGUAUUGUCUGAACU83.918553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8592947CAGCTGTATTGTCTGAACTAGTTCAGACAATACAGCTG0.230600.002100.577600.500001.000001.00000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192CCAAGAAAGCAAGCUCAUC68.76952052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641210CCAAGAAAGCAAGCTCATCGATGAGCTTGCTTTCTTGG0.254300.053700.663800.750001.000001.00000


Target Position: 3692, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3692CAGAAUUAAACUUUUAAUU80.9927802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933710CAGAATTAAACTTTTAATTAATTAAAAGTTTAATTCTG0.023800.017900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3690-3712TTCAGAATTAAACTTTTAATTCAAAUUAAAAGUUUAAUUCUGAACAGAAUUAAACUUUUAAUUCAU-9.76.922


Target Position: 3592, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592CCUUGUUUUGGACAGUUUA87.5037324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7383610CCTTGTTTTGGACAGTTTATAAACTGTCCAAAACAAGG0.594000.004300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3590-3612AACCTTGTTTTGGACAGTTTACCUAAACUGUCCAAAACAAGGUUCCUUGUUUUGGACAGUUUACCU17.810.312


Target Position: 3134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3134AGAAUGCACAAGAAUGGAU80.5084843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623152AGAATGCACAAGAATGGATATCCATTCTTGTGCATTCT0.134400.040500.543100.750001.000001.00000


Target Position: 3391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3391AUCACUCUAAUUAAUUGUA80.9886803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083409ATCACTCTAATTAATTGTATACAATTAATTAGAGTGAT0.125500.113300.500000.500001.000001.00000


Target Position: 2737, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2737CCACAAAAACAGGUAUAUA95.883251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132755CCACAAAAACAGGTATATATATATACCTGTTTTTGTGG0.185400.145100.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2735-2757TGCCACAAAAACAGGTATATACTUAUAUACCUGUUUUUGUGGCACCACAAAAACAGGUAUAUACUU15.212.222


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888UGUUCGUGCACAUCAGGAU76.80911187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091906TGTTCGTGCACATCAGGATATCCTGATGTGCACGAACA0.268600.005600.525900.750000.989100.62500


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661GCUGAAACAUGCAGUUGUA98.865422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740679GCTGAAACATGCAGTTGTATACAACTGCATGTTTCAGC0.113400.004300.672401.000001.000001.00000


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681ACUUCAGAAAGACUUGGUU74.75591401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172699ACTTCAGAAAGACTTGGTTAACCAAGTCTTTCTGAAGT0.056100.025900.560300.750001.000001.00000


Target Position: 3280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280UUUUGCAGUAACUGUUUUU65.43892441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143298TTTTGCAGTAACTGTTTTTAAAAACAGTTACTGCAAAA0.044900.018900.500000.500001.000001.00000


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314GUUAAGUUAUAGUGAAUAC79.8326904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303332GTTAAGTTATAGTGAATACGTATTCACTATAACTTAAC0.041700.009400.465500.500001.000001.00000


Target Position: 3691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3691UCAGAAUUAAACUUUUAAU76.82741186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003709TCAGAATTAAACTTTTAATATTAAAAGTTTAATTCTGA0.059100.046800.715500.750001.000001.00000


Target Position: 3179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179GCCUUGCUUGUUAAAUUUU76.30611228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1853197GCCTTGCTTGTTAAATTTTAAAATTTAACAAGCAAGGC0.309700.063601.000001.000001.000001.00000


Target Position: 594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594UCCCAUCUACACAGUUUGA74.68581408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917612TCCCATCTACACAGTTTGATCAAACTGTGTAGATGGGA0.070900.018700.646600.500000.962000.75000


Target Position: 3611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3611CCAGUUGCCUUUUAUCCCA82.5017670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593629CCAGTTGCCTTTTATCCCATGGGATAAAAGGCAACTGG0.445600.108700.500000.750001.000001.00000


Target Position: 738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CAAAACUGCUAAAUGACGA82.2378690

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
736-758GACAAAACTGCTAAATGACGAGGUCGUCAUUUAGCAGUUUUGUCCAAAACUGCUAAAUGACGAGGU21.110.333


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248UAAUGAGGACCUAUACUUA94.915761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861266TAATGAGGACCTATACTTATAAGTATAGGTCCTCATTA0.161900.020900.500000.500001.000001.00000


Target Position: 2715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715GUUUAGGCUAUUUGUAAAU78.69591003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222733GTTTAGGCTATTTGTAAATATTTACAAATAGCCTAAAC0.076200.011600.637900.750001.000001.00000


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227GACCCCAAGCUUUAGUAAA88.3412286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321245GACCCCAAGCTTTAGTAAATTTACTAAAGCTTGGGGTC0.101500.016200.819000.750001.000001.00000


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664AGAGAAAAUGCGGUUAUAA89.5613223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7143682AGAGAAAATGCGGTTATAATTATAACCGCATTTTCTCT0.056500.032100.689700.750001.000001.00000


Target Position: 3096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096ACAAUACAAAUGGAUUUUG61.51252816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143114ACAATACAAATGGATTTTGCAAAATCCATTTGTATTGT0.019500.010800.560300.500001.000001.00000


Target Position: 2267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2267CCACAAGAUUACAAGAAAC80.2244870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2332285CCACAAGATTACAAGAAACGTTTCTTGTAATCTTGTGG0.466700.411100.698300.750001.000001.00000


Target Position: 3619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3619CUUUUAUCCCAAAGUUGUU77.42761121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3617-3639GCCTTTTATCCCAAAGTTGTTGTAACAACUUUGGGAUAAAAGGCCUUUUAUCCCAAAGUUGUUGUU17.82.122


Target Position: 3302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3302GUCUCUCGUAGUGUUAAGU73.15471581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163320GTCTCTCGTAGTGTTAAGTACTTAACACTACGAGAGAC0.097600.001300.612100.500001.000001.00000


Target Position: 2272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2272AGAUUACAAGAAACGGCUU77.09161157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9232290AGATTACAAGAAACGGCTTAAGCCGTTTCTTGTAATCT0.017700.009800.586200.750001.000001.00000


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258GAGGACAAGCCACAAGAUU80.2542867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332276GAGGACAAGCCACAAGATTAATCTTGTGGCTTGTCCTC0.511100.004700.801700.750001.000001.00000


Target Position: 3613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613AGUUGCCUUUUAUCCCAAA83.9799549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3063631AGTTGCCTTTTATCCCAAATTTGGGATAAAAGGCAACT0.188400.075600.706900.750001.000001.00000


Target Position: 3114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114GGGAGUGACUCAAGAAGUG80.345856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543132GGGAGTGACTCAAGAAGTGCACTTCTTGAGTCACTCCC0.039900.001100.698300.750001.000001.00000


Target Position: 2748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2748GGUAUAUACUUUGAAAGGA90.2468173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992766GGTATATACTTTGAAAGGATCCTTTCAAAGTATATACC0.074000.029400.482800.750001.000001.00000


Target Position: 3388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3388AUAAUCACUCUAAUUAAUU75.08921364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9233406ATAATCACTCTAATTAATTAATTAATTAGAGTGATTAT0.188800.134600.534500.500001.000001.00000


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622UUUAGGUAAGAAGUUUUAA73.75211519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402640TTTAGGTAAGAAGTTTTAATTAAAACTTCTTACCTAAA0.408700.020900.465500.500001.000001.00000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660UGCUGAAACAUGCAGUUGU71.25651779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870678TGCTGAAACATGCAGTTGTACAACTGCATGTTTCAGCA0.110000.002900.646600.500000.940200.62500


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186UUGUUAAAUUUUUUUUUUU67.54552196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293204TTGTTAAATTTTTTTTTTTAAAAAAAAAAATTTAACAA0.413800.130800.646600.500001.000001.00000


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063UUUGUGCAGCUGCUUUAUU64.01812582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772081TTTGTGCAGCTGCTTTATTAATAAAGCAGCTGCACAAA0.142600.012800.491400.500000.956501.00000


Target Position: 3077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3077CCUUUUUGGUCGAGGAGUA87.6845315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373095CCTTTTTGGTCGAGGAGTATACTCCTCGACCAAAAAGG0.023200.001200.663801.000001.000001.00000


Target Position: 2921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2921UCUUUAUACAGCUGUAUUG66.91422271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452939TCTTTATACAGCTGTATTGCAATACAGCTGTATAAAGA0.014100.009900.577600.500000.945700.75000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680UGACCAGCCGACACCAAGA78.9857978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901698TGACCAGCCGACACCAAGATCTTGGTGTCGGCTGGTCA0.310100.117900.500000.500000.967400.62500


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295GUUGGACAUGGCCAUGGAA88.8785259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
932313GTTGGACATGGCCATGGAATTCCATGGCCATGTCCAAC0.099100.001200.474100.750000.956500.75000


Target Position: 3556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3556UGGGUAGGGUAAAUCAGUA87.3059338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373574TGGGTAGGGTAAATCAGTATACTGATTTACCCTACCCA0.073400.032700.663800.750001.000001.00000


Target Position: 3686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3686AUGGUUCAGAAUUAAACUU70.39811877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363704ATGGTTCAGAATTAAACTTAAGTTTAATTCTGAACCAT0.191100.044400.517200.500000.929300.62500


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663UGAAACAUGCAGUUGUAAA84.8613487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519681TGAAACATGCAGTTGTAAATTTACAACTGCATGTTTCA0.158700.014500.724100.750001.000001.00000


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222UGUAAUGGUACUGACUUUG59.91942953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013240TGTAATGGTACTGACTTTGCAAAGTCAGTACCATTACA0.040700.006600.560300.500001.000001.00000


Target Position: 3644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3644UGCUGUGAUACGAUGCUUC65.42232445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9313662TGCTGTGATACGATGCTTCGAAGCATCGTATCACAGCA0.080400.038100.681000.500001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195AGAAAGCAAGCUCAUCAUA87.2057344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421213AGAAAGCAAGCTCATCATATATGATGAGCTTGCTTTCT0.114600.007800.681000.750001.000001.00000


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147AUGGAUCACAAGAUGGAAU74.50061430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823165ATGGATCACAAGATGGAATATTCCATCTTGTGATCCAT0.081700.003700.646600.500000.994601.00000


Target Position: 1540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540UUCUAACCUCACUUGCAAU74.38441444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321558TTCTAACCTCACTTGCAATATTGCAAGTGAGGTTAGAA0.035200.003600.663800.500001.000001.00000


Target Position: 221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221GGUAUUUGAAGUAUACCAU89.6333217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
219-241AGGGTATTTGAAGTATACCATACAUGGUAUACUUCAAAUACCCUGGUAUUUGAAGUAUACCAUACU21.16.932


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013GGGAUGUUCACAACCGAAU79.6174927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032031GGGATGTTCACAACCGAATATTCGGTTGTGAACATCCC0.226700.005700.982801.000000.934800.75000


Target Position: 2813, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813GAUCAUGUGUGGAAGUUAU94.699666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602831GATCATGTGTGGAAGTTATATAACTTCCACACATGATC0.046300.009300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2811-2833GTGATCATGTGTGGAAGTTATTAAUAACUUCCACACAUGAUCACGAUCAUGUGUGGAAGUUAUUAU14.620.532


Target Position: 1981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1981AGGUUGUACCGGAGCCCUU72.93711598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901999AGGTTGTACCGGAGCCCTTAAGGGCTCCGGTACAACCT0.024300.002200.706900.750000.945700.62500


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CAGAACUGUCUUUGGACUC66.6062305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9241421CAGAACTGTCTTTGGACTCGAGTCCAAAGACAGTTCTG0.053000.001200.474100.500000.918500.75000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519CACCUGUGCAGCUGGAAUU78.8485989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541537CACCTGTGCAGCTGGAATTAATTCCAGCTGCACAGGTG0.041500.002200.784500.750000.967400.62500


Target Position: 3130, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3130GUGAAGAAUGCACAAGAAU81.9785710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4763148GTGAAGAATGCACAAGAATATTCTTGTGCATTCTTCAC0.147300.043900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3128-3150AAGTGAAGAATGCACAAGAATGGAUUCUUGUGCAUUCUUCACUUGUGAAGAAUGCACAAGAAUGGU19.220.422


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156UACGACAGACUGCCUUCAA78.31071039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811174TACGACAGACTGCCTTCAATTGAAGGCAGTCTGTCGTA0.065600.032500.534500.500000.913000.87500


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181GCUUAUGGCAACCAAGAAA89.5471225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811199GCTTATGGCAACCAAGAAATTTCTTGGTTGCCATAAGC0.198000.006400.853401.000000.983701.00000


Target Position: 2820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820UGUGGAAGUUAUUAACUUU86.2169401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342838TGTGGAAGTTATTAACTTTAAAGTTAATAACTTCCACA0.047900.002400.706900.750000.978300.62500


Target Position: 3479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3479GUUUCCUUUUUAAUAUGCU73.77831513

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3477-3499TAGTTTCCTTTTTAATATGCTTAAGCAUAUUAAAAAGGAAACUAGUUUCCUUUUUAAUAUGCUUAU15.218.722


Target Position: 3119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119UGACUCAAGAAGUGAAGAA83.9064557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803137TGACTCAAGAAGTGAAGAATTCTTCACTTCTTGAGTCA0.077200.001700.551700.750001.000001.00000


Target Position: 874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874GCAGAAUACAAAUGAUGUA96.393443

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
872-894ATGCAGAATACAAATGATGTAGAUACAUCAUUUGUAUUCUGCAUGCAGAAUACAAAUGAUGUAGAU20.513.412


