siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 3885   4679   5131   5502  
Biltr, Rnaxs, Sidirect 1087   1097   1147   1148   1150   1155   1364   1591   2574   2629   3764   3766   3792   3794   3886   3894   3895   3916   3943   3958  
3959   3962   3967   3968   3970   4008   4221   4538   4541   4683   4685   4977   4986   4987   5108   5109   5135   5140   5142   5143  
5245   5247   5249   5264   5291   5292   5296   5301   5341   5469   5555   5622   5630  
Biltr, Ernai 3633   5121   5596  
Biltr, Sidirect 1592   1651   1801   2266   3643   3773   3778   3781   3909   3993   4227   4533   4536   4687   4692   4915   4976   5110   5134   5159  
5338   5355   5364   5365   5476   5527  
Biltr, Ernai, Rnaxs, Sidirect 5411   5565   5620  
Biltr, Rnaxs 20   24   25   26   27   28   29   30   31   135   136   137   138   139   156   157   158   159   160   161  
162   163   348   349   419   420   531   532   533   534   578   579   739   855   857   858   898   899   900   910  
911   917   920   923   926   979   988   1010   1013   1046   1047   1048   1049   1050   1051   1052   1053   1078   1079   1082  
1083   1084   1085   1086   1091   1092   1093   1096   1098   1116   1117   1118   1119   1146   1149   1151   1158   1185   1186   1187  
1188   1190   1220   1221   1225   1232   1233   1234   1235   1236   1237   1240   1241   1242   1244   1246   1247   1248   1251   1256  
1264   1265   1266   1269   1270   1275   1276   1277   1288   1307   1308   1312   1342   1343   1360   1361   1363   1370   1371   1373  
1388   1472   1502   1541   1542   1553   1554   1555   1556   1557   1588   1589   1590   1609   1610   1619   1620   1621   1645   1647  
1648   1649   1650   1702   1703   1704   1705   1715   1716   1717   1720   1797   1798   1799   1824   1825   1826   1827   1829   1849  
1859   1860   1864   1865   1868   1869   1871   1872   1875   1877   1878   1879   1880   1915   1966   1967   1969   2011   2060   2168  
2169   2170   2174   2175   2180   2181   2187   2188   2201   2202   2205   2206   2207   2208   2225   2226   2227   2228   2229   2230  
2231   2232   2233   2237   2262   2263   2264   2265   2277   2280   2281   2282   2283   2285   2286   2288   2289   2290   2291   2292  
2294   2295   2336   2337   2338   2345   2346   2413   2414   2415   2427   2520   2529   2570   2571   2572   2573   2575   2581   2582  
2583   2601   2602   2603   2604   2607   2608   2615   2616   2618   2619   2620   2621   2622   2623   2624   2625   2628   2630   2633  
2634   2673   2674   2675   2676   2677   2679   2680   2792   2793   2796   2828   2829   2831   2838   2840   2841   2846   2849   2850  
2851   2852   2853   2855   2856   2889   2896   2897   2898   2900   2901   2927   2928   2939   2997   2998   3007   3050   3105   3128  
3138   3139   3140   3147   3150   3151   3159   3160   3169   3170   3174   3175   3210   3211   3212   3213   3214   3215   3221   3222  
3223   3226   3228   3229   3284   3285   3286   3287   3289   3290   3295   3296   3297   3301   3304   3305   3309   3310   3311   3314  
3315   3316   3319   3362   3365   3366   3367   3370   3371   3374   3375   3376   3478   3486   3487   3491   3492   3493   3494   3495  
3496   3497   3500   3501   3508   3509   3510   3516   3521   3522   3588   3589   3590   3635   3639   3640   3641   3642   3647   3651  
3652   3653   3663   3691   3757   3758   3759   3760   3761   3762   3763   3765   3767   3783   3786   3787   3791   3793   3795   3796  
3797   3801   3802   3803   3804   3805   3806   3807   3808   3809   3810   3812   3813   3820   3821   3822   3831   3832   3883   3884  
3887   3888   3889   3890   3891   3893   3896   3901   3902   3903   3904   3905   3906   3911   3912   3913   3915   3917   3918   3919  
3922   3923   3924   3925   3930   3931   3932   3935   3936   3938   3939   3944   3945   3946   3947   3948   3955   3956   3957   3960  
3961   3963   3964   3965   3966   3969   3985   3986   3987   3989   4004   4005   4006   4007   4009   4010   4011   4012   4015   4016  
4017   4029   4031   4032   4033   4034   4046   4047   4048   4051   4052   4053   4056   4057   4153   4154   4158   4180   4181   4182  
4184   4185   4186   4190   4219   4220   4225   4226   4230   4231   4232   4285   4286   4293   4296   4381   4389   4390   4391   4392  
4393   4394   4395   4396   4397   4399   4400   4402   4403   4404   4405   4408   4472   4512   4515   4516   4517   4519   4522   4525  
4526   4528   4529   4530   4534   4539   4540   4580   4604   4626   4627   4628   4629   4669   4670   4671   4672   4673   4674   4675  
4676   4677   4678   4684   4686   4689   4690   4691   4697   4698   4708   4709   4714   4719   4720   4722   4723   4727   4779   4780  
4782   4783   4786   4810   4811   4825   4826   4827   4828   4829   4830   4831   4832   4834   4835   4836   4849   4850   4854   4855  
4856   4858   4863   4866   4867   4868   4870   4873   4880   4881   4882   4883   4884   4885   4886   4910   4911   4912   4913   4918  
4923   4924   4932   4937   4940   4942   4943   4978   4979   4984   4985   4998   5000   5001   5006   5007   5009   5010   5013   5014  
5030   5031   5033   5034   5035   5036   5037   5038   5060   5061   5067   5068   5078   5085   5086   5087   5096   5097   5098   5099  
5100   5101   5102   5105   5106   5107   5111   5112   5129   5130   5132   5133   5136   5139   5141   5147   5148   5149   5150   5153  
5154   5155   5157   5158   5172   5177   5178   5189   5190   5191   5192   5193   5196   5206   5208   5234   5235   5236   5237   5238  
5239   5240   5241   5242   5243   5244   5246   5248   5252   5253   5254   5261   5262   5263   5265   5266   5267   5287   5288   5289  
5290   5293   5294   5295   5300   5303   5306   5314   5321   5322   5324   5325   5326   5327   5329   5330   5334   5335   5336   5340  
5342   5343   5344   5345   5346   5396   5397   5398   5401   5402   5406   5407   5409   5410   5412   5413   5432   5433   5434   5435  
5438   5440   5441   5442   5443   5445   5446   5467   5468   5472   5500   5501   5503   5504   5505   5506   5507   5508   5525   5542  
5543   5546   5548   5549   5550   5551   5552   5553   5554   5556   5561   5562   5563   5564   5566   5567   5572   5573   5574   5575  
5583   5584   5605   5606   5607   5608   5609   5619   5621   5623   5624   5625   5626   5627   5628   5629   5631   5632  


Target Position: 5036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5036UGGUCAUCACUGUCCUCAC71.53021963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9975054TGGTCATCACTGTCCTCACGTGAGGACAGTGATGACCA0.599500.005300.551700.500000.907600.75000


Target Position: 5338, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5338GAACAGAACUAGGAAAUGA94.953563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5336-5358GTGAACAGAACTAGGAAATGAATUCAUUUCCUAGUUCUGUUCACGAACAGAACUAGGAAAUGAAUU20.119.222


Target Position: 2226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2226GUCGGACGCAACAGAGAAA89.3474218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982244GTCGGACGCAACAGAGAAATTTCTCTGTTGCGTCCGAC0.269800.065700.819000.750001.000001.00000


Target Position: 5401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5401GUCUUUCCUUGUAAAACAG73.70891652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9465419GTCTTTCCTTGTAAAACAGCTGTTTTACAAGGAAAGAC0.028200.003900.534500.500001.000001.00000


Target Position: 5625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5625AUUGACCUGAAAAAAAAAA72.48521825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9165643ATTGACCTGAAAAAAAAAATTTTTTTTTTCAGGTCAAT0.964900.602900.508600.500001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857UCAGUUUGAAAAGGAGGAU63.11633131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702875TCAGTTTGAAAAGGAGGATATCCTCCTTTTCAAACTGA0.083000.046000.543100.750001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146CCCAGAAAAGAUGGAAAAG66.0362732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481164CCCAGAAAAGATGGAAAAGCTTTTCCATCTTTTCTGGG0.088700.022100.853400.750000.934800.62500


Target Position: 3289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289GCCUUCACCCCACUCAGCU69.41542262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3863307GCCTTCACCCCACTCAGCTAGCTGAGTGGGGTGAAGGC0.449100.354700.646600.750000.983700.62500


Target Position: 5100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5100UCCUCAGUCGCUAUAUUAA85.4057458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4855118TCCTCAGTCGCTATATTAATTAATATAGCGACTGAGGA0.150500.047200.836200.750001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349AGACCCCUCGUAGCGCAUU63.60963058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849367AGACCCCTCGTAGCGCATTAATGCGCTACGAGGGGTCT0.148400.003500.715500.750000.907600.62500


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091AAGAAACAGAUAACACCAA85.3721461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411109AAGAAACAGATAACACCAATTGGTGTTATCTGTTTCTT0.868300.755600.491400.500001.000001.00000


Target Position: 4154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4154UCCUUGUAACCUCUUCUUC56.97774000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5534172TCCTTGTAACCTCTTCTTCGAAGAAGAGGTTACAAGGA0.494000.158700.698300.500001.000001.00000


Target Position: 4225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4225UGGAAAGUCAGAAAAAGAA83.4254602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5104243TGGAAAGTCAGAAAAAGAATTCTTTTTCTGACTTTCCA0.441900.021500.672400.750001.000001.00000


Target Position: 5504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5504GAGAGGUGCUAGAAAAAUA103.6912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8615522GAGAGGTGCTAGAAAAATATATTTTTCTAGCACCTCTC0.598100.003200.767200.750001.000001.00000


Target Position: 5632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5632UGAAAAAAAAAAAAAAAAA78.69621028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2695650TGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCA0.991300.950400.724100.750001.000001.00000


Target Position: 4677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4677GGGCAACAGAGAAAACAAA94.657168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1934695GGGCAACAGAGAAAACAAATTTGTTTTCTCTGTTGCCC0.891800.112000.991401.000001.000001.00000


Target Position: 3955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3955UUUGCUACUUUUGCUGUUU61.37253380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8843973TTTGCTACTTTTGCTGTTTAAACAGCAAAAGTAGCAAA0.178000.078900.500000.500000.978300.87500


Target Position: 3906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906AAACAAAAAAGAAAAAAAA85.5071442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9113924AAACAAAAAAGAAAAAAAATTTTTTTTCTTTTTTGTTT0.900100.183800.500000.500001.000001.00000


Target Position: 3786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3786CACAAAGUGUAUAAAUCUG79.7229922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793804CACAAAGTGTATAAATCTGCAGATTTATACACTTTGTG0.095900.002900.508600.500001.000001.00000


Target Position: 5006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5006GGCUGCUUGGAAUUUACUU79.9505899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2505024GGCTGCTTGGAATTTACTTAAGTAAATTCCAAGCAGCC0.316500.114100.862101.000001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532CCGGUCUGCAAGGAAAGUG58.6273777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910550CCGGTCTGCAAGGAAAGTGCACTTTCCTTGCAGACCGG0.231800.002600.620700.750001.000001.00000


Target Position: 4057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4057GUAUGAAAAGGGUGGGAAU85.2506473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394075GTATGAAAAGGGTGGGAATATTCCCACCCTTTTCATAC0.030000.019900.672400.750001.000001.00000


Target Position: 3932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932GUUUUUAAAAAGGUCAUAU79.1766972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5763950GTTTTTAAAAAGGTCATATATATGACCTTTTTAAAAAC0.215000.015300.603400.750001.000001.00000


Target Position: 3913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3913AAAGAAAAAAAAGGAAAAU71.1752017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433931AAAGAAAAAAAAGGAAAATATTTTCCTTTTTTTTCTTT0.211200.210600.491400.500001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609AAGACUGCUGGAGUUAAUA83.1209627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371627AAGACTGCTGGAGTTAATATATTAACTCCAGCAGTCTT0.084200.003800.594800.500001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702GCGGGUAACUCUAUCGGAC74.28081573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841720GCGGGTAACTCTATCGGACGTCCGATAGAGTTACCCGC0.039000.001600.603400.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GGAUGAUGAUGAUGAUGAU104.3341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801071GGATGATGATGATGATGATATCATCATCATCATCATCC0.290000.124200.689701.000001.000001.00000


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674AUGGCACCCGAGGCAUUAU67.52592530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292692ATGGCACCCGAGGCATTATATAATGCCTCGGGTGCCAT0.032400.004100.612100.500000.962001.00000


Target Position: 5402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5402UCUUUCCUUGUAAAACAGU60.58833495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9505420TCTTTCCTTGTAAAACAGTACTGTTTTACAAGGAAAGA0.133300.004300.517200.500001.000001.00000


Target Position: 5177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5177UCUGUAGGGAAAAUGGGAU67.39342559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6895195TCTGTAGGGAAAATGGGATATCCCATTTTCCCTACAGA0.175900.042700.543100.750001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169ACUCCACCGUCAGCUGUAA82.0029715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443187ACTCCACCGTCAGCTGTAATTACAGCTGACGGTGGAGT0.114600.006700.672400.750000.951100.87500


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345UGUAUGUCAUCGUGGAGUA86.9101348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212363TGTATGTCATCGTGGAGTATACTCCACGATGACATACA0.052200.005100.525900.750001.000001.00000


Target Position: 3633, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3633GUGCCAGUGGCUUAUUAAU83.0262636

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1363319GTGCCAGTGGCTTATTAAT1/1/0/097.75FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38270639..38270657(-)00FGFR1(0.002)


Target Position: 5326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5326GCAUCAUUUGGUGAACAGA88.1834264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9155344GCATCATTTGGTGAACAGATCTGTTCACCAAATGATGC0.053300.002500.629300.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GGAGGAUGAUGAUGAUGAU101.0839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631068GGAGGATGATGATGATGATATCATCATCATCATCCTCC0.222300.016000.689701.000001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979CUGGUCACAGCCACACUCU73.58981665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
653997CTGGTCACAGCCACACTCTAGAGTGTGGCTGTGACCAG0.145500.010000.560300.500000.923900.62500


Target Position: 4918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4918AUCUUGGCUUCUUACAGUU74.21221581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964936ATCTTGGCTTCTTACAGTTAACTGTAAGAAGCCAAGAT0.032700.001500.534500.500001.000001.00000


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578GGGGGCACAAGGUCUGGAG66.67332645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852596GGGGGCACAAGGTCTGGAGCTCCAGACCTTGTGCCCCC0.046000.005800.681000.750001.000001.00000


Target Position: 3487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3487GCUUUCUCCUGUCGGUUUG63.54053064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743505GCTTTCTCCTGTCGGTTTGCAAACCGACAGGAGAAAGC0.040400.004200.706900.750000.940201.00000


Target Position: 5060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5060GGAUUCUGGCUCCCCCGUA82.4796671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6425078GGATTCTGGCTCCCCCGTATACGGGGGAGCCAGAATCC0.418200.011100.689701.000000.929301.00000


Target Position: 2897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2897CCUCACAGAGACCCACCUU76.3691297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732915CCTCACAGAGACCCACCTTAAGGTGGGTCTCTGTGAGG0.081900.010700.706901.000000.967400.62500


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314UCCCUCCACCUCCUCUCCA61.97953295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573332TCCCTCCACCTCCTCTCCATGGAGAGGAGGTGGAGGGA0.229600.170000.525900.500001.000001.00000


Target Position: 4153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4153UUCCUUGUAACCUCUUCUU62.58063206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9034171TTCCTTGTAACCTCTTCTTAAGAAGAGGTTACAAGGAA0.462200.109500.534500.500001.000001.00000


Target Position: 4679, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4679GCAACAGAGAAAACAAAAA91.5567128

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6467919GCAACAGAGAAAACAAAAA1/1/0/094.96FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38269593..38269611(-)00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1244697GCAACAGAGAAAACAAAAATTTTTGTTTTCTCTGTTGC0.863900.194300.853401.000001.000001.00000


Target Position: 5289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5289CUGCUAACAUUACAAUUUG74.33661568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8545307CTGCTAACATTACAATTTGCAAATTGTAATGTTAGCAG0.062100.004100.637900.500001.000001.00000


Target Position: 5502, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5502GGGAGAGGUGCUAGAAAAA95.547955

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8550219GGGAGAGGTGCTAGAAAAA1/1/0/094.96FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38268770..38268788(-)00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8965520GGGAGAGGTGCTAGAAAAATTTTTCTAGCACCTCTCCC0.077400.002700.991401.000001.000001.00000


Target Position: 3812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812AUUUACAUGUCUUUUUAAA83.1102628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753830ATTTACATGTCTTTTTAAATTTAAAAAGACATGTAAAT0.241100.045000.508600.500001.000001.00000


Target Position: 3911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3911AAAAAGAAAAAAAAGGAAA79.15974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523929AAAAAGAAAAAAAAGGAAATTTCCTTTTTTTTCTTTTT0.753700.820500.500000.500001.000001.00000


Target Position: 31, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
31CAGGCUGUAGGAAGAGAAG73.84551628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
85749CAGGCTGTAGGAAGAGAAGCTTCTCTTCCTACAGCCTG0.228900.003400.646600.500001.000001.00000


Target Position: 4219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4219UGCUUUUGGAAAGUCAGAA74.69981517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9704237TGCTTTTGGAAAGTCAGAATTCTGACTTTCCAAAAGCA0.056200.001800.681000.750001.000001.00000


Target Position: 2927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927UGGAAGACCUGGACCGCAU73.16631724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612945TGGAAGACCTGGACCGCATATGCGGTCCAGGTCTTCCA0.044200.009500.689700.750000.956500.75000


Target Position: 5397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5397GAGUGUCUUUCCUUGUAAA102.385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6985415GAGTGTCTTTCCTTGTAAATTTACAAGGAAAGACACTC0.110800.008100.810300.750001.000001.00000


Target Position: 4923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4923GGCUUCUUACAGUUCUUCC69.51952251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9644941GGCTTCTTACAGTTCTTCCGGAAGAACTGTAAGAAGCC0.024800.009100.629300.500001.000001.00000


Target Position: 4286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4286GCGCUGGGCAGAGAGUCAA81.6404747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894304GCGCTGGGCAGAGAGTCAATTGACTCTCTGCCCAGCGC0.589400.001600.775901.000001.000001.00000


Target Position: 5242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5242UUGGCGACUAUUGUAAAAU62.85453166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7985260TTGGCGACTATTGTAAAATATTTTACAATAGTCGCCAA0.263800.016500.637900.500001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187CCAAGACAGUGAAGUUCAA95.734753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491205CCAAGACAGTGAAGTTCAATTGAACTTCACTGTCTTGG0.235100.065900.698301.000001.000001.00000


Target Position: 4810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4810GGCUAGUUUUGCAUUCAGG73.47451685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9634828GGCTAGTTTTGCATTCAGGCCTGAATGCAAAACTAGCC0.024900.002600.655200.500001.000001.00000


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263UCAGAAAUGGAGAUGAUGA82.0551710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202281TCAGAAATGGAGATGATGATCATCATCTCCATTTCTGA0.112300.112400.500000.500001.000001.00000


Target Position: 4998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4998GGUUUUUUGGCUGCUUGGA73.58331666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9845016GGTTTTTTGGCTGCTTGGATCCAAGCAGCCAAAAAACC0.116400.008900.482800.750001.000001.00000


Target Position: 5355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5355GAAUUUUUAGCUCUUAAAA92.696899

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5353-5375ATGAATTTTTAGCTCTTAAAAGCUUUUAAGAGCUAAAAAUUCAUGAAUUUUUAGCUCUUAAAAGCU7.1-12.032


Target Position: 4827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4827GGUCCCUGGCUUCGUUUCU69.80972204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5924845GGTCCCTGGCTTCGTTTCTAGAAACGAAGCCAGGGACC0.359900.013700.629300.750001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308CACCUGGAGCAUCAUAAUG72.53241818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711326CACCTGGAGCATCATAATGCATTATGATGCTCCAGGTG0.073900.001800.637900.500001.000001.00000


Target Position: 2231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2231ACGCAACAGAGAAAGACUU74.09061595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502249ACGCAACAGAGAAAGACTTAAGTCTTTCTCTGTTGCGT0.191000.077500.637900.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898UGGAGAUGUGGAGCCUUGU65.02962865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967916TGGAGATGTGGAGCCTTGTACAAGGCTCCACATCTCCA0.045200.001900.637900.500001.000001.00000


Target Position: 25, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
25GGAGACCAGGCUGUAGGAA83.4117603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39543GGAGACCAGGCTGTAGGAATTCCTACAGCCTGGTCTCC0.208000.042900.698301.000000.967400.75000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645GAGGUGCUUCACUUAAGAA99.262619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801663GAGGTGCTTCACTTAAGAATTCTTAAGTGAAGCACCTC0.327500.001600.637900.750000.983700.62500


Target Position: 3956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3956UUGCUACUUUUGCUGUUUU67.56182526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893974TTGCTACTTTTGCTGTTTTAAAACAGCAAAAGTAGCAA0.306700.089400.646600.500000.978300.75000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170CUCCACCGUCAGCUGUAAC63.92113014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013188CTCCACCGTCAGCTGTAACGTTACAGCTGACGGTGGAG0.111300.007500.663800.500000.951100.87500


Target Position: 4517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4517CAACUUAGUGAAACCCCAU85.1745480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9624535CAACTTAGTGAAACCCCATATGGGGTTTCACTAAGTTG0.684000.055200.491400.750001.000001.00000


Target Position: 5551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5551CCUUGCUGUUACUACUCAA97.095331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2265569CCTTGCTGTTACTACTCAATTGAGTAGTAACAGCAAGG0.726000.111000.698301.000001.000001.00000


Target Position: 4516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4516CCAACUUAGUGAAACCCCA85.9716404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8584534CCAACTTAGTGAAACCCCATGGGGTTTCACTAAGTTGG0.423100.063700.500000.750001.000001.00000


Target Position: 3820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3820GUCUUUUUAAAAGGGUCGU59.23453681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073838GTCTTTTTAAAAGGGTCGTACGACCCTTTTAAAAAGAC0.036100.015500.543100.500001.000001.00000


Target Position: 5628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5628GACCUGAAAAAAAAAAAAA88.6292250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4895646GACCTGAAAAAAAAAAAAATTTTTTTTTTTTTCAGGTC0.979900.823600.819000.750001.000001.00000


Target Position: 4048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4048CUAUGGGCUGUAUGAAAAG72.53211819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7374066CTATGGGCTGTATGAAAAGCTTTTCATACAGCCCATAG0.341500.061900.534500.500001.000001.00000


Target Position: 3763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3763UCUGUAUAUAGCUAUGAAG71.16422019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603781TCTGTATATAGCTATGAAGCTTCATAGCTATATACAGA0.192600.110200.586200.500001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312UGGAGCAUCAUAAUGGACU66.39362683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751330TGGAGCATCATAATGGACTAGTCCATTATGATGCTCCA0.070600.011300.637900.500001.000001.00000


Target Position: 3968, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3968CUGUUUUAUUUUUUUAAAU80.6765836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3233986CTGTTTTATTTTTTTAAATATTTAAAAAAATAAAACAG0.483500.388500.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3966-3988TGCTGTTTTATTTTTTTAAATTAAUUUAAAAAAAUAAAACAGCACUGUUUUAUUUUUUUAAAUUAU-9.17.210


Target Position: 5556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5556CUGUUACUACUCAAAUCAC77.2151197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9475574CTGTTACTACTCAAATCACGTGATTTGAGTAGTAACAG0.796200.318000.491400.500001.000001.00000


Target Position: 4181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4181UGCACCCAGACCUCACGAC55.80734145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7244199TGCACCCAGACCTCACGACGTCGTGAGGTCTGGGTGCA0.150500.076700.534500.500001.000001.00000


Target Position: 3691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3691CAGAGGAUGGUGAGGCGAA89.5709204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7753709CAGAGGATGGTGAGGCGAATTCGCCTCACCATCCTCTG0.175800.005500.612100.750001.000001.00000


Target Position: 4850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4850GGUAUGCCUCCCCAGAUCG66.03732731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8464868GGTATGCCTCCCCAGATCGCGATCTGGGGAGGCATACC0.140800.013000.560300.500000.983700.75000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CAAGACAGUGAAGUUCAAA90.1736177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911206CAAGACAGTGAAGTTCAAATTTGAACTTCACTGTCTTG0.211600.059800.646600.750001.000001.00000


Target Position: 5506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5506GAGGUGCUAGAAAAAUAUA96.583139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9585524GAGGTGCTAGAAAAATATATATATTTTTCTAGCACCTC0.465600.002000.767200.750001.000001.00000


Target Position: 4009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4009UUUAGGUCCCUCAAUAAAA78.03581095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8894027TTTAGGTCCCTCAATAAAATTTTATTGAGGGACCTAAA0.394900.057400.500000.500001.000001.00000


