siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 77   125   126   127   129   132   138   139   140   141   142   145   146   151   177   178   183   184   253   254  
255   257   258   302   306   307   420   471   472   477   480   482   483   524   525   537   539   582   583   603  
604   632   633   634   637   638   639   640   641   642   643   687   688   692   696   698   699   700   701   703  
704   708   709   710   712   713  
Biltr, Ernai, Rnaxs 476   682   683   702  
Biltr, Rnaxs, Sidirect 697   705   706   707   711  
Biltr, Ernai 171   232   319   590   675   678  


Target Position: 705, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705GCGUAACUCAAAAAAAAAA90.46887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723GCGTAACTCAAAAAAAAAATTTTTTTTTTGAGTTACGC0.995900.438000.922401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
703-725TTGCGTAACTCAAAAAAAAAAAAUUUUUUUUUUGAGUUACGCAAGCGUAACUCAAAAAAAAAAAAU-11.319.621


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709AACUCAAAAAAAAAAAAAA84.792126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61727AACTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAGTT0.998000.647600.646600.500001.000001.00000


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637GGGGCGGGGACGUAGGGCU64.7994272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71655GGGGCGGGGACGTAGGGCTAGCCCTACGTCCCCGCCCC0.094800.001300.637900.750001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640GCGGGGACGUAGGGCUAAG65.2541263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58658GCGGGGACGTAGGGCTAAGCTTAGCCCTACGTCCCCGC0.053500.002000.784500.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GGGAACCACGGCAGAAGCG60.2679339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73557GGGAACCACGGCAGAAGCGCGCTTCTGCCGTGGTTCCC0.012100.009100.569000.500000.945700.75000


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710ACUCAAAAAAAAAAAAAAA81.919650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23728ACTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAGT0.998300.652400.706900.750001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688GCAAUAAAAGAAAUGUUGC66.3878250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67706GCAATAAAAGAAATGTTGCGCAACATTTCTTTTATTGC0.055600.054100.500000.500001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129UCUAGGACCUGCCUCUUCU71.0247173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62147TCTAGGACCTGCCTCTTCTAGAAGAGGCAGGTCCTAGA0.100500.009000.500000.500000.956500.87500


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582GCGGGGCAGUGAACUUCAG71.3231169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70600GCGGGGCAGTGAACTTCAGCTGAAGTTCACTGCCCCGC0.051600.001300.637900.750001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537CAGGGAACCACGGCAGAAG66.746243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57555CAGGGAACCACGGCAGAAGCTTCTGCCGTGGTTCCCTG0.086600.010600.646600.500001.000001.00000


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632GGCGGGGGGCGGGGACGUA70.7211179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66650GGCGGGGGGCGGGGACGTATACGTCCCCGCCCCCCGCC0.068500.001600.819001.000001.000001.00000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692UAAAAGAAAUGUUGCGUAA83.339135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70710TAAAAGAAATGTTGCGTAATTACGCAACATTTCTTTTA0.060700.057100.500000.500001.000001.00000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177AGCUACUGCUUUUCCUCUG65.5032260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68195AGCTACTGCTTTTCCTCTGCAGAGGAAAAGCAGTAGCT0.315200.042600.569000.500000.934800.62500


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132AGGACCUGCCUCUUCUCAC65.7863258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67150AGGACCTGCCTCTTCTCACGTGAGAAGAGGCAGGTCCT0.042900.002100.551700.500000.994600.62500


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139GCCUCUUCUCACCAAGAUG74.4915128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65157GCCTCTTCTCACCAAGATGCATCTTGGTGAGAAGAGGC0.036800.002600.844800.750000.902200.62500


Target Position: 232, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232CUCUGUGGGGAAUUCUAGA82.905441

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_923219CTCTGTGGGGAATTCTAGA1/1/0/078.51KISS1NM_002256.31NANANA1:204161909..204161927(-)00KISS1(0.002)


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471AGAAGGACCUGCCGAACUA88.525511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74489AGAAGGACCTGCCGAACTATAGTTCGGCAGGTCCTTCT0.060000.001100.551700.750001.000001.00000


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CUUCUAGGACCUGCCUCUU72.2748154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64145CTTCTAGGACCTGCCTCTTAAGAGGCAGGTCCTAGAAG0.061200.007000.500000.750000.956500.87500


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472GAAGGACCUGCCGAACUAC74.2918133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71490GAAGGACCTGCCGAACTACGTAGTTCGGCAGGTCCTTC0.144300.002500.491400.500001.000001.00000