Target Position: 3184, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3184GCUUGUUAAAUUUUUUUUU77.32691132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1153202GCTTGTTAAATTTTTTTTTAAAAAAAAATTTAACAAGC0.403800.119200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3182-3204TTGCTTGTTAAATTTTTTTTTTTAAAAAAAAAUUUAACAAGCAAGCUUGUUAAAUUUUUUUUUUUU-11.311.811


Target Position: 2278, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278CAAGAAACGGCUUUCAGUU82.5871662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382296CAAGAAACGGCTTTCAGTTAACTGAAAGCCGTTTCTTG0.040400.006600.500000.750000.951100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2276-2298TACAAGAAACGGCTTTCAGTTGAAACUGAAAGCCGUUUCUUGUACAAGAAACGGCUUUCAGUUGAU19.213.332


Target Position: 3423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3423GUAACAAUUGUGUAGCCUU86.1973404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663441GTAACAATTGTGTAGCCTTAAGGCTACACAATTGTTAC0.033100.001900.543100.750001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673AGUUGUAAACUUGAUUAAC70.35511880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947691AGTTGTAAACTTGATTAACGTTAATCAAGTTTACAACT0.032000.007800.560300.500001.000001.00000


Target Position: 3558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3558GGUAGGGUAAAUCAGUAAG75.79121285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7563576GGTAGGGTAAATCAGTAAGCTTACTGATTTACCCTACC0.048100.022800.715500.750001.000001.00000


Target Position: 2909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2909GCAGCCUUUCUCUCUUUAU82.9194634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1542927GCAGCCTTTCTCTCTTTATATAAAGAGAGAAAGGCTGC0.562400.074000.810301.000001.000001.00000


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909CCGCUGGGACCUUGCAUAA83.5326596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949927CCGCTGGGACCTTGCATAATTATGCAAGGTCCCAGCGG0.488200.001100.879301.000001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870CCAUGCAGAAUACAAAUGA84.3605520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763888CCATGCAGAATACAAATGATCATTTGTATTCTGCATGG0.080900.003800.620700.750001.000001.00000


Target Position: 3457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3457CAAAUAGAAAAUGGUCCAA84.8074490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093475CAAATAGAAAATGGTCCAATTGGACCATTTTCTATTTG0.091500.024200.500000.750000.967400.62500


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462AGAAAAUGGUCCAAUUAGU79.9987889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223480AGAAAATGGTCCAATTAGTACTAATTGGACCATTTTCT0.568100.043600.517200.500001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216CUGAGGGUAUUUGAAGUAU79.512934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
945234CTGAGGGTATTTGAAGTATATACTTCAAATACCCTCAG0.142300.001100.741400.750001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430CUUUCAGAUGCUGCAACUA85.5748440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561448CTTTCAGATGCTGCAACTATAGTTGCAGCATCTGAAAG0.102300.018700.465500.750000.994601.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505AGCUGAUAUUGAUGGACAG78.66981007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906523AGCTGATATTGATGGACAGCTGTCCATCAATATCAGCT0.044800.001400.569000.500001.000001.00000


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278UUUUUUGCAGUAACUGUUU61.81842790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453296TTTTTTGCAGTAACTGTTTAAACAGTTACTGCAAAAAA0.032800.021100.500000.500001.000001.00000


Target Position: 2238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2238CUGUUUUGUUCCGAAUGUC66.70422291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512256CTGTTTTGTTCCGAATGTCGACATTCGGAACAAAACAG0.062500.001400.465500.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793CCAUCAGCUUUCUAAAAAG81.9722711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921811CCATCAGCTTTCTAAAAAGCTTTTTAGAAAGCTGATGG0.018500.013600.706900.750000.978300.87500


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309AUCUGUCUGCUCUAGUAAU81.5806748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601327ATCTGTCTGCTCTAGTAATATTACTAGAGCAGACAGAT0.157900.006300.672400.500001.000001.00000


Target Position: 3631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3631AGUUGUUGUAACCUGCUGU75.6091303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233649AGTTGTTGTAACCTGCTGTACAGCAGGTTACAACAACT0.053700.004100.500000.500001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590AACCUUGUUUUGGACAGUU71.77831719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9053608AACCTTGTTTTGGACAGTTAACTGTCCAAAACAAGGTT0.029500.001500.500000.500001.000001.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700UGAUGCAGAACUUGCCACA78.49091026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786718TGATGCAGAACTTGCCACATGTGGCAAGTTCTGCATCA0.099300.003500.517200.500000.907601.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495GGGUUCAGAUGAUAUAAAU94.939360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951513GGGTTCAGATGATATAAATATTTATATCATCTGAACCC0.086500.006000.982801.000001.000001.00000


Target Position: 2811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2811GUGAUCAUGUGUGGAAGUU75.29191338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962829GTGATCATGTGTGGAAGTTAACTTCCACACATGATCAC0.060100.012300.646600.750001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885GCUUGUUCGUGCACAUCAG80.7768820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001903GCTTGTTCGTGCACATCAGCTGATGTGCACGAACAAGC0.226900.003200.569000.750000.962000.87500


Target Position: 2824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2824GAAGUUAUUAACUUUAAUG81.0119800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592842GAAGTTATTAACTTTAATGCATTAAAGTTAATAACTTC0.058300.010500.517200.500000.978300.62500


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592GAUCCCAUCUACACAGUUU89.9575200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293610GATCCCATCTACACAGTTTAAACTGTGTAGATGGGATC0.196600.037900.681000.750000.962000.87500


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550ACUUGCAAUAAUUAUAAGA80.3907851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551568ACTTGCAATAATTATAAGATCTTATAATTATTGCAAGT0.741300.124800.482800.500001.000001.00000


Target Position: 2626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626GGUAAGAAGUUUUAAAAAG80.3824852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262644GGTAAGAAGTTTTAAAAAGCTTTTTAAAACTTCTTACC0.295300.115800.715500.750001.000001.00000


Target Position: 3047, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047GAACAAUUGAAGUAAACUU90.1735178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6873065GAACAATTGAAGTAAACTTAAGTTTACTTCAATTGTTC0.234800.009700.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3045-3067GGGAACAATTGAAGTAAACTTTTAAGUUUACUUCAAUUGUUCCCGAACAAUUGAAGUAAACUUUUU12.95.332


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070AGCUGCUUUAUUCUCCCAU70.57141851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4342088AGCTGCTTTATTCTCCCATATGGGAGAATAAAGCAGCT0.391100.087400.698300.750001.000001.00000


Target Position: 2346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346CUGCUGAUCUUGGACUUGA82.5512664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962364CTGCTGATCTTGGACTTGATCAAGTCCAAGATCAGCAG0.193700.055100.560300.500001.000001.00000


Target Position: 3083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3083UGGUCGAGGAGUAACAAUA85.9834417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4483101TGGTCGAGGAGTAACAATATATTGTTACTCCTCGACCA0.153200.019600.801700.750001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986CUGGUGAAAAUGCUUGGUU71.77671720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061004CTGGTGAAAATGCTTGGTTAACCAAGCATTTTCACCAG0.021500.002200.637900.750001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186CUGACAGAGUUACUUCACU81.6406738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472204CTGACAGAGTTACTTCACTAGTGAAGTAACTCTGTCAG0.013900.003900.577600.500001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549CACUUGCAAUAAUUAUAAG82.0222705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841567CACTTGCAATAATTATAAGCTTATAATTATTGCAAGTG0.744200.121800.655200.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389GUCAACGUCUUGUUCAGAA89.2341246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401407GTCAACGTCTTGTTCAGAATTCTGAACAAGACGTTGAC0.015300.005900.646600.750000.972800.62500


Target Position: 3511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511UGGAUCUAUUUCAUGUUUU73.07361587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7083529TGGATCTATTTCATGTTTTAAAACATGAAATAGATCCA0.112700.005600.844800.750001.000001.00000


Target Position: 3299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3299UAAGUCUCUCGUAGUGUUA79.6248924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273317TAAGTCTCTCGTAGTGTTATAACACTACGAGAGACTTA0.017100.003800.500000.500001.000001.00000


Target Position: 3303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3303UCUCUCGUAGUGUUAAGUU70.47911866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333321TCTCTCGTAGTGTTAAGTTAACTTAACACTACGAGAGA0.088400.001200.577600.750001.000001.00000


Target Position: 3648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648GUGAUACGAUGCUUCAAGA92.7408106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253666GTGATACGATGCTTCAAGATCTTGAAGCATCGTATCAC0.114200.059500.569000.500001.000001.00000


Target Position: 3115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115GGAGUGACUCAAGAAGUGA90.3607168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393133GGAGTGACTCAAGAAGTGATCACTTCTTGAGTCACTCC0.042000.001100.646600.750001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745GUUGUGGUUAAGCUCUUAC68.44672083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421763GTTGTGGTTAAGCTCTTACGTAAGAGCTTAACCACAAC0.482700.001200.465500.500001.000001.00000


Target Position: 273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273CUACUCAAGCUGAUUUGAU82.3336683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
271-293GGCTACTCAAGCTGATTTGATGGAUCAAAUCAGCUUGAGUAGCCCUACUCAAGCUGAUUUGAUGGU16.320.323


Target Position: 2261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261GACAAGCCACAAGAUUACA85.9801419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852279GACAAGCCACAAGATTACATGTAATCTTGTGGCTTGTC0.596000.015100.612100.500001.000001.00000


Target Position: 3176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3176CUAGCCUUGCUUGUUAAAU70.91991818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3403194CTAGCCTTGCTTGTTAAATATTTAACAAGCAAGGCTAG0.170700.046700.663800.750000.967400.75000


Target Position: 3458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3458AAAUAGAAAAUGGUCCAAU76.8371185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703476AAATAGAAAATGGTCCAATATTGGACCATTTTCTATTT0.103800.031000.491400.500000.967400.62500


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526GCAGCUGGAAUUCUUUCUA87.3249337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821544GCAGCTGGAATTCTTTCTATAGAAAGAATTCCAGCTGC0.118200.006400.681001.000001.000001.00000


Target Position: 319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319CAGAAAAGCGGCUGUUAGU79.109970

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
317-339GACAGAAAAGCGGCTGTTAGTCAACUAACAGCCGCUUUUCUGUCCAGAAAAGCGGCUGUUAGUCAU16.410.323


Target Position: 3539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3539ACUAUUUGGGAUAUGUAUG67.06972253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103557ACTATTTGGGATATGTATGCATACATATCCCAAATAGT0.191100.047700.551700.500001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046CACAACCUUUUAUUACAUC70.66251843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651064CACAACCTTTTATTACATCGATGTAATAAAAGGTTGTG0.932900.114400.612100.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253UAGCUCUUUUUUUUUUUUU64.772509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6673271TAGCTCTTTTTTTTTTTTTAAAAAAAAAAAAAGAGCTA0.988300.422900.672400.500001.000001.00000


Target Position: 3235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3235ACUUUGCUUGCUUUGAAGU66.09192363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343253ACTTTGCTTGCTTTGAAGTACTTCAAAGCAAGCAAAGT0.024700.001200.500000.500001.000001.00000


Target Position: 2404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404UGAUCCUAGCUAUCGUUCU70.85371822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7842422TGATCCTAGCTATCGTTCTAGAACGATAGCTAGGATCA0.148800.027000.500000.500001.000001.00000


Target Position: 3430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3430UUGUGUAGCCUUUUUGUAU74.05721479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403448TTGTGTAGCCTTTTTGTATATACAAAAAGGCTACACAA0.114100.012500.603400.500001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GUGGUCACCUGUGCAGCUG62.80032696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361532GTGGTCACCTGTGCAGCTGCAGCTGCACAGGTGACCAC0.016100.001400.508600.500000.923900.62500


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230AGUAUACCAUACAACUGUU88.6711269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
609248AGTATACCATACAACTGTTAACAGTTGTATGGTATACT0.379500.056600.560300.750001.000001.00000


Target Position: 2861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2861GCAACUUAAUACUCAAAUG81.9096720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632879GCAACTTAATACTCAAATGCATTTGAGTATTAAGTTGC0.027400.028600.698300.750001.000001.00000


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017CUGUGUUGUUUUAUGCCAU84.3524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691035CTGTGTTGTTTTATGCCATATGGCATAAAACAACACAG0.443500.011700.629300.750001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910CGCUGGGACCUUGCAUAAC65.98912377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897928CGCTGGGACCTTGCATAACGTTATGCAAGGTCCCAGCG0.479700.001600.775900.750001.000001.00000


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CGGUUAUAAAAAAUGGUUC69.61551963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4263692CGGTTATAAAAAATGGTTCGAACCATTTTTTATAACCG0.370300.061600.741400.750001.000001.00000


Target Position: 3050, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050CAAUUGAAGUAAACUUUUU86.9179361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4613068CAATTGAAGTAAACTTTTTAAAAAGTTTACTTCAATTG0.122100.067000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3048-3070AACAATTGAAGTAAACTTTTTGTAAAAAGUUUACUUCAAUUGUUCAAUUGAAGUAAACUUUUUGUU3.27.422


Target Position: 3150, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150GAUCACAAGAUGGAAUUUA88.4693278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013168GATCACAAGATGGAATTTATAAATTCCATCTTGTGATC0.053400.003200.646600.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3148-3170TGGATCACAAGATGGAATTTATCUAAAUUCCAUCUUGUGAUCCAGAUCACAAGAUGGAAUUUAUCU14.220.533


Target Position: 22, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
22GACUUAUAAGAGCUCCUUG80.0288885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68040GACTTATAAGAGCTCCTTGCAAGGAGCTCTTATAAGTC0.090700.006400.672400.500001.000001.00000