Target Position: 2629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GACUACUAUAAAAAGACAA92.6742100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3012647GACTACTATAAAAAGACAATTGTCTTTTTATAGTAGTC0.802600.657400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2627-2649TCGACTACTATAAAAAGACAACCUUGUCUUUUUAUAGUAGUCGAGACUACUAUAAAAAGACAACCU19.218.832


Target Position: 3809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3809UAUAUUUACAUGUCUUUUU72.97741753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983827TATATTTACATGTCTTTTTAAAAAGACATGTAAATATA0.132100.023300.543100.500001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675UGGCACCCGAGGCAUUAUU60.75393469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672693TGGCACCCGAGGCATTATTAATAATGCCTCGGGTGCCA0.064200.005900.836200.750000.962001.00000


Target Position: 4538, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4538CUACUAAAAAUGCAAAAAU82.1014704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3434556CTACTAAAAATGCAAAAATATTTTTGCATTTTTAGTAG0.496500.208200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4536-4558CTCTACTAAAAATGCAAAAATTAAUUUUUGCAUUUUUAGUAGAGCUACUAAAAAUGCAAAAAUUAU14.16.600


Target Position: 24, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
24AGGAGACCAGGCUGUAGGA81.6253749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99942AGGAGACCAGGCTGTAGGATCCTACAGCCTGGTCTCCT0.084300.040600.474100.500000.967400.75000


Target Position: 3967, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3967GCUGUUUUAUUUUUUUAAA89.7813192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1433985GCTGTTTTATTTTTTTAAATTTAAAAAAATAAAACAGC0.504900.403800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3965-3987TTGCTGTTTTATTTTTTTAAATTUUUAAAAAAAUAAAACAGCAAGCUGUUUUAUUUUUUUAAAUUU-9.110.310


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607CGCACGGGACAUUCACCAC71.40891980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462625CGCACGGGACATTCACCACGTGGTGAATGTCCCGTGCG0.134500.017000.629300.750000.956500.75000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647UUAAUUCCGAUACUAGUUU62.28653255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7273665TTAATTCCGATACTAGTTTAAACTAGTATCGGAATTAA0.158700.140500.534500.500001.000001.00000


Target Position: 5264, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5264CUUUGUUUCUCUCUGUAAA91.4654129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4615282CTTTGTTTCTCTCTGTAAATTTACAGAGAGAAACAAAG0.169000.134800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5262-5284CTCTTTGTTTCTCTCTGTAAATAUUUACAGAGAGAAACAAAGAGCUUUGUUUCUCUCUGUAAAUAU20.35.622


Target Position: 4536, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4536CUCUACUAAAAAUGCAAAA81.5648759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4534-4556ATCTCTACTAAAAATGCAAAAATUUUUGCAUUUUUAGUAGAGAUCUCUACUAAAAAUGCAAAAAUU20.020.100


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680CCCGAGGCAUUAUUUGACC59.72973610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762698CCCGAGGCATTATTTGACCGGTCAAATAATGCCTCGGG0.080800.002900.637900.500000.918500.62500


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079CUUCAGAGGAGAAAGAAAC68.6622372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9421097CTTCAGAGGAGAAAGAAACGTTTCTTTCTCCTCTGAAG0.808900.034600.491400.500000.972800.62500


Target Position: 3915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3915AGAAAAAAAAGGAAAAUGU75.01071476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893933AGAAAAAAAAGGAAAATGTACATTTTCCTTTTTTTTCT0.081500.066800.517200.500001.000001.00000


Target Position: 4686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4686AGAAAACAAAAAGGAAAAC59.85583593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6294704AGAAAACAAAAAGGAAAACGTTTTCCTTTTTGTTTTCT0.751400.683300.577600.500001.000001.00000


Target Position: 4522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4522UAGUGAAACCCCAUCUCUA90.5812159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8964540TAGTGAAACCCCATCTCTATAGAGATGGGGTTTCACTA0.150100.047100.500000.500000.929300.75000


Target Position: 2288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2288UCGGGAAGCAUAAGAAUAU74.28471572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942306TCGGGAAGCATAAGAATATATATTCTTATGCTTCCCGA0.337000.038700.750000.750001.000001.00000


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427CUACAACCCCAGCCACAAC69.08682310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122445CTACAACCCCAGCCACAACGTTGTGGCTGGGGTTGTAG0.135300.055700.525900.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573AGGACAAUGUGAUGAAGAU89.7493194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622591AGGACAATGTGATGAAGATATCTTCATCACATTGTCCT0.266900.016000.663800.750001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370UGGAGAAUGAGUACGGCAG63.45563078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311388TGGAGAATGAGTACGGCAGCTGCCGTACTCATTCTCCA0.176900.016600.560300.500001.000001.00000


Target Position: 3957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3957UGCUACUUUUGCUGUUUUA80.7978825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343975TGCTACTTTTGCTGTTTTATAAAACAGCAAAAGTAGCA0.297800.091700.819000.750000.978300.75000


Target Position: 5033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5033UGCUGGUCAUCACUGUCCU72.46291828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9995051TGCTGGTCATCACTGTCCTAGGACAGTGATGACCAGCA0.036400.001500.508600.500000.907600.75000


Target Position: 3491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3491UCUCCUGUCGGUUUGGUCU63.96363009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733509TCTCCTGTCGGTTTGGTCTAGACCAAACCGACAGGAGA0.095100.016200.500000.500000.940200.87500


Target Position: 4006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4006CAGUUUAGGUCCCUCAAUA96.599637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3844024CAGTTTAGGTCCCTCAATATATTGAGGGACCTAAACTG0.400200.038500.741400.750001.000001.00000


Target Position: 3948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3948UAUAUUUUUUGCUACUUUU76.94461221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6883966TATATTTTTTGCTACTTTTAAAAGTAGCAAAAAATATA0.180200.057300.543100.500001.000001.00000


Target Position: 4684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4684AGAGAAAACAAAAAGGAAA87.5292310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3584702AGAGAAAACAAAAAGGAAATTTCCTTTTTGTTTTCTCT0.771500.618000.724100.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214CACCACCUGUCCGUCCCUG60.99623439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243232CACCACCTGTCCGTCCCTGCAGGGACGGACAGGTGGTG0.114500.094400.508600.500001.000001.00000


Target Position: 1361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361CCUGCAUUGUGGAGAAUGA89.9938184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551379CCTGCATTGTGGAGAATGATCATTCTCCACAATGCAGG0.236300.002000.620700.750001.000001.00000


Target Position: 4856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4856CCUCCCCAGAUCGUCCUUC53.91174365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5094874CCTCCCCAGATCGTCCTTCGAAGGACGATCTGGGGAGG0.347700.124400.672400.750001.000001.00000


Target Position: 5629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5629ACCUGAAAAAAAAAAAAAA82.6616661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2555647ACCTGAAAAAAAAAAAAAATTTTTTTTTTTTTTCAGGT0.984100.854600.853400.750001.000001.00000


Target Position: 3521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3521ACCCAUAAGCCCCUCGCAC55.25464208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823539ACCCATAAGCCCCTCGCACGTGCGAGGGGCTTATGGGT0.083800.019800.560300.500000.929300.75000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163GUGGGAGUGAGAGAGCGAG67.51882532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988181GTGGGAGTGAGAGAGCGAGCTCGCTCTCTCACTCCCAC0.091800.012100.482800.500001.000001.00000


Target Position: 4932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4932CAGUUCUUCCUGUCCAAAC70.45062118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8614950CAGTTCTTCCTGTCCAAACGTTTGGACAGGAAGAACTG0.195600.077000.637900.500000.902200.62500


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365UUGCUGCCAGCCACUUCAU63.86953022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583383TTGCTGCCAGCCACTTCATATGAAGTGGCTGGCAGCAA0.213500.002500.491400.500000.945700.75000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174UGGACAAGGACAAACCCAA81.3926776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622192TGGACAAGGACAAACCCAATTGGGTTTGTCCTTGTCCA0.118100.017500.698300.750000.929300.75000


Target Position: 4697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4697AGGAAAACAAAUGAUGAAG65.36782814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5754715AGGAAAACAAATGATGAAGCTTCATCATTTGTTTTCCT0.254300.197400.706900.500001.000001.00000


Target Position: 5105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5105AGUCGCUAUAUUAAAGCUU73.98361605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6135123AGTCGCTATATTAAAGCTTAAGCTTTAATATAGCGACT0.242300.020500.569000.750000.902200.75000


Target Position: 5234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5234CUGCAGUGUUGGCGACUAU83.8546575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9765252CTGCAGTGTTGGCGACTATATAGTCGCCAACACTGCAG0.023000.004000.741400.750001.000001.00000


Target Position: 4405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4405ACAGUGAUUAAGAGGAAAG68.37632418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6394423ACAGTGATTAAGAGGAAAGCTTTCCTCTTAATCACTGT0.201500.091200.569000.500001.000001.00000


Target Position: 5245, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5245GCGACUAUUGUAAAAUUCU81.8423732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3495263GCGACTATTGTAAAATTCTAGAATTTTACAATAGTCGC0.448100.082100.698300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5243-5265TGGCGACTATTGTAAAATTCTCTAGAAUUUUACAAUAGUCGCCAGCGACUAUUGUAAAAUUCUCUU0.420.933


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135GGCGGAGGCGGAGGAGGGA69.1152309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799153GGCGGAGGCGGAGGAGGGATCCCTCCTCCGCCTCCGCC0.237600.004500.629300.750001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966GCUGACUCCAGUGCAUCCA75.81841368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121984GCTGACTCCAGTGCATCCATGGATGCACTGGAGTCAGC0.208200.047000.508600.750000.934800.62500


Target Position: 3924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3924AGGAAAAUGUUUUUAAAAA89.5616205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643942AGGAAAATGTTTTTAAAAATTTTTAAAAACATTTTCCT0.144600.005900.844800.750001.000001.00000


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232CGCAACAGAGAAAGACUUG70.70142078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542250CGCAACAGAGAAAGACTTGCAAGTCTTTCTCTGTTGCG0.172900.047900.775900.750001.000001.00000


Target Position: 3803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3803UGAGUAUAUAUUUACAUGU76.61821262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453821TGAGTATATATTTACATGTACATGTAAATATATACTCA0.062000.006200.517200.500001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869GAUGAAGAGUGGUACCAAG86.6705359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961887GATGAAGAGTGGTACCAAGCTTGGTACCACTCTTCATC0.141600.031700.543100.500001.000001.00000


Target Position: 4685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4685GAGAAAACAAAAAGGAAAA89.6379198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4424703GAGAAAACAAAAAGGAAAATTTTCCTTTTTGTTTTCTC0.771300.705300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4683-4705CAGAGAAAACAAAAAGGAAAACAUUUUCCUUUUUGUUUUCUCUGGAGAAAACAAAAAGGAAAACAU18.713.311


Target Position: 4053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4053GGCUGUAUGAAAAGGGUGG63.69283046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8264071GGCTGTATGAAAAGGGTGGCCACCCTTTTCATACAGCC0.050800.021700.655200.500001.000001.00000


Target Position: 5155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5155GAAAGUUCAAUAUGUUUUC71.82711926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8875173GAAAGTTCAATATGTTTTCGAAAACATATTGAACTTTC0.090300.040600.500000.500001.000001.00000


Target Position: 3640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3640UGGCUUAUUAAUUCCGAUA79.0387987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3283658TGGCTTATTAATTCCGATATATCGGAATTAATAAGCCA0.656900.051500.801700.750001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624ACAUCGACUACUAUAAAAA91.2694134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222642ACATCGACTACTATAAAAATTTTTATAGTAGTCGATGT0.873400.514400.706900.750001.000001.00000


Target Position: 4722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4722AGAAACUGAAACCCAGACA77.31431188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9764740AGAAACTGAAACCCAGACATGTCTGGGTTTCAGTTTCT0.076300.002800.517200.500000.962000.87500


Target Position: 5193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5193GAUUGCUGCUUUAAAUUUC74.27971574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8815211GATTGCTGCTTTAAATTTCGAAATTTAAAGCAGCAATC0.244300.026200.508600.500001.000001.00000


Target Position: 5508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5508GGUGCUAGAAAAAUAUAAG83.138625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8675526GGTGCTAGAAAAATATAAGCTTATATTTTTCTAGCACC0.062400.003100.715500.750001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148CAGAAAAGAUGGAAAAGAA102.196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331166CAGAAAAGATGGAAAAGAATTCTTTTCCATCTTTTCTG0.165700.052100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1146-1168CCCAGAAAAGATGGAAAAGAAATUUCUUUUCCAUCUUUUCUGGGCAGAAAAGAUGGAAAAGAAAUU14.810.322


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139CGCUGACUGCCACCCACAC71.23482009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993157CGCTGACTGCCACCCACACGTGTGGGTGGCAGTCAGCG0.832900.055000.629300.750000.951100.75000


Target Position: 4629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4629GAGGCGGAGGUUGCAGUGA75.70891390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9584647GAGGCGGAGGTTGCAGTGATCACTGCAACCTCCGCCTC0.026400.002600.586200.500001.000001.00000


Target Position: 5253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5253UGUAAAAUUCUCUUUGUUU78.08811091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3395271TGTAAAATTCTCTTTGTTTAAACAAAGAGAATTTTACA0.644500.386900.706900.750001.000001.00000


Target Position: 4910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4910UGUCGCAGAUCUUGGCUUC62.08313278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574928TGTCGCAGATCTTGGCTTCGAAGCCAAGATCTGCGACA0.042600.002000.534500.500000.967400.62500


Target Position: 4394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4394GGGGUAGAGCUACAGUGAU87.4233316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3654412GGGGTAGAGCTACAGTGATATCACTGTAGCTCTACCCC0.401000.043700.810301.000001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574GGACAAUGUGAUGAAGAUA98.740324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672592GGACAATGTGATGAAGATATATCTTCATCACATTGTCC0.263600.015900.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2572-2594GAGGACAATGTGATGAAGATAGCUAUCUUCAUCACAUUGUCCUCGGACAAUGUGAUGAAGAUAGCU20.420.502


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048UCGGAGGAUGAUGAUGAUG56.97274003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961066TCGGAGGATGATGATGATGCATCATCATCATCCTCCGA0.206500.007500.637900.500001.000001.00000


Target Position: 4858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4858UCCCCAGAUCGUCCUUCCU60.26533536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8594876TCCCCAGATCGTCCTTCCTAGGAAGGACGATCTGGGGA0.272300.103800.525900.500001.000001.00000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190AGACAGUGAAGUUCAAAUG72.52041820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651208AGACAGTGAAGTTCAAATGCATTTGAACTTCACTGTCT0.291000.042300.569000.500001.000001.00000


Target Position: 3128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3128GACUCAAACGCCGCUGACU78.04021094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623146GACTCAAACGCCGCTGACTAGTCAGCGGCGTTTGAGTC0.025000.006000.612100.500000.934800.62500


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105CCCAGCCCAGCUUGCCAAU64.48732935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333123CCCAGCCCAGCTTGCCAATATTGGCAAGCTGGGCTGGG0.439900.007100.982801.000000.934800.75000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855GGUCAGUUUGAAAAGGAGG66.4342679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
891873GGTCAGTTTGAAAAGGAGGCCTCCTTTTCAAACTGACC0.482600.007900.508600.500001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169CGGGCUGGACAAGGACAAA85.465447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242187CGGGCTGGACAAGGACAAATTTGTCCTTGTCCAGCCCG0.290300.007500.913801.000001.000001.00000


Target Position: 4296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4296GAGAGUCAAGGCCCAGCAG72.22241866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894314GAGAGTCAAGGCCCAGCAGCTGCTGGGCCTTGACTCTC0.021400.001700.525900.500000.972800.75000


Target Position: 5267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5267UGUUUCUCUCUGUAAAUAG69.83972201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9035285TGTTTCTCTCTGTAAATAGCTATTTACAGAGAGAAACA0.036400.031100.534500.500001.000001.00000


Target Position: 3930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3930AUGUUUUUAAAAAGGUCAU67.70492504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573948ATGTTTTTAAAAAGGTCATATGACCTTTTTAAAAACAT0.332500.014800.500000.500001.000001.00000


Target Position: 3316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3316CCUCCACCUCCUCUCCACC61.01713436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343334CCTCCACCTCCTCTCCACCGGTGGAGAGGAGGTGGAGG0.213800.156800.491400.500001.000001.00000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212CCCACCACCUGUCCGUCCC49.90614789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743230CCCACCACCTGTCCGTCCCGGGACGGACAGGTGGTGGG0.129300.111600.500000.500001.000001.00000


Target Position: 4052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052GGGCUGUAUGAAAAGGGUG70.62082092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7854070GGGCTGTATGAAAAGGGTGCACCCTTTTCATACAGCCC0.059300.023300.698300.750001.000001.00000


Target Position: 4885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4885GUGACCAGACUGUAUUUGU79.1041979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6674903GTGACCAGACTGTATTTGTACAAATACAGTCTGGTCAC0.239500.009100.586200.500001.000001.00000


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634CUAUAAAAAGACAACCAAC77.79891120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052652CTATAAAAAGACAACCAACGTTGGTTGTCTTTTTATAG0.586800.538300.525900.500001.000001.00000


Target Position: 5398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5398AGUGUCUUUCCUUGUAAAA82.7901650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5685416AGTGTCTTTCCTTGTAAAATTTTACAAGGAAAGACACT0.129500.015900.706900.750001.000001.00000


Target Position: 4669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4669UCCAGCCUGGGCAACAGAG52.55714509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7024687TCCAGCCTGGGCAACAGAGCTCTGTTGCCCAGGCTGGA0.111000.008000.560300.500000.934800.62500


Target Position: 3808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3808AUAUAUUUACAUGUCUUUU75.81681369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943826ATATATTTACATGTCTTTTAAAAGACATGTAAATATAT0.133500.019100.543100.500001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969GACUCCAGUGCAUCCAUGA88.1999263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181987GACTCCAGTGCATCCATGATCATGGATGCACTGGAGTC0.345900.027700.594800.500000.983700.62500


Target Position: 4924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4924GCUUCUUACAGUUCUUCCU78.9558997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8354942GCTTCTTACAGTTCTTCCTAGGAAGAACTGTAAGAAGC0.149400.009700.508600.750001.000001.00000


Target Position: 5087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5087CUCAAACUACCACUCCUCA83.9574565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7925105CTCAAACTACCACTCCTCATGAGGAGTGGTAGTTTGAG0.428100.334400.586200.500001.000001.00000


Target Position: 4678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4678GGCAACAGAGAAAACAAAA90.6586155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1284696GGCAACAGAGAAAACAAAATTTTGTTTTCTCTGTTGCC0.892600.179301.000001.000001.000001.00000


Target Position: 3501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3501GUUUGGUCUGUUUUGCCUU76.19551319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293519GTTTGGTCTGTTTTGCCTTAAGGCAAAACAGACCAAAC0.178800.005500.508600.750000.972800.75000


Target Position: 2266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2266GAAAUGGAGAUGAUGAAGA87.9737284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2264-2286CAGAAATGGAGATGATGAAGATGUCUUCAUCAUCUCCAUUUCUGGAAAUGGAGAUGAUGAAGAUGU20.420.112


Target Position: 5154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5154AGAAAGUUCAAUAUGUUUU77.49781158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4925172AGAAAGTTCAATATGTTTTAAAACATATTGAACTTTCT0.147200.078700.724100.750001.000001.00000


Target Position: 2602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2602GGCCUCGCACGGGACAUUC59.81663597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9742620GGCCTCGCACGGGACATTCGAATGTCCCGTGCGAGGCC0.056100.001800.827600.750000.951100.75000


Target Position: 3310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3310CCUCUCCCUCCACCUCCUC54.48534306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7213328CCTCTCCCTCCACCTCCTCGAGGAGGTGGAGGGAGAGG0.255100.251900.534500.750001.000001.00000


Target Position: 4534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4534AUCUCUACUAAAAAUGCAA83.3489604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304552ATCTCTACTAAAAATGCAATTGCATTTTTAGTAGAGAT0.612400.204600.534500.500001.000001.00000


Target Position: 5157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5157AAGUUCAAUAUGUUUUCAU77.77761122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9865175AAGTTCAATATGTTTTCATATGAAAACATATTGAACTT0.032200.024000.482800.500001.000001.00000


Target Position: 5196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5196UGCUGCUUUAAAUUUCUGA72.34471846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515214TGCTGCTTTAAATTTCTGATCAGAAATTTAAAGCAGCA0.027200.013800.629300.500001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046CCUCGGAGGAUGAUGAUGA85.4285453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631064CCTCGGAGGATGATGATGATCATCATCATCCTCCGAGG0.187500.003200.620700.750001.000001.00000


Target Position: 3375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3375CCACUUCAUCCCCUCCCAG66.47792671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653393CCACTTCATCCCCTCCCAGCTGGGAGGGGATGAAGTGG0.114700.070400.560300.750001.000001.00000


Target Position: 4829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4829UCCCUGGCUUCGUUUCUUG57.50323932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6294847TCCCTGGCTTCGTTTCTTGCAAGAAACGAAGCCAGGGA0.267000.011600.724100.500001.000001.00000


Target Position: 3374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3374GCCACUUCAUCCCCUCCCA78.77121020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3603392GCCACTTCATCCCCTCCCATGGGAGGGGATGAAGTGGC0.873200.090200.655200.750001.000001.00000


Target Position: 5365, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5365CUCUUAAAAGCAUUUGCUU77.32621184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5363-5385AGCTCTTAAAAGCATTTGCTTTGAAGCAAAUGCUUUUAAGAGCUCUCUUAAAAGCAUUUGCUUUGU18.57.122


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620AGUUAAUACCACCGACAAA92.4039106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231638AGTTAATACCACCGACAAATTTGTCGGTGGTATTAACT0.094500.049800.706900.750001.000001.00000


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117CGUAUGCCCGUAGCUCCAU72.69151799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7611135CGTATGCCCGTAGCTCCATATGGAGCTACGGGCATACG0.062900.025000.620701.000000.940201.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052AGGAUGAUGAUGAUGAUGA85.0083491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081070AGGATGATGATGATGATGATCATCATCATCATCATCCT0.291100.122400.620700.500001.000001.00000


Target Position: 4390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4390CCACGGGGUAGAGCUACAG65.12652849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6484408CCACGGGGTAGAGCTACAGCTGTAGCTCTACCCCGTGG0.157400.022200.560300.750001.000001.00000


Target Position: 5321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5321AGAAGGCAUCAUUUGGUGA82.4159676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9775339AGAAGGCATCATTTGGTGATCACCAAATGATGCCTTCT0.022900.002000.500000.500001.000001.00000


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GCUGGUUGAAAAAUGGCAA85.8456416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6511259GCTGGTTGAAAAATGGCAATTGCCATTTTTCAACCAGC0.296200.010300.706901.000001.000001.00000


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226GUCCCUGUCCCCUUUCCUG64.99492872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053244GTCCCTGTCCCCTTTCCTGCAGGAAAGGGGACAGGGAC0.133600.032100.534500.500001.000001.00000


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286GAUCGGGAAGCAUAAGAAU87.5817307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202304GATCGGGAAGCATAAGAATATTCTTATGCTTCCCGATC0.413500.096200.672400.750001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225CCAAACCCCACACUGCGCU60.7193474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701243CCAAACCCCACACTGCGCTAGCGCAGTGTGGGGTTTGG0.092200.006500.491400.750000.951100.75000


Target Position: 5295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5295ACAUUACAAUUUGUAUUUA87.6532300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4555313ACATTACAATTTGTATTTATAAATACAAATTGTAATGT0.362300.028900.672400.750001.000001.00000


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285GGCGCUGGGCAGAGAGUCA87.3873320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9494303GGCGCTGGGCAGAGAGTCATGACTCTCTGCCCAGCGCC0.578100.002000.775900.750001.000001.00000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553UCGAGGUGAAUGGGAGCAA69.37092269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691571TCGAGGTGAATGGGAGCAATTGCTCCCATTCACCTCGA0.066500.005800.646600.750001.000001.00000


Target Position: 4779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4779GCUUCUAAGUGCAGGAGAA97.840829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604797GCTTCTAAGTGCAGGAGAATTCTCCTGCACTTAGAAGC0.026000.002800.681001.000001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920CAACCUCUAACUGCAGAAC67.27732574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
893938CAACCTCTAACTGCAGAACGTTCTGCAGTTAGAGGTTG0.076200.027500.500000.500000.945700.62500


Target Position: 5336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5336GUGAACAGAACUAGGAAAU76.23981314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8415354GTGAACAGAACTAGGAAATATTTCCTAGTTCTGTTCAC0.047700.007500.784500.750001.000001.00000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CCUGGAGAUCAUCAUCUAU91.099139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911815CCTGGAGATCATCATCTATATAGATGATGATCTCCAGG0.059100.002700.801701.000000.918500.75000


Target Position: 3919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3919AAAAAAGGAAAAUGUUUUU71.85691923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653937AAAAAAGGAAAATGTTTTTAAAAACATTTTCCTTTTTT0.067300.027500.500000.500001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676GGCACCCGAGGCAUUAUUU76.9451220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832694GGCACCCGAGGCATTATTTAAATAATGCCTCGGGTGCC0.080100.008701.000001.000000.962000.87500