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525GGGAGGCGGCACCAGGGAA82.135346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51543GGGAGGCGGCACCAGGGAATTCCCTGGTGCCGCCTCCC0.126500.003100.819001.000000.940201.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700AUGUUGCGUAACUCAAAAA82.50143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60718ATGTTGCGTAACTCAAAAATTTTTGAGTTACGCAACAT0.605500.072200.655200.500001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GGCAAUAAAAGAAAUGUUG72.137156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41705GGCAATAAAAGAAATGTTGCAACATTTCTTTTATTGCC0.086400.085300.853400.750001.000001.00000


Target Position: 141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
141CUCUUCUCACCAAGAUGAA84.174529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66159CTCTTCTCACCAAGATGAATTCATCTTGGTGAGAAGAG0.031800.029500.637900.750000.902200.62500


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CAAAAAAAAAAAAAAAAAA86.775916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
30731CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.999000.994800.646600.750001.000001.00000


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641CGGGGACGUAGGGCUAAGG57.3397405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66659CGGGGACGTAGGGCTAAGGCCTTAGCCCTACGTCCCCG0.044900.001800.569000.500001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138UGCCUCUUCUCACCAAGAU69.7824195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73156TGCCTCTTCTCACCAAGATATCTTGGTGAGAAGAGGCA0.069000.001100.672400.750000.902200.62500


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GGGACGUAGGGCUAAGGGA82.348645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65661GGGACGTAGGGCTAAGGGATCCCTTAGCCCTACGTCCC0.037900.001700.620700.750001.000001.00000


Target Position: 675, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675CUUCCAACCCGAGGCAAUA79.939365

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_867519CTTCCAACCCGAGGCAATA1/1/0/080.04KISS1NM_002256.31NANANA1:204159490..204159508(-)00KISS1(0.002)


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604CCAAAGGAGUCAGAGCAUG67.8048225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42622CCAAAGGAGTCAGAGCATGCATGCTCTGACTCCTTTGG0.081300.056100.689700.750001.000001.00000


Target Position: 476, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476GACCUGCCGAACUACAACU78.906874

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1047619GACCTGCCGAACTACAACT1/1/0/078.51KISS1NM_002256.31NANANA1:204159689..204159707(-)00KISS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62494GACCTGCCGAACTACAACTAGTTGTAGTTCGGCAGGTC0.444300.011700.612100.500000.902200.62500


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GCUUUUCCUCUGUGCCACC64.1022286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69202GCTTTTCCTCTGTGCCACCGGTGGCACAGAGGAAAAGC0.028900.027600.500000.500001.000001.00000


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603CCCAAAGGAGUCAGAGCAU78.538679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39621CCCAAAGGAGTCAGAGCATATGCTCTGACTCCTTTGGG0.087400.077700.836201.000001.000001.00000


Target Position: 633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633GCGGGGGGCGGGGACGUAG54.0392472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62651GCGGGGGGCGGGGACGTAGCTACGTCCCCGCCCCCCGC0.078000.001800.750000.750001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420CCCACAGCCGCCAGAUCCC54.4426461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71438CCCACAGCCGCCAGATCCCGGGATCTGGCGGCTGTGGG0.024400.005700.500000.500000.929300.62500


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CGGGGCAGUGAACUUCAGA82.086848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69601CGGGGCAGTGAACTTCAGATCTGAAGTTCACTGCCCCG0.057800.001500.689700.750001.000001.00000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254ACAGGCCAGCAGCUAGAAU73.8667140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
52272ACAGGCCAGCAGCTAGAATATTCTAGCTGCTGGCCTGT0.178900.003000.698300.750000.967401.00000


Target Position: 682, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CCCGAGGCAAUAAAAGAAA79.287169

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_668219CCCGAGGCAATAAAAGAAA1/1/0/082.01KISS1NM_002256.31NANANA1:204159483..204159501(-)00KISS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68700CCCGAGGCAATAAAAGAAATTTCTTTTATTGCCTCGGG0.314900.001500.991401.000001.000001.00000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183UGCUUUUCCUCUGUGCCAC56.1163430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71201TGCTTTTCCTCTGTGCCACGTGGCACAGAGGAAAAGCA0.037100.008000.560300.500001.000001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306UGCCGUGCACCGAGAGGAA78.176783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70324TGCCGTGCACCGAGAGGAATTCCTCTCGGTGCACGGCA0.027200.009400.681000.750000.951100.75000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482CCGAACUACAACUGGAACU70.5031181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26500CCGAACTACAACTGGAACTAGTTCCAGTTGTAGTTCGG0.194400.105800.706900.750001.000001.00000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634CGGGGGGCGGGGACGUAGG47.9425573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72652CGGGGGGCGGGGACGTAGGCCTACGTCCCCGCCCCCCG0.089400.001900.569000.500001.000001.00000