Target Position: 3513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3513GAUCUAUUUCAUGUUUUUG75.55951307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8623531GATCTATTTCATGTTTTTGCAAAAACATGAAATAGATC0.027400.006400.534500.500001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306GCUAUCUGUCUGCUCUAGU77.2751137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621324GCTATCTGTCTGCTCTAGTACTAGAGCAGACAGATAGC0.056200.003900.646600.750001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237GCUGUUUUGUUCCGAAUGU73.68791523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552255GCTGTTTTGTTCCGAATGTACATTCGGAACAAAACAGC0.030400.003600.646600.750001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744AGUUGUGGUUAAGCUCUUA89.5723221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501762AGTTGTGGTTAAGCTCTTATAAGAGCTTAACCACAACT0.481000.001100.672400.750001.000001.00000


Target Position: 3372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3372UGUAGAACACUAAUUCAUA92.7927102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3803390TGTAGAACACTAATTCATATATGAATTAGTGTTCTACA0.171500.027600.663800.750000.934800.87500


Target Position: 3088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3088GAGGAGUAACAAUACAAAU92.8059101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5523106GAGGAGTAACAATACAAATATTTGTATTGTTACTCCTC0.245500.012600.801700.750000.983701.00000


Target Position: 3178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178AGCCUUGCUUGUUAAAUUU77.56471105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4953196AGCCTTGCTTGTTAAATTTAAATTTAACAAGCAAGGCT0.231900.057100.853400.750001.000001.00000


Target Position: 3261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261UUUUUUUUUUUUUUUUUUU61.69032797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793279TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.927700.922600.500000.500001.000001.00000


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345ACUGCUGAUCUUGGACUUG61.84392788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162363ACTGCTGATCTTGGACTTGCAAGTCCAAGATCAGCAGT0.149800.057600.560300.500001.000001.00000


Target Position: 3259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259UUUUUUUUUUUUUUUUUUU61.69032795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063277TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.952300.935900.500000.500001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GUAGAAACAGCUCGUUGUA89.5841220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815908GTAGAAACAGCTCGTTGTATACAACGAGCTGTTTCTAC0.264700.008800.500000.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GACAGACUGCCUUCAAAUU86.5433375

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3115919GACAGACTGCCTTCAAATT1/1/0/097.75CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41267307..41267325(+)00CTNNB1(0.002)


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612AUGCUGCUCAUCCCACUAA78.66551008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946630ATGCTGCTCATCCCACTAATTAGTGGGATGAGCAGCAT0.228100.017100.620700.500001.000001.00000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731GAACUGACAAAACUGCUAA94.411469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436749GAACTGACAAAACTGCTAATTAGCAGTTTTGTCAGTTC0.456000.274600.637900.750001.000001.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412GCUAUCGUUCUUUUCACUC65.99372376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6462430GCTATCGTTCTTTTCACTCGAGTGAAAAGAACGATAGC0.207100.019500.543100.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040ACUCUCCACAACCUUUUAU70.78681829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981058ACTCTCCACAACCTTTTATATAAAAGGTTGTGGAGAGT0.186900.015900.663800.750001.000001.00000


Target Position: 3383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3383AAUUCAUAAUCACUCUAAU89.4644236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7913401AATTCATAATCACTCTAATATTAGAGTGATTATGAATT0.366100.072500.500000.500001.000001.00000


Target Position: 3669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3669AAAUGCGGUUAUAAAAAAU80.2683864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543687AAATGCGGTTATAAAAAATATTTTTTATAACCGCATTT0.321300.035000.491400.500001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388AGUCAACGUCUUGUUCAGA82.0013707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391406AGTCAACGTCTTGTTCAGATCTGAACAAGACGTTGACT0.015700.005100.482800.500000.983700.62500


Target Position: 1689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689GACACCAAGAAGCAGAGAU81.9426713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921707GACACCAAGAAGCAGAGATATCTCTGCTTCTTGGTGTC0.023800.020700.637900.750000.989100.87500


Target Position: 2039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039AGAGGACUAAAUACCAUUC71.66141734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472057AGAGGACTAAATACCATTCGAATGGTATTTAGTCCTCT0.136900.021500.551700.500000.967400.87500


Target Position: 3463, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463GAAAAUGGUCCAAUUAGUU86.2873393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983481GAAAATGGTCCAATTAGTTAACTAATTGGACCATTTTC0.570300.049000.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3461-3483TAGAAAATGGTCCAATTAGTTTCAACUAAUUGGACCAUUUUCUAGAAAAUGGUCCAAUUAGUUUCU4.611.322


Target Position: 3395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395CUCUAAUUAAUUGUAAUCU75.18831352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8983413CTCTAATTAATTGTAATCTAGATTACAATTAATTAGAG0.084300.071200.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3393-3415CACTCTAATTAATTGTAATCTGAAGAUUACAAUUAAUUAGAGUGCUCUAAUUAAUUGUAAUCUGAU16.16.932


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679AUAAAAAAUGGUUCAGAAU76.80291188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203697ATAAAAAATGGTTCAGAATATTCTGAACCATTTTTTAT0.114200.089000.534500.500001.000001.00000


Target Position: 2302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302GACCAGCUCUCUCUUCAGA89.4402239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192320GACCAGCTCTCTCTTCAGATCTGAAGAGAGAGCTGGTC0.082300.001300.594800.500000.951100.62500


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509GAUAUUGAUGGACAGUAUG77.40861124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767527GATATTGATGGACAGTATGCATACTGTCCATCAATATC0.090400.003800.525900.500001.000001.00000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128ACAAAACAAAUGUUAAAUU76.58991208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361146ACAAAACAAATGTTAAATTAATTTAACATTTGTTTTGT0.246200.215700.698300.750001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CAACCUUUUAUUACAUCAA91.8344128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101066CAACCTTTTATTACATCAATTGATGTAATAAAAGGTTG0.286500.084100.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1046-1068CACAACCTTTTATTACATCAAGAUUGAUGUAAUAAAAGGUUGUGCAACCUUUUAUUACAUCAAGAU21.517.312


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960CCGCAUGGAAGAAAUAGUU78.1811048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251978CCGCATGGAAGAAATAGTTAACTATTTCTTCCATGCGG0.395100.051500.767201.000001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CAUGCGUUCUCCUCAGAUG78.71941001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
844850CATGCGTTCTCCTCAGATGCATCTGAGGAGAACGCATG0.067900.002300.500000.500000.962000.75000


Target Position: 3534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3534CAAAAACUAUUUGGGAUAU81.4824759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853552CAAAAACTATTTGGGATATATATCCCAAATAGTTTTTG0.127400.011100.603400.750001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411UCUUUGGACUCUCAGGAAU71.33121771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301429TCTTTGGACTCTCAGGAATATTCCTGAGAGTCCAAAGA0.085900.004800.715500.750001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404AGAACUGUCUUUGGACUCU74.55931424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011422AGAACTGTCTTTGGACTCTAGAGTCCAAAGACAGTTCT0.052500.001500.500000.500000.918500.87500


Target Position: 3312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3312GUGUUAAGUUAUAGUGAAU91.8073129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7843330GTGTTAAGTTATAGTGAATATTCACTATAACTTAACAC0.042400.016600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3310-3332TAGTGTTAAGTTATAGTGAATACAUUCACUAUAACUUAACACUAGUGUUAAGUUAUAGUGAAUACU20.311.822


Target Position: 1822, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822CCUUUGUCCCGCAAAUCAU80.4992844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201840CCTTTGTCCCGCAAATCATATGATTTGCGGGACAAAGG0.105800.028700.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1820-1842GCCCTTTGTCCCGCAAATCATGCAUGAUUUGCGGGACAAAGGGCCCUUUGUCCCGCAAAUCAUGCU13.819.222


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163GACUGCCUUCAAAUUUUAG74.78231398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761181GACTGCCTTCAAATTTTAGCTAAAATTTGAAGGCAGTC0.297800.004000.646600.500001.000001.00000


Target Position: 2648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648GUUUGGGUAAAAUACUUUU79.7055917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902666GTTTGGGTAAAATACTTTTAAAAGTATTTTACCCAAAC0.198200.006200.646600.750001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564UCCCUGAGACAUUAGAUGA78.06471055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909582TCCCTGAGACATTAGATGATCATCTAATGTCTCAGGGA0.022400.001800.646600.500001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970GAAAUAGUUGAAGGUUGUA89.9701198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671988GAAATAGTTGAAGGTTGTATACAACCTTCAACTATTTC0.059800.036800.491400.750001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023UGUUUUAUGCCAUUACAAC67.8382168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6571041TGTTTTATGCCATTACAACGTTGTAATGGCATAAAACA0.151400.052200.560300.500001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038CAACUCUCCACAACCUUUU74.48721433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321056CAACTCTCCACAACCTTTTAAAAGGTTGTGGAGAGTTG0.203700.008200.646600.750001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633AGUUUUAAAAAGCCAGUUU73.79771510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5132651AGTTTTAAAAAGCCAGTTTAAACTGGCTTTTTAAAACT0.106600.073300.706900.750001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882GUUGCUUGUUCGUGCACAU85.7619429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381900GTTGCTTGTTCGTGCACATATGTGCACGAACAAGCAAC0.098000.001200.491400.750000.902200.62500


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014GGAUGUUCACAACCGAAUU86.4794383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072032GGATGTTCACAACCGAATTAATTCGGTTGTGAACATCC0.173600.005600.862101.000000.978300.62500


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047ACAACCUUUUAUUACAUCA83.0034628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901065ACAACCTTTTATTACATCATGATGTAATAAAAGGTTGT0.907700.099500.482800.500001.000001.00000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595CCCAUCUACACAGUUUGAU70.25491891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755613CCCATCTACACAGTTTGATATCAAACTGTGTAGATGGG0.048500.006500.810301.000000.962000.62500


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041CUCUCCACAACCUUUUAUU75.28141340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751059CTCTCCACAACCTTTTATTAATAAAAGGTTGTGGAGAG0.175900.021700.801700.750001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177UAGCCUUGCUUGUUAAAUU78.30071042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5273195TAGCCTTGCTTGTTAAATTAATTTAACAAGCAAGGCTA0.176500.051900.663800.500000.967400.62500


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667ACAUGCAGUUGUAAACUUG73.84161504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818685ACATGCAGTTGTAAACTTGCAAGTTTACAACTGCATGT0.056900.002900.560300.500001.000001.00000


Target Position: 1541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1541UCUAACCUCACUUGCAAUA71.56871748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591559TCTAACCTCACTTGCAATATATTGCAAGTGAGGTTAGA0.187300.007100.681000.750001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921UGCAUAACCUUUCCCAUCA76.42621220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927939TGCATAACCTTTCCCATCATGATGGGAAAGGTTATGCA0.223200.161600.629300.500001.000001.00000


Target Position: 2827, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827GUUAUUAACUUUAAUGUUU82.6041661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492845GTTATTAACTTTAATGTTTAAACATTAAAGTTAATAAC0.098700.033500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2825-2847AAGTTATTAACTTTAATGTTTTTAAACAUUAAAGUUAAUAACUUGUUAUUAACUUUAAUGUUUUUU6.9-7.522


Target Position: 3095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095AACAAUACAAAUGGAUUUU68.00072135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353113AACAATACAAATGGATTTTAAAATCCATTTGTATTGTT0.030400.014700.646600.500001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094GCUGGUGGGCUGCAGAAAA87.7233314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021112GCTGGTGGGCTGCAGAAAATTTTCTGCAGCCCACCAGC0.059000.010300.853401.000001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225UGGACCCCAAGCUUUAGUA74.78471397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271243TGGACCCCAAGCTTTAGTATACTAAAGCTTGGGGTCCA0.054400.014700.663800.750001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890GCUGUUUUAAACAUUAAUA91.4997137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772908GCTGTTTTAAACATTAATATATTAATGTTTAAAACAGC0.088100.033800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2888-2910TTGCTGTTTTAAACATTAATAGCUAUUAAUGUUUAAAACAGCAAGCUGUUUUAAACAUUAAUAGCU-1.810.323


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911GCUGGGACCUUGCAUAACC68.1812115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
902929GCTGGGACCTTGCATAACCGGTTATGCAAGGTCCCAGC0.488500.001700.500000.500001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875CAGAAUACAAAUGAUGUAG73.30021563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809893CAGAATACAAATGATGTAGCTACATCATTTGTATTCTG0.039800.015700.612100.500000.923900.62500


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623UAUCCCAAAGUUGUUGUAA73.89331499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7533641TATCCCAAAGTTGTTGTAATTACAACAACTTTGGGATA0.049600.013700.508600.500001.000001.00000


Target Position: 2257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257UGAGGACAAGCCACAAGAU81.0687797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542275TGAGGACAAGCCACAAGATATCTTGTGGCTTGTCCTCA0.161800.004000.543100.750001.000001.00000


Target Position: 2649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649UUUGGGUAAAAUACUUUUA72.78951609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362667TTTGGGTAAAATACTTTTATAAAAGTATTTTACCCAAA0.068500.001200.465500.500001.000001.00000


Target Position: 3090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3090GGAGUAACAAUACAAAUGG72.74091613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083108GGAGTAACAATACAAATGGCCATTTGTATTGTTACTCC0.316800.080800.525900.500000.983700.87500


Target Position: 2265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265AGCCACAAGAUUACAAGAA81.3605772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3392283AGCCACAAGATTACAAGAATTCTTGTAATCTTGTGGCT0.676100.085600.681000.750001.000001.00000


Target Position: 3307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3307UCGUAGUGUUAAGUUAUAG67.95682143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8353325TCGTAGTGTTAAGTTATAGCTATAACTTAACACTACGA0.440500.002400.620700.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351UGGAAUGCAAGCUUUAGGA73.18811572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161369TGGAATGCAAGCTTTAGGATCCTAAAGCTTGCATTCCA0.104700.006100.474100.500001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513UUGAUGGACAGUAUGCAAU68.05682129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524531TTGATGGACAGTATGCAATATTGCATACTGTCCATCAA0.187400.036600.637900.500001.000001.00000


Target Position: 3564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3564GUAAAUCAGUAAGAGGUGU74.18041466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193582GTAAATCAGTAAGAGGTGTACACCTCTTACTGATTTAC0.079200.013400.474100.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UGCCACUACCACAGCUCCU64.90332498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861400TGCCACTACCACAGCTCCTAGGAGCTGTGGTAGTGGCA0.056200.002100.508600.500000.902200.62500


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492CUCAAGAACAAGUAGCUGA83.7343575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544510CTCAAGAACAAGTAGCTGATCAGCTACTTGTTCTTGAG0.099900.028500.586200.500001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033CAUUACAACUCUCCACAAC74.94331378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081051CATTACAACTCTCCACAACGTTGTGGAGAGTTGTAATG0.039800.006300.508600.500001.000001.00000


Target Position: 2052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052CCAUUCCAUUGUUUGUGCA83.8843559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832070CCATTCCATTGTTTGTGCATGCACAAACAATGGAATGG0.050700.013000.491400.750001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101GGCUGCAGAAAAUGGUUGC60.67092889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121119GGCTGCAGAAAATGGTTGCGCAACCATTTTCTGCAGCC0.020400.003000.646600.500000.929300.62500


Target Position: 3516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3516CUAUUUCAUGUUUUUGAUC67.86752159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8623534CTATTTCATGTTTTTGATCGATCAAAAACATGAAATAG0.089200.003900.491400.500001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070GGAGCUAAAAUGGCAGUGC62.34172738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571088GGAGCTAAAATGGCAGTGCGCACTGCCATTTTAGCTCC0.011600.001800.517200.500001.000001.00000


Target Position: 2917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2917UCUCUCUUUAUACAGCUGU59.4253002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352935TCTCTCTTTATACAGCTGTACAGCTGTATAAAGAGAGA0.016100.017000.517200.500001.000001.00000


Target Position: 3046, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046GGAACAAUUGAAGUAAACU85.0953475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713064GGAACAATTGAAGTAAACTAGTTTACTTCAATTGTTCC0.239000.003700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3044-3066TGGGAACAATTGAAGTAAACTTTAGUUUACUUCAAUUGUUCCCAGGAACAAUUGAAGUAAACUUUU12.914.832


Target Position: 2678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2678AGAACUUCAGAAAGACUUG71.25591780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152696AGAACTTCAGAAAGACTTGCAAGTCTTTCTGAAGTTCT0.158700.073600.577600.500001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162AGACUGCCUUCAAAUUUUA88.9554256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781180AGACTGCCTTCAAATTTTATAAAATTTGAAGGCAGTCT0.595100.038700.689700.750001.000001.00000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841UGUUUUUUGCCACAGCUUU67.53482199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572859TGTTTTTTGCCACAGCTTTAAAGCTGTGGCAAAAAACA0.094700.017100.706900.750000.983700.87500


Target Position: 3094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094UAACAAUACAAAUGGAUUU74.47141437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7753112TAACAATACAAATGGATTTAAATCCATTTGTATTGTTA0.043900.018700.534500.500001.000001.00000


Target Position: 3552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3552UGUAUGGGUAGGGUAAAUC58.46693060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053570TGTATGGGTAGGGTAAATCGATTTACCCTACCCATACA0.090500.046900.525900.500001.000001.00000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CUGUUGGAUUGAUUCGAAA90.4938162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211815CTGTTGGATTGATTCGAAATTTCGAATCAATCCAACAG0.356500.001300.784500.750001.000001.00000


Target Position: 3438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3438CCUUUUUGUAUAAAAUAGA84.2995525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4913456CCTTTTTGTATAAAATAGATCTATTTTATACAAAAAGG0.593400.029800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3436-3458AGCCTTTTTGTATAAAATAGACAUCUAUUUUAUACAAAAAGGCUCCUUUUUGUAUAAAAUAGACAU-4.32.122


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889UGCUGUUUUAAACAUUAAU73.66251527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3332907TGCTGTTTTAAACATTAATATTAATGTTTAAAACAGCA0.174700.033100.844800.750001.000001.00000


Target Position: 2810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2810UGUGAUCAUGUGUGGAAGU70.6981838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612828TGTGATCATGTGTGGAAGTACTTCCACACATGATCACA0.070200.015900.500000.500001.000001.00000


Target Position: 1169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1169CUUCAAAUUUUAGCUUAUG68.63072064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131187CTTCAAATTTTAGCTTATGCATAAGCTAAAATTTGAAG0.020300.010700.482800.500001.000001.00000


Target Position: 3092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092AGUAACAAUACAAAUGGAU76.93471176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183110AGTAACAATACAAATGGATATCCATTTGTATTGTTACT0.116900.036200.525900.750000.983700.62500


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082UUGGUCGAGGAGUAACAAU67.09232251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853100TTGGTCGAGGAGTAACAATATTGTTACTCCTCGACCAA0.143300.018800.637900.500001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477GACUCUUGUUCAGCUUCUG74.98461376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271495GACTCTTGTTCAGCTTCTGCAGAAGCTGAACAAGAGTC0.036400.003800.534500.500000.983700.62500


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GGUGGUUAAUAAGGCUGCA86.6954369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890784GGTGGTTAATAAGGCTGCATGCAGCCTTATTAACCACC0.084400.001600.500000.750001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362GACUCUGGAAUCCAUUCUG74.99511373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
893380GACTCTGGAATCCATTCTGCAGAATGGATTCCAGAGTC0.036700.001600.534500.500000.983701.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261CGUGGACAAUGGCUACUCA97.951125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905279CGTGGACAATGGCTACTCATGAGTAGCCATTGTCCACG0.021700.003600.551700.750001.000001.00000


Target Position: 3445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3445GUAUAAAAUAGACAAAUAG82.1415701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443463GTATAAAATAGACAAATAGCTATTTGTCTATTTTATAC0.057800.035100.508600.500001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137AUGUUAAAUUCUUGGCUAU79.7753914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8741155ATGTTAAATTCTTGGCTATATAGCCAAGAATTTAACAT0.026000.011500.612100.500001.000001.00000


Target Position: 3520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3520UUCAUGUUUUUGAUCAAAA77.36421130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273538TTCATGTTTTTGATCAAAATTTTGATCAAAAACATGAA0.135200.007400.672400.500001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884UGCUUGUUCGUGCACAUCA78.53771019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441902TGCTTGTTCGTGCACATCATGATGTGCACGAACAAGCA0.135700.004200.629300.500000.934800.62500


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741AAAAACAGGUAUAUACUUU82.1159702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322759AAAAACAGGTATATACTTTAAAGTATATACCTGTTTTT0.199800.076900.500000.500001.000001.00000


Target Position: 2736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2736GCCACAAAAACAGGUAUAU78.22381047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3082754GCCACAAAAACAGGTATATATATACCTGTTTTTGTGGC0.187700.061200.956901.000000.994600.75000


Target Position: 3546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3546GGGAUAUGUAUGGGUAGGG62.89912688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7983564GGGATATGTATGGGTAGGGCCCTACCCATACATATCCC0.130000.043200.500000.500001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GCAGAACUUGCCACACGUG75.85241281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850722GCAGAACTTGCCACACGTGCACGTGTGGCAAGTTCTGC0.031800.004400.560300.750000.983700.62500


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338GAAUGAGACUGCUGAUCUU98.966320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692356GAATGAGACTGCTGATCTTAAGATCAGCAGTCTCATTC0.154100.009700.534500.750000.967400.62500


Target Position: 3341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3341CAAUUUCUAAUUUUUAAGA84.7994492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3339-3361AGCAATTTCTAATTTTTAAGAATUCUUAAAAAUUAGAAAUUGCUCAAUUUCUAAUUUUUAAGAAUU-3.85.322


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777AGGCUGCAGUUAUGGUCCA79.4304946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
785795AGGCTGCAGTTATGGTCCATGGACCATAACTGCAGCCT0.066700.012800.500000.500001.000001.00000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727CCCUGAACUGACAAAACUG77.42621122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
386745CCCTGAACTGACAAAACTGCAGTTTTGTCAGTTCAGGG0.419800.163300.706900.750001.000001.00000


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861UUGUACGUACCAUGCAGAA75.17731355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
913879TTGTACGTACCATGCAGAATTCTGCATGGTACGTACAA0.055900.014100.474100.500001.000001.00000


Target Position: 3089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3089AGGAGUAACAAUACAAAUG72.45351646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8203107AGGAGTAACAATACAAATGCATTTGTATTGTTACTCCT0.315600.030100.689700.500000.983701.00000


Target Position: 99, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
99CGGAGAGCGAGGGGAGGCG53.16713355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878117CGGAGAGCGAGGGGAGGCGCGCCTCCCCTCGCTCTCCG0.038100.005400.491400.500000.978300.75000


Target Position: 3570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3570CAGUAAGAGGUGUUAUUUG80.6942828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6523588CAGTAAGAGGTGTTATTTGCAAATAACACCTCTTACTG0.335400.007300.637900.500001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308UAUCUGUCUGCUCUAGUAA84.5721508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361326TATCTGTCTGCTCTAGTAATTACTAGAGCAGACAGATA0.104300.006800.508600.500001.000001.00000


Target Position: 1323, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323GUAAUAAGCCGGCUAUUGU79.4982937

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1321-1343TAGTAATAAGCCGGCTATTGTAGACAAUAGCCGGCUUAUUACUAGUAAUAAGCCGGCUAUUGUAGU19.7-2.333


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GUACCAUGCAGAAUACAAA97.712329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582885GTACCATGCAGAATACAAATTTGTATTCTGCATGGTAC0.136600.011200.681000.750001.000001.00000


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GGGACCUUGCAUAACCUUU78.9285983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169932GGGACCTTGCATAACCTTTAAAGGTTATGCAAGGTCCC0.314300.098100.991401.000001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UGUUGGAUUGAUUCGAAAU77.52881111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831816TGTTGGATTGATTCGAAATATTTCGAATCAATCCAACA0.363400.001700.698300.750001.000001.00000


Target Position: 3427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3427CAAUUGUGUAGCCUUUUUG72.72161615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523445CAATTGTGTAGCCTTTTTGCAAAAAGGCTACACAATTG0.136600.001100.500000.500001.000001.00000


Target Position: 3126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3126AGAAGUGAAGAAUGCACAA90.6353158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753144AGAAGTGAAGAATGCACAATTGTGCATTCTTCACTTCT0.129300.037700.577600.750001.000001.00000


Target Position: 3444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3444UGUAUAAAAUAGACAAAUA94.97259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4853462TGTATAAAATAGACAAATATATTTGTCTATTTTATACA0.114300.067800.663800.750001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232UAUACCAUACAACUGUUUU72.33871660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874250TATACCATACAACTGTTTTAAAACAGTTGTATGGTATA0.472900.057000.543100.500001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496AGAACAAGUAGCUGAUAUU88.4569281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831514AGAACAAGTAGCTGATATTAATATCAGCTACTTGTTCT0.035400.036800.715500.750001.000001.00000


Target Position: 3580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580UGUUAUUUGGAACCUUGUU69.33811986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173598TGTTATTTGGAACCTTGTTAACAAGGTTCCAAATAACA0.032200.001300.560300.750001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GAUGUUCACAACCGAAUUG72.23091677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6652033GATGTTCACAACCGAATTGCAATTCGGTTGTGAACATC0.148900.007200.534500.500000.983700.87500


Target Position: 2911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2911AGCCUUUCUCUCUUUAUAC71.13661795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022929AGCCTTTCTCTCTTTATACGTATAAAGAGAGAAAGGCT0.364700.390600.672400.500001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857GCUAUUGUACGUACCAUGC65.60662423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833875GCTATTGTACGTACCATGCGCATGGTACGTACAATAGC0.034700.006000.500000.500001.000001.00000


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190UAAAUUUUUUUUUUUUUUU69.36371980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6643208TAAATTTTTTTTTTTTTTTAAAAAAAAAAAAAAATTTA0.479200.219300.534500.500001.000001.00000


Target Position: 1124, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124CUCAACAAAACAAAUGUUA79.2577961

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1122-1144TGCTCAACAAAACAAATGTTAAAUAACAUUUGUUUUGUUGAGCACUCAACAAAACAAAUGUUAAAU5.320.512


Target Position: 2623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2623UUAGGUAAGAAGUUUUAAA81.8368722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662641TTAGGTAAGAAGTTTTAAATTTAAAACTTCTTACCTAA0.410600.022200.534500.500001.000001.00000


Target Position: 3155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155CAAGAUGGAAUUUAUCAAA93.807379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3973173CAAGATGGAATTTATCAAATTTGATAAATTCCATCTTG0.167100.025800.646600.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647UGUGAUACGAUGCUUCAAG66.11152359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813665TGTGATACGATGCTTCAAGCTTGAAGCATCGTATCACA0.104300.057600.569000.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425GGAAUCUUUCAGAUGCUGC67.53822198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711443GGAATCTTTCAGATGCTGCGCAGCATCTGAAAGATTCC0.044500.006600.517200.500000.994600.62500


Target Position: 2653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653GGUAAAAUACUUUUACUCU90.2567172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2651-2673TGGGTAAAATACTTTTACTCTGCAGAGUAAAAGUAUUUUACCCAGGUAAAAUACUUUUACUCUGCU14.6-0.333


Target Position: 3468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3468UGGUCCAAUUAGUUUCCUU77.01191165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2413486TGGTCCAATTAGTTTCCTTAAGGAAACTAATTGGACCA0.225000.066800.706900.750001.000001.00000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037UCAGAGGACUAAAUACCAU80.2929860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5992055TCAGAGGACTAAATACCATATGGTATTTAGTCCTCTGA0.568700.022700.569000.750000.967400.75000


Target Position: 546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
546GGGUACGAGCUGCUAUGUU82.8939639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919564GGGTACGAGCTGCTATGTTAACATAGCAGCTCGTACCC0.018800.003000.844801.000001.000001.00000


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605CUCUUGUGCGUACUGUCCU71.50011752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431623CTCTTGTGCGTACTGTCCTAGGACAGTACGCACAAGAG0.069800.003000.465500.500001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191ACCAAGAAAGCAAGCUCAU71.21081783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411209ACCAAGAAAGCAAGCTCATATGAGCTTGCTTTCTTGGT0.250500.045000.698300.750001.000001.00000


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356UGCAAGCUUUAGGACUUCA76.05291255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171374TGCAAGCTTTAGGACTTCATGAAGTCCTAAAGCTTGCA0.045000.033600.629300.500000.945700.62500


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958GUCCGCAUGGAAGAAAUAG64.22742559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001976GTCCGCATGGAAGAAATAGCTATTTCTTCCATGCGGAC0.563700.017100.646600.500000.902200.62500


Target Position: 1820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1820GCCCUUUGUCCCGCAAAUC58.56083053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161838GCCCTTTGTCCCGCAAATCGATTTGCGGGACAAAGGGC0.106000.031700.819000.750001.000001.00000


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555CAAUAAUUAUAAGAACAAG83.6095589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421573CAATAATTATAAGAACAAGCTTGTTCTTATAATTATTG0.173400.069700.508600.500001.000001.00000


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385UUCAUAAUCACUCUAAUUA78.8113995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713403TTCATAATCACTCTAATTATAATTAGAGTGATTATGAA0.249300.075600.637900.500001.000001.00000


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851CACAGCUUUUGCAACUUAA92.1627118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062869CACAGCTTTTGCAACTTAATTAAGTTGCAAAAGCTGTG0.109700.025300.758600.750000.913000.75000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19CGCGACUUAUAAGAGCUCC61.14632845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79037CGCGACTTATAAGAGCTCCGGAGCTCTTATAAGTCGCG0.078700.009300.551700.500000.967400.62500


Target Position: 3148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148UGGAUCACAAGAUGGAAUU67.19532243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743166TGGATCACAAGATGGAATTAATTCCATCTTGTGATCCA0.071300.003700.836200.750000.994600.87500


Target Position: 3380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3380ACUAAUUCAUAAUCACUCU80.2904861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003398ACTAATTCATAATCACTCTAGAGTGATTATGAATTAGT0.313600.040500.482800.500001.000001.00000


Target Position: 2792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792UCAGAUUUCUGGUUGUUAU79.8214906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832810TCAGATTTCTGGTTGTTATATAACAACCAGAAATCTGA0.217900.003600.681000.750000.913000.62500


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409UGGUAAAGGCAAUCCUGAG69.35641981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900427TGGTAAAGGCAATCCTGAGCTCAGGATTGCCTTTACCA0.091900.001500.534500.500000.934800.87500


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517GUCACCUGUGCAGCUGGAA76.95091173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701535GTCACCTGTGCAGCTGGAATTCCAGCTGCACAGGTGAC0.042500.001800.646600.750000.902200.62500


Target Position: 2335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335UUGGAAUGAGACUGCUGAU74.32421452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492353TTGGAATGAGACTGCTGATATCAGCAGTCTCATTCCAA0.219900.007000.465500.500001.000001.00000


Target Position: 3406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406UGUAAUCUGAAUAAAGUGU68.57932070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943424TGTAATCTGAATAAAGTGTACACTTTATTCAGATTACA0.058100.028800.500000.500001.000001.00000


Target Position: 1061, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061CAUCAAGAAGGAGCUAAAA89.9605199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1059-1081TACATCAAGAAGGAGCTAAAATGUUUUAGCUCCUUCUUGAUGUACAUCAAGAAGGAGCUAAAAUGU18.320.422


Target Position: 3400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400AUUAAUUGUAAUCUGAAUA81.2833778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9313418ATTAATTGTAATCTGAATATATTCAGATTACAATTAAT0.073900.030100.465500.500001.000001.00000


Target Position: 3563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3563GGUAAAUCAGUAAGAGGUG76.11311248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863581GGTAAATCAGTAAGAGGTGCACCTCTTACTGATTTACC0.062600.016100.560300.750001.000001.00000


Target Position: 2888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888UUGCUGUUUUAAACAUUAA78.62451012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462906TTGCTGTTTTAAACATTAATTAATGTTTAAAACAGCAA0.179500.002300.612100.500000.989100.62500


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987UGGUGAAAAUGCUUGGUUC70.231892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9511005TGGTGAAAATGCTTGGTTCGAACCAAGCATTTTCACCA0.013400.003600.672400.500001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074GCUUUAUUCUCCCAUUGAA95.893950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2872092GCTTTATTCTCCCATTGAATTCAATGGGAGAATAAAGC0.356400.082600.681001.000001.000001.00000


Target Position: 1754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1754AAGCUCUUACACCCACCAU73.6821525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051772AAGCTCTTACACCCACCATATGGTGGGTGTAAGAGCTT0.126600.058200.482800.500000.983700.62500


Target Position: 2920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2920CUCUUUAUACAGCUGUAUU84.0606544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562938CTCTTTATACAGCTGTATTAATACAGCTGTATAAAGAG0.012400.011800.801700.750000.945700.62500


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350UGAUCUUGGACUUGAUAUU77.52991110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2522368TGATCTTGGACTTGATATTAATATCAAGTCCAAGATCA0.231900.044200.715500.750001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913CCUUUCUCUCUUUAUACAG71.71081725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292931CCTTTCTCTCTTTATACAGCTGTATAAAGAGAGAAAGG0.075500.081400.560300.750001.000001.00000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703UGCAGAACUUGCCACACGU72.83131606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
895721TGCAGAACTTGCCACACGTACGTGTGGCAAGTTCTGCA0.023400.007700.577600.500000.907600.62500


Target Position: 3232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232CUGACUUUGCUUGCUUUGA72.50811639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533250CTGACTTTGCTTGCTTTGATCAAAGCAAGCAAAGTCAG0.049700.013600.560300.500001.000001.00000


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138UGUUAAAUUCUUGGCUAUU71.53681751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801156TGTTAAATTCTTGGCTATTAATAGCCAAGAATTTAACA0.025200.012800.698300.750001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185AUGGCAACCAAGAAAGCAA81.6631736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261203ATGGCAACCAAGAAAGCAATTGCTTTCTTGGTTGCCAT0.101100.010000.508600.500000.983700.62500


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687CCGACACCAAGAAGCAGAG68.8342041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141705CCGACACCAAGAAGCAGAGCTCTGCTTCTTGGTGTCGG0.038700.034600.603400.750000.989101.00000


Target Position: 3508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508AGGUGGAUCUAUUUCAUGU83.9504550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7493526AGGTGGATCTATTTCATGTACATGAAATAGATCCACCT0.127900.004100.637900.500001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CUAUCUGUCUGCUCUAGUA100.70210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721325CTATCTGTCTGCTCTAGTATACTAGAGCAGACAGATAG0.087100.005000.491400.750001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815GCUUCCAGACACGCUAUCA86.5457374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815833GCTTCCAGACACGCTATCATGATAGCGTGTCTGGAAGC0.038500.038900.629300.750000.994600.62500


Target Position: 1232, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CAAGCUUUAGUAAAUAUAA97.812427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191250CAAGCTTTAGTAAATATAATTATATTTACTAAAGCTTG0.320600.052000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1230-1252CCCAAGCTTTAGTAAATATAATGUUAUAUUUACUAAAGCUUGGGCAAGCUUUAGUAAAUAUAAUGU-8.017.022


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483UGUUCAGCUUCUGGGUUCA76.18761242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431501TGTTCAGCTTCTGGGTTCATGAACCCAGAAGCTGAACA0.031400.001100.482800.500000.983701.00000


Target Position: 1497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497GUUCAGAUGAUAUAAAUGU80.1497876

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1495-1517GGGTTCAGATGATATAAATGTGGACAUUUAUAUCAUCUGAACCCGUUCAGAUGAUAUAAAUGUGGU-1.820.433


Target Position: 3681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3681AAAAAAUGGUUCAGAAUUA90.0054192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503699AAAAAATGGTTCAGAATTATAATTCTGAACCATTTTTT0.334800.074000.465500.500001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296UGCUGAAGGUGCUAUCUGU81.6292739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351314TGCTGAAGGTGCTATCTGTACAGATAGCACCTTCAGCA0.027300.001200.646600.500000.978300.75000


Target Position: 2598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598UUGAUACUGACCUGUAAAU70.5221859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912616TTGATACTGACCTGTAAATATTTACAGGTCAGTATCAA0.024200.013700.637900.500001.000001.00000


Target Position: 3635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635GUUGUAACCUGCUGUGAUA96.320644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793653GTTGTAACCTGCTGTGATATATCACAGCAGGTTACAAC0.025400.002300.603400.750001.000001.00000


Target Position: 2783, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2783GGAAUGUUCUCAGAUUUCU82.8096647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2781-2803TTGGAATGTTCTCAGATTTCTGGAGAAAUCUGAGAACAUUCCAAGGAAUGUUCUCAGAUUUCUGGU14.814.822


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556UGCUAUGUUCCCUGAGACA80.9244809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
752574TGCTATGTTCCCTGAGACATGTCTCAGGGAACATAGCA0.057000.004300.646600.500001.000001.00000


Target Position: 3135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3135GAAUGCACAAGAAUGGAUC72.77291611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8633153GAATGCACAAGAATGGATCGATCCATTCTTGTGCATTC0.126400.039700.491400.500001.000001.00000


Target Position: 3433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3433UGUAGCCUUUUUGUAUAAA77.86561072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733451TGTAGCCTTTTTGTATAAATTTATACAAAAAGGCTACA0.134800.011600.706900.750001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031GCCAUUACAACUCUCCACA82.5045669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551049GCCATTACAACTCTCCACATGTGGAGAGTTGTAATGGC0.332900.147300.793100.750001.000001.00000


Target Position: 2712, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2712GUGGUUUAGGCUAUUUGUA85.9825418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782730GTGGTTTAGGCTATTTGTATACAAATAGCCTAAACCAC0.084900.001700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2710-2732GAGTGGTTTAGGCTATTTGTAAAUACAAAUAGCCUAAACCACUCGUGGUUUAGGCUAUUUGUAAAU6.920.032


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887GAUGUAGAAACAGCUCGUU80.1008880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886905GATGTAGAAACAGCTCGTTAACGAGCTGTTTCTACATC0.024700.003200.534500.750001.000001.00000


Target Position: 103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
103GAGCGAGGGGAGGCGGAGA75.21131346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943121GAGCGAGGGGAGGCGGAGATCTCCGCCTCCCCTCGCTC0.075800.012200.586200.500000.978300.75000


Target Position: 3022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022ACUAACCAAGCUGAGUUUC52.16083398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8443040ACTAACCAAGCTGAGTTTCGAAACTCAGCTTGGTTAGT0.141000.065400.534500.500000.983700.62500


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634GUUUUAAAAAGCCAGUUUG67.87792157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702652GTTTTAAAAAGCCAGTTTGCAAACTGGCTTTTTAAAAC0.026200.018800.500000.500001.000001.00000


Target Position: 2826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826AGUUAUUAACUUUAAUGUU83.7592571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222844AGTTATTAACTTTAATGTTAACATTAAAGTTAATAACT0.077800.026800.560300.750001.000001.00000


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030UGCCAUUACAACUCUCCAC62.92292686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011048TGCCATTACAACTCTCCACGTGGAGAGTTGTAATGGCA0.242500.134600.560300.500001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331UGUUAGUCACUGGCAGCAA80.2971859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930349TGTTAGTCACTGGCAGCAATTGCTGCCAGTGACTAACA0.017700.001200.560300.750001.000001.00000


Target Position: 2084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084CCCAUUGAAAACAUCCAAA84.6118504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632102CCCATTGAAAACATCCAAATTTGGATGTTTTCAATGGG0.158600.072700.991401.000000.907600.62500


Target Position: 877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GAAUACAAAUGAUGUAGAA101.7336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822895GAATACAAATGATGTAGAATTCTACATCATTTGTATTC0.037300.021200.500000.750000.923900.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
875-897CAGAATACAAATGATGTAGAAACUUCUACAUCAUUUGUAUUCUGGAAUACAAAUGAUGUAGAAACU20.36.912


Target Position: 2606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2606GACCUGUAAAUCAUCCUUU83.73576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6352624GACCTGTAAATCATCCTTTAAAGGATGATTTACAGGTC0.076100.008100.819000.750001.000001.00000


Target Position: 2822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2822UGGAAGUUAUUAACUUUAA84.9036484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992840TGGAAGTTATTAACTTTAATTAAAGTTAATAACTTCCA0.065100.005800.810300.750000.978300.75000


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262UUUUUUUUUUUUUUUUUUU61.69032798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243280TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.914500.911800.500000.500001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221CUGUAAUGGUACUGACUUU90.0464188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3093239CTGTAATGGTACTGACTTTAAAGTCAGTACCATTACAG0.190300.036200.784500.750001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954GGGGGUCCGCAUGGAAGAA81.3921769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581972GGGGGTCCGCATGGAAGAATTCTTCCATGCGGACCCCC0.498100.002100.819001.000000.902201.00000


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406AUCCUAGCUAUCGUUCUUU67.7512177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332424ATCCTAGCTATCGTTCTTTAAAGAACGATAGCTAGGAT0.131900.029700.681000.500001.000001.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671GCAGUUGUAAACUUGAUUA93.227393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792689GCAGTTGTAAACTTGATTATAATCAAGTTTACAACTGC0.041400.011400.819001.000001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732AACUGACAAAACUGCUAAA89.5991219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684750AACTGACAAAACTGCTAAATTTAGCAGTTTTGTCAGTT0.456900.289400.646600.500001.000001.00000


Target Position: 3093, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093GUAACAAUACAAAUGGAUU86.9191360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6513111GTAACAATACAAATGGATTAATCCATTTGTATTGTTAC0.070400.026500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3091-3113GAGTAACAATACAAATGGATTTTAAUCCAUUUGUAUUGUUACUCGUAACAAUACAAAUGGAUUUUU20.16.931


Target Position: 3236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3236CUUUGCUUGCUUUGAAGUA81.9955708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3234-3256GACTTTGCTTGCTTTGAAGTAGCUACUUCAAAGCAAGCAAAGUCCUUUGCUUGCUUUGAAGUAGCU19.218.622


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816CUUCCAGACACGCUAUCAU82.7073654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897834CTTCCAGACACGCTATCATATGATAGCGTGTCTGGAAG0.026800.025900.482800.750000.994600.75000


Target Position: 2342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2342GAGACUGCUGAUCUUGGAC73.99911487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8812360GAGACTGCTGATCTTGGACGTCCAAGATCAGCAGTCTC0.113000.039500.491400.500000.967400.62500


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239UGUUUUGUUCCGAAUGUCU71.63171740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132257TGTTTTGTTCCGAATGTCTAGACATTCGGAACAAAACA0.204300.001400.482800.500001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196GAAAGCAAGCUCAUCAUAC78.49031027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991214GAAAGCAAGCTCATCATACGTATGATGAGCTTGCTTTC0.117100.007000.491400.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257CCUAUACUUACGAAAAACU79.9777891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431275CCTATACTTACGAAAAACTAGTTTTTCGTAAGTATAGG0.522700.151700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1255-1277GACCTATACTTACGAAAAACTACAGUUUUUCGUAAGUAUAGGUCCCUAUACUUACGAAAAACUACU8.711.222


Target Position: 3285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285CAGUAACUGUUUUUUAAGU83.2225616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403303CAGTAACTGTTTTTTAAGTACTTAAAAAACAGTTACTG0.195300.019200.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3283-3305TGCAGTAACTGTTTTTTAAGTCTACUUAAAAAACAGUUACUGCACAGUAACUGUUUUUUAAGUCUU-3.817.622


Target Position: 3305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305UCUCGUAGUGUUAAGUUAU77.96461064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8843323TCTCGTAGTGTTAAGTTATATAACTTAACACTACGAGA0.099200.001700.681000.750001.000001.00000


Target Position: 3660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3660UUCAAGAGAAAAUGCGGUU60.05362931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653678TTCAAGAGAAAATGCGGTTAACCGCATTTTCTCTTGAA0.052500.036400.525900.500001.000001.00000


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230UACUGACUUUGCUUGCUUU80.7401825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873248TACTGACTTTGCTTGCTTTAAAGCAAGCAAAGTCAGTA0.042100.007200.681000.500001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810UCGAAAUCUUGCCCUUUGU62.85062691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131828TCGAAATCTTGCCCTTTGTACAAAGGGCAAGATTTCGA0.122300.081900.586200.500001.000001.00000


Target Position: 2852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852ACAGCUUUUGCAACUUAAU75.29871337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4162870ACAGCTTTTGCAACTTAATATTAAGTTGCAAAAGCTGT0.225500.022100.698300.750000.913000.75000


Target Position: 2744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2744AACAGGUAUAUACUUUGAA85.4606449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122762AACAGGTATATACTTTGAATTCAAAGTATATACCTGTT0.239100.072600.474100.500001.000001.00000


Target Position: 3313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313UGUUAAGUUAUAGUGAAUA82.8561643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7973331TGTTAAGTTATAGTGAATATATTCACTATAACTTAACA0.041000.012900.663800.750001.000001.00000


Target Position: 2912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2912GCCUUUCUCUCUUUAUACA91.7873130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152930GCCTTTCTCTCTTTATACATGTATAAAGAGAGAAAGGC0.339200.375700.793100.750001.000001.00000


Target Position: 3436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3436AGCCUUUUUGUAUAAAAUA85.6658435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3833454AGCCTTTTTGTATAAAATATATTTTATACAAAAAGGCT0.336800.040500.810300.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051CCUUUUAUUACAUCAAGAA91.7438131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521069CCTTTTATTACATCAAGAATTCTTGATGTAATAAAAGG0.161000.068000.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1049-1071AACCTTTTATTACATCAAGAAGGUUCUUGAUGUAAUAAAAGGUUCCUUUUAUUACAUCAAGAAGGU20.4-4.332


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305UGCUAUCUGUCUGCUCUAG65.92712384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381323TGCTATCTGTCTGCTCTAGCTAGAGCAGACAGATAGCA0.043200.003000.681000.500001.000001.00000


Target Position: 1755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755AGCUCUUACACCCACCAUC65.65072414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691773AGCTCTTACACCCACCATCGATGGTGGGTGTAAGAGCT0.112700.082600.672400.500001.000001.00000


Target Position: 2814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2814AUCAUGUGUGGAAGUUAUU71.49961753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422832ATCATGTGTGGAAGTTATTAATAACTTCCACACATGAT0.105900.018100.672400.500001.000001.00000


Target Position: 3263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3263UUUUUUUUUUUUUUUUUUU61.69032799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893281TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.908700.906800.500000.500001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333GCUUGGAAUGAGACUGCUG76.7581192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6362351GCTTGGAATGAGACTGCTGCAGCAGTCTCATTCCAAGC0.102500.008100.569000.750001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646CUGUGAUACGAUGCUUCAA88.8466262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5743664CTGTGATACGATGCTTCAATTGAAGCATCGTATCACAG0.088400.041100.637900.750001.000001.00000


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306CUCGUAGUGUUAAGUUAUA90.2405175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8623324CTCGTAGTGTTAAGTTATATATAACTTAACACTACGAG0.375200.002000.767200.750001.000001.00000


Target Position: 3680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3680UAAAAAAUGGUUCAGAAUU70.51441861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043698TAAAAAATGGTTCAGAATTAATTCTGAACCATTTTTTA0.272300.080400.525900.500001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146UCUUGGCUAUUACGACAGA76.05741254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071164TCTTGGCTATTACGACAGATCTGTCGTAATAGCCAAGA0.464300.012600.500000.500001.000001.00000


Target Position: 3668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3668AAAAUGCGGUUAUAAAAAA85.5634441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503686AAAATGCGGTTATAAAAAATTTTTTATAACCGCATTTT0.148900.035900.500000.500001.000001.00000


Target Position: 3502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3502AUAAGCAGGUGGAUCUAUU79.0771971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573520ATAAGCAGGTGGATCTATTAATAGATCCACCTGCTTAT0.062100.001000.534500.500001.000001.00000


Target Position: 3401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401UUAAUUGUAAUCUGAAUAA78.9978977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333419TTAATTGTAATCTGAATAATTATTCAGATTACAATTAA0.070000.026400.500000.500001.000001.00000


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950CAUUGUGAUUGGCCUGUAG79.434945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492968CATTGTGATTGGCCTGTAGCTACAGGCCAATCACAATG0.013600.001700.482800.500001.000001.00000


Target Position: 3603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3603ACAGUUUACCAGUUGCCUU76.73551195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973621ACAGTTTACCAGTTGCCTTAAGGCAACTGGTAAACTGT0.219300.082100.569000.750001.000001.00000


Target Position: 3180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3180CCUUGCUUGUUAAAUUUUU76.72861197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1673198CCTTGCTTGTTAAATTTTTAAAAATTTAACAAGCAAGG0.374300.069600.844801.000001.000001.00000


Target Position: 2028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028GAAUUGUUAUCAGAGGACU82.7699649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522046GAATTGTTATCAGAGGACTAGTCCTCTGATAACAATTC0.067700.028300.465500.500001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157ACGACAGACUGCCUUCAAA90.1706179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081175ACGACAGACTGCCTTCAAATTTGAAGGCAGTCTGTCGT0.080000.035000.775900.750000.913000.75000


Target Position: 3532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3532AUCAAAAACUAUUUGGGAU76.22441236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733550ATCAAAAACTATTTGGGATATCCCAAATAGTTTTTGAT0.066700.009000.500000.500000.951100.75000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045CUAAAUACCAUUCCAUUGU69.8921927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462063CTAAATACCATTCCATTGTACAATGGAATGGTATTTAG0.109200.044900.465500.500001.000001.00000


Target Position: 1926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926UGGGUGGGACACAGCAGCA76.77691190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661944TGGGTGGGACACAGCAGCATGCTGCTGTGTCCCACCCA0.215400.002000.491400.500001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228GGUACUGACUUUGCUUGCU78.50441024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763246GGTACTGACTTTGCTTGCTAGCAAGCAAAGTCAGTACC0.025900.003300.500000.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GUGGACCCCAAGCUUUAGU63.68882611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311242GTGGACCCCAAGCTTTAGTACTAAAGCTTGGGGTCCAC0.053600.006600.586200.500000.989100.62500


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405GAUCCUAGCUAUCGUUCUU89.4975231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402423GATCCTAGCTATCGTTCTTAAGAACGATAGCTAGGATC0.160800.027400.543100.750001.000001.00000


Target Position: 3654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654CGAUGCUUCAAGAGAAAAU85.0243477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2133672CGATGCTTCAAGAGAAAATATTTTCTCTTGAAGCATCG0.367900.054800.784501.000000.967400.75000


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173ACCCUAGCCUUGCUUGUUA80.785818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5633191ACCCTAGCCTTGCTTGTTATAACAAGCAAGGCTAGGGT0.091900.040100.819000.750000.967401.00000


Target Position: 3424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3424UAACAAUUGUGUAGCCUUU77.08481159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273442TAACAATTGTGTAGCCTTTAAAGGCTACACAATTGTTA0.026600.001200.534500.500001.000001.00000


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673CCUACAGAACUUCAGAAAG74.18011467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132691CCTACAGAACTTCAGAAAGCTTTCTGAAGTTCTGTAGG0.240000.037000.706900.750001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618CUCAUCCCACUAAUGUCCA75.35451333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933636CTCATCCCACTAATGTCCATGGACATTAGTGGGATGAG0.022100.016800.465500.500000.972800.75000


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GGGACACAGCAGCAAUUUG78.63451011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961949GGGACACAGCAGCAATTTGCAAATTGCTGCTGTGTCCC0.023200.007300.844800.750001.000001.00000


Target Position: 3642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642CCUGCUGUGAUACGAUGCU72.41951651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8873660CCTGCTGTGATACGATGCTAGCATCGTATCACAGCAGG0.104000.001900.491400.750001.000001.00000


Target Position: 237, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237CAUACAACUGUUUUGAAAA95.098457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353255CATACAACTGTTTTGAAAATTTTCAAAACAGTTGTATG0.454700.224700.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
235-257ACCATACAACTGTTTTGAAAATCUUUUCAAAACAGUUGUAUGGUCAUACAACUGUUUUGAAAAUCU7.714.622


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GGUUAAUAAGGCUGCAGUU88.7663264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
658787GGTTAATAAGGCTGCAGTTAACTGCAGCCTTATTAACC0.069500.011700.706901.000001.000001.00000


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017UGUUCACAACCGAAUUGUU79.5436932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152035TGTTCACAACCGAATTGTTAACAATTCGGTTGTGAACA0.163200.118900.560300.750000.929300.62500


Target Position: 2908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2908AGCAGCCUUUCUCUCUUUA81.4749761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2872926AGCAGCCTTTCTCTCTTTATAAAGAGAGAAAGGCTGCT0.722700.050300.819000.750001.000001.00000


Target Position: 1863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1863CCAUUCCACGACUAGUUCA85.7072433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471881CCATTCCACGACTAGTTCATGAACTAGTCGTGGAATGG0.051300.032900.620700.750001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953AGGGGGUCCGCAUGGAAGA69.80351937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961971AGGGGGTCCGCATGGAAGATCTTCCATGCGGACCCCCT0.190400.001600.620700.500000.902200.87500


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411AGCUAUCGUUCUUUUCACU80.006888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602429AGCTATCGTTCTTTTCACTAGTGAAAAGAACGATAGCT0.206200.036100.646600.500001.000001.00000


Target Position: 3233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3233UGACUUUGCUUGCUUUGAA85.2477464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723251TGACTTTGCTTGCTTTGAATTCAAAGCAAGCAAAGTCA0.026200.004000.551700.750001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948GCUUACUGGCCAUCUUUAA88.3733284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923966GCTTACTGGCCATCTTTAATTAAAGATGGCCAGTAAGC0.129100.001300.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
946-968GGGCTTACTGGCCATCTTTAAGTUUAAAGAUGGCCAGUAAGCCCGCUUACUGGCCAUCUUUAAGUU6.916.423


Target Position: 1554, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554GCAAUAAUUAUAAGAACAA93.868876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841572GCAATAATTATAAGAACAATTGTTCTTATAATTATTGC0.193500.088500.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1552-1574TTGCAATAATTATAAGAACAAGAUUGUUCUUAUAAUUAUUGCAAGCAAUAAUUAUAAGAACAAGAU19.2-1.821


Target Position: 2907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2907UAGCAGCCUUUCUCUCUUU74.90361385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302925TAGCAGCCTTTCTCTCTTTAAAGAGAGAAAGGCTGCTA0.762700.021300.672400.500001.000001.00000


Target Position: 1303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303GGUGCUAUCUGUCUGCUCU89.069254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201321GGTGCTATCTGTCTGCTCTAGAGCAGACAGATAGCACC0.106300.014500.629300.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508UGAUAUUGAUGGACAGUAU88.6666270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799526TGATATTGATGGACAGTATATACTGTCCATCAATATCA0.083000.003300.681000.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889GUUCGUGCACAUCAGGAUA89.4417238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6341907GTTCGTGCACATCAGGATATATCCTGATGTGCACGAAC0.230600.008100.603400.750001.000001.00000


Target Position: 2621, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621CUUUAGGUAAGAAGUUUUA85.1917469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272639CTTTAGGTAAGAAGTTTTATAAAACTTCTTACCTAAAG0.406300.019400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2619-2641TCCTTTAGGTAAGAAGTTTTAAAUAAAACUUCUUACCUAAAGGACUUUAGGUAAGAAGUUUUAAAU3.218.632


Target Position: 96, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
96GAGCGGAGAGCGAGGGGAG70.10941906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818114GAGCGGAGAGCGAGGGGAGCTCCCCTCGCTCTCCGCTC0.190500.006600.500000.500000.972800.75000


Target Position: 3483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483CCUUUUUAAUAUGCUUAAA87.0039353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613501CCTTTTTAATATGCTTAAATTTAAGCATATTAAAAAGG0.045900.020800.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3481-3503TTCCTTTTTAATATGCTTAAAATUUUAAGCAUAUUAAAAAGGAACCUUUUUAAUAUGCUUAAAAUU19.7-3.822


Target Position: 2611, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2611GUAAAUCAUCCUUUAGGUA91.6355132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582629GTAAATCATCCTTTAGGTATACCTAAAGGATGATTTAC0.061200.023300.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2609-2631CTGTAAATCATCCTTTAGGTAAGUACCUAAAGGAUGAUUUACAGGUAAAUCAUCCUUUAGGUAAGU18.68.922


Target Position: 3538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538AACUAUUUGGGAUAUGUAU81.8385721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9013556AACTATTTGGGATATGTATATACATATCCCAAATAGTT0.219000.040000.603400.500001.000001.00000


Target Position: 2865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865CUUAAUACUCAAAUGAGUA92.7656103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2863-2885AACTTAATACTCAAATGAGTAACUACUCAUUUGAGUAUUAAGUUCUUAAUACUCAAAUGAGUAACU19.21.422


Target Position: 3506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3506GCAGGUGGAUCUAUUUCAU90.6216159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473524GCAGGTGGATCTATTTCATATGAAATAGATCCACCTGC0.130000.007700.698301.000001.000001.00000


Target Position: 2259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2259AGGACAAGCCACAAGAUUA94.90862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6652277AGGACAAGCCACAAGATTATAATCTTGTGGCTTGTCCT0.546800.006900.810300.750001.000001.00000


Target Position: 3581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3581GUUAUUUGGAACCUUGUUU73.60711531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993599GTTATTTGGAACCTTGTTTAAACAAGGTTCCAAATAAC0.022900.001700.646600.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518UCACCUGUGCAGCUGGAAU72.03691695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571536TCACCTGTGCAGCTGGAATATTCCAGCTGCACAGGTGA0.039800.002100.715500.750000.902200.75000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006ACCAGUGGAUUCUGUGUUG67.81662172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651024ACCAGTGGATTCTGTGTTGCAACACAGAATCCACTGGT0.127600.001900.706900.500000.918500.75000


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955GGGGUCCGCAUGGAAGAAA77.70871083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251973GGGGTCCGCATGGAAGAAATTTCTTCCATGCGGACCCC0.514200.002700.991401.000000.902201.00000


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GCCUUCAAAUUUUAGCUUA87.1328345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991185GCCTTCAAATTTTAGCTTATAAGCTAAAATTTGAAGGC0.270000.292300.965501.000001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160ACAGACUGCCUUCAAAUUU71.35241767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201178ACAGACTGCCTTCAAATTTAAATTTGAAGGCAGTCTGT0.602500.040400.706900.750001.000001.00000


Target Position: 3579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3579GUGUUAUUUGGAACCUUGU75.19321349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413597GTGTTATTTGGAACCTTGTACAAGGTTCCAAATAACAC0.018700.001100.586200.500001.000001.00000


Target Position: 2597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2597UUUGAUACUGACCUGUAAA79.8454902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862615TTTGATACTGACCTGTAAATTTACAGGTCAGTATCAAA0.024900.015800.500000.500001.000001.00000


Target Position: 3245, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3245CUUUGAAGUAGCUCUUUUU84.6128503

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6324519CTTTGAAGTAGCTCTTTTT1/1/0/097.75CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41281464..41281482(+)00CTNNB1(0.002)&LOC100290667(0.029)&SFRS6(0.029)&LOC644422(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4263263CTTTGAAGTAGCTCTTTTTAAAAAGAGCTACTTCAAAG0.424700.024700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3243-3265TGCTTTGAAGTAGCTCTTTTTTTAAAAAGAGCUACUUCAAAGCACUUUGAAGUAGCUCUUUUUUUU10.312.222


Target Position: 2939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939GUCUGAACUUGCAUUGUGA94.053173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392957GTCTGAACTTGCATTGTGATCACAATGCAAGTTCAGAC0.127500.058700.594800.500001.000001.00000


Target Position: 3379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3379CACUAAUUCAUAAUCACUC75.82251282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893397CACTAATTCATAATCACTCGAGTGATTATGAATTAGTG0.333400.032800.482800.500001.000001.00000


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194AAGAAAGCAAGCUCAUCAU79.8733900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321212AAGAAAGCAAGCTCATCATATGATGAGCTTGCTTTCTT0.138900.014100.482800.500001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677CAGAACUUCAGAAAGACUU77.65711090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3672695CAGAACTTCAGAAAGACTTAAGTCTTTCTGAAGTTCTG0.228500.055400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2675-2697TACAGAACTTCAGAAAGACTTGGAAGUCUUUCUGAAGUUCUGUACAGAACUUCAGAAAGACUUGGU17.717.722


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GGAUGAUCCUAGCUAUCGU92.1916115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672419GGATGATCCTAGCTATCGTACGATAGCTAGGATCATCC0.061100.001900.594800.750001.000001.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311CUGUCUGCUCUAGUAAUAA91.6107133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6301329CTGTCTGCTCTAGTAATAATTATTACTAGAGCAGACAG0.150000.008600.750000.750001.000001.00000


Target Position: 236, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236CCAUACAACUGUUUUGAAA93.108996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100254CCATACAACTGTTTTGAAATTTCAAAACAGTTGTATGG0.443700.218300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
234-256TACCATACAACTGTTTTGAAAATUUUCAAAACAGUUGUAUGGUACCAUACAACUGUUUUGAAAAUU7.713.531


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504GCUGACUAUCCAGUUGAUG67.3452226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222522GCTGACTATCCAGTTGATGCATCAACTGGATAGTCAGC0.018400.002400.698300.750000.918500.62500


Target Position: 2881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881GUAACAUUUGCUGUUUUAA87.1086347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652899GTAACATTTGCTGTTTTAATTAAAACAGCAAATGTTAC0.076900.003800.646600.750000.934800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2879-2901GAGTAACATTTGCTGTTTTAAACUUAAAACAGCAAAUGUUACUCGUAACAUUUGCUGUUUUAAACU7.26.911


Target Position: 3257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257UCUUUUUUUUUUUUUUUUU63.34462645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1703275TCTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAGA0.987400.911200.724100.750001.000001.00000


Target Position: 3017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3017GACACACUAACCAAGCUGA89.7662207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5893035GACACACTAACCAAGCTGATCAGCTTGGTTAGTGTGTC0.296400.067900.594800.500001.000001.00000


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869ACCAUGCAGAAUACAAAUG61.04212856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754887ACCATGCAGAATACAAATGCATTTGTATTCTGCATGGT0.174300.016900.698300.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672CAGUUGUAAACUUGAUUAA92.6089107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841690CAGTTGTAAACTTGATTAATTAATCAAGTTTACAACTG0.033500.009500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
670-692TGCAGTTGTAAACTTGATTAACTUUAAUCAAGUUUACAACUGCACAGUUGUAAACUUGAUUAACUU8.919.022


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802GGAUUGAUUCGAAAUCUUG81.8166723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041820GGATTGATTCGAAATCTTGCAAGATTTCGAATCAATCC0.226700.024300.724100.750001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908ACCGCUGGGACCUUGCAUA76.23351235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940926ACCGCTGGGACCTTGCATATATGCAAGGTCCCAGCGGT0.476500.001100.810300.750001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CGACAGACUGCCUUCAAAU89.9734196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531176CGACAGACTGCCTTCAAATATTTGAAGGCAGTCTGTCG0.097600.037100.784501.000000.913000.62500


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723UCGCCUUCACUAUGGACUA77.36531129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791741TCGCCTTCACTATGGACTATAGTCCATAGTGAAGGCGA0.094500.001700.620700.750000.983700.62500


Target Position: 3243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243UGCUUUGAAGUAGCUCUUU66.1222357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5093261TGCTTTGAAGTAGCTCTTTAAAGAGCTACTTCAAAGCA0.108100.016200.853400.750000.918500.62500


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073UGCUUUAUUCUCCCAUUGA75.74521288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7042091TGCTTTATTCTCCCATTGATCAATGGGAGAATAAAGCA0.358200.090900.629300.500001.000001.00000


Target Position: 3247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3247UUGAAGUAGCUCUUUUUUU67.06572254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103265TTGAAGTAGCTCTTTTTTTAAAAAAAGAGCTACTTCAA0.801100.037800.646600.500001.000001.00000


Target Position: 3519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519UUUCAUGUUUUUGAUCAAA73.76241518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773537TTTCATGTTTTTGATCAAATTTGATCAAAAACATGAAA0.123200.003700.500000.500001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CUGGGUUCAGAUGAUAUAA88.1625295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771511CTGGGTTCAGATGATATAATTATATCATCTGAACCCAG0.065400.007700.750000.750000.989100.62500


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042UCUCCACAACCUUUUAUUA83.4397600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501060TCTCCACAACCTTTTATTATAATAAAAGGTTGTGGAGA0.175000.019400.689700.750001.000001.00000


Target Position: 526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
526UGCAAUGACUCGAGCUCAG66.96642268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
938544TGCAATGACTCGAGCTCAGCTGAGCTCGAGTCATTGCA0.015900.001600.569000.500000.972800.75000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151AUCACAAGAUGGAAUUUAU85.5984438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8963169ATCACAAGATGGAATTTATATAAATTCCATCTTGTGAT0.048800.003500.637900.500001.000001.00000


Target Position: 3432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3432GUGUAGCCUUUUUGUAUAA92.2449114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5773450GTGTAGCCTTTTTGTATAATTATACAAAAAGGCTACAC0.135900.011400.758600.750001.000001.00000


Target Position: 20, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
20GCGACUUAUAAGAGCUCCU77.78141077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73338GCGACTTATAAGAGCTCCTAGGAGCTCTTATAAGTCGC0.053100.019800.577600.750001.000001.00000


Target Position: 1582, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582CUGCCAAGUGGGUGGUAUA90.0206191

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4158219CTGCCAAGTGGGTGGTATA1/1/0/097.75CTNNB1NM_001904.3+NM_001098209.1+NM_001098210.11+1+1NANANA3:41275148..41275166(+)00CTNNB1(0.002)


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095CUGGUGGGCUGCAGAAAAU79.3266954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791113CTGGTGGGCTGCAGAAAATATTTTCTGCAGCCCACCAG0.065200.008700.775900.750001.000001.00000


Target Position: 1496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496GGUUCAGAUGAUAUAAAUG86.7165368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211514GGTTCAGATGATATAAATGCATTTATATCATCTGAACC0.087500.005100.698300.750001.000001.00000


Target Position: 2710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2710GAGUGGUUUAGGCUAUUUG77.1191152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9032728GAGTGGTTTAGGCTATTTGCAAATAGCCTAAACCACTC0.066200.001500.663800.500001.000001.00000


Target Position: 3551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3551AUGUAUGGGUAGGGUAAAU74.62861419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193569ATGTATGGGTAGGGTAAATATTTACCCTACCCATACAT0.105100.065100.646600.500001.000001.00000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408CCUAGCUAUCGUUCUUUUC66.47842313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542426CCTAGCTATCGTTCTTTTCGAAAAGAACGATAGCTAGG0.147600.012500.672400.750001.000001.00000


Target Position: 305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
305GCCAUGGAACCAGACAGAA84.1766536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289323GCCATGGAACCAGACAGAATTCTGTCTGGTTCCATGGC0.264000.038400.827601.000000.983700.62500


Target Position: 2821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821GUGGAAGUUAUUAACUUUA89.2189248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332839GTGGAAGTTATTAACTTTATAAAGTTAATAACTTCCAC0.066800.002500.758600.750000.978300.75000


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589GAACCUUGUUUUGGACAGU77.20211142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343607GAACCTTGTTTTGGACAGTACTGTCCAAAACAAGGTTC0.028300.001200.465500.500001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096UGGUGGGCUGCAGAAAAUG57.75933104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281114TGGTGGGCTGCAGAAAATGCATTTTCTGCAGCCCACCA0.345500.007100.689700.500001.000001.00000


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140CACAAGAAUGGAUCACAAG77.63331094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663158CACAAGAATGGATCACAAGCTTGTGATCCATTCTTGTG0.066500.038300.655200.500001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952GAGGGGGUCCGCAUGGAAG69.78831941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291970GAGGGGGTCCGCATGGAAGCTTCCATGCGGACCCCCTC0.088300.001200.672400.500000.902200.75000


Target Position: 2829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829UAUUAACUUUAAUGUUUUU78.39431033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492847TATTAACTTTAATGTTTTTAAAAACATTAAAGTTAATA0.117500.033000.543100.500001.000001.00000


Target Position: 3127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3127GAAGUGAAGAAUGCACAAG73.15591580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303145GAAGTGAAGAATGCACAAGCTTGTGCATTCTTCACTTC0.117300.030400.534500.500001.000001.00000


Target Position: 2065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065UGUGCAGCUGCUUUAUUCU73.89481497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932083TGTGCAGCTGCTTTATTCTAGAATAAAGCAGCTGCACA0.201300.013500.482800.500000.956500.87500


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254GGACCUAUACUUACGAAAA98.87121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731272GGACCTATACTTACGAAAATTTTCGTAAGTATAGGTCC0.310800.071200.870701.000001.000001.00000


Target Position: 3525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3525GUUUUUGAUCAAAAACUAU85.428453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3523-3545ATGTTTTTGATCAAAAACTATTTAUAGUUUUUGAUCAAAAACAUGUUUUUGAUCAAAAACUAUUUU4.97.722


Target Position: 3254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254AGCUCUUUUUUUUUUUUUU74.32921451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4033272AGCTCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGAGCT0.991300.790800.853400.750001.000001.00000


Target Position: 2674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674CUACAGAACUUCAGAAAGA90.0355189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2672-2694GCCTACAGAACTTCAGAAAGACTUCUUUCUGAAGUUCUGUAGGCCUACAGAACUUCAGAAAGACUU16.620.322


Target Position: 3381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3381CUAAUUCAUAAUCACUCUA88.226292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573399CTAATTCATAATCACTCTATAGAGTGATTATGAATTAG0.310500.076900.500000.750001.000001.00000


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238AUACAACUGUUUUGAAAAU78.30591040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671256ATACAACTGTTTTGAAAATATTTTCAAAACAGTTGTAT0.256000.122900.534500.500001.000001.00000


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019GUGUUGUUUUAUGCCAUUA86.2195400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981037GTGTTGTTTTATGCCATTATAATGGCATAAAACAACAC0.114000.010500.758600.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792UCCAUCAGCUUUCUAAAAA75.35121334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710810TCCATCAGCTTTCTAAAAATTTTTAGAAAGCTGATGGA0.057000.025300.870700.750000.978300.87500


Target Position: 3562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3562GGGUAAAUCAGUAAGAGGU83.7536573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413580GGGTAAATCAGTAAGAGGTACCTCTTACTGATTTACCC0.052200.016900.637900.750001.000001.00000


Target Position: 2075, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075CUUUAUUCUCCCAUUGAAA89.164250

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2073-2095TGCTTTATTCTCCCATTGAAAACUUUCAAUGGGAGAAUAAAGCACUUUAUUCUCCCAUUGAAAACU13.82.122


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037ACAACUCUCCACAACCUUU79.2977956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411055ACAACTCTCCACAACCTTTAAAGGTTGTGGAGAGTTGT0.071800.008300.706900.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894UGCACAUCAGGAUACCCAG67.40312215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121912TGCACATCAGGATACCCAGCTGGGTATCCTGATGTGCA0.039200.028300.569000.500000.951100.62500


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895GCACAUCAGGAUACCCAGC64.21682560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411913GCACATCAGGATACCCAGCGCTGGGTATCCTGATGTGC0.037100.026600.500000.500000.978300.87500


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688CGACACCAAGAAGCAGAGA78.5061023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101706CGACACCAAGAAGCAGAGATCTCTGCTTCTTGGTGTCG0.039500.035100.569000.750000.989101.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GACCAGCCGACACCAAGAA84.5894507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111699GACCAGCCGACACCAAGAATTCTTGGTGTCGGCTGGTC0.354300.133800.646600.750000.967400.62500


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596GUUUGAUACUGACCUGUAA97.781928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112614GTTTGATACTGACCTGTAATTACAGGTCAGTATCAAAC0.039400.018900.612100.750001.000001.00000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129CAAAACAAAUGUUAAAUUC73.1851573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111147CAAAACAAATGTTAAATTCGAATTTAACATTTGTTTTG0.246700.212300.474100.500001.000001.00000


Target Position: 3055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055GAAGUAAACUUUUUGUUCU87.427329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3053-3075TTGAAGTAAACTTTTTGTTCTGGAGAACAAAAAGUUUACUUCAAGAAGUAAACUUUUUGUUCUGGU14.94.932


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCACAACCUUUUAUUACAU86.9206359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221063CCACAACCTTTTATTACATATGTAATAAAAGGTTGTGG0.287000.034800.689701.000001.000001.00000


Target Position: 495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495AAGAACAAGUAGCUGAUAU82.1067703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878513AAGAACAAGTAGCTGATATATATCAGCTACTTGTTCTT0.054900.057500.594800.500001.000001.00000


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139GUUAAAUUCUUGGCUAUUA88.5808274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891157GTTAAATTCTTGGCTATTATAATAGCCAAGAATTTAAC0.024400.020900.612100.750001.000001.00000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013GAUUCUGUGUUGUUUUAUG83.1277620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021031GATTCTGTGTTGTTTTATGCATAAAACAACACAGAATC0.067100.043400.525900.500001.000001.00000


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961CGCAUGGAAGAAAUAGUUG71.1961784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791979CGCATGGAAGAAATAGTTGCAACTATTTCTTCCATGCG0.135400.025900.775900.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336UGGAAUGAGACUGCUGAUC53.943319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622354TGGAATGAGACTGCTGATCGATCAGCAGTCTCATTCCA0.166400.008600.663800.500001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UACAACUCUCCACAACCUU66.33582332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461054TACAACTCTCCACAACCTTAAGGTTGTGGAGAGTTGTA0.057500.004200.543100.500001.000001.00000


Target Position: 3411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3411UCUGAAUAAAGUGUAACAA78.8483990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373429TCTGAATAAAGTGTAACAATTGTTACACTTTATTCAGA0.052700.018200.577600.750001.000001.00000


Target Position: 12, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12GCUUCUGCGCGACUUAUAA91.4847138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89930GCTTCTGCGCGACTTATAATTATAAGTCGCGCAGAAGC0.040800.001500.819001.000000.967400.75000


Target Position: 241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241CAACUGUUUUGAAAAUCCA88.3427285

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
239-261TACAACTGTTTTGAAAATCCAGCUGGAUUUUCAAAACAGUUGUACAACUGUUUUGAAAAUCCAGCU14.217.832


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032CCAUUACAACUCUCCACAA96.24246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371050CCATTACAACTCTCCACAATTGTGGAGAGTTGTAATGG0.347400.160600.698301.000001.000001.00000


Target Position: 2348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2348GCUGAUCUUGGACUUGAUA90.6581156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2052366GCTGATCTTGGACTTGATATATCAAGTCCAAGATCAGC0.262500.057000.810301.000001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474UGGGACUCUUGUUCAGCUU69.45321970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271492TGGGACTCTTGTTCAGCTTAAGCTGAACAAGAGTCCCA0.173200.002600.706900.750000.983700.75000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553UGCAAUAAUUAUAAGAACA84.2155533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611571TGCAATAATTATAAGAACATGTTCTTATAATTATTGCA0.167900.104000.646600.500001.000001.00000


Target Position: 3371, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371GUGUAGAACACUAAUUCAU86.429384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4583389GTGTAGAACACTAATTCATATGAATTAGTGTTCTACAC0.128000.018900.637900.750000.934800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3369-3391TGGTGTAGAACACTAATTCATAAAUGAAUUAGUGUUCUACACCAGUGUAGAACACUAAUUCAUAAU8.920.332


Target Position: 3340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3340GCAAUUUCUAAUUUUUAAG70.98511812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3813358GCAATTTCTAATTTTTAAGCTTAAAAATTAGAAATTGC0.149300.075000.715500.750001.000001.00000


Target Position: 2885, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885CAUUUGCUGUUUUAAACAU85.9455423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452903CATTTGCTGTTTTAAACATATGTTTAAAACAGCAAATG0.578400.002300.500000.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2883-2905AACATTTGCTGTTTTAAACATTAAUGUUUAAAACAGCAAAUGUUCAUUUGCUGUUUUAAACAUUAU7.218.522


Target Position: 3311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3311AGUGUUAAGUUAUAGUGAA94.847364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7703329AGTGTTAAGTTATAGTGAATTCACTATAACTTAACACT0.044700.019000.534500.750001.000001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306CCAUGGAACCAGACAGAAA97.079337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179324CCATGGAACCAGACAGAAATTTCTGTCTGGTTCCATGG0.329400.065700.844801.000001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018UGUGUUGUUUUAUGCCAUU73.40751549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381036TGTGTTGTTTTATGCCATTAATGGCATAAAACAACACA0.448900.008000.698300.750001.000001.00000


Target Position: 2620, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620CCUUUAGGUAAGAAGUUUU82.7544651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772638CCTTTAGGTAAGAAGTTTTAAAACTTCTTACCTAAAGG0.275800.017400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2618-2640ATCCTTTAGGTAAGAAGTTTTAAAAAACUUCUUACCUAAAGGAUCCUUUAGGUAAGAAGUUUUAAU13.315.822


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007CCAGUGGAUUCUGUGUUGU73.01921591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661025CCAGTGGATTCTGTGTTGTACAACACAGAATCCACTGG0.116100.006900.637900.750000.918500.62500


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646CAGUUUGGGUAAAAUACUU86.3854387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242664CAGTTTGGGTAAAATACTTAAGTATTTTACCCAAACTG0.178000.005000.646600.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258CUAUACUUACGAAAAACUA90.3116171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831276CTATACTTACGAAAAACTATAGTTTTTCGTAAGTATAG0.516800.163200.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1256-1278ACCTATACTTACGAAAAACTACTUAGUUUUUCGUAAGUAUAGGUCUAUACUUACGAAAAACUACUU3.26.333


Target Position: 1551, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551CUUGCAAUAAUUAUAAGAA92.5857109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451569CTTGCAATAATTATAAGAATTCTTATAATTATTGCAAG0.740400.132400.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1549-1571CACTTGCAATAATTATAAGAACAUUCUUAUAAUUAUUGCAAGUGCUUGCAAUAAUUAUAAGAACAU8.420.022


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669AUGCAGUUGUAAACUUGAU77.28391136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956687ATGCAGTTGTAAACTTGATATCAAGTTTACAACTGCAT0.093000.014800.474100.500001.000001.00000


Target Position: 3475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3475AUUAGUUUCCUUUUUAAUA82.6705659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553493ATTAGTTTCCTTTTTAATATATTAAAAAGGAAACTAAT0.325200.133800.465500.500001.000001.00000


Target Position: 3338, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3338CAGCAAUUUCUAAUUUUUA93.867777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573356CAGCAATTTCTAATTTTTATAAAAATTAGAAATTGCTG0.629400.065200.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3336-3358TACAGCAATTTCTAATTTTTAAGUAAAAAUUAGAAAUUGCUGUACAGCAAUUUCUAAUUUUUAAGU-12.018.521


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332GGCUUGGAAUGAGACUGCU79.3467952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152350GGCTTGGAATGAGACTGCTAGCAGTCTCATTCCAAGCC0.061500.005300.646600.750001.000001.00000


Target Position: 3431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3431UGUGUAGCCUUUUUGUAUA86.1142409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563449TGTGTAGCCTTTTTGTATATATACAAAAAGGCTACACA0.115400.012500.663800.750001.000001.00000


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228ACCCCAAGCUUUAGUAAAU78.29471043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691246ACCCCAAGCTTTAGTAAATATTTACTAAAGCTTGGGGT0.163800.017900.844800.750001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390UCAACGUCUUGUUCAGAAC64.14582568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651408TCAACGTCTTGTTCAGAACGTTCTGAACAAGACGTTGA0.027200.009200.577600.500000.972800.75000


Target Position: 3626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3626CCCAAAGUUGUUGUAACCU68.46112082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743644CCCAAAGTTGTTGTAACCTAGGTTACAACAACTTTGGG0.044000.009100.646600.750001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256CUGAGGACAAGCCACAAGA80.9121810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882274CTGAGGACAAGCCACAAGATCTTGTGGCTTGTCCTCAG0.113600.003500.560300.500000.956500.62500


Target Position: 3264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3264UUUUUUUUUUUUUUUUUUU61.69032800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933282TTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA0.788500.782900.500000.500001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439GGAUACCUCCCAAGUCCUG70.32751882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
889457GGATACCTCCCAAGTCCTGCAGGACTTGGGAGGTATCC0.050400.001600.586200.750000.929300.62500