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GGAACCCAAGGACUUUUCU73.83061629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783438GGAACCCAAGGACTTTTCTAGAAAAGTCCTTGGGTTCC0.059800.016000.646600.750001.000001.00000


Target Position: 3893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3893UGCUAUAUAUUAAAAACAA90.8349148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2963911TGCTATATATTAAAAACAATTGTTTTTAATATATAGCA0.277800.164900.706900.750001.000001.00000


Target Position: 3773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3773GCUAUGAAGAAAACACAAA90.9575144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3771-3793TAGCTATGAAGAAAACACAAAGTUUUGUGUUUUCUUCAUAGCUAGCUAUGAAGAAAACACAAAGUU19.313.422


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251AAAUGGCAAAGAAUUCAAA86.501374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641269AAATGGCAAAGAATTCAAATTTGAATTCTTTGCCATTT0.094300.021500.500000.500001.000001.00000


Target Position: 4221, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4221CUUUUGGAAAGUCAGAAAA81.7506738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514239CTTTTGGAAAGTCAGAAAATTTTCTGACTTTCCAAAAG0.081700.006400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4219-4241TGCTTTTGGAAAGTCAGAAAAAGUUUUCUGACUUUCCAAAAGCACUUUUGGAAAGUCAGAAAAAGU20.420.121


Target Position: 4867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4867CGUCCUUCCUGUAUCCAUG78.48081053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5154885CGTCCTTCCTGTATCCATGCATGGATACAGGAAGGACG0.157100.057100.620700.750001.000001.00000


Target Position: 5573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5573ACCCACAAAUUUCCCCAAA72.20631869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1925591ACCCACAAATTTCCCCAAATTTGGGGAAATTTGTGGGT0.850700.814300.853400.750001.000001.00000


Target Position: 4008, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4008GUUUAGGUCCCUCAAUAAA89.3055219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5044026GTTTAGGTCCCTCAATAAATTTATTGAGGGACCTAAAC0.394100.054000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4006-4028CAGTTTAGGTCCCTCAATAAAAAUUUAUUGAGGGACCUAAACUGGUUUAGGUCCCUCAAUAAAAAU8.918.623


Target Position: 4011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4011UAGGUCCCUCAAUAAAAAU71.511967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9014029TAGGTCCCTCAATAAAAATATTTTTATTGAGGGACCTA0.353500.096400.663800.500001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415GCUGGAAUACUGCUACAAC80.9788811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4512433GCTGGAATACTGCTACAACGTTGTAGCAGTATTCCAGC0.707700.032900.706900.750001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078UCUUCAGAGGAGAAAGAAA86.0994391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761096TCTTCAGAGGAGAAAGAAATTTCTTTCTCCTCTGAAGA0.194900.024800.724100.750000.940200.62500


Target Position: 4883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4883AUGUGACCAGACUGUAUUU81.1894791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8754901ATGTGACCAGACTGTATTTAAATACAGTCTGGTCACAT0.049000.010000.655200.500001.000001.00000


Target Position: 1801, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801GAGAUCAUCAUCUAUUGCA91.3247132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1799-1821TGGAGATCATCATCTATTGCACAUGCAAUAGAUGAUGAUCUCCAGAGAUCAUCAUCUAUUGCACAU19.720.423


Target Position: 3935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3935UUUAAAAAGGUCAUAUAUU72.78151786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453953TTTAAAAAGGTCATATATTAATATATGACCTTTTTAAA0.279400.024200.491400.500001.000001.00000


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589UGCUUCGUGCCUCGAUUGA65.40272805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9253607TGCTTCGTGCCTCGATTGATCAATCGAGGCACGAAGCA0.038500.002300.629300.500000.967400.75000


Target Position: 5153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5153AAGAAAGUUCAAUAUGUUU81.2161790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5645171AAGAAAGTTCAATATGTTTAAACATATTGAACTTTCTT0.207600.122400.637900.500001.000001.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419CGGAACCCAAGGACUUUUC59.65883625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
913437CGGAACCCAAGGACTTTTCGAAAAGTCCTTGGGTTCCG0.034300.020800.741400.750001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603GCCUCGCACGGGACAUUCA84.7248505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302621GCCTCGCACGGGACATTCATGAATGTCCCGTGCGAGGC0.679200.002300.775900.750000.951100.75000


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787ACAAAGUGUAUAAAUCUGA80.8381822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793805ACAAAGTGTATAAATCTGATCAGATTTATACACTTTGT0.133600.002500.482800.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615ACAUUCACCACAUCGACUA80.9386813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202633ACATTCACCACATCGACTATAGTCGATGTGGTGAATGT0.591100.108000.534500.750001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156AGCGCGGGUGGGAGUGAGA72.78911784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960174AGCGCGGGTGGGAGTGAGATCTCACTCCCACCCGCGCT0.112200.001900.629300.500001.000001.00000


Target Position: 5035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5035CUGGUCAUCACUGUCCUCA75.79091378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9695053CTGGTCATCACTGTCCTCATGAGGACAGTGATGACCAG0.037800.002400.560300.500000.907600.62500


Target Position: 3765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3765UGUAUAUAGCUAUGAAGAA90.4383163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7293783TGTATATAGCTATGAAGAATTCTTCATAGCTATATACA0.345100.143500.534500.750001.000001.00000


Target Position: 5131, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5131GCUGGAUUACUGCUAAAUA97.881428

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7513119GCTGGATTACTGCTAAATA1/1/0/094.96FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38269141..38269159(-)00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5365149GCTGGATTACTGCTAAATATATTTAGCAGTAATCCAGC0.271400.018300.810301.000001.000001.00000


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139GAGGCGGAGGAGGGACCAG62.873164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
945157GAGGCGGAGGAGGGACCAGCTGGTCCCTCCTCCGCCTC0.060200.002100.525900.500000.945700.62500


Target Position: 3783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3783AAACACAAAGUGUAUAAAU81.874730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923801AAACACAAAGTGTATAAATATTTATACACTTTGTGTTT0.021000.004600.491400.500000.940200.75000


Target Position: 5626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5626UUGACCUGAAAAAAAAAAA68.77442355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8455644TTGACCTGAAAAAAAAAAATTTTTTTTTTTCAGGTCAA0.968700.772300.646600.500001.000001.00000


Target Position: 4029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4029UUGCUGCUGCUUCAUUUAU65.1652844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9274047TTGCTGCTGCTTCATTTATATAAATGAAGCAGCAGCAA0.032600.003800.603400.500000.956500.75000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248GAAAAAUGGCAAAGAAUUC73.86891623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021266GAAAAATGGCAAAGAATTCGAATTCTTTGCCATTTTTC0.087400.034200.500000.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967CUGACUCCAGUGCAUCCAU79.4633940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971985CTGACTCCAGTGCATCCATATGGATGCACTGGAGTCAG0.217100.041500.629300.750000.967400.62500


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234ACACUGCGCUGGUUGAAAA88.3168260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961252ACACTGCGCTGGTTGAAAATTTTCAACCAGCGCAGTGT0.233800.008300.706900.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287CUGCCUUCACCCCACUCAG66.5492662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033305CTGCCTTCACCCCACTCAGCTGAGTGGGGTGAAGGCAG0.445800.108300.500000.500001.000001.00000


Target Position: 4397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4397GUAGAGCUACAGUGAUUAA98.945422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4214415GTAGAGCTACAGTGATTAATTAATCACTGTAGCTCTAC0.528700.102200.646600.750001.000001.00000


Target Position: 3643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643CUUAUUAAUUCCGAUACUA89.424215

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3641-3663GGCTTATTAATTCCGATACTAGTUAGUAUCGGAAUUAAUAAGCCCUUAUUAAUUCCGAUACUAGUU20.9-7.533


Target Position: 4984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4984CUCCGAAUGUUUUUGGUUU76.84551235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8085002CTCCGAATGTTTTTGGTTTAAACCAAAAACATTCGGAG0.153600.004300.810300.750001.000001.00000


Target Position: 4873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4873UCCUGUAUCCAUGUGACCA75.3551433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7814891TCCTGTATCCATGTGACCATGGTCACATGGATACAGGA0.070100.040500.525900.500000.994600.75000


Target Position: 4408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4408GUGAUUAAGAGGAAAGCAA88.7963242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4754426GTGATTAAGAGGAAAGCAATTGCTTTCCTCTTAATCAC0.155200.132400.646600.750001.000001.00000


Target Position: 5136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5136AUUACUGCUAAAUACAAAA83.1712620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8175154ATTACTGCTAAATACAAAATTTTGTATTTAGCAGTAAT0.361500.140200.508600.500000.994600.75000


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292GAAGCAUAAGAAUAUCAUC84.3832535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382310GAAGCATAAGAATATCATCGATGATATTCTTATGCTTC0.310300.204700.491400.500001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621GUUAAUACCACCGACAAAG66.55742658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271639GTTAATACCACCGACAAAGCTTTGTCGGTGGTATTAAC0.073500.045500.508600.500001.000001.00000


Target Position: 3885, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885GCAUCAGUUGCUAUAUAUU92.6626101

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5388519GCATCAGTTGCTATATATT1/1/0/094.96FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38270387..38270405(-)00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963903GCATCAGTTGCTATATATTAATATATAGCAACTGATGC0.249200.004600.844801.000000.983700.62500


Target Position: 5340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5340ACAGAACUAGGAAAUGAAU81.3548778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6135358ACAGAACTAGGAAATGAATATTCATTTCCTAGTTCTGT0.095700.016000.698300.750001.000001.00000


Target Position: 4402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4402GCUACAGUGAUUAAGAGGA85.7347421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9904420GCTACAGTGATTAAGAGGATCCTCTTAATCACTGTAGC0.357900.151000.482800.750001.000001.00000


Target Position: 2581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581GUGAUGAAGAUAGCAGACU72.16221879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832599GTGATGAAGATAGCAGACTAGTCTGCTATCTTCATCAC0.136400.025100.586200.500001.000001.00000


Target Position: 3810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3810AUAUUUACAUGUCUUUUUA87.902287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213828ATATTTACATGTCTTTTTATAAAAAGACATGTAAATAT0.145600.025300.508600.500001.000001.00000


Target Position: 161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
161GGGUGGGAGUGAGAGAGCG68.92672332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805179GGGTGGGAGTGAGAGAGCGCGCTCTCTCACTCCCACCC0.054800.026200.569000.500001.000001.00000


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604CCUCGCACGGGACAUUCAC62.5193216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722622CCTCGCACGGGACATTCACGTGAATGTCCCGTGCGAGG0.100600.003000.551700.750000.972800.75000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533CGGUCUGCAAGGAAAGUGA86.3895380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
614551CGGTCTGCAAGGAAAGTGATCACTTTCCTTGCAGACCG0.204600.012200.689700.750001.000001.00000


Target Position: 3493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493UCCUGUCGGUUUGGUCUGU58.70693761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973511TCCTGTCGGTTTGGTCTGTACAGACCAAACCGACAGGA0.174100.019700.663800.500000.940200.75000


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338GGUCCCUUGUAUGUCAUCG68.05642456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522356GGTCCCTTGTATGTCATCGCGATGACATACAAGGGACC0.073300.003500.560300.500001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911CCUUGUCACCAACCUCUAA91.5577127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516929CCTTGTCACCAACCTCTAATTAGAGGTTGGTGACAAGG0.135700.021100.810301.000000.989100.75000


Target Position: 3371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371CCAGCCACUUCAUCCCCUC63.87093020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7363389CCAGCCACTTCATCCCCTCGAGGGGATGAAGTGGCTGG0.257100.107800.534500.750001.000001.00000


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663UUUGCUUUGCUGACCAAAU66.33782690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553681TTTGCTTTGCTGACCAAATATTTGGTCAGCAAAGCAAA0.097600.013800.491400.500000.962000.62500


Target Position: 5345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5345ACUAGGAAAUGAAUUUUUA89.9252187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4525363ACTAGGAAATGAATTTTTATAAAAATTCATTTCCTAGT0.173100.033700.672400.750001.000001.00000


Target Position: 4231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4231GUCAGAAAAAGAAGAUGUC71.00712042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9074249GTCAGAAAAAGAAGATGTCGACATCTTCTTTTTCTGAC0.183300.063600.500000.500001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868AGAUGAAGAGUGGUACCAA95.533656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961886AGATGAAGAGTGGTACCAATTGGTACCACTCTTCATCT0.227800.054300.577600.750001.000001.00000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841CAGUAACUGCACCAACGAG80.4985851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962859CAGTAACTGCACCAACGAGCTCGTTGGTGCAGTTACTG0.059100.011900.474100.500000.989100.62500


Target Position: 5067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5067GGCUCCCCCGUACCUCAUG60.69323476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7815085GGCTCCCCCGTACCTCATGCATGAGGTACGGGGGAGCC0.060100.044000.844800.750000.934800.62500


Target Position: 5141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5141UGCUAAAUACAAAAGAAAG70.84462061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8345159TGCTAAATACAAAAGAAAGCTTTCTTTTGTATTTAGCA0.357000.185100.715500.500001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119UAUGCCCGUAGCUCCAUAU70.71332075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081137TATGCCCGTAGCTCCATATATATGGAGCTACGGGCATA0.037100.011900.500000.500000.940200.87500


Target Position: 28, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28GACCAGGCUGUAGGAAGAG67.26722577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97346GACCAGGCTGTAGGAAGAGCTCTTCCTACAGCCTGGTC0.455700.038400.508600.500000.967400.75000


Target Position: 5134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5134GGAUUACUGCUAAAUACAA101.7567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5132-5154CTGGATTACTGCTAAATACAAAAUUGUAUUUAGCAGUAAUCCAGGGAUUACUGCUAAAUACAAAAU6.914.532


Target Position: 5572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5572CACCCACAAAUUUCCCCAA83.5287597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3745590CACCCACAAATTTCCCCAATTGGGGAAATTTGTGGGTG0.877700.843000.646600.750001.000001.00000


Target Position: 2289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289CGGGAAGCAUAAGAAUAUC73.87521620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772307CGGGAAGCATAAGAATATCGATATTCTTATGCTTCCCG0.328200.051800.732800.750001.000001.00000


Target Position: 5106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5106GUCGCUAUAUUAAAGCUUA93.189489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6995124GTCGCTATATTAAAGCTTATAAGCTTTAATATAGCGAC0.076400.022100.784500.750000.902200.75000


Target Position: 3500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3500GGUUUGGUCUGUUUUGCCU80.5387847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8483518GGTTTGGTCTGTTTTGCCTAGGCAAAACAGACCAAACC0.174400.005700.508600.750000.972800.62500


Target Position: 2230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2230GACGCAACAGAGAAAGACU87.8295294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772248GACGCAACAGAGAAAGACTAGTCTTTCTCTGTTGCGTC0.217500.039800.612100.500001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CGGAGGAUGAUGAUGAUGA89.6367199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171067CGGAGGATGATGATGATGATCATCATCATCATCCTCCG0.213000.012100.689700.750001.000001.00000


Target Position: 4831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4831CCUGGCUUCGUUUCUUGUU70.72112074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6104849CCTGGCTTCGTTTCTTGTTAACAAGAAACGAAGCCAGG0.205700.012500.698301.000001.000001.00000


Target Position: 5013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5013UGGAAUUUACUUCUGCCAC58.64853771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9195031TGGAATTTACTTCTGCCACGTGGCAGAAGTAAATTCCA0.118800.037700.551700.500001.000001.00000


Target Position: 3923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3923AAGGAAAAUGUUUUUAAAA85.9498407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663941AAGGAAAATGTTTTTAAAATTTTAAAAACATTTTCCTT0.143100.005700.637900.500001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247UGAAAAAUGGCAAAGAAUU72.56561814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6311265TGAAAAATGGCAAAGAATTAATTCTTTGCCATTTTTCA0.092800.050000.715500.750001.000001.00000


Target Position: 4912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4912UCGCAGAUCUUGGCUUCUU66.69572643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9034930TCGCAGATCTTGGCTTCTTAAGAAGCCAAGATCTGCGA0.037400.002600.655200.750000.994600.75000


Target Position: 5192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5192GGAUUGCUGCUUUAAAUUU85.5133441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6775210GGATTGCTGCTTTAAATTTAAATTTAAAGCAGCAATCC0.081200.030900.870701.000001.000001.00000


Target Position: 4034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4034GCUGCUUCAUUUAUCUAUG77.84081114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9054052GCTGCTTCATTTATCTATGCATAGATAAATGAAGCAGC0.054800.002600.698300.750001.000001.00000


Target Position: 3497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497GUCGGUUUGGUCUGUUUUG65.53592789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9853515GTCGGTTTGGTCTGTTTTGCAAAACAGACCAAACCGAC0.116600.011600.672400.500001.000001.00000


Target Position: 4720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4720GCAGAAACUGAAACCCAGA87.3163326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434738GCAGAAACTGAAACCCAGATCTGGGTTTCAGTTTCTGC0.144600.002100.629300.750000.962000.62500


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GUACCAAGAAGAGUGACUU82.0487711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781898GTACCAAGAAGAGTGACTTAAGTCACTCTTCTTGGTAC0.039900.028600.543100.750001.000001.00000


Target Position: 3486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3486AGCUUUCUCCUGUCGGUUU73.26591712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783504AGCTTTCTCCTGTCGGTTTAAACCGACAGGAGAAAGCT0.058200.002900.853400.750000.940200.87500


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917CACCAACCUCUAACUGCAG72.81991780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996935CACCAACCTCTAACTGCAGCTGCAGTTAGAGGTTGGTG0.077300.014600.508600.500001.000001.00000


Target Position: 5148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5148UACAAAAGAAAGUUCAAUA85.9893402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7445166TACAAAAGAAAGTTCAATATATTGAACTTTCTTTTGTA0.523200.284800.637900.500001.000001.00000


Target Position: 4834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4834GGCUUCGUUUCUUGUUGGU71.51681965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6584852GGCTTCGTTTCTTGTTGGTACCAACAAGAAACGAAGCC0.084900.060800.646600.750001.000001.00000


Target Position: 4529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4529ACCCCAUCUCUACUAAAAA85.5442438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3454547ACCCCATCTCTACTAAAAATTTTTAGTAGAGATGGGGT0.237700.123400.853400.750001.000001.00000


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621ACCACAUCGACUACUAUAA85.4721446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2342639ACCACATCGACTACTATAATTATAGTAGTCGATGTGGT0.776700.504700.819000.750001.000001.00000


Target Position: 5240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5240UGUUGGCGACUAUUGUAAA86.8287354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6575258TGTTGGCGACTATTGTAAATTTACAATAGTCGCCAACA0.234600.009800.706900.750001.000001.00000


Target Position: 3758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3758GGGGCUCUGUAUAUAGCUA98.699225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8593776GGGGCTCTGTATATAGCTATAGCTATATACAGAGCCCC0.223100.003300.819001.000000.918500.62500


Target Position: 4942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4942UGUCCAAACUCCAUCCUGU77.70891134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8974960TGTCCAAACTCCATCCTGTACAGGATGGAGTTTGGACA0.075400.036900.500000.500001.000001.00000


Target Position: 4403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4403CUACAGUGAUUAAGAGGAA93.652183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8994421CTACAGTGATTAAGAGGAATTCCTCTTAATCACTGTAG0.370700.160200.500000.750001.000001.00000


Target Position: 4880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4880UCCAUGUGACCAGACUGUA75.85841363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9424898TCCATGTGACCAGACTGTATACAGTCTGGTCACATGGA0.028900.006600.689700.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GGUGGGAGUGAGAGAGCGA90.1137180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
844180GGTGGGAGTGAGAGAGCGATCGCTCTCTCACTCCCACC0.047500.021000.560300.750001.000001.00000


Target Position: 4884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4884UGUGACCAGACUGUAUUUG55.90564130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8884902TGTGACCAGACTGTATTTGCAAATACAGTCTGGTCACA0.070700.007900.560300.500001.000001.00000


Target Position: 5468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5468GGGAUGAAGAAUCUAAAAG75.48831416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5205486GGGATGAAGAATCTAAAAGCTTTTAGATTCTTCATCCC0.601500.020300.853400.750001.000001.00000


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CCACACUGCGCUGGUUGAA77.84351113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861250CCACACTGCGCTGGTTGAATTCAACCAGCGCAGTGTGG0.099800.002800.672401.000000.918500.62500


Target Position: 5287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5287ACCUGCUAACAUUACAAUU76.0941333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9905305ACCTGCTAACATTACAATTAATTGTAATGTTAGCAGGT0.081900.001600.844800.750001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228CCCUGUCCCCUUUCCUGCU67.25992580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5723246CCCTGTCCCCTTTCCTGCTAGCAGGAAAGGGGACAGGG0.113600.023000.637900.750001.000001.00000


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622CCACAUCGACUACUAUAAA95.868150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562640CCACATCGACTACTATAAATTTATAGTAGTCGATGTGG0.846700.503500.844801.000001.000001.00000


Target Position: 5296, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5296CAUUACAAUUUGUAUUUAU91.881120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5345314CATTACAATTTGTATTTATATAAATACAAATTGTAATG0.226900.020200.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5294-5316AACATTACAATTTGTATTTATGTAUAAAUACAAAUUGUAAUGUUCAUUACAAUUUGUAUUUAUGUU1.46.922


Target Position: 2205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205AGUGGCUGUGAAGAUGUUG63.5793059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7642223AGTGGCTGTGAAGATGTTGCAACATCTTCACAGCCACT0.132600.016200.560300.500001.000001.00000


Target Position: 3801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801UCUGAGUAUAUAUUUACAU77.56341151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343819TCTGAGTATATATTTACATATGTAAATATATACTCAGA0.128000.012200.569000.750001.000001.00000


Target Position: 4004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4004UUCAGUUUAGGUCCCUCAA70.58382102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8354022TTCAGTTTAGGTCCCTCAATTGAGGGACCTAAACTGAA0.255700.028400.525900.500001.000001.00000


Target Position: 2280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2280GAAGAUGAUCGGGAAGCAU84.6476513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932298GAAGATGATCGGGAAGCATATGCTTCCCGATCATCTTC0.314200.013800.517200.750001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502UGUGUAAGGUGUACAGUGA85.5217439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911520TGTGTAAGGTGTACAGTGATCACTGTACACCTTACACA0.021000.010400.482800.500000.983700.75000


Target Position: 4854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4854UGCCUCCCCAGAUCGUCCU53.52724412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8254872TGCCTCCCCAGATCGTCCTAGGACGATCTGGGGAGGCA0.352600.095000.508600.500001.000001.00000


Target Position: 5438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5438UGGCCCUACCUUGAAGCAA69.25082285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7365456TGGCCCTACCTTGAAGCAATTGCTTCAAGGTAGGGCCA0.069800.016100.698300.750000.923900.62500


Target Position: 5583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5583UUCCCCAAAGACUGCGCUA66.13732715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8705601TTCCCCAAAGACTGCGCTATAGCGCAGTCTTTGGGGAA0.349200.291400.500000.500000.972800.75000


Target Position: 5034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5034GCUGGUCAUCACUGUCCUC76.01571342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9265052GCTGGTCATCACTGTCCTCGAGGACAGTGATGACCAGC0.034300.002300.543100.750000.907600.62500


Target Position: 5068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5068GCUCCCCCGUACCUCAUGG58.0843854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9235086GCTCCCCCGTACCTCATGGCCATGAGGTACGGGGGAGC0.032800.022300.508600.500000.989100.62500


Target Position: 4692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4692CAAAAAGGAAAACAAAUGA83.9095571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4690-4712AACAAAAAGGAAAACAAATGATGUCAUUUGUUUUCCUUUUUGUUCAAAAAGGAAAACAAAUGAUGU12.19.521


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371GGAGAAUGAGUACGGCAGC66.63312651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921389GGAGAATGAGTACGGCAGCGCTGCCGTACTCATTCTCC0.113600.018800.517200.500001.000001.00000


Target Position: 3807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3807UAUAUAUUUACAUGUCUUU76.5641271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903825TATATATTTACATGTCTTTAAAGACATGTAAATATATA0.137200.019100.543100.500001.000001.00000


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905AAAACAAAAAAGAAAAAAA87.0441342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803923AAAACAAAAAAGAAAAAAATTTTTTTCTTTTTTGTTTT0.917300.191700.500000.500001.000001.00000


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269ACCUGACCACAGAAUUGGA83.2102617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911287ACCTGACCACAGAATTGGATCCAATTCTGTGGTCAGGT0.060800.003200.482800.500000.902200.62500


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GCUGACUGCCACCCACACG64.99392873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7213158GCTGACTGCCACCCACACGCGTGTGGGTGGCAGTCAGC0.766600.062500.577600.500000.983700.75000


Target Position: 5014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5014GGAAUUUACUUCUGCCACC71.40021982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9425032GGAATTTACTTCTGCCACCGGTGGCAGAAGTAAATTCC0.129000.049500.517200.500001.000001.00000


Target Position: 5566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5566UCAAAUCACCCACAAAUUU68.90582335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1915584TCAAATCACCCACAAATTTAAATTTGTGGGTGATTTGA0.900000.772400.724100.750001.000001.00000