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140CCUCUUCUCACCAAGAUGA82.959539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
67158CCTCTTCTCACCAAGATGATCATCTTGGTGAGAAGAGG0.031000.008200.620700.750000.902200.62500


Target Position: 302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
302AGCCUGCCGUGCACCGAGA73.9108139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63320AGCCTGCCGTGCACCGAGATCTCGGTGCACGGCAGGCT0.047500.001700.629300.500000.951100.75000


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708UAACUCAAAAAAAAAAAAA75.4373117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58726TAACTCAAAAAAAAAAAAATTTTTTTTTTTTTGAGTTA0.997600.620400.534500.500001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711CUCAAAAAAAAAAAAAAAA81.522352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
12729CTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAG0.998600.985800.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
709-731AACTCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGAGUUCUCAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 678, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678CCAACCCGAGGCAAUAAAA83.117938

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_367819CCAACCCGAGGCAATAAAA1/1/0/088.67KISS1NM_002256.31NANANANA00KISS1(0.002)


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258GCCAGCAGCUAGAAUCCCU78.842175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62276GCCAGCAGCTAGAATCCCTAGGGATTCTAGCTGCTGGC0.040900.008000.655200.750000.983700.62500


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699AAUGUUGCGUAACUCAAAA85.40323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58717AATGTTGCGTAACTCAAAATTTTGAGTTACGCAACATT0.603300.071300.508600.500001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639GGCGGGGACGUAGGGCUAA76.724101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
35657GGCGGGGACGTAGGGCTAATTAGCCCTACGTCCCCGCC0.184700.010700.965501.000001.000001.00000


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253CACAGGCCAGCAGCUAGAA83.121437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44271CACAGGCCAGCAGCTAGAATTCTAGCTGCTGGCCTGTG0.298100.006700.620700.750000.967401.00000


Target Position: 696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696AGAAAUGUUGCGUAACUCA87.806412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60714AGAAATGTTGCGTAACTCATGAGTTACGCAACATTTCT0.399800.065900.500000.500001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698AAAUGUUGCGUAACUCAAA88.793210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73716AAATGTTGCGTAACTCAAATTTGAGTTACGCAACATTT0.601300.070000.500000.500001.000001.00000


Target Position: 483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483CGAACUACAACUGGAACUC67.2368237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74501CGAACTACAACTGGAACTCGAGTTCCAGTTGTAGTTCG0.044700.030800.482800.750001.000001.00000


Target Position: 126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126ACUUCUAGGACCUGCCUCU72.9419147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73144ACTTCTAGGACCTGCCTCTAGAGGCAGGTCCTAGAAGT0.051400.006100.482800.500000.956500.75000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703UUGCGUAACUCAAAAAAAA80.480363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54721TTGCGTAACTCAAAAAAAATTTTTTTTGAGTTACGCAA0.988200.079800.646600.500001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707GUAACUCAAAAAAAAAAAA86.770617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27725GTAACTCAAAAAAAAAAAATTTTTTTTTTTTGAGTTAC0.997100.619800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
705-727GCGTAACTCAAAAAAAAAAAAAAUUUUUUUUUUUUGAGUUACGCGUAACUCAAAAAAAAAAAAAAU-11.320.310


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151CAAGAUGAACUCACUGGUU85.757320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68169CAAGATGAACTCACTGGTTAACCAGTGAGTTCATCTTG0.029900.001500.500000.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GUGAACUUCAGACCCCAAA78.645378

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_559019GTGAACTTCAGACCCCAAA1/1/0/082.01KISS1NM_002256.31NANANA1:204159575..204159593(-)00KISS1(0.002)


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704UGCGUAACUCAAAAAAAAA83.489834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36722TGCGTAACTCAAAAAAAAATTTTTTTTTGAGTTACGCA0.991100.430000.853400.750001.000001.00000


Target Position: 171, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171CUUGGCAGCUACUGCUUUU79.104771

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_117119CTTGGCAGCTACTGCTTTT1/1/0/093.71KISS1NM_002256.31NANANA1:204161970..204161988(-)00KISS1(0.002)


Target Position: 178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
178GCUACUGCUUUUCCUCUGU75.3051119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37196GCTACTGCTTTTCCTCTGTACAGAGGAAAAGCAGTAGC0.219100.013700.646600.750001.000001.00000


Target Position: 702, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702GUUGCGUAACUCAAAAAAA90.71245