Target Position: 5300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5300ACAAUUUGUAUUUAUGUUU73.3411703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5255318ACAATTTGTATTTATGTTTAAACATAAATACAAATTGT0.132900.108000.706900.750001.000001.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556AGGUGAAUGGGAGCAAGAU79.1073977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991574AGGTGAATGGGAGCAAGATATCTTGCTCCCATTCACCT0.096300.002600.663800.750001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096ACAGAUAACACCAAACCAA88.0449279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691114ACAGATAACACCAAACCAATTGGTTTGGTGTTATCTGT0.784100.726300.560300.750001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570CAGAGGACAAUGUGAUGAA96.434342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152588CAGAGGACAATGTGATGAATTCATCACATTGTCCTCTG0.118300.007800.612100.750001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633ACUAUAAAAAGACAACCAA85.4222455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612651ACTATAAAAAGACAACCAATTGGTTGTCTTTTTATAGT0.637900.579000.560300.750001.000001.00000


Target Position: 3759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3759GGGCUCUGUAUAUAGCUAU86.654364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063777GGGCTCTGTATATAGCTATATAGCTATATACAGAGCCC0.211700.004400.948301.000000.918500.62500


Target Position: 20, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
20CCAAAGGAGACCAGGCUGU66.97122615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71638CCAAAGGAGACCAGGCTGTACAGCCTGGTCTCCTTTGG0.073100.061000.637900.750001.000001.00000


Target Position: 4943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4943GUCCAAACUCCAUCCUGUC70.13922166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8634961GTCCAAACTCCATCCTGTCGACAGGATGGAGTTTGGAC0.069100.035600.500000.500001.000001.00000


Target Position: 3884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3884GGCAUCAGUUGCUAUAUAU94.12374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6233902GGCATCAGTTGCTATATATATATATAGCAACTGATGCC0.277200.011800.956901.000000.940200.62500


Target Position: 5130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5130UGCUGGAUUACUGCUAAAU70.86732057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6565148TGCTGGATTACTGCTAAATATTTAGCAGTAATCCAGCA0.216000.009900.844800.750001.000001.00000


Target Position: 5476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476GAAUCUAAAAGUCUUCAUA99.141521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5474-5496AAGAATCTAAAAGTCTTCATAAGUAUGAAGACUUUUAGAUUCUUGAAUCUAAAAGUCUUCAUAAGU20.46.932


Target Position: 5562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5562CUACUCAAAUCACCCACAA86.4278376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7695580CTACTCAAATCACCCACAATTGTGGGTGATTTGAGTAG0.871900.725400.525900.750001.000001.00000


Target Position: 5503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5503GGAGAGGUGCUAGAAAAAU84.2864539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8815521GGAGAGGTGCTAGAAAAATATTTTTCTAGCACCTCTCC0.574100.002900.862101.000001.000001.00000


Target Position: 5543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5543AGUGAUGUCCUUGCUGUUA81.7653736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7605561AGTGATGTCCTTGCTGTTATAACAGCAAGGACATCACT0.105100.006100.672400.750001.000001.00000


Target Position: 4986, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4986CCGAAUGUUUUUGGUUUUU67.59692519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4825004CCGAATGTTTTTGGTTTTTAAAAACCAAAAACATTCGG0.151100.077300.913801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4984-5006CTCCGAATGTTTTTGGTTTTTTGAAAAACCAAAAACAUUCGGAGCCGAAUGUUUUUGGUUUUUUGU18.821.122


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872GAAGAGUGGUACCAAGAAG82.3705680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671890GAAGAGTGGTACCAAGAAGCTTCTTGGTACCACTCTTC0.171600.080300.534500.500001.000001.00000


Target Position: 4709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4709GAUGAAGGUCUGCAGAAAC78.91261004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9164727GATGAAGGTCTGCAGAAACGTTTCTGCAGACCTTCATC0.034000.005700.534500.500001.000001.00000


Target Position: 3297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3297CCCACUCAGCUCACCUCUC65.82642758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4433315CCCACTCAGCTCACCTCTCGAGAGGTGAGCTGAGTGGG0.787600.415600.681000.750001.000001.00000


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588CUGCCUUAUGUCCAGAUCU76.14331329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901606CTGCCTTATGTCCAGATCTAGATCTGGACATAAGGCAG0.038000.027700.560300.500000.994600.62500


Target Position: 5335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5335GGUGAACAGAACUAGGAAA97.05132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8385353GGTGAACAGAACTAGGAAATTTCCTAGTTCTGTTCACC0.048300.004100.853401.000001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151AAAAGAUGGAAAAGAAAUU76.80561239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461169AAAAGATGGAAAAGAAATTAATTTCTTTTCCATCTTTT0.398000.023900.491400.500001.000001.00000


Target Position: 2225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225AGUCGGACGCAACAGAGAA88.7801244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922243AGTCGGACGCAACAGAGAATTCTCTGTTGCGTCCGACT0.273700.001500.534500.750000.934800.62500


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319CCACCUCCUCUCCACCUGC60.21413541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893337CCACCTCCTCTCCACCTGCGCAGGTGGAGAGGAGGTGG0.064100.061900.491400.500001.000001.00000


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652UCCGAUACUAGUUUGCUUU67.85422486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8113670TCCGATACTAGTTTGCTTTAAAGCAAACTAGTATCGGA0.053900.042500.870700.750001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082CAGAGGAGAAAGAAACAGA92.1394112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771100CAGAGGAGAAAGAAACAGATCTGTTTCTTTCTCCTCTG0.839200.064400.560300.500001.000001.00000


Target Position: 5099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5099CUCCUCAGUCGCUAUAUUA90.9693142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6005117CTCCTCAGTCGCTATATTATAATATAGCGACTGAGGAG0.102600.049800.775900.750001.000001.00000


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222GUCCGUCCCUGUCCCCUUU71.29271999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503240GTCCGTCCCTGTCCCCTTTAAAGGGGACAGGGACGGAC0.123300.046900.819000.750001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264UUCAAACCUGACCACAGAA76.32591306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861282TTCAAACCTGACCACAGAATTCTGTGGTCAGGTTTGAA0.047700.004900.500000.500000.902200.62500


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CUAACUGCAGAACUGGGAU76.93641224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963944CTAACTGCAGAACTGGGATATCCCAGTTCTGCAGTTAG0.030900.007500.491400.750001.000001.00000


Target Position: 3766, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3766GUAUAUAGCUAUGAAGAAA99.38318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3073784GTATATAGCTATGAAGAAATTTCTTCATAGCTATATAC0.348800.144800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3764-3786CTGTATATAGCTATGAAGAAAACUUUCUUCAUAGCUAUAUACAGGUAUAUAGCUAUGAAGAAAACU20.4-0.822


Target Position: 3918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3918AAAAAAAGGAAAAUGUUUU73.28711710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753936AAAAAAAGGAAAATGTTTTAAAACATTTTCCTTTTTTT0.072000.034700.500000.500001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826CCUUCCUCAUCUCCUGCAU75.88911361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611844CCTTCCTCATCTCCTGCATATGCAGGAGATGAGGAAGG0.790100.027300.689701.000001.000001.00000


Target Position: 3285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285GCCUGCCUUCACCCCACUC60.45443509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2813303GCCTGCCTTCACCCCACTCGAGTGGGGTGAAGGCAGGC0.482400.082600.689700.750001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277GAUGAAGAUGAUCGGGAAG73.68581656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042295GATGAAGATGATCGGGAAGCTTCCCGATCATCTTCATC0.111800.002600.543100.500001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840CCAGUAACUGCACCAACGA82.4551673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782858CCAGTAACTGCACCAACGATCGTTGGTGCAGTTACTGG0.386900.030500.551700.750000.989100.75000


Target Position: 3986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3986UUAUGUUCUAAACCUAUUU69.07962312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7784004TTATGTTCTAAACCTATTTAAATAGGTTTAGAACATAA0.083700.064700.534500.500001.000001.00000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860CGUCUACAAGAUGAAGAGU79.1047978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171878CGTCTACAAGATGAAGAGTACTCTTCATCTTGTAGACG0.058600.004200.569000.750001.000001.00000


Target Position: 3888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3888UCAGUUGCUAUAUAUUAAA82.716655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4373906TCAGTTGCTATATATTAAATTTAATATATAGCAACTGA0.353300.114400.724100.750001.000001.00000


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889UGCAGUGCCCUCACAGAGA75.99251346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162907TGCAGTGCCCTCACAGAGATCTCTGTGAGGGCACTGCA0.137100.007700.629300.500000.934801.00000


Target Position: 4714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4714AGGUCUGCAGAAACUGAAA88.0003283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124732AGGTCTGCAGAAACTGAAATTTCAGTTTCTGCAGACCT0.179200.004300.844800.750001.000001.00000


Target Position: 5327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5327CAUCAUUUGGUGAACAGAA94.709367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9855345CATCATTTGGTGAACAGAATTCTGTTCACCAAATGATG0.064800.004200.482800.750001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AGGACAAACCCAACCGUGU70.75542067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952198AGGACAAACCCAACCGTGTACACGGTTGGGTTTGTCCT0.048900.002700.637900.500000.945700.62500


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851ACCAACGAGCUGUACAUGA75.34131436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932869ACCAACGAGCTGTACATGATCATGTACAGCTCGTTGGT0.121300.038300.629300.500001.000001.00000


Target Position: 3831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3831AGGGUCGUUACCAGAGAUU69.56742243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723849AGGGTCGTTACCAGAGATTAATCTCTGGTAACGACCCT0.041200.004000.836200.750000.934800.75000


Target Position: 2855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2855ACGAGCUGUACAUGAUGAU75.69741393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052873ACGAGCTGTACATGATGATATCATCATGTACAGCTCGT0.075000.011000.594800.750001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829UCCUCAUCUCCUGCAUGGU61.29023392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931847TCCTCATCTCCTGCATGGTACCATGCAGGAGATGAGGA0.020900.002500.517200.500000.989100.75000


Target Position: 3962, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3962CUUUUGCUGUUUUAUUUUU76.03451340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4483980CTTTTGCTGTTTTATTTTTAAAAATAAAACAGCAAAAG0.496600.135500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3960-3982TACTTTTGCTGTTTTATTTTTTTAAAAAUAAAACAGCAAAAGUACUUUUGCUGUUUUAUUUUUUUU-9.718.621


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799UGGAGAUCAUCAUCUAUUG74.75061511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481817TGGAGATCATCATCTATTGCAATAGATGATGATCTCCA0.057600.018500.698300.500000.918500.87500


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282AGAUGAUCGGGAAGCAUAA91.8525121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392300AGATGATCGGGAAGCATAATTATGCTTCCCGATCATCT0.623700.018000.689700.750001.000001.00000


Target Position: 3764, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3764CUGUAUAUAGCUAUGAAGA89.5865203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7033782CTGTATATAGCTATGAAGATCTTCATAGCTATATACAG0.222600.118100.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3762-3784CTCTGTATATAGCTATGAAGAAAUCUUCAUAGCUAUAUACAGAGCUGUAUAUAGCUAUGAAGAAAU13.48.232


Target Position: 4010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4010UUAGGUCCCUCAAUAAAAA81.1527796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8574028TTAGGTCCCTCAATAAAAATTTTTATTGAGGGACCTAA0.402000.061900.534500.500001.000001.00000


Target Position: 4978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4978AAAAUUCUCCGAAUGUUUU73.79061636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8564996AAAATTCTCCGAATGTTTTAAAACATTCGGAGAATTTT0.202000.006300.500000.500001.000001.00000


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170GGGCUGGACAAGGACAAAC67.38782560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832188GGGCTGGACAAGGACAAACGTTTGTCCTTGTCCAGCCC0.270300.005300.844800.750001.000001.00000


Target Position: 3508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3508CUGUUUUGCCUUCACCCAU74.99631478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143526CTGTTTTGCCTTCACCCATATGGGTGAAGGCAAAACAG0.053000.008900.629300.750001.000001.00000


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904AAAAACAAAAAAGAAAAAA73.24651714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393922AAAAACAAAAAAGAAAAAATTTTTTCTTTTTTGTTTTT0.929600.195400.500000.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265UCAAACCUGACCACAGAAU65.33052821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091283TCAAACCTGACCACAGAATATTCTGTGGTCAGGTTTGA0.054400.005900.715500.750000.902200.75000


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555GAGGUGAAUGGGAGCAAGA87.0378343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381573GAGGTGAATGGGAGCAAGATCTTGCTCCCATTCACCTC0.030100.003600.586200.500001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336AUGGUCCCUUGUAUGUCAU71.122027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362354ATGGTCCCTTGTATGTCATATGACATACAAGGGACCAT0.067500.002200.500000.500001.000001.00000


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997CCAGUACUCCCCCAGCUUU77.35981179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453015CCAGTACTCCCCCAGCTTTAAAGCTGGGGGAGTACTGG0.314900.006600.844801.000000.951100.87500


Target Position: 5314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5314UGUUUAAAGAAGGCAUCAU73.26491713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9655332TGTTTAAAGAAGGCATCATATGATGCCTTCTTTAAACA0.024500.005700.551700.750001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865ACAAGAUGAAGAGUGGUAC65.29942823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701883ACAAGATGAAGAGTGGTACGTACCACTCTTCATCTTGT0.194100.035200.525900.500001.000001.00000


Target Position: 5324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5324AGGCAUCAUUUGGUGAACA81.7494739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9505342AGGCATCATTTGGTGAACATGTTCACCAAATGATGCCT0.031600.002000.637900.500001.000001.00000


Target Position: 1825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1825GCCUUCCUCAUCUCCUGCA77.49651159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201843GCCTTCCTCATCTCCTGCATGCAGGAGATGAGGAAGGC0.052400.042300.646600.750001.000001.00000


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276CACAGAAUUGGAGGCUACA85.1458482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741294CACAGAATTGGAGGCTACATGTAGCCTCCAATTCTGTG0.099100.013600.586200.500001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610AGACUGCUGGAGUUAAUAC75.11921464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961628AGACTGCTGGAGTTAATACGTATTAACTCCAGCAGTCT0.178500.003500.543100.500001.000001.00000


Target Position: 5110, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5110CUAUAUUAAAGCUUAUAUU88.7871243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5108-5130CGCTATATTAAAGCTTATATTTTAAUAUAAGCUUUAAUAUAGCGCUAUAUUAAAGCUUAUAUUUUU-2.7-5.922


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619UCACCACAUCGACUACUAU82.0739706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3942637TCACCACATCGACTACTATATAGTAGTCGATGTGGTGA0.646500.152400.681000.750001.000001.00000


Target Position: 5330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5330CAUUUGGUGAACAGAACUA91.3694131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9845348CATTTGGTGAACAGAACTATAGTTCTGTTCACCAAATG0.021800.001600.482800.750001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342UCUGACAAGGGCAACUACA74.35231566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861360TCTGACAAGGGCAACTACATGTAGTTGCCCTTGTCAGA0.065400.002300.517200.500001.000001.00000


Target Position: 5329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5329UCAUUUGGUGAACAGAACU68.55022396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9875347TCATTTGGTGAACAGAACTAGTTCTGTTCACCAAATGA0.022600.001600.517200.500001.000001.00000


Target Position: 3985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3985AUUAUGUUCUAAACCUAUU76.39621293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8824003ATTATGTTCTAAACCTATTAATAGGTTTAGAACATAAT0.091100.065500.500000.500001.000001.00000


Target Position: 4855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4855GCCUCCCCAGAUCGUCCUU66.92392622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2274873GCCTCCCCAGATCGTCCTTAAGGACGATCTGGGGAGGC0.352400.120700.862101.000001.000001.00000


Target Position: 4830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4830CCCUGGCUUCGUUUCUUGU71.95791904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5754848CCCTGGCTTCGTTTCTTGTACAAGAAACGAAGCCAGGG0.388400.015400.784500.750001.000001.00000


Target Position: 5262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5262CUCUUUGUUUCUCUCUGUA88.2842261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4795280CTCTTTGTTTCTCTCTGTATACAGAGAGAAACAAAGAG0.202600.171100.629300.750001.000001.00000


Target Position: 5142, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5142GCUAAAUACAAAAGAAAGU76.79641241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3815160GCTAAATACAAAAGAAAGTACTTTCTTTTGTATTTAGC0.383800.196800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5140-5162CTGCTAAATACAAAAGAAAGTTCACUUUCUUUUGUAUUUAGCAGGCUAAAUACAAAAGAAAGUUCU10.3-2.322


Target Position: 5303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5303AUUUGUAUUUAUGUUUAAA85.8273418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8195321ATTTGTATTTATGTTTAAATTTAAACATAAATACAAAT0.100900.073300.508600.500001.000001.00000


Target Position: 5619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5619AGUGAAAUUGACCUGAAAA91.157137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2995637AGTGAAATTGACCTGAAAATTTTCAGGTCAATTTCACT0.790400.493300.706900.750001.000001.00000


Target Position: 3496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496UGUCGGUUUGGUCUGUUUU69.67372231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5363514TGTCGGTTTGGTCTGTTTTAAAACAGACCAAACCGACA0.278900.031900.706900.750001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084GAGGAGAAAGAAACAGAUA96.523241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611102GAGGAGAAAGAAACAGATATATCTGTTTCTTTCTCCTC0.847700.116200.767200.750001.000001.00000


Target Position: 5140, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5140CUGCUAAAUACAAAAGAAA89.5218209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5195158CTGCTAAATACAAAAGAAATTTCTTTTGTATTTAGCAG0.370800.123500.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5138-5160TACTGCTAAATACAAAAGAAAGTUUUCUUUUGUAUUUAGCAGUACUGCUAAAUACAAAAGAAAGUU5.519.722


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092AGAAACAGAUAACACCAAA90.7111153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421110AGAAACAGATAACACCAAATTTGGTGTTATCTGTTTCT0.838500.732300.724100.750001.000001.00000


Target Position: 3210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3210GGCCCACCACCUGUCCGUC63.53773065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4683228GGCCCACCACCTGTCCGTCGACGGACAGGTGGTGGGCC0.182500.151000.681000.750000.923900.62500


Target Position: 5406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5406UCCUUGUAAAACAGUGAUG58.52233788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8135424TCCTTGTAAAACAGTGATGCATCACTGTTTTACAAGGA0.084400.004200.715500.500001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093GAAACAGAUAACACCAAAC78.9416999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171111GAAACAGATAACACCAAACGTTTGGTGTTATCTGTTTC0.771600.681000.525900.500001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590GCUUCGUGCCUCGAUUGAA89.1962223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223608GCTTCGTGCCTCGATTGAATTCAATCGAGGCACGAAGC0.044500.002500.681001.000000.972800.87500


Target Position: 4675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4675CUGGGCAACAGAGAAAACA75.4211428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9874693CTGGGCAACAGAGAAAACATGTTTTCTCTGTTGCCCAG0.661300.063800.577600.500001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CACACUGCGCUGGUUGAAA84.4375527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781251CACACTGCGCTGGTTGAAATTTCAACCAGCGCAGTGTG0.151500.008700.793100.750001.000001.00000


Target Position: 5294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5294AACAUUACAAUUUGUAUUU72.6341808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9255312AACATTACAATTTGTATTTAAATACAAATTGTAATGTT0.468200.024800.646600.500001.000001.00000


Target Position: 5549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5549GUCCUUGCUGUUACUACUC65.38332812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9725567GTCCTTGCTGTTACTACTCGAGTAGTAACAGCAAGGAC0.692300.077800.508600.500001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589UGCCUUAUGUCCAGAUCUU76.00111344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841607TGCCTTATGTCCAGATCTTAAGATCTGGACATAAGGCA0.038900.019400.715500.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413GGGCUGGAAUACUGCUACA93.818279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082431GGGCTGGAATACTGCTACATGTAGCAGTATTCCAGCCC0.742200.002600.784500.750001.000001.00000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264CAGAAAUGGAGAUGAUGAA95.274858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602282CAGAAATGGAGATGATGAATTCATCATCTCCATTTCTG0.118500.113200.612100.750001.000001.00000


Target Position: 3909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3909CAAAAAAGAAAAAAAAGGA81.5971752

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3907-3929AACAAAAAAGAAAAAAAAGGAAAUCCUUUUUUUUCUUUUUUGUUCAAAAAAGAAAAAAAAGGAAAU9.5-5.910


Target Position: 4836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4836CUUCGUUUCUUGUUGGUAU83.3244607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7354854CTTCGTTTCTTGTTGGTATATACCAACAAGAAACGAAG0.069900.054800.594800.750001.000001.00000


Target Position: 5334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5334UGGUGAACAGAACUAGGAA88.8521237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8585352TGGTGAACAGAACTAGGAATTCCTAGTTCTGTTCACCA0.046500.003400.672400.750001.000001.00000


Target Position: 4626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4626UGGGAGGCGGAGGUUGCAG50.05444777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434644TGGGAGGCGGAGGTTGCAGCTGCAACCTCCGCCTCCCA0.028800.005200.560300.500001.000001.00000


Target Position: 3987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3987UAUGUUCUAAACCUAUUUU72.93161761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9744005TATGTTCTAAACCTATTTTAAAATAGGTTTAGAACATA0.082200.055700.543100.500001.000001.00000


Target Position: 27, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
27AGACCAGGCUGUAGGAAGA86.2385386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86045AGACCAGGCTGTAGGAAGATCTTCCTACAGCCTGGTCT0.186500.036900.500000.500000.967400.87500


Target Position: 2262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262CUCAGAAAUGGAGAUGAUG69.76652213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142280CTCAGAAATGGAGATGATGCATCATCTCCATTTCTGAG0.111100.111800.655200.500001.000001.00000


Target Position: 2201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2201CCAAAGUGGCUGUGAAGAU83.1962618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172219CCAAAGTGGCTGTGAAGATATCTTCACAGCCACTTTGG0.183000.020600.663801.000001.000001.00000


Target Position: 3891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3891GUUGCUAUAUAUUAAAAAC80.2859865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503909GTTGCTATATATTAAAAACGTTTTTAATATATAGCAAC0.283200.142700.500000.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534GGUCUGCAAGGAAAGUGAG75.89551359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717552GGTCTGCAAGGAAAGTGAGCTCACTTTCCTTGCAGACC0.223500.026300.543100.750001.000001.00000


Target Position: 5606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5606UCAAAUAAAAGACAGUGAA79.3159955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9195624TCAAATAAAAGACAGTGAATTCACTGTCTTTTATTTGA0.033800.032200.551700.750001.000001.00000


Target Position: 4399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4399AGAGCUACAGUGAUUAAGA89.9369186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9064417AGAGCTACAGTGATTAAGATCTTAATCACTGTAGCTCT0.425600.110600.500000.500001.000001.00000


Target Position: 3175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175CCGUCAGCUGUAACCCUCA85.4419451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053193CCGTCAGCTGTAACCCTCATGAGGGTTACAGCTGACGG0.979000.012700.689700.750000.962000.75000


Target Position: 3912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912AAAAGAAAAAAAAGGAAAA82.1483699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883930AAAAGAAAAAAAAGGAAAATTTTCCTTTTTTTTCTTTT0.742100.806000.500000.500001.000001.00000


Target Position: 3796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3796AUAAAUCUGAGUAUAUAUU79.0822981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383814ATAAATCTGAGTATATATTAATATATACTCAGATTTAT0.063600.026800.534500.500001.000001.00000


Target Position: 5086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5086GCUCAAACUACCACUCCUC73.0681734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7135104GCTCAAACTACCACTCCTCGAGGAGTGGTAGTTTGAGC0.527600.347200.543100.750001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GCGGGUGGGAGUGAGAGAG64.04832997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629177GCGGGTGGGAGTGAGAGAGCTCTCTCACTCCCACCCGC0.093400.035500.612100.750001.000001.00000


Target Position: 3793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3793UGUAUAAAUCUGAGUAUAU86.8934350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673811TGTATAAATCTGAGTATATATATACTCAGATTTATACA0.043100.014900.663800.750001.000001.00000


Target Position: 1150, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150GAAAAGAUGGAAAAGAAAU86.1119389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721168GAAAAGATGGAAAAGAAATATTTCTTTTCCATCTTTTC0.459900.025200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1148-1170CAGAAAAGATGGAAAAGAAATTGAUUUCUUUUCCAUCUUUUCUGGAAAAGAUGGAAAAGAAAUUGU5.55.312


Target Position: 1717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1717GGACUCUCCCAUCACUCUG72.7281795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531735GGACTCTCCCATCACTCTGCAGAGTGATGGGAGAGTCC0.027000.002900.586200.750000.994600.62500


Target Position: 4690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4690AACAAAAAGGAAAACAAAU76.33911304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9414708AACAAAAAGGAAAACAAATATTTGTTTTCCTTTTTGTT0.795300.687300.637900.500001.000001.00000


Target Position: 3639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3639GUGGCUUAUUAAUUCCGAU85.4649448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5803657GTGGCTTATTAATTCCGATATCGGAATTAATAAGCCAC0.673100.015000.612100.750001.000001.00000


Target Position: 3794, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3794GUAUAAAUCUGAGUAUAUA103.4163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573812GTATAAATCTGAGTATATATATATACTCAGATTTATAC0.044700.020800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3792-3814GTGTATAAATCTGAGTATATATTUAUAUACUCAGAUUUAUACACGUAUAAAUCUGAGUAUAUAUUU6.1-8.022


Target Position: 3522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522CCCAUAAGCCCCUCGCACU71.99481899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463540CCCATAAGCCCCTCGCACTAGTGCGAGGGGCTTATGGG0.066700.017000.784500.750000.929300.87500


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903UAAAAACAAAAAAGAAAAA77.43321166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903921TAAAAACAAAAAAGAAAAATTTTTCTTTTTTGTTTTTA0.942800.199100.534500.500001.000001.00000


Target Position: 4786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4786AGUGCAGGAGAACAUGUCA88.0524278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9874804AGTGCAGGAGAACATGTCATGACATGTTCTCCTGCACT0.032600.002000.482800.500000.989100.75000


Target Position: 1704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1704GGGUAACUCUAUCGGACUC76.51181276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181722GGGTAACTCTATCGGACTCGAGTCCGATAGAGTTACCC0.052500.007300.681000.750001.000001.00000


Target Position: 4051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4051UGGGCUGUAUGAAAAGGGU67.72212500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604069TGGGCTGTATGAAAAGGGTACCCTTTTCATACAGCCCA0.078600.002500.491400.500001.000001.00000


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136GCGGAGGCGGAGGAGGGAC53.58434403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847154GCGGAGGCGGAGGAGGGACGTCCCTCCTCCGCCTCCGC0.061200.003600.603400.750001.000001.00000


Target Position: 4541, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4541CUAAAAAUGCAAAAAUUAU84.4173530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5004559CTAAAAATGCAAAAATTATATAATTTTTGCATTTTTAG0.707300.273500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4539-4561TACTAAAAATGCAAAAATTATCCAUAAUUUUUGCAUUUUUAGUACUAAAAAUGCAAAAAUUAUCCU-9.7-9.700


Target Position: 5098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5098ACUCCUCAGUCGCUAUAUU81.1827792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6845116ACTCCTCAGTCGCTATATTAATATAGCGACTGAGGAGT0.079800.052800.698300.750000.994600.62500


Target Position: 1649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649UGCUUCACUUAAGAAAUGU65.53062791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331667TGCTTCACTTAAGAAATGTACATTTCTTAAGTGAAGCA0.148500.058300.646600.500000.962000.62500


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047CUCGGAGGAUGAUGAUGAU87.7361299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181065CTCGGAGGATGATGATGATATCATCATCATCCTCCGAG0.176000.004200.629300.750001.000001.00000


Target Position: 1592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CUUAUGUCCAGAUCUUGAA86.6414365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1590-1612GCCTTATGTCCAGATCTTGAAGAUUCAAGAUCUGGACAUAAGGCCUUAUGUCCAGAUCUUGAAGAU20.416.121


Target Position: 3931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3931UGUUUUUAAAAAGGUCAUA73.95681608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5473949TGTTTTTAAAAAGGTCATATATGACCTTTTTAAAAACA0.212300.017000.663800.750001.000001.00000


Target Position: 5096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5096CCACUCCUCAGUCGCUAUA80.9326816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7645114CCACTCCTCAGTCGCTATATATAGCGACTGAGGAGTGG0.062500.059500.801701.000000.902200.62500


Target Position: 3296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3296CCCCACUCAGCUCACCUCU66.34592687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2063314CCCCACTCAGCTCACCTCTAGAGGTGAGCTGAGTGGGG0.788400.409300.767200.750001.000001.00000


Target Position: 3886, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3886CAUCAGUUGCUAUAUAUUA99.403717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003904CATCAGTTGCTATATATTATAATATATAGCAACTGATG0.353300.004500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3884-3906GGCATCAGTTGCTATATATTAAAUAAUAUAUAGCAACUGAUGCCCAUCAGUUGCUAUAUAUUAAAU-8.619.222


Target Position: 5608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5608AAAUAAAAGACAGUGAAAU77.87681107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9505626AAATAAAAGACAGTGAAATATTTCACTGTCTTTTATTT0.032800.030300.491400.500001.000001.00000


Target Position: 3945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3945UCAUAUAUUUUUUGCUACU74.12761589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7973963TCATATATTTTTTGCTACTAGTAGCAAAAAATATATGA0.096900.063600.517200.500001.000001.00000


Target Position: 4293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4293GCAGAGAGUCAAGGCCCAG69.51072252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9554311GCAGAGAGTCAAGGCCCAGCTGGGCCTTGACTCTCTGC0.026700.018300.569000.750000.972800.75000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879GGUACCAAGAAGAGUGACU79.3651953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631897GGTACCAAGAAGAGTGACTAGTCACTCTTCTTGGTACC0.044000.030800.646600.750001.000001.00000


Target Position: 5546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5546GAUGUCCUUGCUGUUACUA84.8587498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8495564GATGTCCTTGCTGTTACTATAGTAACAGCAAGGACATC0.275600.053900.508600.750001.000001.00000


Target Position: 5605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5605GUCAAAUAAAAGACAGUGA84.1712550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9175623GTCAAATAAAAGACAGTGATCACTGTCTTTTATTTGAC0.033900.032700.594800.500000.934800.62500


Target Position: 5433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5433UGCCUUGGCCCUACCUUGA66.94742619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8165451TGCCTTGGCCCTACCTTGATCAAGGTAGGGCCAAGGCA0.052700.034400.629300.500000.918500.75000


Target Position: 1087, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087GAGAAAGAAACAGAUAACA88.0056281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961105GAGAAAGAAACAGATAACATGTTATCTGTTTCTTTCTC0.852300.745100.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1085-1107AGGAGAAAGAAACAGATAACACCUGUUAUCUGUUUCUUUCUCCUGAGAAAGAAACAGAUAACACCU14.519.121


Target Position: 1147, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147CCAGAAAAGAUGGAAAAGA80.9334815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6021165CCAGAAAAGATGGAAAAGATCTTTTCCATCTTTTCTGG0.101800.038800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1145-1167CCCCAGAAAAGATGGAAAAGAAAUCUUUUCCAUCUUUUCUGGGGCCAGAAAAGAUGGAAAAGAAAU18.712.211


Target Position: 4628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4628GGAGGCGGAGGUUGCAGUG67.74092497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944646GGAGGCGGAGGTTGCAGTGCACTGCAACCTCCGCCTCC0.020900.003500.577600.750001.000001.00000


Target Position: 3916, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3916GAAAAAAAAGGAAAAUGUU85.3662462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663934GAAAAAAAAGGAAAATGTTAACATTTTCCTTTTTTTTC0.072600.053500.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3914-3936AAGAAAAAAAAGGAAAATGTTTTAACAUUUUCCUUUUUUUUCUUGAAAAAAAAGGAAAAUGUUUUU5.3-11.321


Target Position: 3290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3290CCUUCACCCCACUCAGCUC70.6212091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523308CCTTCACCCCACTCAGCTCGAGCTGAGTGGGGTGAAGG0.455900.365300.534500.750000.983700.75000


Target Position: 4180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4180CUGCACCCAGACCUCACGA73.73711646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9354198CTGCACCCAGACCTCACGATCGTGAGGTCTGGGTGCAG0.138700.011800.491400.500000.951100.62500


Target Position: 4826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4826AGGUCCCUGGCUUCGUUUC54.57344297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8414844AGGTCCCTGGCTTCGTTTCGAAACGAAGCCAGGGACCT0.343500.003800.672400.500001.000001.00000


Target Position: 2229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229GGACGCAACAGAGAAAGAC71.59941955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762247GGACGCAACAGAGAAAGACGTCTTTCTCTGTTGCGTCC0.298900.009200.551700.750001.000001.00000


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494CCUGUCGGUUUGGUCUGUU71.94191911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003512CCTGTCGGTTTGGTCTGTTAACAGACCAAACCGACAGG0.180900.022200.698301.000000.972800.75000


Target Position: 4915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4915CAGAUCUUGGCUUCUUACA81.4403772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4913-4935CGCAGATCTTGGCTTCTTACAGTUGUAAGAAGCCAAGAUCUGCGCAGAUCUUGGCUUCUUACAGUU14.619.122


Target Position: 5001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5001UUUUUGGCUGCUUGGAAUU57.76483892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9565019TTTTTGGCTGCTTGGAATTAATTCCAAGCAGCCAAAAA0.127600.005900.491400.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GAGGAUGAUGAUGAUGAUG75.70621391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691069GAGGATGATGATGATGATGCATCATCATCATCATCCTC0.264900.025800.655200.500001.000001.00000


Target Position: 26, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
26GAGACCAGGCUGUAGGAAG74.68741520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76544GAGACCAGGCTGTAGGAAGCTTCCTACAGCCTGGTCTC0.190400.035200.672400.500000.967400.87500


Target Position: 2928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2928GGAAGACCUGGACCGCAUC70.42123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052946GGAAGACCTGGACCGCATCGATGCGGTCCAGGTCTTCC0.036300.006700.689700.750001.000001.00000


Target Position: 4033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4033UGCUGCUUCAUUUAUCUAU73.89131618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954051TGCTGCTTCATTTATCTATATAGATAAATGAAGCAGCA0.061200.001500.810300.750001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237CAGAGAAAGACUUGUCAGA89.5092211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422255CAGAGAAAGACTTGTCAGATCTGACAAGTCTTTCTCTG0.199700.071600.560300.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619GAGUUAAUACCACCGACAA96.060248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161637GAGTTAATACCACCGACAATTGTCGGTGGTATTAACTC0.095600.054100.663800.750001.000001.00000


Target Position: 5009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5009UGCUUGGAAUUUACUUCUG62.47433225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8865027TGCTTGGAATTTACTTCTGCAGAAGTAAATTCCAAGCA0.227000.012400.569000.500001.000001.00000


Target Position: 3993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3993CUAAACCUAUUUUCAGUUU75.15841460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3991-4013TTCTAAACCTATTTTCAGTTTAGAAACUGAAAAUAGGUUUAGAACUAAACCUAUUUUCAGUUUAGU19.218.622


Target Position: 4985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4985UCCGAAUGUUUUUGGUUUU65.30452822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5315003TCCGAATGTTTTTGGTTTTAAAACCAAAAACATTCGGA0.140100.032900.870700.750001.000001.00000


Target Position: 2616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616CAUUCACCACAUCGACUAC78.84771012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982634CATTCACCACATCGACTACGTAGTCGATGTGGTGAATG0.558600.111600.474100.500001.000001.00000


Target Position: 5206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5206AAUUUCUGAGCUAGGGAUU69.16852299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9965224AATTTCTGAGCTAGGGATTAATCCCTAGCTCAGAAATT0.020700.001900.500000.500001.000001.00000


Target Position: 4227, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4227GAAAGUCAGAAAAAGAAGA87.3771322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4225-4247TGGAAAGTCAGAAAAAGAAGATGUCUUCUUUUUCUGACUUUCCAGAAAGUCAGAAAAAGAAGAUGU10.319.222


Target Position: 4683, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4683CAGAGAAAACAAAAAGGAA96.959533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454701CAGAGAAAACAAAAAGGAATTCCTTTTTGTTTTCTCTG0.770700.564800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4681-4703AACAGAGAAAACAAAAAGGAAAAUUCCUUUUUGUUUUCUCUGUUCAGAGAAAACAAAAAGGAAAAU18.719.111


Target Position: 1221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1221GACCCCAAACCCCACACUG66.12722717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461239GACCCCAAACCCCACACTGCAGTGTGGGGTTTGGGGTC0.073900.024800.534500.500001.000001.00000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923CCUCUAACUGCAGAACUGG64.18352979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
987941CCTCTAACTGCAGAACTGGCCAGTTCTGCAGTTAGAGG0.021500.002100.500000.500000.945700.62500


Target Position: 5622, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5622GAAAUUGACCUGAAAAAAA94.974162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5245640GAAATTGACCTGAAAAAAATTTTTTTCAGGTCAATTTC0.876200.584100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5620-5642GTGAAATTGACCTGAAAAAAAAAUUUUUUUCAGGUCAAUUUCACGAAAUUGACCUGAAAAAAAAAU0.77.412


Target Position: 5609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5609AAUAAAAGACAGUGAAAUU85.476445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9445627AATAAAAGACAGTGAAATTAATTTCACTGTCTTTTATT0.036600.029600.500000.500001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098AGAUAACACCAAACCAAAC73.47681684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921116AGATAACACCAAACCAAACGTTTGGTTTGGTGTTATCT0.746700.671200.577600.500001.000001.00000


Target Position: 2853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2853CAACGAGCUGUACAUGAUG77.75231127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372871CAACGAGCTGTACATGATGCATCATGTACAGCTCGTTG0.094800.016400.491400.500001.000001.00000


Target Position: 2291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2291GGAAGCAUAAGAAUAUCAU89.7056196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2422309GGAAGCATAAGAATATCATATGATATTCTTATGCTTCC0.333700.215400.715501.000001.000001.00000


Target Position: 3376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3376CACUUCAUCCCCUCCCAGA80.1048882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613394CACTTCATCCCCTCCCAGATCTGGGAGGGGATGAAGTG0.107100.063700.569000.500000.983700.62500


Target Position: 4670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4670CCAGCCUGGGCAACAGAGA73.74831643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7044688CCAGCCTGGGCAACAGAGATCTCTGTTGCCCAGGCTGG0.175300.008000.620700.750000.934800.75000


Target Position: 4032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4032CUGCUGCUUCAUUUAUCUA90.1997175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9404050CTGCTGCTTCATTTATCTATAGATAAATGAAGCAGCAG0.060700.002100.612100.750001.000001.00000


Target Position: 5247, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5247GACUAUUGUAAAAUUCUCU85.861413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7155265GACTATTGTAAAATTCTCTAGAGAATTTTACAATAGTC0.739500.237400.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5245-5267GCGACTATTGTAAAATTCTCTTTAGAGAAUUUUACAAUAGUCGCGACUAUUGUAAAAUUCUCUUUU14.811.632


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237CUGCGCUGGUUGAAAAAUG67.08062601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131255CTGCGCTGGTTGAAAAATGCATTTTTCAACCAGCGCAG0.199700.007800.629300.500001.000001.00000


Target Position: 5442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5442CCUACCUUGAAGCAAUGUU73.69741654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6405460CCTACCTTGAAGCAATGTTAACATTGCTTCAAGGTAGG0.090200.015800.698301.000000.951100.62500


Target Position: 4886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4886UGACCAGACUGUAUUUGUU83.9303568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6744904TGACCAGACTGTATTTGTTAACAAATACAGTCTGGTCA0.276400.008800.577600.750001.000001.00000


Target Position: 2828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2828GCAUGGACAAGCCCAGUAA91.9584115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852846GCATGGACAAGCCCAGTAATTACTGGGCTTGTCCATGC0.021700.004400.819001.000000.902200.87500


Target Position: 2188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188CCCAACCGUGUGACCAAAG61.34243382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702206CCCAACCGTGTGACCAAAGCTTTGGTCACACGGTTGGG0.042100.011500.853400.750001.000001.00000


Target Position: 5265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5265UUUGUUUCUCUCUGUAAAU70.14762164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9535283TTTGTTTCTCTCTGTAAATATTTACAGAGAGAAACAAA0.087700.066100.491400.500001.000001.00000


Target Position: 2792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792UGGAGGAACUUUUCAAGCU72.15641880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362810TGGAGGAACTTTTCAAGCTAGCTTGAAAAGTTCCTCCA0.036200.002900.491400.500001.000001.00000


Target Position: 5150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5150CAAAAGAAAGUUCAAUAUG73.96431607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9445168CAAAAGAAAGTTCAATATGCATATTGAACTTTCTTTTG0.525200.247000.491400.500001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GGACAAACCCAACCGUGUG74.23191580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272199GGACAAACCCAACCGTGTGCACACGGTTGGGTTTGTCC0.038600.002300.577600.750001.000001.00000


Target Position: 5409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5409UUGUAAAACAGUGAUGAUA77.32051185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8325427TTGTAAAACAGTGATGATATATCATCACTGTTTTACAA0.080600.011400.603400.500001.000001.00000


Target Position: 5621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5621UGAAAUUGACCUGAAAAAA79.6233929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1685639TGAAATTGACCTGAAAAAATTTTTTCAGGTCAATTTCA0.863500.571000.724100.750001.000001.00000


Target Position: 3821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3821UCUUUUUAAAAGGGUCGUU59.23493680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9743839TCTTTTTAAAAGGGTCGTTAACGACCCTTTTAAAAAGA0.023000.010900.577600.750001.000001.00000


Target Position: 2838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2838GCCCAGUAACUGCACCAAC69.78052211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142856GCCCAGTAACTGCACCAACGTTGGTGCAGTTACTGGGC0.095600.030400.853400.750000.934800.62500


Target Position: 5550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5550UCCUUGCUGUUACUACUCA77.30671191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9945568TCCTTGCTGTTACTACTCATGAGTAGTAACAGCAAGGA0.704000.088700.646600.500001.000001.00000


Target Position: 5101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5101CCUCAGUCGCUAUAUUAAA92.4888103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5985119CCTCAGTCGCTATATTAAATTTAATATAGCGACTGAGG0.103500.034300.844801.000001.000001.00000


Target Position: 2233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233GCAACAGAGAAAGACUUGU75.13021463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322251GCAACAGAGAAAGACTTGTACAAGTCTTTCTCTGTTGC0.130800.046500.646600.750001.000001.00000


Target Position: 3301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301CUCAGCUCACCUCUCCCUC58.27713826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683319CTCAGCTCACCTCTCCCTCGAGGGAGAGGTGAGCTGAG0.691600.403700.500000.500001.000001.00000


Target Position: 5435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5435CCUUGGCCCUACCUUGAAG69.75952215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9245453CCTTGGCCCTACCTTGAAGCTTCAAGGTAGGGCCAAGG0.032800.023400.706900.750000.923901.00000


Target Position: 4719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4719UGCAGAAACUGAAACCCAG70.41452122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9224737TGCAGAAACTGAAACCCAGCTGGGTTTCAGTTTCTGCA0.146900.002900.569000.500000.967400.62500


Target Position: 3492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3492CUCCUGUCGGUUUGGUCUG57.7933887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493510CTCCTGTCGGTTTGGTCTGCAGACCAAACCGACAGGAG0.150000.019700.525900.500000.940200.75000


Target Position: 3762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3762CUCUGUAUAUAGCUAUGAA102.5064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393780CTCTGTATATAGCTATGAATTCATAGCTATATACAGAG0.186400.101300.637900.750001.000001.00000


Target Position: 4393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4393CGGGGUAGAGCUACAGUGA87.8549292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5444411CGGGGTAGAGCTACAGTGATCACTGTAGCTCTACCCCG0.214900.035300.689700.750001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246UUGAAAAAUGGCAAAGAAU70.31872136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371264TTGAAAAATGGCAAAGAATATTCTTTGCCATTTTTCAA0.108200.061900.637900.500001.000001.00000


Target Position: 3797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3797UAAAUCUGAGUAUAUAUUU76.36831299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7253815TAAATCTGAGTATATATTTAAATATATACTCAGATTTA0.155400.025000.534500.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137CGGAGGCGGAGGAGGGACC52.51614512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814155CGGAGGCGGAGGAGGGACCGGTCCCTCCTCCGCCTCCG0.055900.004200.560300.500000.940200.75000


Target Position: 5237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5237CAGUGUUGGCGACUAUUGU81.7623737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7935255CAGTGTTGGCGACTATTGTACAATAGTCGCCAACACTG0.084700.004800.577600.500001.000001.00000


Target Position: 5322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5322GAAGGCAUCAUUUGGUGAA87.9018288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9695340GAAGGCATCATTTGGTGAATTCACCAAATGATGCCTTC0.023700.002000.500000.750001.000001.00000


Target Position: 5149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5149ACAAAAGAAAGUUCAAUAU78.83841015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3415167ACAAAAGAAAGTTCAATATATATTGAACTTTCTTTTGT0.566900.284800.663800.750001.000001.00000


Target Position: 4012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4012AGGUCCCUCAAUAAAAAUU73.61071662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5114030AGGTCCCTCAATAAAAATTAATTTTTATTGAGGGACCT0.323400.157200.836200.750001.000001.00000


Target Position: 4627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4627GGGAGGCGGAGGUUGCAGU72.69611798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9864645GGGAGGCGGAGGTTGCAGTACTGCAACCTCCGCCTCCC0.021700.004300.784500.750001.000001.00000


Target Position: 5108, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5108CGCUAUAUUAAAGCUUAUA89.8506190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9705126CGCTATATTAAAGCTTATATATAAGCTTTAATATAGCG0.023700.013700.879301.000000.902200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5106-5128GTCGCTATATTAAAGCTTATATTUAUAAGCUUUAAUAUAGCGACCGCUAUAUUAAAGCUUAUAUUU18.314.832


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824GGCCUUCCUCAUCUCCUGC61.4483370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711842GGCCTTCCTCATCTCCTGCGCAGGAGATGAGGAAGGCC0.061700.057000.646600.500001.000001.00000


Target Position: 4005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4005UCAGUUUAGGUCCCUCAAU68.54562397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4174023TCAGTTTAGGTCCCTCAATATTGAGGGACCTAAACTGA0.378500.033100.715500.750001.000001.00000


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813UUUACAUGUCUUUUUAAAA80.4388855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483831TTTACATGTCTTTTTAAAATTTTAAAAAGACATGTAAA0.263300.093500.500000.500001.000001.00000


Target Position: 4689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4689AAACAAAAAGGAAAACAAA88.8111241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8714707AAACAAAAAGGAAAACAAATTTGTTTTCCTTTTTGTTT0.796200.681000.500000.500001.000001.00000


Target Position: 5238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5238AGUGUUGGCGACUAUUGUA90.75151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7735256AGTGTTGGCGACTATTGTATACAATAGTCGCCAACACT0.209400.006400.525900.750001.000001.00000


Target Position: 4825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4825CAGGUCCCUGGCUUCGUUU71.9591903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854843CAGGTCCCTGGCTTCGTTTAAACGAAGCCAGGGACCTG0.088100.001600.784500.750000.978300.62500


Target Position: 1097, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097CAGAUAACACCAAACCAAA95.774551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3711115CAGATAACACCAAACCAAATTTGGTTTGGTGTTATCTG0.794800.721700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1095-1117AACAGATAACACCAAACCAAACCUUUGGUUUGGUGUUAUCUGUUCAGAUAACACCAAACCAAACCU18.814.522


Target Position: 4882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4882CAUGUGACCAGACUGUAUU83.7351580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344900CATGTGACCAGACTGTATTAATACAGTCTGGTCACATG0.049000.008800.646600.750001.000001.00000


Target Position: 2290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2290GGGAAGCAUAAGAAUAUCA93.350386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272308GGGAAGCATAAGAATATCATGATATTCTTATGCTTCCC0.315500.219500.767200.750001.000001.00000


Target Position: 2601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2601UGGCCUCGCACGGGACAUU61.85113314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932619TGGCCTCGCACGGGACATTAATGTCCCGTGCGAGGCCA0.052100.001500.836200.750000.951100.87500


Target Position: 5567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5567CAAAUCACCCACAAAUUUC70.7432070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9975585CAAATCACCCACAAATTTCGAAATTTGTGGGTGATTTG0.896000.795700.474100.500001.000001.00000


Target Position: 3781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3781GAAAACACAAAGUGUAUAA93.782381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3779-3801AAGAAAACACAAAGTGTATAAATUUAUACACUUUGUGUUUUCUUGAAAACACAAAGUGUAUAAAUU15.813.322


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284GGCCUGCCUUCACCCCACU70.61052096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713302GGCCTGCCTTCACCCCACTAGTGGGGTGAAGGCAGGCC0.540100.087000.793100.750000.923900.62500


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147GCCACCCACACGCCCUCCC45.07495169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163165GCCACCCACACGCCCTCCCGGGAGGGCGTGTGGGTGGC0.774400.683300.508600.500001.000001.00000


Target Position: 5446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5446CCUUGAAGCAAUGUUGUGU74.65681529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7825464CCTTGAAGCAATGTTGTGTACACAACATTGCTTCAAGG0.059900.009700.637900.750001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221UGUCCGUCCCUGUCCCCUU67.31792568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6193239TGTCCGTCCCTGTCCCCTTAAGGGGACAGGGACGGACA0.120700.051400.569000.750000.994600.87500


Target Position: 5290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5290UGCUAACAUUACAAUUUGU77.28271193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8285308TGCTAACATTACAATTTGTACAAATTGTAATGTTAGCA0.073300.005900.646600.500001.000001.00000


Target Position: 5133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5133UGGAUUACUGCUAAAUACA81.6838744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515151TGGATTACTGCTAAATACATGTATTTAGCAGTAATCCA0.412400.114700.637900.500001.000001.00000


Target Position: 1086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1086GGAGAAAGAAACAGAUAAC83.0027637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281104GGAGAAAGAAACAGATAACGTTATCTGTTTCTTTCTCC0.836000.199500.724100.750001.000001.00000


Target Position: 3946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3946CAUAUAUUUUUUGCUACUU81.1009802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7993964CATATATTTTTTGCTACTTAAGTAGCAAAAAATATATG0.115300.063600.517200.750001.000001.00000