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_470219GTTGCGTAACTCAAAAAAA1/1/0/088.67KISS1NM_002256.31NANANANA00KISS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
33720GTTGCGTAACTCAAAAAAATTTTTTTGAGTTACGCAAC0.634800.077700.646600.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477ACCUGCCGAACUACAACUG58.3331382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46495ACCTGCCGAACTACAACTGCAGTTGTAGTTCGGCAGGT0.250500.013300.569000.500000.902200.75000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712UCAAAAAAAAAAAAAAAAA74.8393123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24730TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.998800.989300.724100.750001.000001.00000


Target Position: 683, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683CCGAGGCAAUAAAAGAAAU81.95249

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_268319CCGAGGCAATAAAAGAAAT1/1/0/090.92KISS1NM_002256.31NANANANA00KISS1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72701CCGAGGCAATAAAAGAAATATTTCTTTTATTGCCTCGG0.291200.001200.905201.000001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642GGGGACGUAGGGCUAAGGG56.5494422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66660GGGGACGTAGGGCTAAGGGCCCTTAGCCCTACGTCCCC0.041100.001800.500000.500001.000001.00000


Target Position: 319, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GAGGAAGCCAGCUGCUACU80.592261

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_731919GAGGAAGCCAGCTGCTACT1/1/0/081.03KISS1NM_002256.31NANANA1:204159846..204159864(-)00KISS1(0.002)


Target Position: 706, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706CGUAACUCAAAAAAAAAAA84.015131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
14724CGTAACTCAAAAAAAAAAATTTTTTTTTTTGAGTTACG0.996200.618800.775901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
704-726TGCGTAACTCAAAAAAAAAAAAAUUUUUUUUUUUGAGUUACGCACGUAACUCAAAAAAAAAAAAAU-11.321.411


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255CAGGCCAGCAGCUAGAAUC69.6064196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64273CAGGCCAGCAGCTAGAATCGATTCTAGCTGCTGGCCTG0.150000.001700.603400.500000.967400.87500


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480UGCCGAACUACAACUGGAA80.958156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23498TGCCGAACTACAACTGGAATTCCAGTTGTAGTTCGGCA0.290900.065700.681000.750000.902200.62500


Target Position: 142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
142UCUUCUCACCAAGAUGAAC60.4252336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65160TCTTCTCACCAAGATGAACGTTCATCTTGGTGAGAAGA0.042300.026100.577600.500000.923900.62500


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257GGCCAGCAGCUAGAAUCCC59.5847355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74275GGCCAGCAGCTAGAATCCCGGGATTCTAGCTGCTGGCC0.055500.003300.508600.500000.967400.62500


Target Position: 145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
145UCUCACCAAGAUGAACUCA71.0684172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63163TCTCACCAAGATGAACTCATGAGTTCATCTTGGTGAGA0.096400.016300.500000.500000.923900.62500


Target Position: 146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
146CUCACCAAGAUGAACUCAC64.896268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57164CTCACCAAGATGAACTCACGTGAGTTCATCTTGGTGAG0.095300.013100.517200.500000.945700.62500


Target Position: 697, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697GAAAUGUUGCGUAACUCAA94.05732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56715GAAATGTTGCGTAACTCAATTGAGTTACGCAACATTTC0.408700.068200.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
695-717AAGAAATGTTGCGTAACTCAAAAUUGAGUUACGCAACAUUUCUUGAAAUGUUGCGUAACUCAAAAU20.35.322


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638GGGCGGGGACGUAGGGCUA80.626159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48656GGGCGGGGACGTAGGGCTATAGCCCTACGTCCCCGCCC0.107100.004300.819001.000001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524CGGGAGGCGGCACCAGGGA65.4784261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54542CGGGAGGCGGCACCAGGGATCCCTGGTGCCGCCTCCCG0.116500.002600.543100.750000.940201.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307GCCGUGCACCGAGAGGAAG61.3076322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74325GCCGTGCACCGAGAGGAAGCTTCCTCTCGGTGCACGGC0.012000.004000.862100.750000.951100.62500


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125CACUUCUAGGACCUGCCUC63.7101289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72143CACTTCTAGGACCTGCCTCGAGGCAGGTCCTAGAAGTG0.047600.005300.482800.500000.956500.62500


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77GGCUCCGCCAGACUCCUGC54.9021454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7295GGCTCCGCCAGACTCCTGCGCAGGAGTCTGGCGGAGCC0.015600.002300.646600.500000.918500.62500


Target Position: 701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
701UGUUGCGUAACUCAAAAAA76.5237104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17719TGTTGCGTAACTCAAAAAATTTTTTGAGTTACGCAACA0.632200.073600.706900.750001.000001.00000