Target Position: 4671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4671CAGCCUGGGCAACAGAGAA89.5147210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7004689CAGCCTGGGCAACAGAGAATTCTCTGTTGCCCAGGCTG0.212300.008100.612100.750000.934800.75000


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116CCGUAUGCCCGUAGCUCCA78.92171002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981134CCGTATGCCCGTAGCTCCATGGAGCTACGGGCATACGG0.056500.027700.569000.750000.940201.00000


Target Position: 5552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5552CUUGCUGUUACUACUCAAA87.4239315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4965570CTTGCTGTTACTACTCAAATTTGAGTAGTAACAGCAAG0.705000.126800.637900.750001.000001.00000


Target Position: 5443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5443CUACCUUGAAGCAAUGUUG71.40561981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8775461CTACCTTGAAGCAATGTTGCAACATTGCTTCAAGGTAG0.090300.008800.525900.500000.962000.62500


Target Position: 4015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4015UCCCUCAAUAAAAAUUGCU58.6613768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8434033TCCCTCAATAAAAATTGCTAGCAATTTTTATTGAGGGA0.095000.070900.517200.500000.962000.75000


Target Position: 4031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4031GCUGCUGCUUCAUUUAUCU84.0249560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9204049GCTGCTGCTTCATTTATCTAGATAAATGAAGCAGCAGC0.039400.002500.629300.750001.000001.00000


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529GUGCAUACACCGAGACCUG73.84961625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132547GTGCATACACCGAGACCTGCAGGTCTCGGTGTATGCAC0.070400.013600.508600.500001.000001.00000


Target Position: 5097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5097CACUCCUCAGUCGCUAUAU79.1711973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7035115CACTCCTCAGTCGCTATATATATAGCGACTGAGGAGTG0.075600.056200.750000.750000.951100.62500


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149AGAAAAGAUGGAAAAGAAA89.5907202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571167AGAAAAGATGGAAAAGAAATTTCTTTTCCATCTTTTCT0.292100.027600.724100.750001.000001.00000


Target Position: 5109, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5109GCUAUAUUAAAGCUUAUAU89.5584206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9905127GCTATATTAAAGCTTATATATATAAGCTTTAATATAGC0.021100.012700.810301.000000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5107-5129TCGCTATATTAAAGCTTATATTTAUAUAAGCUUUAAUAUAGCGAGCUAUAUUAAAGCUUAUAUUUU14.9-2.732


Target Position: 3958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3958GCUACUUUUGCUGUUUUAU78.03321096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2043976GCTACTTTTGCTGTTTTATATAAAACAGCAAAAGTAGC0.488900.108500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3956-3978TTGCTACTTTTGCTGTTTTATTTAUAAAACAGCAAAAGUAGCAAGCUACUUUUGCUGUUUUAUUUU7.29.822


Target Position: 2228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228CGGACGCAACAGAGAAAGA87.6161302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302246CGGACGCAACAGAGAAAGATCTTTCTCTGTTGCGTCCG0.220300.007200.689700.750001.000001.00000


Target Position: 3938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3938AAAAAGGUCAUAUAUUUUU75.6281405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903956AAAAAGGTCATATATTTTTAAAAATATATGACCTTTTT0.427400.111700.500000.500001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235CACUGCGCUGGUUGAAAAA85.0976485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091253CACTGCGCTGGTTGAAAAATTTTTCAACCAGCGCAGTG0.289800.007900.793100.750001.000001.00000


Target Position: 1651, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651CUUCACUUAAGAAAUGUCU71.51991964

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1649-1671TGCTTCACTTAAGAAATGTCTCCAGACAUUUCUUAAGUGAAGCACUUCACUUAAGAAAUGUCUCCU14.819.222


Target Position: 4691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4691ACAAAAAGGAAAACAAAUG64.38282947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6754709ACAAAAAGGAAAACAAATGCATTTGTTTTCCTTTTTGT0.466900.468400.551700.500001.000001.00000


Target Position: 3509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3509UGUUUUGCCUUCACCCAUA81.9612722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853527TGTTTTGCCTTCACCCATATATGGGTGAAGGCAAAACA0.038900.008100.663800.750001.000001.00000


Target Position: 3890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3890AGUUGCUAUAUAUUAAAAA89.9058188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923908AGTTGCTATATATTAAAAATTTTTAATATATAGCAACT0.298700.137600.706900.750001.000001.00000


Target Position: 4870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4870CCUUCCUGUAUCCAUGUGA79.6158931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5794888CCTTCCTGTATCCATGTGATCACATGGATACAGGAAGG0.112500.063900.620700.750001.000001.00000


Target Position: 2207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2207UGGCUGUGAAGAUGUUGAA82.2428692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772225TGGCTGTGAAGATGTTGAATTCAACATCTTCACAGCCA0.150600.015300.672400.750001.000001.00000


Target Position: 5407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5407CCUUGUAAAACAGUGAUGA81.9447724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7025425CCTTGTAAAACAGTGATGATCATCACTGTTTTACAAGG0.076000.008500.620700.750001.000001.00000


Target Position: 1716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1716CGGACUCUCCCAUCACUCU82.0641707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031734CGGACTCTCCCATCACTCTAGAGTGATGGGAGAGTCCG0.071600.004400.689700.750000.923900.62500


Target Position: 3367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367GCUGCCAGCCACUUCAUCC67.41922554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773385GCTGCCAGCCACTTCATCCGGATGAAGTGGCTGGCAGC0.200400.061200.482800.500001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155GAUGGAAAAGAAAUUGCAU89.4257214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621173GATGGAAAAGAAATTGCATATGCAATTTCTTTTCCATC0.212500.016200.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1153-1175AAGATGGAAAAGAAATTGCATGCAUGCAAUUUCUUUUCCAUCUUGAUGGAAAAGAAAUUGCAUGCU20.020.122


Target Position: 5292, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5292CUAACAUUACAAUUUGUAU88.5633252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5445310CTAACATTACAATTTGTATATACAAATTGTAATGTTAG0.509100.017300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5290-5312TGCTAACATTACAATTTGTATTTAUACAAAUUGUAAUGUUAGCACUAACAUUACAAUUUGUAUUUU6.96.921


Target Position: 4389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4389GCCACGGGGUAGAGCUACA85.4333452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5754407GCCACGGGGTAGAGCTACATGTAGCTCTACCCCGTGGC0.113100.023600.793100.750000.978300.62500


Target Position: 5574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5574CCCACAAAUUUCCCCAAAG67.67232510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1255592CCCACAAATTTCCCCAAAGCTTTGGGGAAATTTGTGGG0.556700.527200.853400.750001.000001.00000


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281AAGAUGAUCGGGAAGCAUA86.9558347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702299AAGATGATCGGGAAGCATATATGCTTCCCGATCATCTT0.343000.015700.594800.500001.000001.00000


Target Position: 4512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4512CUGGCCAACUUAGUGAAAC61.82233321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954530CTGGCCAACTTAGTGAAACGTTTCACTAAGTTGGCCAG0.148300.002500.637900.500001.000001.00000


Target Position: 5469, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5469GGAUGAAGAAUCUAAAAGU92.0949114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5975487GGATGAAGAATCTAAAAGTACTTTTAGATTCTTCATCC0.105100.014300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5467-5489AGGGATGAAGAATCTAAAAGTCTACUUUUAGAUUCUUCAUCCCUGGAUGAAGAAUCUAAAAGUCUU1.320.423


Target Position: 5111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5111UAUAUUAAAGCUUAUAUUU78.17981081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8975129TATATTAAAGCTTATATTTAAATATAAGCTTTAATATA0.298300.013300.543100.500001.000001.00000


Target Position: 3943, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3943GGUCAUAUAUUUUUUGCUA98.77223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5273961GGTCATATATTTTTTGCTATAGCAAAAAATATATGACC0.132300.100700.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3941-3963AAGGTCATATATTTTTTGCTACTUAGCAAAAAAUAUAUGACCUUGGUCAUAUAUUUUUUGCUACUU18.616.022


Target Position: 2582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582UGAUGAAGAUAGCAGACUU89.1871224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332600TGATGAAGATAGCAGACTTAAGTCTGCTATCTTCATCA0.070100.021100.586200.750001.000001.00000


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213CCACCACCUGUCCGUCCCU70.10722170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9293231CCACCACCTGTCCGTCCCTAGGGACGGACAGGTGGTGG0.125400.103800.500000.750001.000001.00000


Target Position: 4395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4395GGGUAGAGCUACAGUGAUU94.872765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3134413GGGTAGAGCTACAGTGATTAATCACTGTAGCTCTACCC0.439000.054600.982801.000001.000001.00000


Target Position: 3939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3939AAAAGGUCAUAUAUUUUUU81.9879717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123957AAAAGGTCATATATTTTTTAAAAAATATATGACCTTTT0.296200.110400.500000.500001.000001.00000


Target Position: 2202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2202CAAAGUGGCUGUGAAGAUG74.99431479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592220CAAAGTGGCTGTGAAGATGCATCTTCACAGCCACTTTG0.153000.021900.491400.500001.000001.00000


Target Position: 4976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4976GGAAAAUUCUCCGAAUGUU85.8484415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4974-4996GGGGAAAATTCTCCGAATGTTTTAACAUUCGGAGAAUUUUCCCCGGAAAAUUCUCCGAAUGUUUUU21.10.423


Target Position: 3366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366UGCUGCCAGCCACUUCAUC56.29414087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7533384TGCTGCCAGCCACTTCATCGATGAAGTGGCTGGCAGCA0.206800.067200.672400.500000.945700.62500


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590GCCUUAUGUCCAGAUCUUG72.83971777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891608GCCTTATGTCCAGATCTTGCAAGATCTGGACATAAGGC0.038500.013300.853400.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571AGAGGACAAUGUGAUGAAG75.87981362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302589AGAGGACAATGTGATGAAGCTTCATCACATTGTCCTCT0.112600.007400.586200.500001.000001.00000


Target Position: 5542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5542CAGUGAUGUCCUUGCUGUU89.4536212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9285560CAGTGATGTCCTTGCTGTTAACAGCAAGGACATCACTG0.083600.002300.637900.750001.000001.00000


Target Position: 2793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2793GGAGGAACUUUUCAAGCUG78.86621010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9752811GGAGGAACTTTTCAAGCTGCAGCTTGAAAAGTTCCTCC0.023000.002000.586200.750000.983700.62500


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160CCUCCCCAGACUCCACCGU57.83983878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503178CCTCCCCAGACTCCACCGTACGGTGGAGTCTGGGGAGG0.065600.036400.569000.750000.929300.62500


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343CUGACAAGGGCAACUACAC70.13332168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521361CTGACAAGGGCAACTACACGTGTAGTTGCCCTTGTCAG0.063500.003200.491400.500001.000001.00000


Target Position: 3936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936UUAAAAAGGUCAUAUAUUU77.31961187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073954TTAAAAAGGTCATATATTTAAATATATGACCTTTTTAA0.279400.050100.534500.500001.000001.00000


Target Position: 4526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4526GAAACCCCAUCUCUACUAA93.824278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5154544GAAACCCCATCTCTACTAATTAGTAGAGATGGGGTTTC0.229700.092700.637900.750001.000001.00000


Target Position: 3635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635GCCAGUGGCUUAUUAAUUC73.7851638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503653GCCAGTGGCTTATTAATTCGAATTAATAAGCCACTGGC0.308100.006400.827600.750000.918500.62500


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CCCGGUCUGCAAGGAAAGU62.79863173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
893549CCCGGTCTGCAAGGAAAGTACTTTCCTTGCAGACCGGG0.245000.002700.784500.750000.994600.62500


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GCCACACUCUGCACCGCUA91.7223124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791006GCCACACTCTGCACCGCTATAGCGGTGCAGAGTGTGGC0.022400.017700.827601.000000.972800.62500


Target Position: 3961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3961ACUUUUGCUGUUUUAUUUU71.82911925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2113979ACTTTTGCTGTTTTATTTTAAAATAAAACAGCAAAAGT0.503100.127300.706900.750001.000001.00000


Target Position: 1236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236ACUGCGCUGGUUGAAAAAU66.81722628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411254ACTGCGCTGGTTGAAAAATATTTTTCAACCAGCGCAGT0.246600.006800.698300.750001.000001.00000


Target Position: 4184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4184ACCCAGACCUCACGACGCA76.63881259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9654202ACCCAGACCTCACGACGCATGCGTCGTGAGGTCTGGGT0.252300.053300.500000.500001.000001.00000


Target Position: 5112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5112AUAUUAAAGCUUAUAUUUU81.2806783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7705130ATATTAAAGCTTATATTTTAAAATATAAGCTTTAATAT0.288000.011300.543100.500001.000001.00000


Target Position: 5010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5010GCUUGGAAUUUACUUCUGC68.93352330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8925028GCTTGGAATTTACTTCTGCGCAGAAGTAAATTCCAAGC0.118000.012600.500000.500001.000001.00000


Target Position: 5553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5553UUGCUGUUACUACUCAAAU69.82062203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8265571TTGCTGTTACTACTCAAATATTTGAGTAGTAACAGCAA0.745000.225000.637900.500001.000001.00000


Target Position: 3970, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3970GUUUUAUUUUUUUAAAUUA92.1095113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5353988GTTTTATTTTTTTAAATTATAATTTAAAAAAATAAAAC0.476100.390700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3968-3990CTGTTTTATTTTTTTAAATTATGUAAUUUAAAAAAAUAAAACAGGUUUUAUUUUUUUAAAUUAUGU-9.7-9.710


Target Position: 4190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4190ACCUCACGACGCACCUCCU72.98861752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8294208ACCTCACGACGCACCTCCTAGGAGGTGCGTCGTGAGGT0.050300.013000.508600.500001.000001.00000


Target Position: 3311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3311CUCUCCCUCCACCUCCUCU68.71352364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663329CTCTCCCTCCACCTCCTCTAGAGGAGGTGGAGGGAGAG0.273500.237900.586200.500001.000001.00000


Target Position: 5564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5564ACUCAAAUCACCCACAAAU78.3131072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2915582ACTCAAATCACCCACAAATATTTGTGGGTGATTTGAGT0.932000.750700.698300.750001.000001.00000


Target Position: 5037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5037GGUCAUCACUGUCCUCACU86.8505352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6325055GGTCATCACTGTCCTCACTAGTGAGGACAGTGATGACC0.600800.011500.646600.750000.978300.62500


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295GCAUAAGAAUAUCAUCAAC83.7328581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602313GCATAAGAATATCATCAACGTTGATGATATTCTTATGC0.169700.124700.706900.750001.000001.00000


Target Position: 5467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5467AGGGAUGAAGAAUCUAAAA88.8294240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4975485AGGGATGAAGAATCTAAAATTTTAGATTCTTCATCCCT0.602000.022900.844800.750001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158CGCGGGUGGGAGUGAGAGA81.5729758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601176CGCGGGTGGGAGTGAGAGATCTCTCACTCCCACCCGCG0.102400.042500.698300.750001.000001.00000


Target Position: 4046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046AUCUAUGGGCUGUAUGAAA85.6043429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9434064ATCTATGGGCTGTATGAAATTTCATACAGCCCATAGAT0.374500.050500.681000.500001.000001.00000


Target Position: 5085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5085GGCUCAAACUACCACUCCU89.2344221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3635103GGCTCAAACTACCACTCCTAGGAGTGGTAGTTTGAGCC0.534800.297700.655200.750000.983700.62500


Target Position: 2168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168UCGGGCUGGACAAGGACAA66.34792686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122186TCGGGCTGGACAAGGACAATTGTCCTTGTCCAGCCCGA0.294200.007900.646600.750001.000001.00000


Target Position: 3925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925GGAAAAUGUUUUUAAAAAG80.9204817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7683943GGAAAATGTTTTTAAAAAGCTTTTTAAAAACATTTTCC0.147100.005800.732800.750001.000001.00000


Target Position: 4977, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4977GAAAAUUCUCCGAAUGUUU84.3404537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7324995GAAAATTCTCCGAATGTTTAAACATTCGGAGAATTTTC0.110700.007100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4975-4997GGGAAAATTCTCCGAATGTTTTTAAACAUUCGGAGAAUUUUCCCGAAAAUUCUCCGAAUGUUUUUU14.80.432


Target Position: 3495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495CUGUCGGUUUGGUCUGUUU81.2233789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4793513CTGTCGGTTTGGTCTGTTTAAACAGACCAAACCGACAG0.200300.024300.784500.750001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GGUUGAAAAAUGGCAAAGA85.1617481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861262GGTTGAAAAATGGCAAAGATCTTTGCCATTTTTCAACC0.218700.062500.629300.750001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915GUGCACAAGCUGGCCAAGA73.02011745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101933GTGCACAAGCTGGCCAAGATCTTGGCCAGCTTGTGCAC0.034900.012300.569000.500000.923900.75000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013CCCCGACCUUGCCUGAACA81.9578723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991031CCCCGACCTTGCCTGAACATGTTCAGGCAAGGTCGGGG0.019400.002400.784500.750000.994600.62500


Target Position: 2896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896CCCUCACAGAGACCCACCU70.51892109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242914CCCTCACAGAGACCCACCTAGGTGGGTCTCTGTGAGGG0.095300.011700.646600.750000.951100.62500


Target Position: 5159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5159GUUCAAUAUGUUUUCAUUU82.9384639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5157-5179AAGTTCAATATGTTTTCATTTCTAAAUGAAAACAUAUUGAACUUGUUCAAUAUGUUUUCAUUUCUU7.48.922


Target Position: 5129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5129UUGCUGGAUUACUGCUAAA80.4001858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7455147TTGCTGGATTACTGCTAAATTTAGCAGTAATCCAGCAA0.213300.008300.646600.500001.000001.00000


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673GAUGGCACCCGAGGCAUUA81.8808729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472691GATGGCACCCGAGGCATTATAATGCCTCGGGTGCCATC0.028000.002500.646600.750000.962001.00000


Target Position: 3362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3362UCUUUGCUGCCAGCCACUU59.3173672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593380TCTTTGCTGCCAGCCACTTAAGTGGCTGGCAGCAAAGA0.266800.001900.586200.750000.945701.00000


Target Position: 4530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4530CCCCAUCUCUACUAAAAAU88.1393269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3184548CCCCATCTCTACTAAAAATATTTTTAGTAGAGATGGGG0.258900.135000.982801.000001.000001.00000


Target Position: 4723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4723GAAACUGAAACCCAGACAU84.2064544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874741GAAACTGAAACCCAGACATATGTCTGGGTTTCAGTTTC0.076700.002800.517200.750000.962001.00000


Target Position: 1275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1275CCACAGAAUUGGAGGCUAC75.44581426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961293CCACAGAATTGGAGGCTACGTAGCCTCCAATTCTGTGG0.076700.011000.663800.750000.978300.62500


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GCAAAGAAUUCAAACCUGA89.0145228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121274GCAAAGAATTCAAACCTGATCAGGTTTGAATTCTTTGC0.034300.008300.629300.750001.000001.00000


Target Position: 4186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4186CCAGACCUCACGACGCACC57.28943959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394204CCAGACCTCACGACGCACCGGTGCGTCGTGAGGTCTGG0.245300.049000.491400.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859UCGUCUACAAGAUGAAGAG66.96422616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921877TCGTCTACAAGATGAAGAGCTCTTCATCTTGTAGACGA0.060600.002300.482800.500001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579GGGGCACAAGGUCUGGAGA82.2457690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
895597GGGGCACAAGGTCTGGAGATCTCCAGACCTTGTGCCCC0.037200.018000.767200.750001.000001.00000


Target Position: 3894, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3894GCUAUAUAUUAAAAACAAA100.76513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2923912GCTATATATTAAAAACAAATTTGTTTTTAATATATAGC0.280700.252900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3892-3914TTGCTATATATTAAAAACAAAAAUUUGUUUUUAAUAUAUAGCAAGCUAUAUAUUAAAAACAAAAAU5.6-0.822


Target Position: 4913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4913CGCAGAUCUUGGCUUCUUA96.266644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9684931CGCAGATCTTGGCTTCTTATAAGAAGCCAAGATCTGCG0.036600.001900.887901.000000.994600.75000


Target Position: 5244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5244GGCGACUAUUGUAAAAUUC73.16911723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3455262GGCGACTATTGTAAAATTCGAATTTTACAATAGTCGCC0.323800.047500.827600.750001.000001.00000


Target Position: 5596, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5596GCGCUAGCUGUCAAAUAAA93.958375

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10559619GCGCTAGCTGTCAAATAAA1/1/0/094.96FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38268676..38268694(-)00FGFR1(0.002)


Target Position: 5630, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5630CCUGAAAAAAAAAAAAAAA85.9632405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475648CCTGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCAGG0.986100.863900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5628-5650GACCTGAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUCAGGUCCCUGAAAAAAAAAAAAAAAAAU-11.312.200


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307CCACCUGGAGCAUCAUAAU85.0636487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751325CCACCTGGAGCATCATAATATTATGATGCTCCAGGTGG0.085900.001800.836201.000001.000001.00000


Target Position: 4849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4849UGGUAUGCCUCCCCAGAUC60.2643537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844867TGGTATGCCTCCCCAGATCGATCTGGGGAGGCATACCA0.176600.011200.663800.500000.907600.75000


Target Position: 5561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5561ACUACUCAAAUCACCCACA79.8306913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9595579ACTACTCAAATCACCCACATGTGGGTGATTTGAGTAGT0.861700.702000.500000.500001.000001.00000


Target Position: 5623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5623AAAUUGACCUGAAAAAAAA90.5157160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8615641AAATTGACCTGAAAAAAAATTTTTTTTCAGGTCAATTT0.954700.586600.500000.500001.000001.00000


Target Position: 2208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208GGCUGUGAAGAUGUUGAAG74.6151535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412226GGCTGTGAAGATGTTGAAGCTTCAACATCTTCACAGCC0.029300.009300.862100.750001.000001.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575GACAAUGUGAUGAAGAUAG78.08881090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5562593GACAATGTGATGAAGATAGCTATCTTCATCACATTGTC0.208500.022900.646600.500001.000001.00000


Target Position: 5527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5527GCACUAUCAUAAUUACAGU90.3991166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5525-5547AGGCACTATCATAATTACAGTGAACUGUAAUUAUGAUAGUGCCUGCACUAUCAUAAUUACAGUGAU11.620.322


Target Position: 4727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4727CUGAAACCCAGACAUGUGU70.32242135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9684745CTGAAACCCAGACATGTGTACACATGTCTGGGTTTCAG0.023900.002100.577600.500000.994600.62500


Target Position: 4016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4016CCCUCAAUAAAAAUUGCUG69.41042264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7494034CCCTCAATAAAAATTGCTGCAGCAATTTTTATTGAGGG0.066100.052100.706900.750000.923900.62500


Target Position: 5191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5191GGGAUUGCUGCUUUAAAUU80.9361814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6835209GGGATTGCTGCTTTAAATTAATTTAAAGCAGCAATCCC0.088800.008600.982801.000001.000001.00000


Target Position: 3822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3822CUUUUUAAAAGGGUCGUUA78.58051038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9713840CTTTTTAAAAGGGTCGTTATAACGACCCTTTTAAAAAG0.023300.010800.603400.750001.000001.00000


Target Position: 4780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4780CUUCUAAGUGCAGGAGAAC65.84472752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9654798CTTCTAAGTGCAGGAGAACGTTCTCCTGCACTTAGAAG0.036900.004100.491400.500001.000001.00000


Target Position: 5178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5178CUGUAGGGAAAAUGGGAUU72.4521830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4035196CTGTAGGGAAAATGGGATTAATCCCATTTTCCCTACAG0.203100.057600.775900.750001.000001.00000


Target Position: 5000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5000UUUUUUGGCUGCUUGGAAU67.5222531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515018TTTTTTGGCTGCTTGGAATATTCCAAGCAGCCAAAAAA0.122500.006600.491400.500001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798CUGGAGAUCAUCAUCUAUU84.152552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331816CTGGAGATCATCATCTATTAATAGATGATGATCTCCAG0.049000.015200.775900.750000.918500.87500


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901ACAGAGACCCACCUUCAAG69.86352200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522919ACAGAGACCCACCTTCAAGCTTGAAGGTGGGTCTCTGT0.070500.042200.569000.500001.000001.00000


Target Position: 3510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3510GUUUUGCCUUCACCCAUAA85.7084424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8423528GTTTTGCCTTCACCCATAATTATGGGTGAAGGCAAAAC0.047600.006200.612100.750001.000001.00000


Target Position: 3802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802CUGAGUAUAUAUUUACAUG83.7147583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763820CTGAGTATATATTTACATGCATGTAAATATATACTCAG0.071200.008300.629300.500001.000001.00000


Target Position: 4515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4515GCCAACUUAGUGAAACCCC57.79823884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9914533GCCAACTTAGTGAAACCCCGGGGTTTCACTAAGTTGGC0.156700.073000.508600.500001.000001.00000


Target Position: 3887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3887AUCAGUUGCUAUAUAUUAA92.837595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153905ATCAGTTGCTATATATTAATTAATATATAGCAACTGAT0.365200.119200.646600.500001.000001.00000


Target Position: 2187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187ACCCAACCGUGUGACCAAA78.31011073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792205ACCCAACCGTGTGACCAAATTTGGTCACACGGTTGGGT0.039800.003900.853400.750001.000001.00000


Target Position: 3641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641GGCUUAUUAAUUCCGAUAC70.44682119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4023659GGCTTATTAATTCCGATACGTATCGGAATTAATAAGCC0.642100.135500.819000.750001.000001.00000


Target Position: 5102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5102CUCAGUCGCUAUAUUAAAG76.85581232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8295120CTCAGTCGCTATATTAAAGCTTTAATATAGCGACTGAG0.094200.028300.672400.500001.000001.00000


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554CGAGGUGAAUGGGAGCAAG75.18651457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041572CGAGGTGAATGGGAGCAAGCTTGCTCCCATTCACCTCG0.065300.004400.655200.750001.000001.00000


Target Position: 5472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5472UGAAGAAUCUAAAAGUCUU83.8665573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9675490TGAAGAATCTAAAAGTCTTAAGACTTTTAGATTCTTCA0.023900.005300.586200.750001.000001.00000


Target Position: 4533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4533CAUCUCUACUAAAAAUGCA88.7112246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4531-4553CCCATCTCTACTAAAAATGCAAAUGCAUUUUUAGUAGAGAUGGGCAUCUCUACUAAAAAUGCAAAU14.020.200


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705GGUAACUCUAUCGGACUCU73.60881663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491723GGTAACTCTATCGGACTCTAGAGTCCGATAGAGTTACC0.046300.008300.629300.750000.989100.62500


Target Position: 3642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642GCUUAUUAAUUCCGAUACU82.8832644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3773660GCTTATTAATTCCGATACTAGTATCGGAATTAATAAGC0.342500.126300.646600.750001.000001.00000


Target Position: 5341, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5341CAGAACUAGGAAAUGAAUU79.1412976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5935359CAGAACTAGGAAATGAATTAATTCATTTCCTAGTTCTG0.108300.016100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5339-5361AACAGAACTAGGAAATGAATTTTAAUUCAUUUCCUAGUUCUGUUCAGAACUAGGAAAUGAAUUUUU7.218.921


Target Position: 5158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5158AGUUCAAUAUGUUUUCAUU90.4213164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9805176AGTTCAATATGTTTTCATTAATGAAAACATATTGAACT0.022200.015800.698300.750001.000001.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151CCCACACGCCCUCCCCAGA70.37172128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3533169CCCACACGCCCTCCCCAGATCTGGGGAGGGCGTGTGGG0.230400.223900.767200.750001.000001.00000


Target Position: 5555, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5555GCUGUUACUACUCAAAUCA88.5289253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5145573GCTGTTACTACTCAAATCATGATTTGAGTAGTAACAGC0.795000.252300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5553-5575TTGCTGTTACTACTCAAATCACCUGAUUUGAGUAGUAACAGCAAGCUGUUACUACUCAAAUCACCU16.319.022


Target Position: 4674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4674CCUGGGCAACAGAGAAAAC70.80432065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3744692CCTGGGCAACAGAGAAAACGTTTTCTCTGTTGCCCAGG0.295000.051900.698300.750000.945700.62500


Target Position: 2623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2623CACAUCGACUACUAUAAAA96.709235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3862641CACATCGACTACTATAAAATTTTATAGTAGTCGATGTG0.869100.513900.793100.750001.000001.00000


Target Position: 3304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3304AGCUCACCUCUCCCUCCAC66.21352704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133322AGCTCACCTCTCCCTCCACGTGGAGGGAGAGGTGAGCT0.577900.495300.560300.500001.000001.00000


Target Position: 5288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5288CCUGCUAACAUUACAAUUU80.6345840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8945306CCTGCTAACATTACAATTTAAATTGTAATGTTAGCAGG0.054600.002700.844801.000001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572GAGGACAAUGUGAUGAAGA88.8905235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422590GAGGACAATGTGATGAAGATCTTCATCACATTGTCCTC0.260800.011500.586200.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158GGAAAAGAAAUUGCAUGCA82.1927696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211176GGAAAAGAAATTGCATGCATGCATGCAATTTCTTTTCC0.033400.036400.517200.750001.000001.00000


Target Position: 5189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5189AUGGGAUUGCUGCUUUAAA81.5888754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9355207ATGGGATTGCTGCTTTAAATTTAAAGCAGCAATCCCAT0.083200.002200.655200.500001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557GGUGAAUGGGAGCAAGAUU86.4345375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171575GGTGAATGGGAGCAAGATTAATCTTGCTCCCATTCACC0.092300.002500.844801.000001.000001.00000


Target Position: 5441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5441CCCUACCUUGAAGCAAUGU63.4673074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6345459CCCTACCTTGAAGCAATGTACATTGCTTCAAGGTAGGG0.091900.016600.784500.750000.951100.62500


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677GCACCCGAGGCAUUAUUUG66.0982721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142695GCACCCGAGGCATTATTTGCAAATAATGCCTCGGGTGC0.133900.007800.706900.750000.962000.75000


Target Position: 5249, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5249CUAUUGUAAAAUUCUCUUU80.0788885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3245267CTATTGTAAAATTCTCTTTAAAGAGAATTTTACAATAG0.661000.238700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5247-5269GACTATTGTAAAATTCTCTTTGTAAAGAGAAUUUUACAAUAGUCCUAUUGUAAAAUUCUCUUUGUU19.18.532


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UGAAGAGUGGUACCAAGAA84.4231529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831889TGAAGAGTGGTACCAAGAATTCTTGGTACCACTCTTCA0.190900.086600.551700.750001.000001.00000


Target Position: 5507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5507AGGUGCUAGAAAAAUAUAA88.0544277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8355525AGGTGCTAGAAAAATATAATTATATTTTTCTAGCACCT0.434200.003900.810300.750001.000001.00000


Target Position: 4519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4519ACUUAGUGAAACCCCAUCU70.68492082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954537ACTTAGTGAAACCCCATCTAGATGGGGTTTCACTAAGT0.432200.046100.482800.500001.000001.00000


Target Position: 5434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5434GCCUUGGCCCUACCUUGAA79.6229930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7935452GCCTTGGCCCTACCTTGAATTCAAGGTAGGGCCAAGGC0.057800.030700.827601.000000.923901.00000


Target Position: 3889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889CAGUUGCUAUAUAUUAAAA100.86311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3673907CAGTTGCTATATATTAAAATTTTAATATATAGCAACTG0.310100.118400.784500.750001.000001.00000


Target Position: 2852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852CCAACGAGCUGUACAUGAU90.2699174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6872870CCAACGAGCTGTACATGATATCATGTACAGCTCGTTGG0.078100.022900.663801.000001.000001.00000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542GCUAAAGCACAUCGAGGUG70.09712173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721560GCTAAAGCACATCGAGGTGCACCTCGATGTGCTTTAGC0.023100.013800.560300.750000.994600.62500


Target Position: 5412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5412UAAAACAGUGAUGAUAAUU70.41682121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7675430TAAAACAGTGATGATAATTAATTATCATCACTGTTTTA0.095600.027800.525900.500001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414GGCUGGAAUACUGCUACAA90.2826172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272432GGCTGGAATACTGCTACAATTGTAGCAGTATTCCAGCC0.716700.011700.853401.000001.000001.00000


Target Position: 5266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5266UUGUUUCUCUCUGUAAAUA77.61951144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8515284TTGTTTCTCTCTGTAAATATATTTACAGAGAGAAACAA0.046100.041200.603400.500001.000001.00000


Target Position: 5235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5235UGCAGUGUUGGCGACUAUU69.62542237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9545253TGCAGTGTTGGCGACTATTAATAGTCGCCAACACTGCA0.026800.003500.844800.750001.000001.00000


Target Position: 3651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651UUCCGAUACUAGUUUGCUU74.11511592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883669TTCCGATACTAGTTTGCTTAAGCAAACTAGTATCGGAA0.059100.052300.534500.500001.000001.00000


Target Position: 2630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2630ACUACUAUAAAAAGACAAC68.2912427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412648ACTACTATAAAAAGACAACGTTGTCTTTTTATAGTAGT0.754000.677500.560300.500001.000001.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265AGAAAUGGAGAUGAUGAAG68.73532361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302283AGAAATGGAGATGATGAAGCTTCATCATCTCCATTTCT0.044600.037800.586200.500001.000001.00000


Target Position: 3305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305GCUCACCUCUCCCUCCACC61.41443376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9003323GCTCACCTCTCCCTCCACCGGTGGAGGGAGAGGTGAGC0.519700.445700.500000.500001.000001.00000


Target Position: 3761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3761GCUCUGUAUAUAGCUAUGA83.672585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183779GCTCTGTATATAGCTATGATCATAGCTATATACAGAGC0.204000.104900.629300.750000.962000.62500


Target Position: 3760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760GGCUCUGUAUAUAGCUAUG84.0947555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263778GGCTCTGTATATAGCTATGCATAGCTATATACAGAGCC0.202100.021600.844800.750000.918500.62500


Target Position: 5343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5343GAACUAGGAAAUGAAUUUU83.3489605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5545361GAACTAGGAAATGAATTTTAAAATTCATTTCCTAGTTC0.122400.019000.672400.750001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583GAUGAAGAUAGCAGACUUU90.6538156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642601GATGAAGATAGCAGACTTTAAAGTCTGCTATCTTCATC0.043900.014200.681000.750001.000001.00000


Target Position: 2939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939ACCGCAUCGUGGCCUUGAC61.29493390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982957ACCGCATCGTGGCCTTGACGTCAAGGCCACGATGCGGT0.019900.001700.534500.500000.934800.62500


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703CGGGUAACUCUAUCGGACU80.1367878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831721CGGGTAACTCTATCGGACTAGTCCGATAGAGTTACCCG0.073100.001600.706900.750001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608GCACGGGACAUUCACCACA84.5731517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022626GCACGGGACATTCACCACATGTGGTGAATGTCCCGTGC0.144000.022100.646600.750000.956500.87500


Target Position: 5243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5243UGGCGACUAUUGUAAAAUU82.3732679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5115261TGGCGACTATTGTAAAATTAATTTTACAATAGTCGCCA0.295300.021100.836200.750001.000001.00000


Target Position: 5554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5554UGCUGUUACUACUCAAAUC72.98951751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8075572TGCTGTTACTACTCAAATCGATTTGAGTAGTAACAGCA0.765900.234700.672400.500001.000001.00000


Target Position: 5563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5563UACUCAAAUCACCCACAAA88.8318239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7425581TACTCAAATCACCCACAAATTTGTGGGTGATTTGAGTA0.875300.755800.681000.500001.000001.00000


Target Position: 5364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5364GCUCUUAAAAGCAUUUGCU78.24541077

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5362-5384TAGCTCTTAAAAGCATTTGCTTTAGCAAAUGCUUUUAAGAGCUAGCUCUUAAAAGCAUUUGCUUUU20.011.722


Target Position: 4687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4687GAAAACAAAAAGGAAAACA80.6424839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4685-4707GAGAAAACAAAAAGGAAAACAAAUGUUUUCCUUUUUGUUUUCUCGAAAACAAAAAGGAAAACAAAU21.25.611


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277ACAGAAUUGGAGGCUACAA82.3263685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471295ACAGAATTGGAGGCTACAATTGTAGCCTCCAATTCTGT0.095400.013200.560300.750001.000001.00000


Target Position: 3778, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3778GAAGAAAACACAAAGUGUA96.68436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3776-3798ATGAAGAAAACACAAAGTGTATAUACACUUUGUGUUUUCUUCAUGAAGAAAACACAAAGUGUAUAU17.85.511


Target Position: 2679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679ACCCGAGGCAUUAUUUGAC61.41293377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142697ACCCGAGGCATTATTTGACGTCAAATAATGCCTCGGGT0.086300.002500.534500.500000.994600.62500


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229CCUGUCCCCUUUCCUGCUG54.67724283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883247CCTGTCCCCTTTCCTGCTGCAGCAGGAAAGGGGACAGG0.021500.011700.560300.750001.000001.00000


Target Position: 2850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CACCAACGAGCUGUACAUG72.29741852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892868CACCAACGAGCTGTACATGCATGTACAGCTCGTTGGTG0.112800.028100.637900.500000.978300.62500


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900CACAGAGACCCACCUUCAA90.9575143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372918CACAGAGACCCACCTTCAATTGAAGGTGGGTCTCTGTG0.069800.027000.646600.750001.000001.00000


Target Position: 3050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050AGGAUUCCGUCUUCUCUCA82.6466663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9973068AGGATTCCGTCTTCTCTCATGAGAGAAGACGGAATCCT0.020400.012000.620700.500001.000001.00000


Target Position: 5325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5325GGCAUCAUUUGGUGAACAG76.24151313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9655343GGCATCATTTGGTGAACAGCTGTTCACCAAATGATGCC0.039900.001900.715500.750001.000001.00000


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174ACCGUCAGCUGUAACCCUC60.20043544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6953192ACCGTCAGCTGTAACCCTCGAGGGTTACAGCTGACGGT0.301700.011200.543100.500000.962000.87500


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288GGCUACAAGGUCCGUUAUG67.89722480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731306GGCTACAAGGTCCGTTATGCATAACGGACCTTGTAGCC0.071300.001800.844800.750001.000001.00000


Target Position: 3964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3964UUUGCUGUUUUAUUUUUUU65.74432766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813982TTTGCTGTTTTATTTTTTTAAAAAAATAAAACAGCAAA0.518300.229400.500000.500001.000001.00000


Target Position: 5248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5248ACUAUUGUAAAAUUCUCUU74.44641555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6215266ACTATTGTAAAATTCTCTTAAGAGAATTTTACAATAGT0.701800.236800.569000.750001.000001.00000


Target Position: 3792, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3792GUGUAUAAAUCUGAGUAUA95.678454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763810GTGTATAAATCTGAGTATATATACTCAGATTTATACAC0.040000.006900.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3790-3812AAGTGTATAAATCTGAGTATATAUAUACUCAGAUUUAUACACUUGUGUAUAAAUCUGAGUAUAUAU20.38.521


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157GCGCGGGUGGGAGUGAGAG62.3013250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961175GCGCGGGTGGGAGTGAGAGCTCTCACTCCCACCCGCGC0.110000.001900.612100.750001.000001.00000


Target Position: 3944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3944GUCAUAUAUUUUUUGCUAC74.24941577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6463962GTCATATATTTTTTGCTACGTAGCAAAAAATATATGAC0.093800.056400.637900.500001.000001.00000


Target Position: 5501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5501UGGGAGAGGUGCUAGAAAA88.3911256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8925519TGGGAGAGGTGCTAGAAAATTTTCTAGCACCTCTCCCA0.056800.002700.844800.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GGAGAUGUGGAGCCUUGUC72.5061822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
946917GGAGATGTGGAGCCTTGTCGACAAGGCTCCACATCTCC0.049700.002000.551700.750001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010CGUCCCCGACCUUGCCUGA75.11881465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831028CGTCCCCGACCTTGCCTGATCAGGCAAGGTCGGGGACG0.022100.003600.551700.750000.956500.62500


Target Position: 4472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4472AGGUGGGCAGAUCACUUCA83.106630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8224490AGGTGGGCAGATCACTTCATGAAGTGATCTGCCCACCT0.173000.006200.620700.500000.956500.75000


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846ACUGCACCAACGAGCUGUA83.0526633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682864ACTGCACCAACGAGCTGTATACAGCTCGTTGGTGCAGT0.128400.007400.525900.750000.902200.87500


Target Position: 5132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5132CUGGAUUACUGCUAAAUAC78.61591036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6645150CTGGATTACTGCTAAATACGTATTTAGCAGTAATCCAG0.275700.046800.603400.500001.000001.00000


Target Position: 4540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4540ACUAAAAAUGCAAAAAUUA85.462449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454558ACTAAAAATGCAAAAATTATAATTTTTGCATTTTTAGT0.723700.230100.672400.750001.000001.00000


Target Position: 3223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223UCCGUCCCUGUCCCCUUUC39.77225431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6473241TCCGTCCCTGTCCCCTTTCGAAAGGGGACAGGGACGGA0.137000.044400.698300.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CAAACCUGACCACAGAAUU79.4665939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551284CAAACCTGACCACAGAATTAATTCTGTGGTCAGGTTTG0.089800.006200.637900.750000.902200.87500


Target Position: 5410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5410UGUAAAACAGUGAUGAUAA90.4595162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6855428TGTAAAACAGTGATGATAATTATCATCACTGTTTTACA0.078700.046000.672400.750001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348GAGACCCCUCGUAGCGCAU75.29651441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854366GAGACCCCTCGTAGCGCATATGCGCTACGAGGGGTCTC0.142200.003500.655200.750000.907600.62500


Target Position: 5147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5147AUACAAAAGAAAGUUCAAU73.70451653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7325165ATACAAAAGAAAGTTCAATATTGAACTTTCTTTTGTAT0.459900.288600.534500.500001.000001.00000


Target Position: 5263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5263UCUUUGUUUCUCUCUGUAA82.9642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4515281TCTTTGTTTCTCTCTGTAATTACAGAGAGAAACAAAGA0.173600.144400.689700.750001.000001.00000


Target Position: 4525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4525UGAAACCCCAUCUCUACUA76.7171250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6794543TGAAACCCCATCTCTACTATAGTAGAGATGGGGTTTCA0.197200.079300.551700.750000.929300.62500


Target Position: 2829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829CAUGGACAAGCCCAGUAAC73.93211611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572847CATGGACAAGCCCAGTAACGTTACTGGGCTTGTCCATG0.026500.003600.508600.500000.902200.75000


Target Position: 4835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4835GCUUCGUUUCUUGUUGGUA84.537520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7064853GCTTCGTTTCTTGTTGGTATACCAACAAGAAACGAAGC0.074200.057700.672401.000001.000001.00000


Target Position: 3370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3370GCCAGCCACUUCAUCCCCU70.85262060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3693388GCCAGCCACTTCATCCCCTAGGGGATGAAGTGGCTGGC0.235400.122100.655200.750001.000001.00000


Target Position: 5500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5500UUGGGAGAGGUGCUAGAAA76.40131291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515518TTGGGAGAGGTGCTAGAAATTTCTAGCACCTCTCCCAA0.043000.002000.646600.500001.000001.00000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648GUGCUUCACUUAAGAAAUG72.37341841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801666GTGCTTCACTTAAGAAATGCATTTCTTAAGTGAAGCAC0.163000.065800.637900.500000.962000.62500


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160CGGGUGGGAGUGAGAGAGC60.9873441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827178CGGGTGGGAGTGAGAGAGCGCTCTCTCACTCCCACCCG0.050500.033300.560300.500001.000001.00000


Target Position: 2898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898CUCACAGAGACCCACCUUC64.66352917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672916CTCACAGAGACCCACCTTCGAAGGTGGGTCTCTGTGAG0.073300.013800.637900.500001.000001.00000


Target Position: 3965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3965UUGCUGUUUUAUUUUUUUA75.63541403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473983TTGCTGTTTTATTTTTTTATAAAAAAATAAAACAGCAA0.505000.228500.612100.500001.000001.00000


Target Position: 1541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1541GGCUAAAGCACAUCGAGGU79.2351965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911559GGCTAAAGCACATCGAGGTACCTCGATGTGCTTTAGCC0.037800.003200.646600.750001.000001.00000


Target Position: 5291, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5291GCUAACAUUACAAUUUGUA87.5861306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6715309GCTAACATTACAATTTGTATACAAATTGTAATGTTAGC0.154400.008800.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5289-5311CTGCTAACATTACAATTTGTATTUACAAAUUGUAAUGUUAGCAGGCUAACAUUACAAUUUGUAUUU5.311.632


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647GGUGCUUCACUUAAGAAAU87.8468293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181665GGTGCTTCACTTAAGAAATATTTCTTAAGTGAAGCACC0.178200.007700.844801.000000.962000.62500


Target Position: 3922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922AAAGGAAAAUGUUUUUAAA92.879193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453940AAAGGAAAATGTTTTTAAATTTAAAAACATTTTCCTTT0.028600.006800.500000.500001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085AGGAGAAAGAAACAGAUAA90.6677154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101103AGGAGAAAGAAACAGATAATTATCTGTTTCTTTCTCCT0.843600.164500.810300.750001.000001.00000


Target Position: 3901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3901AUUAAAAACAAAAAAGAAA79.8429911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183919ATTAAAAACAAAAAAGAAATTTCTTTTTTGTTTTTAAT0.976000.207700.508600.500001.000001.00000


Target Position: 5344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5344AACUAGGAAAUGAAUUUUU75.45651424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8035362AACTAGGAAATGAATTTTTAAAAATTCATTTCCTAGTT0.134600.024300.646600.500001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831UGGACAAGCCCAGUAACUG63.83133028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9232849TGGACAAGCCCAGTAACTGCAGTTACTGGGCTTGTCCA0.090000.002800.560300.500000.940200.62500


Target Position: 5440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5440GCCCUACCUUGAAGCAAUG70.61532095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6305458GCCCTACCTTGAAGCAATGCATTGCTTCAAGGTAGGGC0.093300.014000.844800.750000.951100.62500


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270CCUGACCACAGAAUUGGAG64.94942880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691288CCTGACCACAGAATTGGAGCTCCAATTCTGTGGTCAGG0.064400.003100.534500.750000.907600.62500


Target Position: 3795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3795UAUAAAUCUGAGUAUAUAU88.7115245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043813TATAAATCTGAGTATATATATATATACTCAGATTTATA0.047500.023700.500000.500001.000001.00000


Target Position: 5346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5346CUAGGAAAUGAAUUUUUAG78.36851066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9105364CTAGGAAATGAATTTTTAGCTAAAAATTCATTTCCTAG0.064100.013400.500000.500001.000001.00000


Target Position: 3767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3767UAUAUAGCUAUGAAGAAAA86.6654361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8873785TATATAGCTATGAAGAAAATTTTCTTCATAGCTATATA0.254800.101000.543100.500001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910GCCUUGUCACCAACCUCUA87.0316344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589928GCCTTGTCACCAACCTCTATAGAGGTTGGTGACAAGGC0.110800.016600.827601.000000.989100.87500


Target Position: 3295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295ACCCCACUCAGCUCACCUC62.06513281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663313ACCCCACTCAGCTCACCTCGAGGTGAGCTGAGTGGGGT0.733200.398400.543100.500000.994600.62500


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653CCGAUACUAGUUUGCUUUG67.91962476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8583671CCGATACTAGTTTGCTTTGCAAAGCAAACTAGTATCGG0.044600.031800.767200.750001.000001.00000


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GGGUCGGUCAUCGUCUACA86.7244358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001867GGGTCGGTCATCGTCTACATGTAGACGATGACCGACCC0.049300.002600.784500.750001.000001.00000


Target Position: 4940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4940CCUGUCCAAACUCCAUCCU63.9813007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8534958CCTGTCCAAACTCCATCCTAGGATGGAGTTTGGACAGG0.126900.030300.500000.750001.000001.00000


Target Position: 5261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5261UCUCUUUGUUUCUCUCUGU70.8432062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7945279TCTCTTTGTTTCTCTCTGTACAGAGAGAAACAAAGAGA0.238900.174100.517200.500001.000001.00000


Target Position: 3902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902UUAAAAACAAAAAAGAAAA73.87491622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263920TTAAAAACAAAAAAGAAAATTTTCTTTTTTGTTTTTAA0.956600.202400.534500.500001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083AGAGGAGAAAGAAACAGAU85.767420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051101AGAGGAGAAAGAAACAGATATCTGTTTCTTTCTCCTCT0.841200.074800.543100.750001.000001.00000


Target Position: 4392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4392ACGGGGUAGAGCUACAGUG65.92452743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9934410ACGGGGTAGAGCTACAGTGCACTGTAGCTCTACCCCGT0.182400.029800.482800.500001.000001.00000


Target Position: 5121, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5121CUUAUAUUUUGCUGGAUUA91.9517118

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3512119CTTATATTTTGCTGGATTA1/1/0/096.22FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38269151..38269169(-)00FGFR1(0.002)


Target Position: 5139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5139ACUGCUAAAUACAAAAGAA94.573670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7585157ACTGCTAAATACAAAAGAATTCTTTTGTATTTAGCAGT0.389000.146800.534500.750000.994600.62500


Target Position: 3805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3805AGUAUAUAUUUACAUGUCU84.079556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733823AGTATATATTTACATGTCTAGACATGTAAATATATACT0.135700.018100.482800.500001.000001.00000


Target Position: 2227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2227UCGGACGCAACAGAGAAAG47.56185009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7902245TCGGACGCAACAGAGAAAGCTTTCTCTGTTGCGTCCGA0.214600.004900.655200.500001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150ACCCACACGCCCUCCCCAG51.10874667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103168ACCCACACGCCCTCCCCAGCTGGGGAGGGCGTGTGGGT0.243300.236500.569000.500001.000001.00000


Target Position: 4185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4185CCCAGACCUCACGACGCAC65.27652825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4194203CCCAGACCTCACGACGCACGTGCGTCGTGAGGTCTGGG0.251700.051700.698300.750001.000001.00000


Target Position: 5525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5525AGGCACUAUCAUAAUUACA86.0922392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8335543AGGCACTATCATAATTACATGTAATTATGATAGTGCCT0.121800.003900.637900.500001.000001.00000


Target Position: 3966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3966UGCUGUUUUAUUUUUUUAA79.2853962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3453984TGCTGTTTTATTTTTTTAATTAAAAAAATAAAACAGCA0.509200.410200.819000.750001.000001.00000


Target Position: 2796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2796GGAACUUUUCAAGCUGCUG69.04192314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532814GGAACTTTTCAAGCTGCTGCAGCAGCTTGAAAAGTTCC0.085300.006300.586200.750000.983700.75000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007CCCAGCUUUCCCGACACCC47.45065018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633025CCCAGCTTTCCCGACACCCGGGTGTCGGGAAAGCTGGG0.264300.110000.500000.500000.902200.62500


Target Position: 4811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4811GCUAGUUUUGCAUUCAGGU76.64451257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9564829GCTAGTTTTGCATTCAGGTACCTGAATGCAAAACTAGC0.026700.004000.500000.750001.000001.00000


Target Position: 4604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4604CUGAGGCAGAAUCCCUUGA73.34151700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9974622CTGAGGCAGAATCCCTTGATCAAGGGATTCTGCCTCAG0.030600.001500.560300.500000.902200.75000


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620CACCACAUCGACUACUAUA95.744852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2282638CACCACATCGACTACTATATATAGTAGTCGATGTGGTG0.767100.163900.750000.750001.000001.00000


Target Position: 5624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5624AAUUGACCUGAAAAAAAAA88.8846236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8265642AATTGACCTGAAAAAAAAATTTTTTTTTCAGGTCAATT0.957700.591300.508600.500001.000001.00000


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294AGCAUAAGAAUAUCAUCAA91.7118125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512312AGCATAAGAATATCATCAATTGATGATATTCTTATGCT0.242100.162200.706900.750001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337UGGUCCCUUGUAUGUCAUC59.33913670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542355TGGTCCCTTGTATGTCATCGATGACATACAAGGGACCA0.044900.002700.663800.500001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858CAGUUUGAAAAGGAGGAUC64.70892909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922876CAGTTTGAAAAGGAGGATCGATCCTCCTTTTCAAACTG0.033300.034400.603400.500001.000001.00000


Target Position: 3832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3832GGGUCGUUACCAGAGAUUU82.3549682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993850GGGTCGTTACCAGAGATTTAAATCTCTGGTAACGACCC0.036800.003500.991401.000000.934800.62500


Target Position: 4783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4783CUAAGUGCAGGAGAACAUG68.59652384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9324801CTAAGTGCAGGAGAACATGCATGTTCTCCTGCACTTAG0.077500.007200.517200.500000.989100.75000


Target Position: 3478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3478GCUUCCUGAGCUUUCUCCU74.45661552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633496GCTTCCTGAGCTTTCTCCTAGGAGAAAGCTCAGGAAGC0.051000.001900.508600.750000.913000.75000


Target Position: 4673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4673GCCUGGGCAACAGAGAAAA80.5815843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454691GCCTGGGCAACAGAGAAAATTTTCTCTGTTGCCCAGGC0.286000.017101.000001.000000.934800.62500


Target Position: 4866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4866UCGUCCUUCCUGUAUCCAU71.95681906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5074884TCGTCCTTCCTGTATCCATATGGATACAGGAAGGACGA0.281600.076000.637900.750001.000001.00000


Target Position: 4047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4047UCUAUGGGCUGUAUGAAAA82.4972670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3574065TCTATGGGCTGTATGAAAATTTTCATACAGCCCATAGA0.304100.060800.724100.750001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186GCCAAGACAGUGAAGUUCA87.5954305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661204GCCAAGACAGTGAAGTTCATGAACTTCACTGTCTTGGC0.215200.061900.775900.750001.000001.00000


Target Position: 5432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5432CUGCCUUGGCCCUACCUUG65.1832838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8105450CTGCCTTGGCCCTACCTTGCAAGGTAGGGCCAAGGCAG0.054000.037300.637900.500000.918500.75000


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GUGGUACCAAGAAGAGUGA81.6193751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511895GTGGTACCAAGAAGAGTGATCACTCTTCTTGGTACCAC0.095400.029500.569000.500001.000001.00000


Target Position: 5445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5445ACCUUGAAGCAAUGUUGUG64.78242900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7875463ACCTTGAAGCAATGTTGTGCACAACATTGCTTCAAGGT0.093900.010000.560300.500001.000001.00000


Target Position: 3960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3960UACUUUUGCUGUUUUAUUU75.47571418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653978TACTTTTGCTGTTTTATTTAAATAAAACAGCAAAAGTA0.495000.121100.681000.500001.000001.00000


Target Position: 5135, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5135GAUUACUGCUAAAUACAAA100.97910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2795153GATTACTGCTAAATACAAATTTGTATTTAGCAGTAATC0.461400.137100.681000.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5133-5155TGGATTACTGCTAAATACAAAAGUUUGUAUUUAGCAGUAAUCCAGAUUACUGCUAAAUACAAAAGU6.911.632


Target Position: 4182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4182GCACCCAGACCUCACGACG65.0232866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6004200GCACCCAGACCTCACGACGCGTCGTGAGGTCTGGGTGC0.130400.047600.577600.500001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625CAUCGACUACUAUAAAAAG84.8156501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212643CATCGACTACTATAAAAAGCTTTTTATAGTAGTCGATG0.843500.505300.517200.500001.000001.00000


Target Position: 5246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5246CGACUAUUGUAAAAUUCUC80.0066895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9805264CGACTATTGTAAAATTCTCGAGAATTTTACAATAGTCG0.735700.206500.482800.750001.000001.00000


Target Position: 3947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3947AUAUAUUUUUUGCUACUUU79.4272942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933965ATATATTTTTTGCTACTTTAAAGTAGCAAAAAATATAT0.162500.062800.543100.500001.000001.00000


Target Position: 5306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5306UGUAUUUAUGUUUAAAGAA84.5274523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7225324TGTATTTATGTTTAAAGAATTCTTTAAACATAAATACA0.081100.053100.534500.750001.000001.00000


Target Position: 3806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3806GUAUAUAUUUACAUGUCUU94.638769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6913824GTATATATTTACATGTCTTAAGACATGTAAATATATAC0.131300.019000.543100.750001.000001.00000


Target Position: 2346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346GUAUGUCAUCGUGGAGUAU84.7169507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562364GTATGTCATCGTGGAGTATATACTCCACGATGACATAC0.044700.008600.637900.750001.000001.00000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720CUCUCCCAUCACUCUGCAU78.73571024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951738CTCTCCCATCACTCTGCATATGCAGAGTGATGGGAGAG0.020800.002100.655200.750001.000001.00000


Target Position: 5584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5584UCCCCAAAGACUGCGCUAG50.6324721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7925602TCCCCAAAGACTGCGCTAGCTAGCGCAGTCTTTGGGGA0.057800.049800.698300.500000.972800.87500


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715UCGGACUCUCCCAUCACUC55.6784158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781733TCGGACTCTCCCATCACTCGAGTGATGGGAGAGTCCGA0.027300.003800.482800.500000.923900.75000


Target Position: 5301, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5301CAAUUUGUAUUUAUGUUUA95.923949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5465319CAATTTGTATTTATGTTTATAAACATAAATACAAATTG0.125800.097800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5299-5321TACAATTTGTATTTATGTTTAAAUAAACAUAAAUACAAAUUGUACAAUUUGUAUUUAUGUUUAAAU6.95.321


Target Position: 4158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4158UGUAACCUCUUCUUCCUAG67.14872589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154176TGTAACCTCTTCTTCCTAGCTAGGAAGAAGAGGTTACA0.034200.003100.534500.500001.000001.00000


Target Position: 4708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708UGAUGAAGGUCUGCAGAAA88.5671251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9094726TGATGAAGGTCTGCAGAAATTTCTGCAGACCTTCATCA0.035000.007300.724100.750001.000001.00000


Target Position: 5631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5631CUGAAAAAAAAAAAAAAAA82.9889638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4335649CTGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCAG0.989600.945900.784500.750001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CUCCAAGAAGUGCAUACAC69.9082195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952538CTCCAAGAAGTGCATACACGTGTATGCACTTCTTGGAG0.146400.083800.517200.500000.945700.62500


Target Position: 5548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5548UGUCCUUGCUGUUACUACU79.0668982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8695566TGTCCTTGCTGTTACTACTAGTAGTAACAGCAAGGACA0.401400.071700.500000.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650GCUUCACUUAAGAAAUGUC77.53271155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791668GCTTCACTTAAGAAATGTCGACATTTCTTAAGTGAAGC0.060400.032100.534500.750000.962000.62500


Target Position: 5236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5236GCAGUGUUGGCGACUAUUG72.17111875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8505254GCAGTGTTGGCGACTATTGCAATAGTCGCCAACACTGC0.052400.003500.706900.750001.000001.00000


Target Position: 3969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3969UGUUUUAUUUUUUUAAAUU75.68871394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3653987TGTTTTATTTTTTTAAATTAATTTAAAAAAATAAAACA0.476200.390700.698300.750001.000001.00000


Target Position: 5575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5575CCACAAAUUUCCCCAAAGA84.6198515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5395593CCACAAATTTCCCCAAAGATCTTTGGGGAAATTTGTGG0.538600.510200.620700.750001.000001.00000


Target Position: 3588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3588GUGCUUCGUGCCUCGAUUG67.87952481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723606GTGCTTCGTGCCTCGATTGCAATCGAGGCACGAAGCAC0.027100.001800.646600.500000.967400.75000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242CUGGUUGAAAAAUGGCAAA79.1784970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431260CTGGTTGAAAAATGGCAAATTTGCCATTTTTCAACCAG0.209400.011100.784500.750001.000001.00000


Target Position: 4868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4868GUCCUUCCUGUAUCCAUGU71.55611959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9294886GTCCTTCCTGTATCCATGTACATGGATACAGGAAGGAC0.158000.086900.612100.500001.000001.00000


Target Position: 4396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4396GGUAGAGCUACAGUGAUUA94.384471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2414414GGTAGAGCTACAGTGATTATAATCACTGTAGCTCTACC0.538800.081500.819001.000001.000001.00000


Target Position: 4230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4230AGUCAGAAAAAGAAGAUGU77.17291200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9214248AGTCAGAAAAAGAAGATGTACATCTTCTTTTTCTGACT0.242700.056900.500000.500001.000001.00000


Target Position: 4580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4580CUGUAAUCCCAGCUCCACA87.6071304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8714598CTGTAATCCCAGCTCCACATGTGGAGCTGGGATTACAG0.042100.024000.577600.500000.918500.62500


Target Position: 3516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3516CCUUCACCCAUAAGCCCCU67.90412478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793534CCTTCACCCATAAGCCCCTAGGGGCTTATGGGTGAAGG0.054700.008400.500000.750001.000001.00000


Target Position: 30, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
30CCAGGCUGUAGGAAGAGAA88.0754274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42748CCAGGCTGTAGGAAGAGAATTCTCTTCCTACAGCCTGG0.435800.031900.672401.000001.000001.00000


Target Position: 3757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3757GGGGGCUCUGUAUAUAGCU78.93131001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9943775GGGGGCTCTGTATATAGCTAGCTATATACAGAGCCCCC0.227600.001500.637900.750000.918500.62500


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864UACAAGAUGAAGAGUGGUA80.5863842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781882TACAAGATGAAGAGTGGTATACCACTCTTCATCTTGTA0.187600.027700.500000.500001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373AGAAUGAGUACGGCAGCAU75.27411445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331391AGAATGAGTACGGCAGCATATGCTGCCGTACTCATTCT0.094000.030400.569000.750001.000001.00000


Target Position: 3211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3211GCCCACCACCUGUCCGUCC54.65684287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533229GCCCACCACCTGTCCGTCCGGACGGACAGGTGGTGGGC0.132100.120800.629300.500001.000001.00000


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138CCGCUGACUGCCACCCACA81.1686795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3913156CCGCTGACTGCCACCCACATGTGGGTGGCAGTCAGCGG0.810900.037400.706900.750000.951100.87500


Target Position: 3315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315CCCUCCACCUCCUCUCCAC65.27672824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4003333CCCTCCACCTCCTCTCCACGTGGAGAGGAGGTGGAGGG0.215800.172600.698300.750001.000001.00000


Target Position: 3896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3896UAUAUAUUAAAAACAAAAA83.1543622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503914TATATATTAAAAACAAAAATTTTTGTTTTTAATATATA0.286900.256100.543100.500001.000001.00000


Target Position: 2849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2849GCACCAACGAGCUGUACAU88.1505266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822867GCACCAACGAGCTGTACATATGTACAGCTCGTTGGTGC0.112200.024100.698301.000000.945700.75000


Target Position: 3883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3883AGGCAUCAGUUGCUAUAUA93.09190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5963901AGGCATCAGTTGCTATATATATATAGCAACTGATGCCT0.403600.013400.801700.750000.940200.75000


Target Position: 5061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5061GAUUCUGGCUCCCCCGUAC71.97581900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8915079GATTCTGGCTCCCCCGTACGTACGGGGGAGCCAGAATC0.302300.012600.500000.500000.929301.00000


Target Position: 4698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4698GGAAAACAAAUGAUGAAGG70.06862175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7614716GGAAAACAAATGATGAAGGCCTTCATCATTTGTTTTCC0.171300.116200.525900.500001.000001.00000


Target Position: 5627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5627UGACCUGAAAAAAAAAAAA80.7429831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4365645TGACCTGAAAAAAAAAAAATTTTTTTTTTTTCAGGTCA0.976900.778500.724100.750001.000001.00000


Target Position: 4528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4528AACCCCAUCUCUACUAAAA85.4129456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7074546AACCCCATCTCTACTAAAATTTTAGTAGAGATGGGGTT0.246600.113500.646600.500001.000001.00000


Target Position: 4937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4937CUUCCUGUCCAAACUCCAU79.3695952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9764955CTTCCTGTCCAAACTCCATATGGAGTTTGGACAGGAAG0.071600.050000.482800.750001.000001.00000


Target Position: 2175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175GGACAAGGACAAACCCAAC77.97121102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632193GGACAAGGACAAACCCAACGTTGGGTTTGTCCTTGTCC0.084200.023300.724100.750000.929300.87500


Target Position: 1364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364GCAUUGUGGAGAAUGAGUA93.196888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771382GCATTGTGGAGAATGAGTATACTCATTCTCCACAATGC0.122400.008700.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1362-1384CTGCATTGTGGAGAATGAGTACGUACUCAUUCUCCACAAUGCAGGCAUUGUGGAGAAUGAGUACGU19.218.132


Target Position: 4672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4672AGCCUGGGCAACAGAGAAA80.9815810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6854690AGCCTGGGCAACAGAGAAATTTCTCTGTTGCCCAGGCT0.255600.008600.853400.750000.934800.75000


Target Position: 5413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5413AAAACAGUGAUGAUAAUUU82.0203713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8555431AAAACAGTGATGATAATTTAAATTATCATCACTGTTTT0.076900.020500.500000.500001.000001.00000


Target Position: 4782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4782UCUAAGUGCAGGAGAACAU72.9481758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894800TCTAAGTGCAGGAGAACATATGTTCTCCTGCACTTAGA0.059000.007300.569000.750000.989100.62500


Target Position: 4007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4007AGUUUAGGUCCCUCAAUAA94.766566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3474025AGTTTAGGTCCCTCAATAATTATTGAGGGACCTAAACT0.401400.047200.672400.750001.000001.00000


Target Position: 3989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3989UGUUCUAAACCUAUUUUCA84.2762541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944007TGTTCTAAACCTATTTTCATGAAAATAGGTTTAGAACA0.428100.046900.482800.500001.000001.00000


Target Position: 2206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206GUGGCUGUGAAGAUGUUGA83.9642562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172224GTGGCTGTGAAGATGTTGATCAACATCTTCACAGCCAC0.087400.010300.569000.500001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739CGCCAGGACCCGAACAGAG71.07572033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862757CGCCAGGACCCGAACAGAGCTCTGTTCGGGTCCTGGCG0.044100.015800.612100.750001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138GGAGGCGGAGGAGGGACCA70.87932056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825156GGAGGCGGAGGAGGGACCATGGTCCCTCCTCCGCCTCC0.064200.004000.525900.750000.951100.75000


Target Position: 4232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4232UCAGAAAAAGAAGAUGUCU68.862342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9474250TCAGAAAAAGAAGATGTCTAGACATCTTCTTTTTCTGA0.128600.051500.500000.500001.000001.00000


Target Position: 5241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5241GUUGGCGACUAUUGUAAAA88.1476267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6265259GTTGGCGACTATTGTAAAATTTTACAATAGTCGCCAAC0.251600.011700.646600.750001.000001.00000


Target Position: 2856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856CGAGCUGUACAUGAUGAUG76.79151242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452874CGAGCTGTACATGATGATGCATCATCATGTACAGCTCG0.047500.007500.637900.750001.000001.00000


Target Position: 3309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3309ACCUCUCCCUCCACCUCCU67.25532581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8223327ACCTCTCCCTCCACCTCCTAGGAGGTGGAGGGAGAGGT0.265800.270300.508600.500001.000001.00000


Target Position: 5208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5208UUUCUGAGCUAGGGAUUUU67.00762612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9085226TTTCTGAGCTAGGGATTTTAAAATCCCTAGCTCAGAAA0.036000.003900.500000.500001.000001.00000


Target Position: 3959, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3959CUACUUUUGCUGUUUUAUU80.3936860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3503977CTACTTTTGCTGTTTTATTAATAAAACAGCAAAAGTAG0.482200.113000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3957-3979TGCTACTTTTGCTGTTTTATTTTAAUAAAACAGCAAAAGUAGCACUACUUUUGCUGUUUUAUUUUU-0.34.911


Target Position: 4017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4017CCUCAAUAAAAAUUGCUGC62.20293266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9404035CCTCAATAAAAATTGCTGCGCAGCAATTTTTATTGAGG0.048600.038300.491400.500000.962000.87500


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827CUUCCUCAUCUCCUGCAUG69.70422224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721845CTTCCTCATCTCCTGCATGCATGCAGGAGATGAGGAAG0.030500.012300.482800.500001.000001.00000


Target Position: 4220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4220GCUUUUGGAAAGUCAGAAA90.4059165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8644238GCTTTTGGAAAGTCAGAAATTTCTGACTTTCCAAAAGC0.066500.003200.853401.000001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472CAGUGGCCCUGGGUAGCAA87.6321301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601490CAGTGGCCCTGGGTAGCAATTGCTACCCAGGGCCACTG0.088900.003300.637900.750000.918500.75000


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286CCUGCCUUCACCCCACUCA74.00871601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5113304CCTGCCTTCACCCCACTCATGAGTGGGGTGAAGGCAGG0.473000.097900.620700.750001.000001.00000


Target Position: 5172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5172UCAUUUCUGUAGGGAAAAU71.56381957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9985190TCATTTCTGTAGGGAAAATATTTTCCCTACAGAAATGA0.090700.001500.715500.750000.994600.62500


Target Position: 5031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5031CCUGCUGGUCAUCACUGUC71.60741953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9415049CCTGCTGGTCATCACTGTCGACAGTGATGACCAGCAGG0.050400.002100.525900.750001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591CCUUAUGUCCAGAUCUUGA90.1785176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461609CCTTATGTCCAGATCTTGATCAAGATCTGGACATAAGG0.047400.013100.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1589-1611TGCCTTATGTCCAGATCTTGAAGUCAAGAUCUGGACAUAAGGCACCUUAUGUCCAGAUCUUGAAGU20.411.621


Target Position: 5411, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5411GUAAAACAGUGAUGAUAAU90.5899158

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4541119GTAAAACAGTGATGATAAT1/1/0/096.22FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANA8:38268861..38268879(-)00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6715429GTAAAACAGTGATGATAATATTATCATCACTGTTTTAC0.082300.036600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5409-5431TTGTAAAACAGTGATGATAATTTAUUAUCAUCACUGUUUUACAAGUAAAACAGUGAUGAUAAUUUU8.77.222


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GAGAUGUGGAGCCUUGUCA87.2472331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
873918GAGATGTGGAGCCTTGTCATGACAAGGCTCCACATCTC0.056400.003000.586200.500001.000001.00000


Target Position: 4881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4881CCAUGUGACCAGACUGUAU91.4255130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9374899CCATGTGACCAGACTGTATATACAGTCTGGTCACATGG0.030500.008700.801701.000001.000001.00000


Target Position: 4979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4979AAAUUCUCCGAAUGUUUUU69.68842228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8624997AAATTCTCCGAATGTTTTTAAAAACATTCGGAGAATTT0.193500.005100.500000.500001.000001.00000


Target Position: 4987, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4987CGAAUGUUUUUGGUUUUUU76.65961254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7415005CGAATGTTTTTGGTTTTTTAAAAAACCAAAAACATTCG0.068300.032100.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4985-5007TCCGAATGTTTTTGGTTTTTTGGAAAAAACCAAAAACAUUCGGACGAAUGUUUUUGGUUUUUUGGU12.614.822


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360ACCUGCAUUGUGGAGAAUG59.21343685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371378ACCTGCATTGTGGAGAATGCATTCTCCACAATGCAGGT0.040200.002200.698300.500001.000001.00000


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618UUCACCACAUCGACUACUA77.74091129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852636TTCACCACATCGACTACTATAGTAGTCGATGTGGTGAA0.586300.142000.500000.500001.000001.00000


Target Position: 3159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3159CCCUCCCCAGACUCCACCG53.36674427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7183177CCCTCCCCAGACTCCACCGCGGTGGAGTCTGGGGAGGG0.072300.048300.577600.500000.945700.62500


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185UGCCAAGACAGUGAAGUUC57.69153905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991203TGCCAAGACAGTGAAGTTCGAACTTCACTGTCTTGGCA0.089100.059700.681000.500001.000001.00000


Target Position: 5030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5030ACCUGCUGGUCAUCACUGU71.43381976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8855048ACCTGCTGGTCATCACTGTACAGTGATGACCAGCAGGT0.043400.002800.646600.500000.929300.62500


Target Position: 4391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4391CACGGGGUAGAGCUACAGU77.70891133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794409CACGGGGTAGAGCTACAGTACTGTAGCTCTACCCCGTG0.164900.028600.586200.500001.000001.00000


Target Position: 5620, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5620GUGAAAUUGACCUGAAAAA88.2243262

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2562019GTGAAATTGACCTGAAAAA1/1/0/097.75FGFR1NM_023105.2+NM_023111.2+NM_023106.2+NM_015850.3+NM_023110.2+NM_023108.2+NM_023107.21+1+1+1+1+0+0NANANANA00FGFR1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1595638GTGAAATTGACCTGAAAAATTTTTCAGGTCAATTTCAC0.833900.526000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5618-5640CAGTGAAATTGACCTGAAAAAAAUUUUUCAGGUCAAUUUCACUGGUGAAAUUGACCUGAAAAAAAU12.27.422


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285UGAUCGGGAAGCAUAAGAA87.5097312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752303TGATCGGGAAGCATAAGAATTCTTATGCTTCCCGATCA0.406700.038400.551700.750001.000001.00000


Target Position: 4056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4056UGUAUGAAAAGGGUGGGAA73.74731644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8734074TGTATGAAAAGGGTGGGAATTCCCACCCTTTTCATACA0.040800.016800.534500.750001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628CGACUACUAUAAAAAGACA99.212420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5832646CGACTACTATAAAAAGACATGTCTTTTTATAGTAGTCG0.808800.653300.586200.750001.000001.00000


Target Position: 29, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
29ACCAGGCUGUAGGAAGAGA74.97571483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80447ACCAGGCTGTAGGAAGAGATCTCTTCCTACAGCCTGGT0.432200.035200.629300.500000.967400.75000


Target Position: 5239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5239GUGUUGGCGACUAUUGUAA86.0657396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7065257GTGTTGGCGACTATTGTAATTACAATAGTCGCCAACAC0.225900.008000.758600.750001.000001.00000


Target Position: 3791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3791AGUGUAUAAAUCUGAGUAU86.3767382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863809AGTGTATAAATCTGAGTATATACTCAGATTTATACACT0.038700.003600.663800.750001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GCAUCAACCACACAUACCA92.14111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231406GCATCAACCACACATACCATGGTATGTGTGGTTGATGC0.142800.049300.508600.750001.000001.00000


Target Position: 5038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5038GUCAUCACUGUCCUCACUA85.6814425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6075056GTCATCACTGTCCTCACTATAGTGAGGACAGTGATGAC0.604900.012600.646600.750001.000001.00000


Target Position: 5505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5505AGAGGUGCUAGAAAAAUAU84.6224514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9315523AGAGGTGCTAGAAAAATATATATTTTTCTAGCACCTCT0.493200.002300.681000.750001.000001.00000


Target Position: 5254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5254GUAAAAUUCUCUUUGUUUC72.80151783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAc