siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Sidirect 1858  
Biltr, Ernai, Rnaxs 585   3446  
Biltr, Rnaxs 169   170   171   172   174   338   340   346   429   430   431   433   519   520   525   538   545   546   653   665  
666   667   668   735   736   742   746   747   753   766   767   827   828   829   830   831   832   855   856   864  
865   866   867   878   879   887   888   889   890   941   942   943   946   947   950   951   955   956   1003   1036  
1044   1103   1104   1128   1132   1224   1225   1226   1294   1305   1306   1384   1386   1387   1388   1389   1391   1392   1412   1413  
1419   1537   1542   1553   1564   1594   1651   1652   1712   1713   1717   1719   1777   1778   1783   1784   1791   1792   1796   1924  
1925   1930   1931   1945   1949   1991   1992   2003   2060   2078   2079   2080   2081   2086   2099   2100   2102   2104   2182   2183  
2184   2185   2258   2260   2294   2295   2306   2307   2310   2319   2387   2491   2492   2493   2494   2495   2499   2503   2516   2570  
2590   2591   2592   2593   2599   2618   2621   2622   2624   2692   2694   2695   2700   2701   2730   2763   2766   2767   2768   2770  
2771   2778   2779   2898   2933   3010   3046   3118   3119   3121   3173   3174   3198   3202   3205   3286   3287   3317   3319   3322  
3323   3326   3327   3329   3332   3350   3369   3378   3392   3393   3394   3398   3422   3423   3424   3425   3426   3427   3428   3445  
3447   3453   3454   3456   3458   3476   3477   3484   3504   3529   3533   3541   3542   3543   3544   3545   3546   3547   3584   3585  
3630   3631   3674   3676   3677   3679   3701   3802   3810   3828   3829   3830   3860   3863   3888   3889   3903   3912   3913   3944  
3950   4033   4034   4036   4037   4038   4045   4047   4094   4104   4105   4106   4116   4339   4348   4473   4518   4593   4594   4708  
4731   4735  
Biltr, Ernai, Rnaxs, Sidirect 2769  
Biltr, Ernai 462   1508   2837   2886   3006   3217  
Biltr, Rnaxs, Sidirect 48   49   173   339   341   342   422   432   434   435   524   539   669   743   754   869   999   1030   1037   1045  
1105   1129   1130   1133   1303   1358   1414   1546   1565   1566   1572   1573   1592   1714   1718   1785   1789   1994   2101   2103  
2186   2187   2259   2301   2308   2320   2454   2693   2899   3120   3288   3318   3320   3328   3330   3351   3370   3384   3399   3457  
3459   3485   3505   3548   3617   3680   3699   3859   3861   3864   3916   3917   3943   3945   4039   4040   4041   4046   4048   4095  
4117   4119   4155   4182   4183   4298   4333   4334   4340   4349   4515   4648   4690   4704   4709   4732  
Biltr, Sidirect 329   390   391   423   527   529   548   550   559   565   591   596   619   625   702   705   706   751   775   794  
802   803   823   824   836   868   871   893   952   957   962   965   968   978   995   997   1028   1109   1119   1125  
1154   1239   1253   1286   1308   1313   1316   1356   1364   1393   1397   1398   1426   1427   1433   1434   1438   1441   1518   1522  
1556   1562   1587   1597   1601   1603   1606   1643   1654   1665   1668   1682   1740   1753   1759   1794   1797   1804   1860   1866  
1868   1869   1877   1981   2016   2092   2105   2109   2111   2113   2148   2149   2189   2261   2286   2287   2296   2318   2379   2388  
2398   2407   2410   2414   2418   2598   2646   2652   2772   2850   2861   2895   2932   3037   3039   3065   3066   3068   3125   3130  
3134   3136   3140   3153   3168   3209   3230   3231   3290   3298   3403   3406   3468   3496   3507   3552   3589   3592   3593   3597  
3604   3613   3621   3642   3644   3646   3650   3689   3709   3721   3722   3731   3732   3760   3764   3767   3770   3871   3890   3891  
3932   3936   3985   4013   4029   4056   4071   4082   4120   4157   4172   4180   4241   4244   4249   4261   4272   4330   4353   4355  
4359   4363   4379   4387   4389   4392   4396   4418   4420   4427   4431   4439   4446   4448   4450   4463   4484   4486   4495   4505  
4509   4559   4568   4571   4585   4595   4619   4620   4622   4629   4645   4659   4660   4667   4668   4680   4681   4688   4713   4723  
4736  


Target Position: 3912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3912AGGAGCCUUAAUUUUUUUU68.69943133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3553930AGGAGCCTTAATTTTTTTTAAAAAAAATTAAGGCTCCT0.704000.174600.844800.750001.000001.00000


Target Position: 3644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3644CAGAAUGUAAAAGAACUUA88.3584564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3642-3664CTCAGAATGTAAAAGAACTTACTUAAGUUCUUUUACAUUCUGAGCAGAAUGUAAAAGAACUUACUU17.719.223


Target Position: 1364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364CUGAUUUCCUAUUUUAACA86.4383754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1362-1384ATCTGATTTCCTATTTTAACAACUGUUAAAAUAGGAAAUCAGAUCUGAUUUCCUAUUUUAACAACU0.016.323


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103GAGGUUGAAAAUCUUUCUA88.8809507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061121GAGGTTGAAAATCTTTCTATAGAAAGATTTTCAACCTC0.128200.036200.637900.750001.000001.00000


Target Position: 2766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2766ACCCUCCUAAACCACUGAA73.87162414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812784ACCCTCCTAAACCACTGAATTCAGTGGTTTAGGAGGGT0.406400.177600.681000.750001.000001.00000


Target Position: 3541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3541ACUGUGUGCUUGUUUUAUA89.9907431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5893559ACTGTGTGCTTGTTTTATATATAAAACAAGCACACAGT0.523000.357300.663800.750001.000001.00000


Target Position: 2895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895GAAUGCAAAAGCAGAAAAU85.3781879

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2893-2915ACGAATGCAAAAGCAGAAAATGAAUUUUCUGCUUUUGCAUUCGUGAAUGCAAAAGCAGAAAAUGAU12.220.022


Target Position: 559, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559CUUUAACUUACUAAAAGAA91.0358370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
557-579TTCTTTAACTTACTAAAAGAAATUUCUUUUAGUAAGUUAAAGAACUUUAACUUACUAAAAGAAAUU7.14.922


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621CUGCCAACACCAACAAAAA89.3944471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572639CTGCCAACACCAACAAAAATTTTTGTTGGTGTTGGCAG0.646800.346300.784500.750000.972800.62500


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003AGAACAUGAAUGUAAUAUA98.400756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591021AGAACATGAATGTAATATATATATTACATTCATGTTCT0.394800.136800.681000.750001.000001.00000


Target Position: 4104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4104CACAUUAUUUCUAGUCCAA94.3876176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7154122CACATTATTTCTAGTCCAATTGGACTAGAAATAATGTG0.175200.093500.646600.750001.000001.00000


Target Position: 3504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3504ACACAUUAGAUUUUAUUUU75.82932121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273522ACACATTAGATTTTATTTTAAAATAAAATCTAATGTGT0.125300.062700.706900.750001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955AGCAAAACAACUAGAAAAU77.49341882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732973AGCAAAACAACTAGAAAATATTTTCTAGTTGTTTTGCT0.475400.179100.844800.750001.000001.00000


Target Position: 3945, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3945CUAAUUGCAUCUCAAAAUU79.52651587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093963CTAATTGCATCTCAAAATTAATTTTGAGATGCAATTAG0.128100.061100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3943-3965GTCTAATTGCATCTCAAAATTATAAUUUUGAGAUGCAAUUAGACCUAAUUGCAUCUCAAAAUUAUU7.415.322


Target Position: 3859, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3859CUGAAGAAUUAAGAUACAA91.1611360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353877CTGAAGAATTAAGATACAATTGTATCTTAATTCTTCAG0.123400.074800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3857-3879TCCTGAAGAATTAAGATACAAATUUGUAUCUUAAUUCUUCAGGACUGAAGAAUUAAGAUACAAAUU20.320.421


Target Position: 3330, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3330CUUGUUUUUAUUAAUUUAU76.85871971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573348CTTGTTTTTATTAATTTATATAAATTAATAAAAACAAG0.206700.107800.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3328-3350CTCTTGTTTTTATTAATTTATATAUAAAUUAAUAAAAACAAGAGCUUGUUUUUAUUAAUUUAUAUU-7.55.611


Target Position: 3485, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3485GAAAAAAAUUACUAAUUUU94.5952162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723503GAAAAAAATTACTAATTTTAAAATTAGTAATTTTTTTC0.155300.060100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3483-3505TAGAAAAAAATTACTAATTTTACAAAAUUAGUAAUUUUUUUCUAGAAAAAAAUUACUAAUUUUACU-4.3-11.312


Target Position: 4094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4094UGUUCAAAGCCACAUUAUU78.05481788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8834112TGTTCAAAGCCACATTATTAATAATGTGGCTTTGAACA0.132300.073800.698300.750000.994600.62500


Target Position: 2652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652CAAGAAUCUUAGUAUCAAU99.205341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2650-2672ATCAAGAATCTTAGTATCAATTGAUUGAUACUAAGAUUCUUGAUCAAGAAUCUUAGUAUCAAUUGU16.114.822


Target Position: 2693, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693GAGAAGUUCCAGAAAAUAA99.895334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912711GAGAAGTTCCAGAAAATAATTATTTTCTGGAACTTCTC0.369300.064000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2691-2713CTGAGAAGTTCCAGAAAATAAATUUAUUUUCUGGAACUUCUCAGGAGAAGUUCCAGAAAAUAAAUU2.117.722


Target Position: 1994, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1994GUAAGAUCUCCAAAGAAAA94.808156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602012GTAAGATCTCCAAAGAAAATTTTCTTTGGAGATCTTAC0.606700.187400.681000.750000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1992-2014CTGTAAGATCTCCAAAGAAAAAAUUUUCUUUGGAGAUCUUACAGGUAAGAUCUCCAAAGAAAAAAU5.516.022


Target Position: 794, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794GAUGAUCUGGUGAUUUCAU89.3854472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
792-814AAGATGATCTGGTGATTTCATTTAUGAAAUCACCAGAUCAUCUUGAUGAUCUGGUGAUUUCAUUUU16.320.423


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591CUGAAGAGUCCAUAUAAAA94.9564143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6502609CTGAAGAGTCCATATAAAATTTTATATGGACTCTTCAG0.867900.044400.784500.750001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294GACUGUUAUGAACACUAUC79.30731617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661312GACTGTTATGAACACTATCGATAGTGTTCATAACAGTC0.337700.022000.637900.500001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494CCCUACCUUGUCACCAAUA82.9661130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1772512CCCTACCTTGTCACCAATATATTGGTGACAAGGTAGGG0.607200.151300.948301.000000.989100.75000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791UGACAAGAGAAAUGAUAAA87.7641623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881809TGACAAGAGAAATGATAAATTTATCATTTCTCTTGTCA0.153400.099700.724100.750001.000001.00000


Target Position: 3136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3136CAUUGUUAUUUAUACAAGA95.968109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3134-3156GTCATTGTTATTTATACAAGATTUCUUGUAUAAAUAACAAUGACCAUUGUUAUUUAUACAAGAUUU11.66.921


Target Position: 1105, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105GGUUGAAAAUCUUUCUAAA104.568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751123GGTTGAAAATCTTTCTAAATTTAGAAAGATTTTCAACC0.133900.066600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1103-1125GAGGTTGAAAATCTTTCTAAACGUUUAGAAAGAUUUUCAACCUCGGUUGAAAAUCUUUCUAAACGU7.114.923


Target Position: 4660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4660CUUUAUUGCUUUUUUGUAU82.36871194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4658-4680TGCTTTATTGCTTTTTTGTATTGAUACAAAAAAGCAAUAAAGCACUUUAUUGCUUUUUUGUAUUGU7.2-1.422


Target Position: 4667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4667GCUUUUUUGUAUUGGUUAA90.3087409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4665-4687TTGCTTTTTTGTATTGGTTAAAAUUAACCAAUACAAAAAAGCAAGCUUUUUUGUAUUGGUUAAAAU20.0-5.922


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128ACGAAGAAAUUUAUCUUAA87.9894603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241146ACGAAGAAATTTATCTTAATTAAGATAAATTTCTTCGT0.151400.030800.741400.750000.934800.62500


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387CACAGUGAAUCCAAAAGAA98.277859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8741405CACAGTGAATCCAAAAGAATTCTTTTGGATTCACTGTG0.433000.056800.620700.750001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866UUGCUCAAAGAACCAUAUA72.4752619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967884TTGCTCAAAGAACCATATATATATGGTTCTTTGAGCAA0.252200.199000.603400.500000.918500.75000


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CCUAAACCACUGAAAAAAC72.23682648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3962789CCTAAACCACTGAAAAAACGTTTTTTCAGTGGTTTAGG0.814600.338600.698300.750001.000001.00000


Target Position: 3484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484AGAAAAAAAUUACUAAUUU84.06011018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8263502AGAAAAAAATTACTAATTTAAATTAGTAATTTTTTTCT0.144100.051900.724100.750001.000001.00000


Target Position: 2695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2695GAAGUUCCAGAAAAUAAAU87.2788670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902713GAAGTTCCAGAAAATAAATATTTATTTTCTGGAACTTC0.524300.085600.663800.750001.000001.00000


Target Position: 3944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3944UCUAAUUGCAUCUCAAAAU72.9212559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8813962TCTAATTGCATCTCAAAATATTTTGAGATGCAATTAGA0.132500.050900.715500.750001.000001.00000


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491GCCCCCUACCUUGUCACCA70.9982835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392509GCCCCCTACCTTGTCACCATGGTGACAAGGTAGGGGGC0.295900.119400.655200.750001.000001.00000


Target Position: 3327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3327GCUCUUGUUUUUAUUAAUU83.56191076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6463345GCTCTTGTTTTTATTAATTAATTAATAAAAACAAGAGC0.189900.099600.844801.000001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796AGAGAAAUGAUAAAACAUU83.92881044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481814AGAGAAATGATAAAACATTAATGTTTTATCATTTCTCT0.121100.057400.715500.750001.000001.00000


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889AGCUGUUAUACCCAUUAAU81.63231291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650907AGCTGTTATACCCATTAATATTAATGGGTATAACAGCT0.189300.070900.844800.750001.000001.00000


Target Position: 4568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4568CUACUAAGUUCACAUUAGA92.5547272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4566-4588TGCTACTAAGTTCACATTAGAATUCUAAUGUGAACUUAGUAGCACUACUAAGUUCACAUUAGAAUU11.611.333


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829UGUCCUUGACUAUUUUAUU79.03481662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851847TGTCCTTGACTATTTTATTAATAAAATAGTCAAGGACA0.367700.059000.698300.750000.962000.62500


Target Position: 1665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665GAAGUACAUCUCAGAAUCU91.3266350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1663-1685CAGAAGTACATCTCAGAATCTTGAGAUUCUGAGAUGUACUUCUGGAAGUACAUCUCAGAAUCUUGU20.419.032


Target Position: 4486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4486CCAUUUCAUCAUUGUUUCU79.80381540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4484-4506CTCCATTTCATCATTGTTTCTGCAGAAACAAUGAUGAAAUGGAGCCAUUUCAUCAUUGUUUCUGCU14.913.822


Target Position: 997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997CUGUAAAGAACAUGAAUGU79.33341613

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
995-1017CTCTGTAAAGAACATGAATGTAAACAUUCAUGUUCUUUACAGAGCUGUAAAGAACAUGAAUGUAAU13.611.822


Target Position: 1654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CACAUAUAGCAGAAGUACA95.6958117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1652-1674GCCACATATAGCAGAAGTACATCUGUACUUCUGCUAUAUGUGGCCACAUAUAGCAGAAGUACAUCU21.48.222


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419GAGUGAAGGAUAUAGGAUA101.96522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401437GAGTGAAGGATATAGGATATATCCTATATCCTTCACTC0.226800.038400.767200.750001.000001.00000


Target Position: 4387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4387GUCUUGUUAGAAAACAAAA89.1715491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4385-4407TGGTCTTGTTAGAAAACAAAATTUUUUGUUUUCUAACAAGACCAGUCUUGUUAGAAAACAAAAUUU5.619.221


Target Position: 3545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3545UGUGCUUGUUUUAUAAAAU79.96211519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303563TGTGCTTGTTTTATAAAATATTTTATAAAACAAGCACA0.232600.183900.698300.750001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GCUGUUAUACCCAUUAAUG78.17691766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827908GCTGTTATACCCATTAATGCATTAATGGGTATAACAGC0.183200.071200.698300.750001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430GGGAGGUUAUAUUCAAAAG81.7941271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867448GGGAGGTTATATTCAAAAGCTTTTGAATATAACCTCCC0.137200.051300.853400.750001.000001.00000


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412CUGAAAAGAGUGAAGGAUA91.4221339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611430CTGAAAAGAGTGAAGGATATATCCTTCACTCTTTTCAG0.314300.100600.741400.750001.000001.00000


Target Position: 2779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2779ACUGAAAAAACUACGCUUU72.18782655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8412797ACTGAAAAAACTACGCTTTAAAGCGTAGTTTTTTCAGT0.140500.149800.706900.750001.000001.00000


Target Position: 1508, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CUUGGAGUUCGCUUGUAUU83.37291090

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4150819CTTGGAGTTCGCTTGTATT1/1/0/097.75RB1NM_000321.21NANANA13:48953739..48953757(+)00RB1(0.002)


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170CCGCCCAAAACCCCCCGAA66.08663433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253188CCGCCCAAAACCCCCCGAATTCGGGGGGTTTTGGGCGG0.793100.339700.741401.000001.000001.00000


Target Position: 4045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045UGUCUAUUUAUCUUUUAUU79.03631660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8094063TGTCTATTTATCTTTTATTAATAAAAGATAAATAGACA0.695300.353400.698300.750001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624CCAACACCAACAAAAAUGA83.04311123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622642CCAACACCAACAAAAATGATCATTTTTGTTGGTGTTGG0.242900.152100.620700.750000.989100.62500


Target Position: 524, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524CUACAGAAAAACAUAGAAA93.7265212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740542CTACAGAAAAACATAGAAATTTCTATGTTTTTCTGTAG0.513200.278900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
522-544AGCTACAGAAAAACATAGAAATCUUUCUAUGUUUUUCUGUAGCUCUACAGAAAAACAUAGAAAUCU13.420.321


Target Position: 2932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932CUCAAACAAGGAAGAGAAA85.4577868

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2930-2952ACCTCAAACAAGGAAGAGAAATGUUUCUCUUCCUUGUUUGAGGUCUCAAACAAGGAAGAGAAAUGU19.120.522


Target Position: 3168, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168GUAAAUCCUGCCAUUUAAA88.8371513

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3166-3188GTGTAAATCCTGCCATTTAAAAAUUUAAAUGGCAGGAUUUACACGUAAAUCCUGCCAUUUAAAAAU-1.415.521


Target Position: 1045, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CAAAAAUUUUAUACCUUUU85.1501899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8821063CAAAAATTTTATACCTTTTAAAAGGTATAAAATTTTTG0.132400.073700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1043-1065TTCAAAAATTTTATACCTTTTATAAAAGGUAUAAAAUUUUUGAACAAAAAUUUUAUACCUUUUAUU18.6-12.022


Target Position: 4448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4448CAGUUAUUUUGAUAACAAU95.5326122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4446-4468GACAGTTATTTTGATAACAATGAAUUGUUAUCAAAAUAACUGUCCAGUUAUUUUGAUAACAAUGAU6.94.622


Target Position: 2850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2850CCAAAUUUCAGCAGAAACU75.25222213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2848-2870GTCCAAATTTCAGCAGAAACTGGAGUUUCUGCUGAAAUUUGGACCCAAAUUUCAGCAGAAACUGGU19.2-3.322


Target Position: 2187, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187CAGAAUUAGAACAUAUCAU89.8166435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132205CAGAATTAGAACATATCATATGATATGTTCTAATTCTG0.596900.105700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2185-2207CCCAGAATTAGAACATATCATCTAUGAUAUGUUCUAAUUCUGGGCAGAAUUAGAACAUAUCAUCUU14.96.922


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319UGAUGUUUGCUCUUGUUUU78.17591767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7553337TGATGTTTGCTCTTGTTTTAAAACAAGAGCAAACATCA0.159100.082700.724100.750001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UCUUGGAUCACAUUUUUAU76.07212083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916764TCTTGGATCACATTTTTATATAAAAATGTGATCCAAGA0.167200.025000.681000.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398CAAAGAAGAGGAGUAUGAU90.7213385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2396-2418ATCAAAGAAGAGGAGTATGATTCAUCAUACUCCUCUUCUUUGAUCAAAGAAGAGGAGUAUGAUUCU20.310.322


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618GGUCUGCCAACACCAACAA87.7094629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522636GGTCTGCCAACACCAACAATTGTTGGTGTTGGCAGACC0.420200.111900.706901.000000.918500.62500


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593GAAGAGUCCAUAUAAAAUU87.9993601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072611GAAGAGTCCATATAAAATTAATTTTATATGGACTCTTC0.372900.125400.663800.750001.000001.00000


Target Position: 3546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3546GUGCUUGUUUUAUAAAAUU82.53291179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263564GTGCTTGTTTTATAAAATTAATTTTATAAAACAAGCAC0.197400.164600.784500.750001.000001.00000


Target Position: 3732, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732CAUUCAGAUCACUGAAUUU94.0933192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3730-3752ACCATTCAGATCACTGAATTTATAAAUUCAGUGAUCUGAAUGGUCAUUCAGAUCACUGAAUUUAUU12.020.421


Target Position: 3394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3394CCUAUCUAUCUUCCAAAUG66.19453422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393412CCTATCTATCTTCCAAATGCATTTGGAAGATAGATAGG0.566800.309900.689700.750001.000001.00000


Target Position: 4619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4619CGUGUAUUGAGAUUUCUUA95.8667112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4617-4639ATCGTGTATTGAGATTTCTTAAAUAAGAAAUCUCAAUACACGAUCGUGUAUUGAGAUUUCUUAAAU5.314.622


Target Position: 1393, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393GAAUCCAAAAGAAAGUAUA93.9853199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1391-1413GTGAATCCAAAAGAAAGTATACTUAUACUUUCUUUUGGAUUCACGAAUCCAAAAGAAAGUAUACUU4.620.121


Target Position: 3428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428CCCAUUCACCAAAAUUAUC66.33943408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3723446CCCATTCACCAAAATTATCGATAATTTTGGTGAATGGG0.306700.127100.810300.750001.000001.00000


Target Position: 4704, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4704GCUAUGUUACUAUUUUCUA94.2864183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4894722GCTATGTTACTATTTTCTATAGAAAATAGTAACATAGC0.242800.128100.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4702-4724TTGCTATGTTACTATTTTCTACAUAGAAAAUAGUAACAUAGCAAGCUAUGUUACUAUUUUCUACAU5.311.622


Target Position: 2861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2861CAGAAACUGGCAGAAAUGA82.03361247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2859-2881AGCAGAAACTGGCAGAAATGACTUCAUUUCUGCCAGUUUCUGCUCAGAAACUGGCAGAAAUGACUU12.017.712


Target Position: 4713, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4713CUAUUUUCUACAAUUAAUA90.6709386

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4711-4733TACTATTTTCTACAATTAATAGTUAUUAAUUGUAGAAAAUAGUACUAUUUUCUACAAUUAAUAGUU-10.32.122


Target Position: 1125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125GAUACGAAGAAAUUUAUCU85.3459882

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1123-1145ACGATACGAAGAAATTTATCTTAAGAUAAAUUUCUUCGUAUCGUGAUACGAAGAAAUUUAUCUUAU1.816.533


Target Position: 329, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329CCUGAUUUUACUGCAUUAU76.01172093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
327-349AACCTGATTTTACTGCATTATGTAUAAUGCAGUAAAAUCAGGUUCCUGAUUUUACUGCAUUAUGUU21.112.022


Target Position: 962, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962CAACUAGAAAAUGAUACAA92.5767269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
960-982AACAACTAGAAAATGATACAAGAUUGUAUCAUUUUCUAGUUGUUCAACUAGAAAAUGAUACAAGAU21.518.922


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700UCCAGAAAAUAAAUCAGAU80.6111438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752718TCCAGAAAATAAATCAGATATCTGATTTATTTTCTGGA0.155300.051500.689700.750001.000001.00000


Target Position: 3861, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861GAAGAAUUAAGAUACAAAU93.0621246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923879GAAGAATTAAGATACAAATATTTGTATCTTAATTCTTC0.131000.049700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3859-3881CTGAAGAATTAAGATACAAATTAAUUUGUAUCUUAAUUCUUCAGGAAGAAUUAAGAUACAAAUUAU6.95.321


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046GCCACAUUUAAUAUCUUCA88.7105526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053064GCCACATTTAATATCTTCATGAAGATATTAAATGTGGC0.173000.048500.775900.750001.000001.00000


Target Position: 3932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3932CAUAGAGAUUUGUCUAAUU94.6872161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3930-3952TTCATAGAGATTTGTCTAATTGCAAUUAGACAAAUCUCUAUGAACAUAGAGAUUUGUCUAAUUGCU14.520.222


Target Position: 4172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4172CUGAUUUUGUGCAAAAGCU76.56882011

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4170-4192ATCTGATTTTGTGCAAAAGCTTCAGCUUUUGCACAAAAUCAGAUCUGAUUUUGUGCAAAAGCUUCU18.67.422


Target Position: 1858, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CUCAGAUUCACCUUUAUUU81.60011299

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5185819CTCAGATTCACCTTTATTT1/1/0/097.75RB1NM_000321.21NANANA13:48955576,49027129..48955579,49027143(+)00RB1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1856-1878CTCTCAGATTCACCTTTATTTGAAAAUAAAGGUGAAUCUGAGAGCUCAGAUUCACCUUUAUUUGAU-4.320.413


Target Position: 3445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3445UCCUGAACUCUUCUGCAAA82.06211243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8993463TCCTGAACTCTTCTGCAAATTTGCAGAAGAGTTCAGGA0.650000.621800.870700.750001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225ACAGAGAACACCACGAAAA85.0185914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561243ACAGAGAACACCACGAAAATTTTCGTGGTGTTCTCTGT0.541400.156100.706900.750001.000001.00000


Target Position: 2286, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286CCAUGUAUGGCAUAUGCAA94.9205147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2284-2306TTCCATGTATGGCATATGCAAAGUUGCAUAUGCCAUACAUGGAACCAUGUAUGGCAUAUGCAAAGU21.113.333


Target Position: 702, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702GUUCGAUAUCUACUGAAAU87.9641607

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
700-722CAGTTCGATATCTACTGAAATAAAUUUCAGUAGAUAUCGAACUGGUUCGAUAUCUACUGAAAUAAU19.217.932


Target Position: 669, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669CAUGUGAACUUAUAUAUUU93.0669245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852687CATGTGAACTTATATATTTAAATATATAAGTTCACATG0.359300.028000.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
667-689GACATGTGAACTTATATATTTGAAAAUAUAUAAGUUCACAUGUCCAUGUGAACUUAUAUAUUUGAU-8.620.522


Target Position: 754, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754CACAUUUUUAUUAGCUAAA85.7816828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
938772CACATTTTTATTAGCTAAATTTAGCTAATAAAAATGTG0.123100.058600.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
752-774ATCACATTTTTATTAGCTAAAGGUUUAGCUAAUAAAAAUGUGAUCACAUUUUUAUUAGCUAAAGGU19.55.322


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719UGAAUGUGCUUAAUUUAAA86.5824734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541737TGAATGTGCTTAATTTAAATTTAAATTAAGCACATTCA0.119700.043400.724100.750001.000001.00000


Target Position: 1522, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522GUAUUACCGAGUAAUGGAA90.7813380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1520-1542TTGTATTACCGAGTAATGGAATCUUCCAUUACUCGGUAAUACAAGUAUUACCGAGUAAUGGAAUCU21.215.333


Target Position: 172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172GCCCAAAACCCCCCGAAAA77.83071823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
21190GCCCAAAACCCCCCGAAAATTTTCGGGGGGTTTTGGGC0.797000.727001.000001.000001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941AGGAGUGCACGGAUAGCAA89.7667442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867959AGGAGTGCACGGATAGCAATTGCTATCCGTGCACTCCT0.137200.027400.698300.750000.902200.62500


Target Position: 2414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414GAUUCUAUUAUAGUAUUCU87.349664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2412-2434ATGATTCTATTATAGTATTCTATAGAAUACUAUAAUAGAAUCAUGAUUCUAUUAUAGUAUUCUAUU14.56.633


Target Position: 1030, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030GAAAAAUGUUUAUUUCAAA99.582637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611048GAAAAATGTTTATTTCAAATTTGAAATAAACATTTTTC0.264600.022300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1028-1050GTGAAAAATGTTTATTTCAAAAAUUUGAAAUAAACAUUUUUCACGAAAAAUGUUUAUUUCAAAAAU7.4-3.321


Target Position: 4298, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4298CUUAAAAUAGGGGAUAUUU78.72851698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124316CTTAAAATAGGGGATATTTAAATATCCCCTATTTTAAG0.226300.030200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4296-4318AACTTAAAATAGGGGATATTTAAAAAUAUCCCCUAUUUUAAGUUCUUAAAAUAGGGGAUAUUUAAU15.4-9.722


Target Position: 3422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3422UGACUGCCCAUUCACCAAA76.77081982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4713440TGACTGCCCATTCACCAAATTTGGTGAATGGGCAGTCA0.362100.137700.724100.750001.000001.00000


Target Position: 3406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3406CCAAAUGCAAUUUGAUUGA77.5441870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3404-3426TTCCAAATGCAATTTGATTGACTUCAAUCAAAUUGCAUUUGGAACCAAAUGCAAUUUGAUUGACUU13.820.022


Target Position: 4659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4659GCUUUAUUGCUUUUUUGUA90.3323407

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4657-4679TTGCTTTATTGCTTTTTTGTATTUACAAAAAAGCAAUAAAGCAAGCUUUAUUGCUUUUUUGUAUUU5.6-4.322


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174CCUGCCAUUUAAAAAGUUG68.6633140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153192CCTGCCATTTAAAAAGTTGCAACTTTTTAAATGGCAGG0.159200.030100.698300.750001.000001.00000


Target Position: 3689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689GUUUUUAAAUGAGGAUUAU82.20011221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3687-3709ATGTTTTTAAATGAGGATTATTGAUAAUCCUCAUUUAAAAACAUGUUUUUAAAUGAGGAUUAUUGU19.9-9.122


Target Position: 2387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387CGUGUUUUGAUCAAAGAAG72.80882576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852405CGTGTTTTGATCAAAGAAGCTTCTTTGATCAAAACACG0.293800.020900.637900.750001.000001.00000


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386GCACAGUGAAUCCAAAAGA86.0723788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521404GCACAGTGAATCCAAAAGATCTTTTGGATTCACTGTGC0.392200.059400.629300.750001.000001.00000


Target Position: 4505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4505GCAUGAAUAUCAUACAAAU100.34329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4503-4525CTGCATGAATATCATACAAATCAAUUUGUAUGAUAUUCAUGCAGGCAUGAAUAUCAUACAAAUCAU6.913.623


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369ACAUGAACACCCUUAGAAA95.2199136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6433387ACATGAACACCCTTAGAAATTTCTAAGGGTGTTCATGT0.368300.045100.706900.750001.000001.00000


Target Position: 3597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3597GUAUAACCAUAUGAUACUA98.811647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3595-3617AAGTATAACCATATGATACTATCUAGUAUCAUAUGGUUAUACUUGUAUAACCAUAUGAUACUAUCU20.315.333


Target Position: 865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865GUUGCUCAAAGAACCAUAU811381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936883GTTGCTCAAAGAACCATATATATGGTTCTTTGAGCAAC0.236200.128100.603400.750000.918500.87500


Target Position: 1717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1717UCUGAAUGUGCUUAAUUUA84.20121003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411735TCTGAATGTGCTTAATTTATAAATTAAGCACATTCAGA0.304300.095200.689700.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864UGUUGCUCAAAGAACCAUA82.07321240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606882TGTTGCTCAAAGAACCATATATGGTTCTTTGAGCAACA0.232000.082700.663800.750000.918501.00000


Target Position: 171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171CGCCCAAAACCCCCCGAAA78.57221719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103189CGCCCAAAACCCCCCGAAATTTCGGGGGGTTTTGGGCG0.803400.389000.922401.000001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435GUUAUAUUCAAAAGAAAAA88.3273568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709453GTTATATTCAAAAGAAAAATTTTTCTTTTGAATATAAC0.556400.110200.646600.750000.994600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
433-455AGGTTATATTCAAAAGAAAAAGGUUUUUCUUUUGAAUAUAACCUGUUAUAUUCAAAAGAAAAAGGU5.5-8.021


Target Position: 1427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427GAUAUAGGAUACAUCUUUA107.8453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1425-1447AGGATATAGGATACATCTTTAAAUAAAGAUGUAUCCUAUAUCCUGAUAUAGGAUACAUCUUUAAAU12.012.222


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413UGAAAAGAGUGAAGGAUAU80.9621390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681431TGAAAAGAGTGAAGGATATATATCCTTCACTCTTTTCA0.365300.082600.681000.750001.000001.00000


Target Position: 596, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596GUUGAUAAUGCUAUGUCAA92.8967258

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
594-616AAGTTGATAATGCTATGTCAAGAUUGACAUAGCAUUAUCAACUUGUUGAUAAUGCUAUGUCAAGAU21.58.922


Target Position: 48, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
48CGUUGAAAUUAUUUUUGUA101.54924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96066CGTTGAAATTATTTTTGTATACAAAAATAATTTCAACG0.161900.110100.594801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
46-68GACGTTGAAATTATTTTTGTAACUACAAAAAUAAUUUCAACGUCCGUUGAAAUUAUUUUUGUAACU5.614.922


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830GUCCUUGACUAUUUUAUUA93.7898208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449848GTCCTTGACTATTTTATTATAATAAAATAGTCAAGGAC0.383700.067700.784500.750001.000001.00000


Target Position: 999, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999GUAAAGAACAUGAAUGUAA93.5553217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031017GTAAAGAACATGAATGTAATTACATTCATGTTCTTTAC0.380800.151100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
997-1019CTGTAAAGAACATGAATGTAATAUUACAUUCAUGUUCUUUACAGGUAAAGAACAUGAAUGUAAUAU16.17.122


Target Position: 1398, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398CAAAAGAAAGUAUACUGAA96.915680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1396-1418TCCAAAAGAAAGTATACTGAAAAUUCAGUAUACUUUCUUUUGGACAAAAGAAAGUAUACUGAAAAU20.35.522


Target Position: 3202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3202GUUUCCUCUUCCAAAGUAA90.4645400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103220GTTTCCTCTTCCAAAGTAATTACTTTGGAAGAGGAAAC0.442000.288000.612100.750000.978300.87500


Target Position: 3477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3477AGAAAUUAGAAAAAAAUUA86.465751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053495AGAAATTAGAAAAAAATTATAATTTTTTTCTAATTTCT0.367800.050100.689700.750001.000001.00000


Target Position: 2933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2933UCAAACAAGGAAGAGAAAU63.69273669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732951TCAAACAAGGAAGAGAAATATTTCTCTTCCTTGTTTGA0.117300.079500.715500.750001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594UCUGAAUGACAACAUUUUU74.40932343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351612TCTGAATGACAACATTTTTAAAAATGTTGTCATTCAGA0.493500.023900.724100.750000.983700.87500


Target Position: 2189, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2189GAAUUAGAACAUAUCAUCU93.8325206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2187-2209CAGAATTAGAACATATCATCTGGAGAUGAUAUGUUCUAAUUCUGGAAUUAGAACAUAUCAUCUGGU17.46.932


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CUUCAUCCAACUUAUGUUU76.07082084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453692CTTCATCCAACTTATGTTTAAACATAAGTTGGATGAAG0.205300.089500.637900.750001.000001.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295GCAUAUGCAAAGUGAAGAA95.2965130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962313GCATATGCAAAGTGAAGAATTCTTCACTTTGCATATGC0.113600.030000.681001.000001.000001.00000


Target Position: 3890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3890CCAUAAACAGACUGUUAAU91.3684345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3888-3910CTCCATAAACAGACTGTTAATTAAUUAACAGUCUGUUUAUGGAGCCAUAAACAGACUGUUAAUUAU11.86.932


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903GUUAAUUAUAGGAGCCUUA88.8612509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8963921GTTAATTATAGGAGCCTTATAAGGCTCCTATAATTAAC0.154900.036200.612100.750001.000001.00000


Target Position: 3125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125GAAAUGUUAGUCAUUGUUA95.7151115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3123-3145TTGAAATGTTAGTCATTGTTATTUAACAAUGACUAACAUUUCAAGAAAUGUUAGUCAUUGUUAUUU12.15.322


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516CACAUUCCUCGAAGCCCUU74.17942375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9512534CACATTCCTCGAAGCCCTTAAGGGCTTCGAGGAATGTG0.120500.117600.655200.750001.000001.00000


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713GGAUUCUGAAUGUGCUUAA93.5113219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481731GGATTCTGAATGTGCTTAATTAAGCACATTCAGAATCC0.219000.061400.836201.000001.000001.00000


Target Position: 527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527CAGAAAAACAUAGAAAUCA87.3559661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
525-547TACAGAAAAACATAGAAATCAGTUGAUUUCUAUGUUUUUCUGUACAGAAAAACAUAGAAAUCAGUU14.85.512


Target Position: 4668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4668CUUUUUUGUAUUGGUUAAA76.99791950

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4666-4688TGCTTTTTTGTATTGGTTAAAACUUUAACCAAUACAAAAAAGCACUUUUUUGUAUUGGUUAAAACU20.0-2.921


Target Position: 3505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3505CACAUUAGAUUUUAUUUUA96.269796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653523CACATTAGATTTTATTTTATAAAATAAAATCTAATGTG0.117900.055200.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3503-3525TACACATTAGATTTTATTTTACTUAAAAUAAAAUCUAAUGUGUACACAUUAGAUUUUAUUUUACUU-9.711.622


Target Position: 802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GGUGAUUUCAUUUCAGUUA91.963302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
800-822CTGGTGATTTCATTTCAGTTAATUAACUGAAAUGAAAUCACCAGGGUGAUUUCAUUUCAGUUAAUU19.214.822


Target Position: 1877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GAUCUUAUUAAACAAUCAA96.0204108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1875-1897TTGATCTTATTAAACAATCAAAGUUGAUUGUUUAAUAAGAUCAAGAUCUUAUUAAACAAUCAAAGU20.56.622


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294GGCAUAUGCAAAGUGAAGA82.91141135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972312GGCATATGCAAAGTGAAGATCTTCACTTTGCATATGCC0.129800.032600.775900.750000.994600.75000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951GGAUAGCAAAACAACUAGA93.3568227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662969GGATAGCAAAACAACTAGATCTAGTTGTTTTGCTATCC0.437000.139800.646600.750000.907600.62500


Target Position: 3351, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351GUAUAUUUUUUUAAUUUAA95.0636141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903369GTATATTTTTTTAATTTAATTAAATTAAAAAAATATAC0.510500.261600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3349-3371ATGTATATTTTTTTAATTTAACAUUAAAUUAAAAAAAUAUACAUGUAUAUUUUUUUAAUUUAACAU-7.5-8.012


Target Position: 968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968GAAAAUGAUACAAGAAUUA94.0497194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
966-988TAGAAAATGATACAAGAATTATTUAAUUCUUGUAUCAUUUUCUAGAAAAUGAUACAAGAAUUAUUU5.37.421


Target Position: 4071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4071GUCAGUAUGGUCUAACACU84.12881009

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4069-4091AAGTCAGTATGGTCTAACACTGGAGUGUUAGACCAUACUGACUUGUCAGUAUGGUCUAACACUGGU19.020.332


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GUGUCCUUGACUAUUUUAU79.2471625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
611846GTGTCCTTGACTATTTTATATAAAATAGTCAAGGACAC0.245400.048600.750000.750000.962000.75000


Target Position: 3593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593CAAAGUAUAACCAUAUGAU93.3961225

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3591-3613AGCAAAGTATAACCATATGATACAUCAUAUGGUUAUACUUUGCUCAAAGUAUAACCAUAUGAUACU14.94.632


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044UCAAAAAUUUUAUACCUUU76.11882076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9191062TCAAAAATTTTATACCTTTAAAGGTATAAAATTTTTGA0.126400.074100.724100.750001.000001.00000


Target Position: 1601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601GACAACAUUUUUCAUAUGU77.54511869

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1599-1621ATGACAACATTTTTCATATGTCTACAUAUGAAAAAUGUUGUCAUGACAACAUUUUUCAUAUGUCUU14.919.321


Target Position: 4180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4180GUGCAAAAGCUUCAAAUUA89.1941488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4178-4200TTGTGCAAAAGCTTCAAATTAAAUAAUUUGAAGCUUUUGCACAAGUGCAAAAGCUUCAAAUUAAAU7.420.032


Target Position: 2410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410GUAUGAUUCUAUUAUAGUA107.8334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2408-2430GAGTATGATTCTATTATAGTATTUACUAUAAUAGAAUCAUACUCGUAUGAUUCUAUUAUAGUAUUU6.38.732


Target Position: 4735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4735UGUCUAUUUUAAAAUAAAU83.31681092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124753TGTCTATTTTAAAATAAATATTTATTTTAAAATAGACA0.147400.071300.698300.750001.000001.00000


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622UGCCAACACCAACAAAAAU74.13952380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072640TGCCAACACCAACAAAAATATTTTTGTTGGTGTTGGCA0.445900.283700.844800.750001.000001.00000


Target Position: 3323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3323GUUUGCUCUUGUUUUUAUU80.09221501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393341GTTTGCTCTTGTTTTTATTAATAAAAACAAGAGCAAAC0.140900.076600.637900.750001.000001.00000


Target Position: 4340, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4340GGAAAAUCACUUUGUCUAA97.934662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794358GGAAAATCACTTTGTCTAATTAGACAAAGTGATTTTCC0.133200.057600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4338-4360TAGGAAAATCACTTTGTCTAACTUUAGACAAAGUGAUUUUCCUAGGAAAAUCACUUUGUCUAACUU20.310.433


Target Position: 1358, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GAAAAUCUGAUUUCCUAUU81.65881289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781376GAAAATCTGATTTCCTATTAATAGGAAATCAGATTTTC0.732400.032300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1356-1378CAGAAAATCTGATTTCCTATTTTAAUAGGAAAUCAGAUUUUCUGGAAAAUCUGAUUUCCUAUUUUU19.95.322


Target Position: 4359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4359CUCAGAAUUAUUUUUAAAA88.8604510

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4357-4379AACTCAGAATTATTTTTAAAAAGUUUUAAAAAUAAUUCUGAGUUCUCAGAAUUAUUUUUAAAAAGU-9.120.422


Target Position: 2102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102UCUCUUUCACUGUUUUAUA83.20611111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642120TCTCTTTCACTGTTTTATATATAAAACAGTGAAAGAGA0.471400.225500.681000.750001.000001.00000


Target Position: 3889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889UCCAUAAACAGACUGUUAA79.43461602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543907TCCATAAACAGACTGTTAATTAACAGTCTGTTTATGGA0.138300.040400.836200.750001.000001.00000


Target Position: 2778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2778CACUGAAAAAACUACGCUU86.2679769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572796CACTGAAAAAACTACGCTTAAGCGTAGTTTTTTCAGTG0.158600.048800.655200.750001.000001.00000


Target Position: 3425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3425CUGCCCAUUCACCAAAAUU74.88022266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783443CTGCCCATTCACCAAAATTAATTTTGGTGAATGGGCAG0.367800.107700.775900.750001.000001.00000


Target Position: 4593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4593GCCAGAAUUUUAGGAACUU78.81161691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5574611GCCAGAATTTTAGGAACTTAAGTTCCTAAAATTCTGGC0.226500.054100.862101.000001.000001.00000


Target Position: 3680, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3680CCAACUUAUGUUUUUAAAU82.23561213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9983698CCAACTTATGTTTTTAAATATTTAAAAACATAAGTTGG0.113600.035600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3678-3700ATCCAACTTATGTTTTTAAATGAAUUUAAAAACAUAAGUUGGAUCCAACUUAUGUUUUUAAAUGAU-9.111.822


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185CCCAGAAUUAGAACAUAUC73.15212517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612203CCCAGAATTAGAACATATCGATATGTTCTAATTCTGGG0.288900.066400.810300.750001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434GGUUAUAUUCAAAAGAAAA100.12332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284452GGTTATATTCAAAAGAAAATTTTCTTTTGAATATAACC0.533500.100100.853401.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
432-454GAGGTTATATTCAAAAGAAAAAGUUUUCUUUUGAAUAUAACCUCGGUUAUAUUCAAAAGAAAAAGU5.51.121


Target Position: 3621, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621CUACUGAAACAGAUUUCAU88.5255550

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3619-3641TACTACTGAAACAGATTTCATACAUGAAAUCUGUUUCAGUAGUACUACUGAAACAGAUUUCAUACU16.320.322


Target Position: 3134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3134GUCAUUGUUAUUUAUACAA87.7157628

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3132-3154TAGTCATTGTTATTTATACAAGAUUGUAUAAAUAACAAUGACUAGUCAUUGUUAUUUAUACAAGAU8.520.522


Target Position: 1592, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CUUCUGAAUGACAACAUUU83.87641050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881610CTTCTGAATGACAACATTTAAATGTTGTCATTCAGAAG0.513700.020800.637900.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1590-1612AACTTCTGAATGACAACATTTTTAAAUGUUGUCAUUCAGAAGUUCUUCUGAAUGACAACAUUUUUU12.120.422


Target Position: 462, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462GGGGAAUCUGUAUCUUUAU89.5731459

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_246219GGGGAATCTGTATCTTTAT1/1/0/097.75RB1NM_000321.21NANANA13:48916766..48916784(+)00RB1(0.002)


Target Position: 1565, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565CGAUUAUCCAUUCAAAAUU83.52711079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531583CGATTATCCATTCAAAATTAATTTTGAATGGATAATCG0.259300.067100.784501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1563-1585AACGATTATCCATTCAAAATTTTAAUUUUGAAUGGAUAAUCGUUCGAUUAUCCAUUCAAAAUUUUU7.411.633


Target Position: 4095, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4095GUUCAAAGCCACAUUAUUU87.8877614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6974113GTTCAAAGCCACATTATTTAAATAATGTGGCTTTGAAC0.281700.071700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4093-4115ATGTTCAAAGCCACATTATTTCTAAAUAAUGUGGCUUUGAACAUGUUCAAAGCCACAUUAUUUCUU-1.812.212


Target Position: 4681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4681GUUAAAACUGUACAUUUAA91.3897342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4679-4701TGGTTAAAACTGTACATTTAAAAUUAAAUGUACAGUUUUAACCAGUUAAAACUGUACAUUUAAAAU6.90.011


Target Position: 1603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603CAACAUUUUUCAUAUGUCU86.5783735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1601-1623GACAACATTTTTCATATGTCTTTAGACAUAUGAAAAAUGUUGUCCAACAUUUUUCAUAUGUCUUUU16.05.322


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392UGAAUCCAAAAGAAAGUAU72.20192653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481410TGAATCCAAAAGAAAGTATATACTTTCTTTTGGATTCA0.139900.068600.681000.750001.000001.00000


Target Position: 3936, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936GAGAUUUGUCUAAUUGCAU87.4796646

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3934-3956TAGAGATTTGTCTAATTGCATCTAUGCAAUUAGACAAAUCUCUAGAGAUUUGUCUAAUUGCAUCUU20.012.023


Target Position: 3447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3447CUGAACUCUUCUGCAAAAA79.37851608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623465CTGAACTCTTCTGCAAAAATTTTTGCAGAAGAGTTCAG0.641200.602800.784500.750001.000001.00000


Target Position: 4157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4157CAUUAAUGUUUCUAUCUGA99.783335

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4155-4177GGCATTAATGTTTCTATCTGATTUCAGAUAGAAACAUUAAUGCCCAUUAAUGUUUCUAUCUGAUUU17.8-1.822


Target Position: 4013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4013CAUGUCUUCCAUGUAUCUU78.78741694

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4011-4033TACATGTCTTCCATGTATCTTTTAAGAUACAUGGAAGACAUGUACAUGUCUUCCAUGUAUCUUUUU20.319.222


Target Position: 4732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4732GUUUGUCUAUUUUAAAAUA95.7862113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9534750GTTTGTCTATTTTAAAATATATTTTAAAATAGACAAAC0.264400.112100.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4730-4752TAGTTTGTCTATTTTAAAATAAAUAUUUUAAAAUAGACAAACUAGUUUGUCUAUUUUAAAAUAAAU-9.719.222


Target Position: 3721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721GGUUUUUAUACCAUUCAGA90.107423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3719-3741TTGGTTTTTATACCATTCAGATCUCUGAAUGGUAUAAAAACCAAGGUUUUUAUACCAUUCAGAUCU18.10.023


Target Position: 1789, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789CUUGACAAGAGAAAUGAUA84.7552939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651807CTTGACAAGAGAAATGATATATCATTTCTCTTGTCAAG0.158500.059700.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1787-1809AACTTGACAAGAGAAATGATAAAUAUCAUUUCUCUUGUCAAGUUCUUGACAAGAGAAAUGAUAAAU7.220.522


Target Position: 2418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418CUAUUAUAGUAUUCUAUAA104.6087

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2416-2438TTCTATTATAGTATTCTATAACTUUAUAGAAUACUAUAAUAGAACUAUUAUAGUAUUCUAUAACUU8.4-5.923


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258AGGCAUUUGGACCAAAUUA84.239998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272276AGGCATTTGGACCAAATTATAATTTGGTCCAAATGCCT0.144000.074800.810300.750000.913000.62500


Target Position: 1130, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130GAAGAAAUUUAUCUUAAAA101.87223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871148GAAGAAATTTATCTTAAAATTTTAAGATAAATTTCTTC0.199800.040400.672400.750000.934800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1128-1150ACGAAGAAATTTATCTTAAAAATUUUUAAGAUAAAUUUCUUCGUGAAGAAAUUUAUCUUAAAAAUU7.15.322


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226CAGAGAACACCACGAAAAA94.2125186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181244CAGAGAACACCACGAAAAATTTTTCGTGGTGTTCTCTG0.529600.157100.784500.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080CCAGAAGCCAUUGAAAUCU72.09122676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782098CCAGAAGCCATTGAAATCTAGATTTCAATGGCTTCTGG0.149900.027300.620700.750001.000001.00000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492CCCCCUACCUUGUCACCAA88.5498546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102510CCCCCTACCTTGTCACCAATTGGTGACAAGGTAGGGGG0.286000.127800.844801.000000.989100.62500


Target Position: 1286, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286CCAGUUAGGACUGUUAUGA80.75471414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1284-1306CTCCAGTTAGGACTGTTATGAACUCAUAACAGUCCUAACUGGAGCCAGUUAGGACUGUUAUGAACU13.516.423


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078ACCCAGAAGCCAUUGAAAU73.63522447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632096ACCCAGAAGCCATTGAAATATTTCAATGGCTTCTGGGT0.150800.027500.844800.750001.000001.00000


Target Position: 1718, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718CUGAAUGUGCUUAAUUUAA87.4641647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861736CTGAATGTGCTTAATTTAATTAAATTAAGCACATTCAG0.153700.060500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1716-1738TTCTGAATGTGCTTAATTTAAAAUUAAAUUAAGCACAUUCAGAACUGAAUGUGCUUAAUUUAAAAU-7.520.532


Target Position: 836, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836GACUAUUUUAUUAAACUCU84.09081014

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
834-856TTGACTATTTTATTAAACTCTCAAGAGUUUAAUAAAAUAGUCAAGACUAUUUUAUUAAACUCUCAU14.64.622


Target Position: 1433, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433GGAUACAUCUUUAAAGAGA94.037195

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1431-1453TAGGATACATCTTTAAAGAGAAAUCUCUUUAAAGAUGUAUCCUAGGAUACAUCUUUAAAGAGAAAU11.716.022


Target Position: 995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995CUCUGUAAAGAACAUGAAU84.04111023

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
993-1015TTCTCTGTAAAGAACATGAATGTAUUCAUGUUCUUUACAGAGAACUCUGUAAAGAACAUGAAUGUU20.520.322


Target Position: 1804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GAUAAAACAUUUAGAACGA88.7259525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1802-1824ATGATAAAACATTTAGAACGATGUCGUUCUAAAUGUUUUAUCAUGAUAAAACAUUUAGAACGAUGU20.9-0.322


Target Position: 1109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109GAAAAUCUUUCUAAACGAU90.0138429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1107-1129TTGAAAATCTTTCTAAACGATACAUCGUUUAGAAAGAUUUUCAAGAAAAUCUUUCUAAACGAUACU16.55.322


Target Position: 2701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2701CCAGAAAAUAAAUCAGAUG75.55352171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832719CCAGAAAATAAATCAGATGCATCTGATTTATTTTCTGG0.115900.040800.689700.750001.000001.00000


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086GCCAUUGAAAUCUACCUCU76.93741959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882104GCCATTGAAATCTACCTCTAGAGGTAGATTTCAATGGC0.818900.104800.775900.750001.000001.00000


Target Position: 1643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643GUUGUAAUGGCCACAUAUA93.4198223

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1641-1663AGGTTGTAATGGCCACATATAGCUAUAUGUGGCCAUUACAACCUGUUGUAAUGGCCACAUAUAGCU13.36.933


Target Position: 824, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CUAUGUGUCCUUGACUAUU81.46151319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
822-844TGCTATGTGTCCTTGACTATTTTAAUAGUCAAGGACACAUAGCACUAUGUGUCCUUGACUAUUUUU20.320.422


Target Position: 823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GCUAUGUGUCCUUGACUAU88.1323584

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
821-843ATGCTATGTGTCCTTGACTATTTAUAGUCAAGGACACAUAGCAUGCUAUGUGUCCUUGACUAUUUU20.317.933


Target Position: 2306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2306GUGAAGAAUAUAGACCUUA87.413655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6332324GTGAAGAATATAGACCTTATAAGGTCTATATTCTTCAC0.390600.077700.758600.750001.000001.00000


Target Position: 529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529GAAAAACAUAGAAAUCAGU83.22281109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
527-549CAGAAAAACATAGAAATCAGTGTACUGAUUUCUAUGUUUUUCUGGAAAAACAUAGAAAUCAGUGUU12.05.622


Target Position: 4620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4620GUGUAUUGAGAUUUCUUAA96.1146102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4618-4640TCGTGTATTGAGATTTCTTAAATUUAAGAAAUCUCAAUACACGAGUGUAUUGAGAUUUCUUAAAUU7.113.522


Target Position: 339, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339CUGCAUUAUGUCAGAAAUU80.78481410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809357CTGCATTATGTCAGAAATTAATTTCTGACATAATGCAG0.149800.043700.775900.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
337-359TACTGCATTATGTCAGAAATTAAAAUUUCUGACAUAAUGCAGUACUGCAUUAUGUCAGAAAUUAAU12.021.132


Target Position: 1253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253GAUGAAGAGGUGAAUGUAA99.578738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1251-1273TTGATGAAGAGGTGAATGTAATTUUACAUUCACCUCUUCAUCAAGAUGAAGAGGUGAAUGUAAUUU16.120.423


Target Position: 591, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591CCAAAGUUGAUAAUGCUAU80.5821443

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
589-611TACCAAAGTTGATAATGCTATGTAUAGCAUUAUCAACUUUGGUACCAAAGUUGAUAAUGCUAUGUU19.710.332


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545AGUGUCCAUAAAUUCUUUA83.50111080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773563AGTGTCCATAAATTCTTTATAAAGAATTTATGGACACT0.155300.038400.672400.750001.000001.00000


Target Position: 2694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694AGAAGUUCCAGAAAAUAAA89.454467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282712AGAAGTTCCAGAAAATAAATTTATTTTCTGGAACTTCT0.384800.073400.724100.750001.000001.00000


Target Position: 2105, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2105CUUUCACUGUUUUAUAAAA94.1772189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2103-2125CTCTTTCACTGTTTTATAAAAAAUUUUAUAAAACAGUGAAAGAGCUUUCACUGUUUUAUAAAAAAU-7.519.222


Target Position: 2899, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899GCAAAAGCAGAAAAUGAAU83.41881085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3192917GCAAAAGCAGAAAATGAATATTCATTTTCTGCTTTTGC0.384800.091500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2897-2919ATGCAAAAGCAGAAAATGAATGAAUUCAUUUUCUGCUUUUGCAUGCAAAAGCAGAAAAUGAAUGAU7.418.611


Target Position: 3121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121ACUUGAAAUGUUAGUCAUU81.11111371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7823139ACTTGAAATGTTAGTCATTAATGACTAACATTTCAAGT0.215700.073800.698300.750001.000001.00000


Target Position: 169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169GCCGCCCAAAACCCCCCGA56.85074213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343187GCCGCCCAAAACCCCCCGATCGGGGGGTTTTGGGCGGC0.792100.151800.706900.750001.000001.00000


Target Position: 4040, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4040GCAAUUGUCUAUUUAUCUU88.4256557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3064058GCAATTGTCTATTTATCTTAAGATAAATAGACAATTGC0.520900.277500.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4038-4060TGGCAATTGTCTATTTATCTTTTAAGAUAAAUAGACAAUUGCCAGCAAUUGUCUAUUUAUCUUUUU6.912.132


Target Position: 3006, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006CACAGAUGUGACUGUAUAA102.93315

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9300619CACAGATGTGACTGTATAA1/1/0/097.75RB1NM_000321.21NANANA13:49054260..49054278(+)00RB1(0.002)


Target Position: 1682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682CUUGAUUCUGGAACAGAUU77.8441821

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1680-1702ATCTTGATTCTGGAACAGATTTGAAUCUGUUCCAGAAUCAAGAUCUUGAUUCUGGAACAGAUUUGU19.216.322


Target Position: 3916, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3916GCCUUAAUUUUUUUUUCAU83.66071065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813934GCCTTAATTTTTTTTTCATATGAAAAAAAAATTAAGGC0.643500.491300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3914-3936GAGCCTTAATTTTTTTTTCATAGAUGAAAAAAAAAUUAAGGCUCGCCUUAAUUUUUUUUUCAUAGU7.710.911


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763GCAACCCUCCUAAACCACU73.12142525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572781GCAACCCTCCTAAACCACTAGTGGTTTAGGAGGGTTGC0.376000.134300.646600.750001.000001.00000


Target Position: 2320, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320CCUUAAAUUCAAAAUCAUU87.0838694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6042338CCTTAAATTCAAAATCATTAATGATTTTGAATTTAAGG0.202700.095600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2318-2340GACCTTAAATTCAAAATCATTGTAAUGAUUUUGAAUUUAAGGUCCCUUAAAUUCAAAAUCAUUGUU7.2-4.332


Target Position: 1759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759GAUCGAAAGUUUUAUCAAA102.46417

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1757-1779GTGATCGAAAGTTTTATCAAAGCUUUGAUAAAACUUUCGAUCACGAUCGAAAGUUUUAUCAAAGCU8.916.731


Target Position: 1668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668GUACAUCUCAGAAUCUUGA87.8929613

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1666-1688AAGTACATCTCAGAATCTTGATTUCAAGAUUCUGAGAUGUACUUGUACAUCUCAGAAUCUUGAUUU12.020.333


Target Position: 1869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869CUUUAUUUGAUCUUAUUAA91.8554312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1867-1889ACCTTTATTTGATCTTATTAAACUUAAUAAGAUCAAAUAAAGGUCUUUAUUUGAUCUUAUUAAACU-2.3-9.722


Target Position: 3830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3830CCAAGUGCACUUUCUAAUG72.11432668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633848CCAAGTGCACTTTCTAATGCATTAGAAAGTGCACTTGG0.118300.026900.689700.750001.000001.00000


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676UCAUCCAACUUAUGUUUUU72.17762659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273694TCATCCAACTTATGTTTTTAAAAACATAAGTTGGATGA0.197200.097600.724100.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860CAGAUUCACCUUUAUUUGA86.2462772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1858-1880CTCAGATTCACCTTTATTTGATCUCAAAUAAAGGUGAAUCUGAGCAGAUUCACCUUUAUUUGAUCU-1.420.432


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570GGGAACAUCUAUAUUUCAC78.33061748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672588GGGAACATCTATATTTCACGTGAAATATAGATGTTCCC0.391700.159400.698300.750001.000001.00000


Target Position: 2646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646CAAGAUCAAGAAUCUUAGU82.03621245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2644-2666TCCAAGATCAAGAATCTTAGTATACUAAGAUUCUUGAUCUUGGACAAGAUCAAGAAUCUUAGUAUU11.620.422


Target Position: 4349, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4349CUUUGUCUAACUCAGAAUU78.20521762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8084367CTTTGTCTAACTCAGAATTAATTCTGAGTTAGACAAAG0.161100.033300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4347-4369CACTTTGTCTAACTCAGAATTATAAUUCUGAGUUAGACAAAGUGCUUUGUCUAACUCAGAAUUAUU20.419.222


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319ACCUUAAAUUCAAAAUCAU82.35991196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932337ACCTTAAATTCAAAATCATATGATTTTGAATTTAAGGT0.331300.156500.698300.750001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173CCCAAAACCCCCCGAAAAA75.80642125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65191CCCAAAACCCCCCGAAAAATTTTTCGGGGGGTTTTGGG0.794300.749800.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
171-193CGCCCAAAACCCCCCGAAAAACGUUUUUCGGGGGGUUUUGGGCGCCCAAAACCCCCCGAAAAACGU20.718.822


Target Position: 4389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4389CUUGUUAGAAAACAAAAUU76.59722003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4387-4409GTCTTGTTAGAAAACAAAATTTTAAUUUUGUUUUCUAACAAGACCUUGUUAGAAAACAAAAUUUUU5.311.822


Target Position: 3119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3119CCACUUGAAAUGUUAGUCA87.717627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793137CCACTTGAAATGTTAGTCATGACTAACATTTCAAGTGG0.193200.073600.620700.750001.000001.00000


Target Position: 3459, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3459GCAAAAAUGGAUAUUAUUA95.7649114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993477GCAAAAATGGATATTATTATAATAATATCCATTTTTGC0.237500.088900.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3457-3479CTGCAAAAATGGATATTATTAGAUAAUAAUAUCCAUUUUUGCAGGCAAAAAUGGAUAUUAUUAGAU-8.0-3.322


Target Position: 3403, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3403CUUCCAAAUGCAAUUUGAU82.25541211

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3401-3423ATCTTCCAAATGCAATTTGATTGAUCAAAUUGCAUUUGGAAGAUCUUCCAAAUGCAAUUUGAUUGU7.420.122


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856ACCUCCCAUGUUGCUCAAA71.15322811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134874ACCTCCCATGTTGCTCAAATTTGAGCAACATGGGAGGT0.523800.433700.853400.750001.000001.00000


Target Position: 3068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068CUUUUUGUGGAUAUAAAAU80.67541428

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3066-3088CTCTTTTTGTGGATATAAAATGTAUUUUAUAUCCACAAAAAGAGCUUUUUGUGGAUAUAAAAUGUU-7.55.612


Target Position: 706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706GAUAUCUACUGAAAUAAAU91.7721317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
704-726TCGATATCTACTGAAATAAATTCAUUUAUUUCAGUAGAUAUCGAGAUAUCUACUGAAAUAAAUUCU-9.78.213


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310AGAAUAUAGACCUUAAAUU85.2844888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832328AGAATATAGACCTTAAATTAATTTAAGGTCTATATTCT0.337800.127000.715500.750001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946UGCACGGAUAGCAAAACAA80.97641386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535964TGCACGGATAGCAAAACAATTGTTTTGCTATCCGTGCA0.282400.056100.706900.750000.929300.62500


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553UCAGAAGAAGAACGAUUAU75.0082244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6891571TCAGAAGAAGAACGATTATATAATCGTTCTTCTTCTGA0.396600.221200.681000.750001.000001.00000


Target Position: 2767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2767CCCUCCUAAACCACUGAAA80.84551404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2172785CCCTCCTAAACCACTGAAATTTCAGTGGTTTAGGAGGG0.420100.192800.991401.000001.000001.00000


Target Position: 965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965CUAGAAAAUGAUACAAGAA96.258597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
963-985AACTAGAAAATGATACAAGAATTUUCUUGUAUCAUUUUCUAGUUCUAGAAAAUGAUACAAGAAUUU20.37.122


Target Position: 539, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GAAAUCAGUGUCCAUAAAU86.463752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
898557GAAATCAGTGTCCATAAATATTTATGGACACTGATTTC0.290400.026100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
537-559TAGAAATCAGTGTCCATAAATTCAUUUAUGGACACUGAUUUCUAGAAAUCAGUGUCCAUAAAUUCU12.812.022


Target Position: 1434, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434GAUACAUCUUUAAAGAGAA102.31419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1432-1454AGGATACATCTTTAAAGAGAAATUUCUCUUUAAAGAUGUAUCCUGAUACAUCUUUAAAGAGAAAUU19.116.032


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855CACCUCCCAUGUUGCUCAA85.232891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710873CACCTCCCATGTTGCTCAATTGAGCAACATGGGAGGTG0.513600.436400.646600.750001.000001.00000


Target Position: 3457, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3457CUGCAAAAAUGGAUAUUAU91.3632347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923475CTGCAAAAATGGATATTATATAATATCCATTTTTGCAG0.152100.085300.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3455-3477TTCTGCAAAAATGGATATTATTAAUAAUAUCCAUUUUUGCAGAACUGCAAAAAUGGAUAUUAUUAU3.520.022


Target Position: 619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GUUGAAGAAGUAUGAUGUA93.5043221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
617-639CTGTTGAAGAAGTATGATGTATTUACAUCAUACUUCUUCAACAGGUUGAAGAAGUAUGAUGUAUUU20.520.423


Target Position: 2308, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308GAAGAAUAUAGACCUUAAA97.672567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352326GAAGAATATAGACCTTAAATTTAAGGTCTATATTCTTC0.391500.157500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2306-2328GTGAAGAATATAGACCTTAAATTUUUAAGGUCUAUAUUCUUCACGAAGAAUAUAGACCUUAAAUUU18.66.922


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184ACCCAGAAUUAGAACAUAU85.8138819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672202ACCCAGAATTAGAACATATATATGTTCTAATTCTGGGT0.249800.053500.810300.750001.000001.00000


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520UGAGCUACAGAAAAACAUA89.9695432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695538TGAGCTACAGAAAAACATATATGTTTTTCTGTAGCTCA0.466900.184700.681000.750001.000001.00000


Target Position: 4037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4037CUGGCAAUUGUCUAUUUAU87.381658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894055CTGGCAATTGTCTATTTATATAAATAGACAATTGCCAG0.358300.031900.741400.750001.000001.00000


Target Position: 3350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350UGUAUAUUUUUUUAAUUUA87.5978639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5153368TGTATATTTTTTTAATTTATAAATTAAAAAAATATACA0.375200.294000.672400.750001.000001.00000


Target Position: 1303, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303GAACACUAUCCAACAAUUA94.7931157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621321GAACACTATCCAACAATTATAATTGTTGGATAGTGTTC0.492300.246700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1301-1323ATGAACACTATCCAACAATTAATUAAUUGUUGGAUAGUGUUCAUGAACACUAUCCAACAAUUAAUU5.319.023


Target Position: 3456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3456UCUGCAAAAAUGGAUAUUA78.78031695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703474TCTGCAAAAATGGATATTATAATATCCATTTTTGCAGA0.134900.072100.689700.750001.000001.00000


Target Position: 3496, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3496CUAAUUUUACACAUUAGAU87.229678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3494-3516TACTAATTTTACACATTAGATTTAUCUAAUGUGUAAAAUUAGUACUAAUUUUACACAUUAGAUUUU13.4-9.722


Target Position: 3426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3426UGCCCAUUCACCAAAAUUA81.39151332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923444TGCCCATTCACCAAAATTATAATTTTGGTGAATGGGCA0.316400.140600.819000.750001.000001.00000


Target Position: 4645, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4645CUUCAGAUAUUAUUGCUUU84.9333923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4643-4665TGCTTCAGATATTATTGCTTTATAAAGCAAUAAUAUCUGAAGCACUUCAGAUAUUAUUGCUUUAUU18.520.422


Target Position: 4559, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4559GGUCUUUUGCUACUAAGUU84.7844938

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4557-4579TGGGTCTTTTGCTACTAAGTTCAAACUUAGUAGCAAAAGACCCAGGUCUUUUGCUACUAAGUUCAU17.613.322


Target Position: 3318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318GUGAUGUUUGCUCUUGUUU75.07212237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7763336GTGATGTTTGCTCTTGTTTAAACAAGAGCAAACATCAC0.155100.077000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3316-3338AGGTGATGTTTGCTCTTGTTTTTAAACAAGAGCAAACAUCACCUGUGAUGUUUGCUCUUGUUUUUU19.220.512


Target Position: 2104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2104UCUUUCACUGUUUUAUAAA78.50691729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452122TCTTTCACTGTTTTATAAATTTATAAAACAGTGAAAGA0.577800.250800.724100.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338ACUGCAUUAUGUCAGAAAU83.45431083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
903356ACTGCATTATGTCAGAAATATTTCTGACATAATGCAGT0.128400.033100.698300.750000.962000.62500


Target Position: 1597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GAAUGACAACAUUUUUCAU95.2549135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1595-1617CTGAATGACAACATTTTTCATATAUGAAAAAUGUUGUCAUUCAGGAAUGACAACAUUUUUCAUAUU7.720.522


Target Position: 4709, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4709GUUACUAUUUUCUACAAUU89.7269446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7444727GTTACTATTTTCTACAATTAATTGTAGAAAATAGTAAC0.519500.129000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4707-4729ATGTTACTATTTTCTACAATTAAAAUUGUAGAAAAUAGUAACAUGUUACUAUUUUCUACAAUUAAU11.66.312


Target Position: 4244, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4244CUAAAGGUGUAUUUAAACU80.87511400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4242-4264ACCTAAAGGTGTATTTAAACTATAGUUUAAAUACACCUUUAGGUCUAAAGGUGUAUUUAAACUAUU0.018.621


Target Position: 4029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4029CUUUUGAACUGGCAAUUGU76.6691991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4027-4049ATCTTTTGAACTGGCAATTGTCTACAAUUGCCAGUUCAAAAGAUCUUUUGAACUGGCAAUUGUCUU20.07.722


Target Position: 3985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3985GAAGGUUUGUGUUUUCUCU87.1411688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3983-4005GGGAAGGTTTGTGTTTTCTCTGGAGAGAAAACACAAACCUUCCCGAAGGUUUGUGUUUUCUCUGGU14.817.322


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924UGAAUCUGCUUGUCCUCUU73.60462453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861942TGAATCTGCTTGTCCTCTTAAGAGGACAAGCAGATTCA0.164500.054600.586200.750001.000001.00000


Target Position: 803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GUGAUUUCAUUUCAGUUAA88.7879518

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
801-823TGGTGATTTCATTTCAGTTAATGUUAACUGAAAUGAAAUCACCAGUGAUUUCAUUUCAGUUAAUGU20.316.322


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307UGAAGAAUAUAGACCUUAA97.808265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422325TGAAGAATATAGACCTTAATTAAGGTCTATATTCTTCA0.495800.102100.689700.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518GCUUGUAUUACCGAGUAAU84.02791028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1516-1538TCGCTTGTATTACCGAGTAATGGAUUACUCGGUAAUACAAGCGAGCUUGUAUUACCGAGUAAUGGU20.911.623


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753UCACAUUUUUAUUAGCUAA86.7893714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956771TCACATTTTTATTAGCTAATTAGCTAATAAAAATGTGA0.119500.057900.689700.750001.000001.00000


Target Position: 3585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585GCUGGAAGCAAAGUAUAAC73.61242451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803603GCTGGAAGCAAAGTATAACGTTATACTTTGCTTCCAGC0.205300.035200.706900.750001.000001.00000


Target Position: 2287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287CAUGUAUGGCAUAUGCAAA97.503671

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2285-2307TCCATGTATGGCATATGCAAAGTUUUGCAUAUGCCAUACAUGGACAUGUAUGGCAUAUGCAAAGUU21.113.332


Target Position: 3329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3329UCUUGUUUUUAUUAAUUUA86.3368762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453347TCTTGTTTTTATTAATTTATAAATTAATAAAAACAAGA0.208000.111700.689700.750001.000001.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493CCCCUACCUUGUCACCAAU79.69071562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2202511CCCCTACCTTGTCACCAATATTGGTGACAAGGTAGGGG0.419500.137800.982801.000000.989100.62500


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286CUGACUACUUUGCCUUCUU79.45781598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7853304CTGACTACTTTGCCTTCTTAAGAAGGCAAAGTAGTCAG0.806200.056600.646600.750000.913000.75000


Target Position: 2772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772CUAAACCACUGAAAAAACU75.01482243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2770-2792TCCTAAACCACTGAAAAAACTACAGUUUUUUCAGUGGUUUAGGACUAAACCACUGAAAAAACUACU-1.820.022


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542CCAUGCUUAAAUCAGAAGA79.86381528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761560CCATGCTTAAATCAGAAGATCTTCTGATTTAAGCATGG0.341800.070100.620700.750001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182GCACCCAGAAUUAGAACAU80.4941455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502200GCACCCAGAATTAGAACATATGTTCTAATTCTGGGTGC0.255500.035200.698301.000001.000001.00000


Target Position: 3543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3543UGUGUGCUUGUUUUAUAAA82.85171143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8103561TGTGTGCTTGTTTTATAAATTTATAAAACAAGCACACA0.526800.366700.706900.750001.000001.00000


Target Position: 1556, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556GAAGAAGAACGAUUAUCCA94.3527179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1554-1576CAGAAGAAGAACGATTATCCATTUGGAUAAUCGUUCUUCUUCUGGAAGAAGAACGAUUAUCCAUUU15.419.122


Target Position: 4484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4484CUCCAUUUCAUCAUUGUUU75.65962152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4482-4504GACTCCATTTCATCATTGTTTCTAAACAAUGAUGAAAUGGAGUCCUCCAUUUCAUCAUUGUUUCUU12.120.122


Target Position: 2101, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101CUCUCUUUCACUGUUUUAU75.48372176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132119CTCTCTTTCACTGTTTTATATAAAACAGTGAAAGAGAG0.354100.214000.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2099-2121ACCTCTCTTTCACTGTTTTATAAAUAAAACAGUGAAAGAGAGGUCUCUCUUUCACUGUUUUAUAAU7.219.122


Target Position: 4418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4418CUCAUUUAAGUUUCAAACU71.58152751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4416-4438TGCTCATTTAAGTTTCAAACTTAAGUUUGAAACUUAAAUGAGCACUCAUUUAAGUUUCAAACUUAU14.98.932


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388ACAGUGAAUCCAAAAGAAA87.2942668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111406ACAGTGAATCCAAAAGAAATTTCTTTTGGATTCACTGT0.645500.047700.706900.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871CAAAGAACCAUAUAAAACA93.7783209

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
869-891CTCAAAGAACCATATAAAACAGCUGUUUUAUAUGGUUCUUUGAGCAAAGAACCAUAUAAAACAGCU-0.313.322


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CGGAUAGCAAAACAACUAG74.5342324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290968CGGATAGCAAAACAACTAGCTAGTTGTTTTGCTATCCG0.430200.130700.741400.750000.907600.62500


Target Position: 3140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GUUAUUUAUACAAGAUUGA82.27451204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3138-3160TTGTTATTTATACAAGATTGAAAUCAAUCUUGUAUAAAUAACAAGUUAUUUAUACAAGAUUGAAAU12.0-7.522


Target Position: 4056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4056CUUUUAUUUUUUUAAGUCA86.6127732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4054-4076ATCTTTTATTTTTTTAAGTCAGTUGACUUAAAAAAAUAAAAGAUCUUUUAUUUUUUUAAGUCAGUU14.6-9.721


Target Position: 4515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4515CAUACAAAUCAGUUAGUUU94.3696178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6464533CATACAAATCAGTTAGTTTAAACTAACTGATTTGTATG0.411100.252200.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4513-4535ATCATACAAATCAGTTAGTTTTTAAACUAACUGAUUUGUAUGAUCAUACAAAUCAGUUAGUUUUUU12.96.921


Target Position: 4446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446GACAGUUAUUUUGAUAACA90.1608418

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4444-4466TTGACAGTTATTTTGATAACAATUGUUAUCAAAAUAACUGUCAAGACAGUUAUUUUGAUAACAAUU16.119.022


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183CACCCAGAAUUAGAACAUA94.5228169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722201CACCCAGAATTAGAACATATATGTTCTAATTCTGGGTG0.242000.041600.750000.750001.000001.00000


Target Position: 3604, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3604CAUAUGAUACUAUCAUACU90.6057390

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3602-3624ACCATATGATACTATCATACTACAGUAUGAUAGUAUCAUAUGGUCAUAUGAUACUAUCAUACUACU16.08.532


Target Position: 3802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802GGUAUAGAGGACCCUAACA91.5602331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8843820GGTATAGAGGACCCTAACATGTTAGGGTCCTCTATACC0.176500.026700.646600.750000.994600.87500


Target Position: 4518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4518ACAAAUCAGUUAGUUUUUA81.2371357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5324536ACAAATCAGTTAGTTTTTATAAAAACTAACTGATTTGT0.395200.271900.672400.750001.000001.00000


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346AUGUCAGAAAUUAAAGAUA85.7621834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954364ATGTCAGAAATTAAAGATATATCTTTAATTTCTGACAT0.293000.039400.612100.500001.000001.00000


Target Position: 3423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3423GACUGCCCAUUCACCAAAA90.9798373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3153441GACTGCCCATTCACCAAAATTTTGGTGAATGGGCAGTC0.351600.182500.819000.750001.000001.00000


Target Position: 3398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3398UCUAUCUUCCAAAUGCAAU68.51173158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8013416TCTATCTTCCAAATGCAATATTGCATTTGGAAGATAGA0.487000.391100.715500.750001.000001.00000


Target Position: 4082, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4082CUAACACUGGCAUGUUCAA88.8425512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4080-4102GTCTAACACTGGCATGTTCAAAGUUGAACAUGCCAGUGUUAGACCUAACACUGGCAUGUUCAAAGU20.519.032


Target Position: 3209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209CUUCCAAAGUAAAAUUGCU77.84181822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3207-3229CTCTTCCAAAGTAAAATTGCTGTAGCAAUUUUACUUUGGAAGAGCUUCCAAAGUAAAAUUGCUGUU14.020.123


Target Position: 2388, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388GUGUUUUGAUCAAAGAAGA87.3393665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2386-2408ACGTGTTTTGATCAAAGAAGAGGUCUUCUUUGAUCAAAACACGUGUGUUUUGAUCAAAGAAGAGGU10.312.233


Target Position: 342, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342CAUUAUGUCAGAAAUUAAA95.7116116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631360CATTATGTCAGAAATTAAATTTAATTTCTGACATAATG0.548200.067200.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
340-362TGCATTATGTCAGAAATTAAAGAUUUAAUUUCUGACAUAAUGCACAUUAUGUCAGAAAUUAAAGAU-9.76.722


Target Position: 3039, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3039GUUUAUGGCCACAUUUAAU86.2049777

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3037-3059CTGTTTATGGCCACATTTAATATAUUAAAUGUGGCCAUAAACAGGUUUAUGGCCACAUUUAAUAUU-1.412.822


Target Position: 1606, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1606CAUUUUUCAUAUGUCUUUA92.3988279

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1604-1626AACATTTTTCATATGTCTTTATTUAAAGACAUAUGAAAAAUGUUCAUUUUUCAUAUGUCUUUAUUU19.20.422


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768CCUCCUAAACCACUGAAAA89.3847473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022786CCTCCTAAACCACTGAAAATTTTCAGTGGTTTAGGAGG0.434600.212400.844801.000001.000001.00000


Target Position: 4736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4736GUCUAUUUUAAAAUAAAUU80.99881382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4734-4756TTGTCTATTTTAAAATAAATTAGAAUUUAUUUUAAAAUAGACAAGUCUAUUUUAAAAUAAAUUAGU-10.36.911


Target Position: 4034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4034GAACUGGCAAUUGUCUAUU78.02051798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9734052GAACTGGCAATTGTCTATTAATAGACAATTGCCAGTTC0.309200.021800.663800.750001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743GUUUCUUGGAUCACAUUUU80.43671462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810761GTTTCTTGGATCACATTTTAAAATGTGATCCAAGAAAC0.149700.031300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
741-763AAGTTTCTTGGATCACATTTTTAAAAAUGUGAUCCAAGAAACUUGUUUCUUGGAUCACAUUUUUAU12.112.231


Target Position: 1562, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GAACGAUUAUCCAUUCAAA105.1245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1560-1582AAGAACGATTATCCATTCAAAATUUUGAAUGGAUAAUCGUUCUUGAACGAUUAUCCAUUCAAAAUU13.815.232


Target Position: 4355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4355CUAACUCAGAAUUAUUUUU79.69351561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4353-4375GTCTAACTCAGAATTATTTTTAAAAAAAUAAUUCUGAGUUAGACCUAACUCAGAAUUAUUUUUAAU-9.720.322


Target Position: 4427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4427GUUUCAAACUUACUAUUUU87.8339616

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4425-4447AAGTTTCAAACTTACTATTTTGAAAAAUAGUAAGUUUGAAACUUGUUUCAAACUUACUAUUUUGAU4.67.721


Target Position: 3767, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3767GUACUUGAAAAAGUAAAGU71.13032816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3765-3787TAGTACTTGAAAAAGTAAAGTGTACUUUACUUUUUCAAGUACUAGUACUUGAAAAAGUAAAGUGUU9.820.322


Target Position: 751, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751GAUCACAUUUUUAUUAGCU81.3031343

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
749-771TGGATCACATTTTTATTAGCTAAAGCUAAUAAAAAUGUGAUCCAGAUCACAUUUUUAUUAGCUAAU14.920.522


Target Position: 4106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4106CAUUAUUUCUAGUCCAAAA100.34628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9004124CATTATTTCTAGTCCAAAATTTTGGACTAGAAATAATG0.184700.127200.655200.750001.000001.00000


Target Position: 429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429UGGGAGGUUAUAUUCAAAA80.64231434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
887447TGGGAGGTTATATTCAAAATTTTGAATATAACCTCCCA0.131500.049500.844800.750001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGUUUAUUUCAAAAAUUUU76.12152075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771054TGTTTATTTCAAAAATTTTAAAATTTTTGAAATAAACA0.133700.021400.706900.750001.000001.00000


Target Position: 3864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3864GAAUUAAGAUACAAAUUAA110.8061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083882GAATTAAGATACAAATTAATTAATTTGTATCTTAATTC0.157600.030700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3862-3884AAGAATTAAGATACAAATTAATTUUAAUUUGUAUCUUAAUUCUUGAAUUAAGAUACAAAUUAAUUU-1.4-4.322


Target Position: 1797, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797GAGAAAUGAUAAAACAUUU93.1915238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1795-1817AAGAGAAATGATAAAACATTTAGAAAUGUUUUAUCAUUUCUCUUGAGAAAUGAUAAAACAUUUAGU5.312.021


Target Position: 4622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4622GUAUUGAGAUUUCUUAAAU89.182490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4620-4642GTGTATTGAGATTTCTTAAATAAAUUUAAGAAAUCUCAAUACACGUAUUGAGAUUUCUUAAAUAAU7.113.412


Target Position: 3731, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731CCAUUCAGAUCACUGAAUU83.75541058

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3729-3751TACCATTCAGATCACTGAATTTAAAUUCAGUGAUCUGAAUGGUACCAUUCAGAUCACUGAAUUUAU19.218.120


Target Position: 3153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153GAUUGAAAAUCUUGUGUAA103.43312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3151-3173AAGATTGAAAATCTTGTGTAAATUUACACAAGAUUUUCAAUCUUGAUUGAAAAUCUUGUGUAAAUU20.47.422


Target Position: 3699, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3699GAGGAUUAUUGAUAGUACU91.6351326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9283717GAGGATTATTGATAGTACTAGTACTATCAATAATCCTC0.383100.048600.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3697-3719ATGAGGATTATTGATAGTACTCTAGUACUAUCAAUAAUCCUCAUGAGGAUUAUUGAUAGUACUCUU14.219.923


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777AGCAGAAGGCAACUUGACA85.204894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981795AGCAGAAGGCAACTTGACATGTCAAGTTGCCTTCTGCT0.140800.043600.646600.500001.000001.00000


Target Position: 4363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4363GAAUUAUUUUUAAAAAGAA100.25631

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4361-4383CAGAATTATTTTTAAAAAGAAATUUCUUUUUAAAAAUAAUUCUGGAAUUAUUUUUAAAAAGAAAUU5.5-10.321


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784GGCAACUUGACAAGAGAAA83.95071041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231802GGCAACTTGACAAGAGAAATTTCTCTTGTCAAGTTGCC0.264800.047401.000001.000001.000001.00000


Target Position: 3393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3393UCCUAUCUAUCUUCCAAAU76.12192074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6593411TCCTATCTATCTTCCAAATATTTGGAAGATAGATAGGA0.669700.380800.862100.750001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925GAAUCUGCUUGUCCUCUUA98.228160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901943GAATCTGCTTGTCCTCTTATAAGAGGACAAGCAGATTC0.209100.058800.637900.750001.000001.00000


Target Position: 4680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4680GGUUAAAACUGUACAUUUA104.15110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4678-4700TTGGTTAAAACTGTACATTTAAAUAAAUGUACAGUUUUAACCAAGGUUAAAACUGUACAUUUAAAU6.90.012


Target Position: 3230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230GCUUUAUGGAUAGUAAGAA91.3653346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250GTGCTTTATGGATAGTAAGAATGUUCUUACUAUCCAUAAAGCACGCUUUAUGGAUAGUAAGAAUGU18.93.522


Target Position: 4594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4594CCAGAAUUUUAGGAACUUC73.14282519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344612CCAGAATTTTAGGAACTTCGAAGTTCCTAAAATTCTGG0.248400.066700.672400.750001.000001.00000


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003CCAAAGAAAAAAGGUUCAA78.62341713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852021CCAAAGAAAAAAGGTTCAATTGAACCTTTTTTCTTTGG0.244100.154500.698301.000001.000001.00000


Target Position: 3613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613CUAUCAUACUACUGAAACA100.25830

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3611-3633TACTATCATACTACTGAAACAGAUGUUUCAGUAGUAUGAUAGUACUAUCAUACUACUGAAACAGAU19.210.233


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GUUAUACCCAUUAAUGGUU76.60652000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913CTGTTATACCCATTAATGGTTCAAACCAUUAAUGGGUAUAACAGGUUAUACCCAUUAAUGGUUCAU20.015.313


Target Position: 952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952GAUAGCAAAACAACUAGAA92.1461294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
950-972CGGATAGCAAAACAACTAGAAAAUUCUAGUUGUUUUGCUAUCCGGAUAGCAAAACAACUAGAAAAU18.919.722


Target Position: 3065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065GCUCUUUUUGUGGAUAUAA89.1112495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3063-3085CAGCTCTTTTTGTGGATATAAAAUUAUAUCCACAAAAAGAGCUGGCUCUUUUUGUGGAUAUAAAAU16.710.332


Target Position: 3384, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3384GAAAAUGUGUCCUAUCUAU96.0496105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393402GAAAATGTGTCCTATCTATATAGATAGGACACATTTTC0.538700.064000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3382-3404TAGAAAATGTGTCCTATCTATCTAUAGAUAGGACACAUUUUCUAGAAAAUGUGUCCUAUCUAUCUU13.05.322


Target Position: 4330, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4330CUAGCUUUUAGGAAAAUCA86.6705723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4328-4350AGCTAGCTTTTAGGAAAATCACTUGAUUUUCCUAAAAGCUAGCUCUAGCUUUUAGGAAAAUCACUU10.418.331


Target Position: 3529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3529GGAAUCUGAUAUACUGUGU83.82371055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7703547GGAATCTGATATACTGTGTACACAGTATATCAGATTCC0.562600.032800.663800.750001.000001.00000


Target Position: 1239, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239GAAAAAGUAACCUUGAUGA89.8817434

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1237-1259ACGAAAAAGTAACCTTGATGAAGUCAUCAAGGUUACUUUUUCGUGAAAAAGUAACCUUGAUGAAGU18.13.221


Target Position: 4036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4036ACUGGCAAUUGUCUAUUUA85.7833826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9474054ACTGGCAATTGTCTATTTATAAATAGACAATTGCCAGT0.339800.022900.672400.750001.000001.00000


Target Position: 3370, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3370CAUGAACACCCUUAGAAAA95.2729133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623388CATGAACACCCTTAGAAAATTTTCTAAGGGTGTTCATG0.330600.046300.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3368-3390AACATGAACACCCTTAGAAAATGUUUUCUAAGGGUGUUCAUGUUCAUGAACACCCUUAGAAAAUGU7.120.522


Target Position: 2318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318GACCUUAAAUUCAAAAUCA94.9949142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2316-2338TAGACCTTAAATTCAAAATCATTUGAUUUUGAAUUUAAGGUCUAGACCUUAAAUUCAAAAUCAUUU7.418.632


Target Position: 4431, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4431CAAACUUACUAUUUUGACA94.2832185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4429-4451TTCAAACTTACTATTTTGACAGTUGUCAAAAUAGUAAGUUUGAACAAACUUACUAUUUUGACAGUU14.94.932


Target Position: 1426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426GGAUAUAGGAUACAUCUUU92.1069295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1424-1446AAGGATATAGGATACATCTTTAAAAAGAUGUAUCCUAUAUCCUUGGAUAUAGGAUACAUCUUUAAU19.28.223


Target Position: 4473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4473AGAAAACUUGACUCCAUUU82.19891222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7154491AGAAAACTTGACTCCATTTAAATGGAGTCAAGTTTTCT0.495900.135900.724100.750000.989100.62500


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332UGUUUUUAUUAAUUUAUAU83.69241062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6043350TGTTTTTATTAATTTATATATATAAATTAATAAAAACA0.274900.120600.663800.750001.000001.00000


Target Position: 3617, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3617CAUACUACUGAAACAGAUU88.2667574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9213635CATACTACTGAAACAGATTAATCTGTTTCAGTAGTATG0.259600.024800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3615-3637ATCATACTACTGAAACAGATTTCAAUCUGUUUCAGUAGUAUGAUCAUACUACUGAAACAGAUUUCU19.214.222


Target Position: 3770, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3770CUUGAAAAAGUAAAGUGUU79.32931614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3768-3790TACTTGAAAAAGTAAAGTGTTCTAACACUUUACUUUUUCAAGUACUUGAAAAAGUAAAGUGUUCUU17.87.722


Target Position: 2296, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296CAUAUGCAAAGUGAAGAAU78.89531679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2294-2316GGCATATGCAAAGTGAAGAATATAUUCUUCACUUUGCAUAUGCCCAUAUGCAAAGUGAAGAAUAUU20.421.123


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887ACAGCUGUUAUACCCAUUA81.68661286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579905ACAGCTGTTATACCCATTATAATGGGTATAACAGCTGT0.421100.223000.672400.750001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CAUAUAAAACAGCUGUUAU91.896305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
895897CATATAAAACAGCTGTTATATAACAGCTGTTTTATATG0.338600.223800.612100.750001.000001.00000


Target Position: 2898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898UGCAAAAGCAGAAAAUGAA83.06531119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632916TGCAAAAGCAGAAAATGAATTCATTTTCTGCTTTTGCA0.497200.087000.681000.750000.913000.62500


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949CCUCUCCAGAAUAAUCACA81.66881288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471967CCTCTCCAGAATAATCACATGTGATTATTCTGGAGAGG0.685900.253300.637900.750001.000001.00000


Target Position: 4183, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4183CAAAAGCUUCAAAUUAAAA91.6532325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9804201CAAAAGCTTCAAATTAAAATTTTAATTTGAAGCTTTTG0.798900.021300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4181-4203TGCAAAAGCTTCAAATTAAAACAUUUUAAUUUGAAGCUUUUGCACAAAAGCUUCAAAUUAAAACAU-9.717.022


Target Position: 391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
391GUUAACUUGGGAGAAAGUU69.12013069

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
389-411TGGTTAACTTGGGAGAAAGTTTCAACUUUCUCCCAAGUUAACCAGUUAACUUGGGAGAAAGUUUCU17.74.922


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305ACACUAUCCAACAAUUAAU82.58661170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601323ACACTATCCAACAATTAATATTAATTGTTGGATAGTGT0.185800.112900.698300.750001.000001.00000


Target Position: 1119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119CUAAACGAUACGAAGAAAU75.74642134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1117-1139TTCTAAACGATACGAAGAAATTTAUUUCUUCGUAUCGUUUAGAACUAAACGAUACGAAGAAAUUUU14.816.522


Target Position: 2060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2060GCAACCUCAGCCUUCCAGA80.20881487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252078GCAACCTCAGCCTTCCAGATCTGGAAGGCTGAGGTTGC0.163800.107000.629300.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414GAAAAGAGUGAAGGAUAUA94.1015191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481432GAAAAGAGTGAAGGATATATATATCCTTCACTCTTTTC0.345800.076900.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1412-1434CTGAAAAGAGTGAAGGATATAGGUAUAUCCUUCACUCUUUUCAGGAAAAGAGUGAAGGAUAUAGGU19.910.321


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389CAGUGAAUCCAAAAGAAAG82.56261175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451407CAGTGAATCCAAAAGAAAGCTTTCTTTTGGATTCACTG0.425200.043200.646600.500001.000001.00000


Target Position: 4041, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4041CAAUUGUCUAUUUAUCUUU85.5565853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8974059CAATTGTCTATTTATCTTTAAAGATAAATAGACAATTG0.526300.288100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4039-4061GGCAATTGTCTATTTATCTTTTAAAAGAUAAAUAGACAAUUGCCCAAUUGUCUAUUUAUCUUUUAU6.914.822


Target Position: 1785, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1785GCAACUUGACAAGAGAAAU83.73711059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401803GCAACTTGACAAGAGAAATATTTCTCTTGTCAAGTTGC0.192600.035900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1783-1805AGGCAACTTGACAAGAGAAATGAAUUUCUCUUGUCAAGUUGCCUGCAACUUGACAAGAGAAAUGAU19.116.722


Target Position: 2837, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2837CUCCCAGGAGAGUCCAAAU81.27851348

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7283719CTCCCAGGAGAGTCCAAAT1/1/0/097.75RB1NM_000321.21NANANA13:49051498..49051516(+)00RB1(0.002)


Target Position: 1783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1783AGGCAACUUGACAAGAGAA91.9311304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481801AGGCAACTTGACAAGAGAATTCTCTTGTCAAGTTGCCT0.261500.028100.672400.750001.000001.00000


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CAUUAGAUUUUAUUUUACU88.5279548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527CACATTAGATTTTATTTTACTATAGUAAAAUAAAAUCUAAUGUGCAUUAGAUUUUAUUUUACUAUU-0.36.622


Target Position: 3130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3130GUUAGUCAUUGUUAUUUAU90.4562401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3128-3150ATGTTAGTCATTGTTATTTATACAUAAAUAACAAUGACUAACAUGUUAGUCAUUGUUAUUUAUACU-7.520.321


Target Position: 2769, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769CUCCUAAACCACUGAAAAA91.5747330

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6276919CTCCTAAACCACTGAAAAA1/1/0/097.75RB1NM_000321.21NANANA13:49050919..49050937(+)00RB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812787CTCCTAAACCACTGAAAAATTTTTCAGTGGTTTAGGAG0.449700.231200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789CCCTCCTAAACCACTGAAAAAACUUUUUCAGUGGUUUAGGAGGGCUCCUAAACCACUGAAAAAACU12.219.922


Target Position: 4439, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4439CUAUUUUGACAGUUAUUUU87.219680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4437-4459TACTATTTTGACAGTTATTTTGAAAAAUAACUGUCAAAAUAGUACUAUUUUGACAGUUAUUUUGAU-0.3-1.422


Target Position: 4585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4585GAAUUAGUGCCAGAAUUUU84.3038991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4583-4605TAGAATTAGTGCCAGAATTTTAGAAAAUUCUGGCACUAAUUCUAGAAUUAGUGCCAGAAUUUUAGU5.34.622


Target Position: 1037, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GUUUAUUUCAAAAAUUUUA86.1477782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371055GTTTATTTCAAAAATTTTATAAAATTTTTGAAATAAAC0.124700.023700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1035-1057ATGTTTATTTCAAAAATTTTATAUAAAAUUUUUGAAAUAAACAUGUUUAUUUCAAAAAUUUUAUAU-12.0-9.721


Target Position: 4261, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4261CUAUCUUGUGUGAUUAACU84.9778919

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4259-4281AACTATCTTGTGTGATTAACTTAAGUUAAUCACACAAGAUAGUUCUAUCUUGUGUGAUUAACUUAU10.013.432


Target Position: 3709, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3709GAUAGUACUCUUGGUUUUU82.13491231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3707-3729TTGATAGTACTCTTGGTTTTTATAAAAACCAAGAGUACUAUCAAGAUAGUACUCUUGGUUUUUAUU18.814.222


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384CUGCACAGUGAAUCCAAAA86.5666737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361402CTGCACAGTGAATCCAAAATTTTGGATTCACTGTGCAG0.275500.069000.784500.750000.967400.62500


Target Position: 1740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1740CCUUUGAUUUUUACAAAGU76.60042002

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1738-1760AGCCTTTGATTTTTACAAAGTGAACUUUGUAAAAAUCAAAGGCUCCUUUGAUUUUUACAAAGUGAU11.812.012


Target Position: 4420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4420CAUUUAAGUUUCAAACUUA102.40918

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4418-4440CTCATTTAAGTTTCAAACTTACTUAAGUUUGAAACUUAAAUGAGCAUUUAAGUUUCAAACUUACUU10.3-4.322


Target Position: 3328, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3328CUCUUGUUUUUAUUAAUUU81.00221380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6233346CTCTTGTTTTTATTAATTTAAATTAATAAAAACAAGAG0.197900.106700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3326-3348TGCTCTTGTTTTTATTAATTTATAAAUUAAUAAAAACAAGAGCACUCUUGUUUUUAUUAAUUUAUU-10.319.221


Target Position: 1546, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546GCUUAAAUCAGAAGAAGAA95.909111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771564GCTTAAATCAGAAGAAGAATTCTTCTTCTGATTTAAGC0.516800.119300.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1544-1566ATGCTTAAATCAGAAGAAGAACGUUCUUCUUCUGAUUUAAGCAUGCUUAAAUCAGAAGAAGAACGU19.1-4.322


Target Position: 957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957CAAAACAACUAGAAAAUGA91.154362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
955-977AGCAAAACAACTAGAAAATGATAUCAUUUUCUAGUUGUUUUGCUCAAAACAACUAGAAAAUGAUAU7.45.621


Target Position: 2149, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149GCUAAAUACACUUUGUGAA92.6068267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2147-2169CGGCTAAATACACTTTGTGAACGUUCACAAAGUGUAUUUAGCCGGCUAAAUACACUUUGUGAACGU20.5-2.332


Target Position: 4353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4353GUCUAACUCAGAAUUAUUU84.7994936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4351-4373TTGTCTAACTCAGAATTATTTTTAAAUAAUUCUGAGUUAGACAAGUCUAACUCAGAAUUAUUUUUU-10.318.922


Target Position: 3326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3326UGCUCUUGUUUUUAUUAAU79.79991541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753344TGCTCTTGTTTTTATTAATATTAATAAAAACAAGAGCA0.182300.091900.844800.750001.000001.00000


Target Position: 3871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3871GAUACAAAUUAAUUUUACU92.9519255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3869-3891AAGATACAAATTAATTTTACTCCAGUAAAAUUAAUUUGUAUCUUGAUACAAAUUAAUUUUACUCCU-0.36.912


Target Position: 3458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3458UGCAAAAAUGGAUAUUAUU76.78411978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033476TGCAAAAATGGATATTATTAATAATATCCATTTTTGCA0.175900.086200.844800.750001.000001.00000


Target Position: 705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705CGAUAUCUACUGAAAUAAA103.8111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
703-725TTCGATATCTACTGAAATAAATTUUUAUUUCAGUAGAUAUCGAACGAUAUCUACUGAAAUAAAUUU2.115.922


Target Position: 4688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4688CUGUACAUUUAAAAUUGCU77.95661809

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4686-4708AACTGTACATTTAAAATTGCTATAGCAAUUUUAAAUGUACAGUUCUGUACAUUUAAAAUUGCUAUU14.020.432


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503GUCACCAAUACCUCACAUU78.56531721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872521GTCACCAATACCTCACATTAATGTGAGGTATTGGTGAC0.908100.588100.810300.750001.000001.00000


Target Position: 3701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3701GGAUUAUUGAUAGUACUCU86.2764767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6743719GGATTATTGATAGTACTCTAGAGTACTATCAATAATCC0.422300.197900.646600.750001.000001.00000


Target Position: 4249, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4249GGUGUAUUUAAACUAUCUU87.7488625

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4247-4269AAGGTGTATTTAAACTATCTTGTAAGAUAGUUUAAAUACACCUUGGUGUAUUUAAACUAUCUUGUU18.914.622


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081CAGAAGCCAUUGAAAUCUA95.1496139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092099CAGAAGCCATTGAAATCTATAGATTTCAATGGCTTCTG0.156100.028400.612100.750001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GGACAUGUGAACUUAUAUA102.4816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905684GGACATGTGAACTTATATATATATAAGTTCACATGTCC0.286200.025800.827601.000001.000001.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174CCAAAACCCCCCGAAAAAC58.47894108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736192CCAAAACCCCCCGAAAAACGTTTTTCGGGGGGTTTTGG0.274900.228900.698300.750001.000001.00000


Target Position: 2111, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111CUGUUUUAUAAAAAAGUGU72.00242689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2109-2131CACTGTTTTATAAAAAAGTGTATACACUUUUUUAUAAAACAGUGCUGUUUUAUAAAAAAGUGUAUU10.37.221


Target Position: 4119, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4119CCAAAAUUACAAGUAAUCA87.4338653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8634137CCAAAATTACAAGTAATCATGATTACTTGTAATTTTGG0.279800.096600.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4117-4139GTCCAAAATTACAAGTAATCAAGUGAUUACUUGUAAUUUUGGACCCAAAAUUACAAGUAAUCAAGU14.5-3.332


Target Position: 4708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4708UGUUACUAUUUUCUACAAU77.90281815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3884726TGTTACTATTTTCTACAATATTGTAGAAAATAGTAACA0.494100.127300.698300.750001.000001.00000


Target Position: 2259, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2259GGCAUUUGGACCAAAUUAU82.5281180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8662277GGCATTTGGACCAAATTATATAATTTGGTCCAAATGCC0.136200.066500.956901.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2257-2279CAGGCATTTGGACCAAATTATGAAUAAUUUGGUCCAAAUGCCUGGGCAUUUGGACCAAAUUAUGAU-1.420.023


Target Position: 4117, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4117GUCCAAAAUUACAAGUAAU90.0944424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304135GTCCAAAATTACAAGTAATATTACTTGTAATTTTGGAC0.166300.068300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4115-4137TAGTCCAAAATTACAAGTAATCAAUUACUUGUAAUUUUGGACUAGUCCAAAAUUACAAGUAAUCAU11.820.122


Target Position: 3037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037CUGUUUAUGGCCACAUUUA87.8145620

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3035-3057TTCTGTTTATGGCCACATTTAATUAAAUGUGGCCAUAAACAGAACUGUUUAUGGCCACAUUUAAUU12.16.923


Target Position: 3650, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3650GUAAAAGAACUUACUGAUU82.81211147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3648-3670ATGTAAAAGAACTTACTGATTATAAUCAGUAAGUUCUUUUACAUGUAAAAGAACUUACUGAUUAUU20.37.122


Target Position: 3548, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548GCUUGUUUUAUAAAAUUUU81.14511364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7313566GCTTGTTTTATAAAATTTTAAAATTTTATAAAACAAGC0.166000.157300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3546-3568GTGCTTGTTTTATAAAATTTTGCAAAAUUUUAUAAAACAAGCACGCUUGUUUUAUAAAAUUUUGCU-12.010.322


Target Position: 4047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4047UCUAUUUAUCUUUUAUUUU72.62122601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2684065TCTATTTATCTTTTATTTTAAAATAAAAGATAAATAGA0.683300.455500.724100.750001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104AGGUUGAAAAUCUUUCUAA90.4879399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941122AGGTTGAAAATCTTTCTAATTAGAAAGATTTTCAACCT0.113700.066000.810300.750001.000001.00000


Target Position: 2886, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886CUCGAACACGAAUGCAAAA85.5658852

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8288619CTCGAACACGAATGCAAAA1/1/0/097.75RB1NM_000321.21NANANA13:49054140..49054158(+)00RB1(0.002)


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888CAGCUGUUAUACCCAUUAA96.928779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655906CAGCTGTTATACCCATTAATTAATGGGTATAACAGCTG0.294200.075400.750000.750001.000001.00000


Target Position: 1441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441CUUUAAAGAGAAAUUUGCU77.01551945

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1439-1461ATCTTTAAAGAGAAATTTGCTAAAGCAAAUUUCUCUUUAAAGAUCUUUAAAGAGAAAUUUGCUAAU14.0-3.822


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653AGCAAAUUGGAAAGGACAU73.91932407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915671AGCAAATTGGAAAGGACATATGTCCTTTCCAATTTGCT0.134100.025100.698300.750001.000001.00000


Target Position: 1397, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397CCAAAAGAAAGUAUACUGA87.3753659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1395-1417ATCCAAAAGAAAGTATACTGAAAUCAGUAUACUUUCUUUUGGAUCCAAAAGAAAGUAUACUGAAAU13.112.222


Target Position: 3642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642CUCAGAAUGUAAAAGAACU82.97921129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3640-3662ACCTCAGAATGTAAAAGAACTTAAGUUCUUUUACAUUCUGAGGUCUCAGAAUGUAAAAGAACUUAU13.320.422


Target Position: 4033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4033UGAACUGGCAAUUGUCUAU76.67271990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604051TGAACTGGCAATTGTCTATATAGACAATTGCCAGTTCA0.307600.022300.681000.750001.000001.00000


Target Position: 1866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866CACCUUUAUUUGAUCUUAU89.6348454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1864-1886TTCACCTTTATTTGATCTTATTAAUAAGAUCAAAUAAAGGUGAACACCUUUAUUUGAUCUUAUUAU16.018.622


Target Position: 4333, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4333GCUUUUAGGAAAAUCACUU81.23911356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7304351GCTTTTAGGAAAATCACTTAAGTGATTTTCCTAAAAGC0.205900.036500.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4331-4353TAGCTTTTAGGAAAATCACTTTGAAGUGAUUUUCCUAAAAGCUAGCUUUUAGGAAAAUCACUUUGU19.21.322


Target Position: 2148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148GGCUAAAUACACUUUGUGA96.791184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2146-2168CCGGCTAAATACACTTTGTGAACUCACAAAGUGUAUUUAGCCGGGGCUAAAUACACUUUGUGAACU16.713.632


Target Position: 1714, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714GAUUCUGAAUGUGCUUAAU88.3996558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271732GATTCTGAATGTGCTTAATATTAAGCACATTCAGAATC0.226800.075500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1712-1734TGGATTCTGAATGTGCTTAATTTAUUAAGCACAUUCAGAAUCCAGAUUCUGAAUGUGCUUAAUUUU19.720.422


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867UGCUCAAAGAACCAUAUAA88.3122570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850885TGCTCAAAGAACCATATAATTATATGGTTCTTTGAGCA0.257600.196400.819000.750000.918500.62500


Target Position: 4731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4731AGUUUGUCUAUUUUAAAAU79.71141556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5604749AGTTTGTCTATTTTAAAATATTTTAAAATAGACAAACT0.224300.124500.698300.750001.000001.00000


Target Position: 423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423GAGUAUUGGGAGGUUAUAU88.8001516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
421-443TGGAGTATTGGGAGGTTATATTCAUAUAACCUCCCAAUACUCCAGAGUAUUGGGAGGUUAUAUUCU15.311.633


Target Position: 2260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2260GCAUUUGGACCAAAUUAUG74.77092282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012278GCATTTGGACCAAATTATGCATAATTTGGTCCAAATGC0.150800.058800.698300.750000.989100.75000


Target Position: 3888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3888CUCCAUAAACAGACUGUUA91.6617324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503906CTCCATAAACAGACTGTTATAACAGTCTGTTTATGGAG0.140300.028100.775900.750001.000001.00000


Target Position: 2109, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109CACUGUUUUAUAAAAAAGU77.59191856

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2107-2129TTCACTGTTTTATAAAAAAGTGTACUUUUUUAUAAAACAGUGAACACUGUUUUAUAAAAAAGUGUU-5.917.821


Target Position: 4116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4116AGUCCAAAAUUACAAGUAA94.9363146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7664134AGTCCAAAATTACAAGTAATTACTTGTAATTTTGGACT0.180700.075400.672400.750001.000001.00000


Target Position: 1356, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356CAGAAAAUCUGAUUUCCUA99.930133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1354-1376TTCAGAAAATCTGATTTCCTATTUAGGAAAUCAGAUUUUCUGAACAGAAAAUCUGAUUUCCUAUUU18.75.322


Target Position: 3118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3118GCCACUUGAAAUGUUAGUC64.61693582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583136GCCACTTGAAATGTTAGTCGACTAACATTTCAAGTGGC0.186300.070700.681000.750001.000001.00000


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537GGAAUCCAUGCUUAAAUCA87.6622632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861555GGAATCCATGCTTAAATCATGATTTAAGCATGGATTCC0.207400.020900.646600.750001.000001.00000


Target Position: 978, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978CAAGAAUUAUUGAAGUUCU88.6151537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
976-998TACAAGAATTATTGAAGTTCTCTAGAACUUCAAUAAUUCUUGUACAAGAAUUAUUGAAGUUCUCUU21.55.332


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730GCGACCGUGUGCUCAAAAG71.53612759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342748GCGACCGTGTGCTCAAAAGCTTTTGAGCACACGGTCGC0.470700.023900.784500.750000.929300.62500


Target Position: 1313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313CAACAAUUAAUGAUGAUUU87.4544650

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1311-1333TCCAACAATTAATGATGATTTTAAAAUCAUCAUUAAUUGUUGGACAACAAUUAAUGAUGAUUUUAU16.25.322


Target Position: 1868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868CCUUUAUUUGAUCUUAUUA92.8695259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1866-1888CACCTTTATTTGATCTTATTAAAUAAUAAGAUCAAAUAAAGGUGCCUUUAUUUGAUCUUAUUAAAU6.9-4.322


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956GCAAAACAACUAGAAAAUG71.53582760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522974GCAAAACAACTAGAAAATGCATTTTCTAGTTGTTTTGC0.517500.282900.698300.750001.000001.00000


Target Position: 4182, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4182GCAAAAGCUUCAAAUUAAA93.5253218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894200GCAAAAGCTTCAAATTAAATTTAATTTGAAGCTTTTGC0.795100.020800.853401.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4180-4202GTGCAAAAGCTTCAAATTAAAACUUUAAUUUGAAGCUUUUGCACGCAAAAGCUUCAAAUUAAAACU-9.718.622


Target Position: 3913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3913GGAGCCUUAAUUUUUUUUU75.45422182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1113931GGAGCCTTAATTTTTTTTTAAAAAAAAATTAAGGCTCC0.706700.201700.870701.000001.000001.00000


Target Position: 1587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587GCAAACUUCUGAAUGACAA91.7806315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1585-1607TAGCAAACTTCTGAATGACAACAUUGUCAUUCAGAAGUUUGCUAGCAAACUUCUGAAUGACAACAU20.510.322


Target Position: 3378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3378CCCUUAGAAAAUGUGUCCU69.04493086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753396CCCTTAGAAAATGTGTCCTAGGACACATTTTCTAAGGG0.117100.043900.646600.750001.000001.00000


Target Position: 1564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564ACGAUUAUCCAUUCAAAAU78.38011738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851582ACGATTATCCATTCAAAATATTTTGAATGGATAATCGT0.153900.068000.767200.750001.000001.00000


Target Position: 2592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592UGAAGAGUCCAUAUAAAAU85.6203845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3052610TGAAGAGTCCATATAAAATATTTTATATGGACTCTTCA0.608000.099900.715500.750001.000001.00000


Target Position: 3298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298CCUUCUUUUGUAGCAUAUA86.9792702

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3296-3318TGCCTTCTTTTGTAGCATATAGGUAUAUGCUACAAAAGAAGGCACCUUCUUUUGUAGCAUAUAGGU19.710.332


Target Position: 3322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3322UGUUUGCUCUUGUUUUUAU79.28671621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643340TGTTTGCTCTTGTTTTTATATAAAAACAAGAGCAAACA0.137100.078400.663800.750001.000001.00000


Target Position: 341, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341GCAUUAUGUCAGAAAUUAA104.3779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521359GCATTATGTCAGAAATTAATTAATTTCTGACATAATGC0.236300.058600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
339-361CTGCATTATGTCAGAAATTAAAGUUAAUUUCUGACAUAAUGCAGGCAUUAUGUCAGAAAUUAAAGU2.15.622


Target Position: 4046, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046GUCUAUUUAUCUUUUAUUU86.4382755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2424064GTCTATTTATCTTTTATTTAAATAAAAGATAAATAGAC0.689800.446900.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4044-4066TTGTCTATTTATCTTTTATTTTTAAAUAAAAGAUAAAUAGACAAGUCUAUUUAUCUUUUAUUUUUU-9.76.922


Target Position: 432, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432GAGGUUAUAUUCAAAAGAA102.16820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755450GAGGTTATATTCAAAAGAATTCTTTTGAATATAACCTC0.166600.068200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
430-452GGGAGGTTATATTCAAAAGAAAAUUCUUUUGAAUAUAACCUCCCGAGGUUAUAUUCAAAAGAAAAU12.218.532


Target Position: 4038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4038UGGCAAUUGUCUAUUUAUC67.94923229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9444056TGGCAATTGTCTATTTATCGATAAATAGACAATTGCCA0.483300.069300.663800.500001.000001.00000


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945UCUUCCUCUCCAGAAUAAU68.13863211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441963TCTTCCTCTCCAGAATAATATTATTCTGGAGAGGAAGA0.307300.244800.715500.750000.940200.87500


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GACAUGUGAACUUAUAUAU90.4274404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901685GACATGTGAACTTATATATATATATAAGTTCACATGTC0.369100.025800.775900.750001.000001.00000


Target Position: 4348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4348ACUUUGUCUAACUCAGAAU79.15611639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7584366ACTTTGTCTAACTCAGAATATTCTGAGTTAGACAAAGT0.166900.034400.698300.750001.000001.00000


Target Position: 3476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476UAGAAAUUAGAAAAAAAUU75.17632227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633494TAGAAATTAGAAAAAAATTAATTTTTTTCTAATTTCTA0.370900.061200.663800.500001.000001.00000


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GCUUGUCCUCUUAAUCUUC74.75932287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221949GCTTGTCCTCTTAATCTTCGAAGATTAAGAGGACAAGC0.299400.131700.681000.750001.000001.00000


Target Position: 3584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3584AGCUGGAAGCAAAGUAUAA91.2271355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533602AGCTGGAAGCAAAGTATAATTATACTTTGCTTCCAGCT0.215500.027900.819000.750000.956500.62500


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433AGGUUAUAUUCAAAAGAAA94.8826150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
418451AGGTTATATTCAAAAGAAATTTCTTTTGAATATAACCT0.499400.077500.844800.750000.994600.62500


Target Position: 3646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646GAAUGUAAAAGAACUUACU87.5356640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3644-3666CAGAATGTAAAAGAACTTACTGAAGUAAGUUCUUUUACAUUCUGGAAUGUAAAAGAACUUACUGAU12.96.923


Target Position: 3533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3533UCUGAUAUACUGUGUGCUU75.67892142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773551TCTGATATACTGTGTGCTTAAGCACACAGTATATCAGA0.469300.077100.586200.750001.000001.00000


Target Position: 3828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828UCCCAAGUGCACUUUCUAA83.23671107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573846TCCCAAGTGCACTTTCTAATTAGAAAGTGCACTTGGGA0.748400.022400.836200.750001.000001.00000


Target Position: 548, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548GUCCAUAAAUUCUUUAACU83.55061077

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
546-568GTGTCCATAAATTCTTTAACTTAAGUUAAAGAAUUUAUGGACACGUCCAUAAAUUCUUUAACUUAU4.921.222


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665AGGACAUGUGAACUUAUAU87.3492663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888683AGGACATGTGAACTTATATATATAAGTTCACATGTCCT0.227000.026500.801700.750001.000001.00000


Target Position: 4048, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4048CUAUUUAUCUUUUAUUUUU85.4706866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7924066CTATTTATCTTTTATTTTTAAAAATAAAAGATAAATAG0.686600.460800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4046-4068GTCTATTTATCTTTTATTTTTTTAAAAAUAAAAGAUAAAUAGACCUAUUUAUCUUUUAUUUUUUUU-9.7-8.011


Target Position: 3544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3544GUGUGCUUGUUUUAUAAAA90.1333421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4263562GTGTGCTTGTTTTATAAAATTTTATAAAACAAGCACAC0.274700.209800.793100.750001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942GGAGUGCACGGAUAGCAAA95.1333140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860960GGAGTGCACGGATAGCAAATTTGCTATCCGTGCACTCC0.203900.027600.870701.000000.902200.75000


Target Position: 1572, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572CCAUUCAAAAUUUUAGCAA83.14021117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031590CCATTCAAAATTTTAGCAATTGCTAAAATTTTGAATGG0.483500.090000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1570-1592ATCCATTCAAAATTTTAGCAAACUUGCUAAAAUUUUGAAUGGAUCCAUUCAAAAUUUUAGCAAACU19.713.802


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712UGGAUUCUGAAUGUGCUUA74.30152362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311730TGGATTCTGAATGTGCTTATAAGCACATTCAGAATCCA0.210000.036500.810300.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625GAAGUAUGAUGUAUUGUUU95.1631138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
623-645AAGAAGTATGATGTATTGTTTGCAAACAAUACAUCAUACUUCUUGAAGUAUGAUGUAUUGUUUGCU6.911.622


Target Position: 4120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4120CAAAAUUACAAGUAAUCAA96.229599

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4118-4140TCCAAAATTACAAGTAATCAAGGUUGAUUACUUGUAAUUUUGGACAAAAUUACAAGUAAUCAAGGU16.1-9.722


Target Position: 3917, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3917CCUUAAUUUUUUUUUCAUA92.5625271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1623935CCTTAATTTTTTTTTCATATATGAAAAAAAAATTAAGG0.634900.509000.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3915-3937AGCCTTAATTTTTTTTTCATAGAUAUGAAAAAAAAAUUAAGGCUCCUUAAUUUUUUUUUCAUAGAU7.4-4.311


Target Position: 565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565CUUACUAAAAGAAAUUGAU82.16361227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
563-585AACTTACTAAAAGAAATTGATACAUCAAUUUCUUUUAGUAAGUUCUUACUAAAAGAAAUUGAUACU7.46.622


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651GGCCACAUAUAGCAGAAGU81.09331374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781669GGCCACATATAGCAGAAGTACTTCTGCTATATGTGGCC0.154800.040400.793100.750000.902200.62500


Target Position: 49, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
49GUUGAAAUUAUUUUUGUAA89.3207475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88767GTTGAAATTATTTTTGTAATTACAAAAATAATTTCAAC0.145000.095100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
47-69ACGTTGAAATTATTTTTGTAACGUUACAAAAAUAAUUUCAACGUGUUGAAAUUAUUUUUGUAACGU7.27.422


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340UGCAUUAUGUCAGAAAUUA82.28991202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870358TGCATTATGTCAGAAATTATAATTTCTGACATAATGCA0.245200.054200.819000.750001.000001.00000


Target Position: 3829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3829CCCAAGUGCACUUUCUAAU77.73511832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523847CCCAAGTGCACTTTCTAATATTAGAAAGTGCACTTGGG0.220600.022700.982801.000001.000001.00000


Target Position: 4396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4396GAAAACAAAAUUUUAUUUU77.46531888

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4394-4416TAGAAAACAAAATTTTATTTTGTAAAAUAAAAUUUUGUUUUCUAGAAAACAAAAUUUUAUUUUGUU-9.75.611


Target Position: 4105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4105ACAUUAUUUCUAGUCCAAA86.5058745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6994123ACATTATTTCTAGTCCAAATTTGGACTAGAAATAATGT0.173700.093400.706900.750001.000001.00000


Target Position: 4272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4272GAUUAACUUAUUUAGAGAU92.0048300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4270-4292GTGATTAACTTATTTAGAGATGCAUCUCUAAAUAAGUUAAUCACGAUUAACUUAUUUAGAGAUGCU20.24.621


Target Position: 2599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2599UCCAUAUAAAAUUUCAGAA79.82811535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532617TCCATATAAAATTTCAGAATTCTGAAATTTTATATGGA0.249800.197600.698300.750001.000001.00000


Target Position: 3722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722GUUUUUAUACCAUUCAGAU87.3631660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3720-3742TGGTTTTTATACCATTCAGATCAAUCUGAAUGGUAUAAAAACCAGUUUUUAUACCAUUCAGAUCAU20.4-9.722


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525UACAGAAAAACAUAGAAAU78.1471771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
957543TACAGAAAAACATAGAAATATTTCTATGTTTTTCTGTA0.419500.220300.672400.500001.000001.00000


Target Position: 3066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066CUCUUUUUGUGGAUAUAAA93.3499228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3064-3086AGCTCTTTTTGTGGATATAAAATUUUAUAUCCACAAAAAGAGCUCUCUUUUUGUGGAUAUAAAAUU3.55.532


Target Position: 3589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589GAAGCAAAGUAUAACCAUA104.8046

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3587-3609TGGAAGCAAAGTATAACCATATGUAUGGUUAUACUUUGCUUCCAGAAGCAAAGUAUAACCAUAUGU20.018.632


Target Position: 2103, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2103CUCUUUCACUGUUUUAUAA93.3317230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062121CTCTTTCACTGTTTTATAATTATAAAACAGTGAAAGAG0.565400.238800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2101-2123CTCTCTTTCACTGTTTTATAAAAUUAUAAAACAGUGAAAGAGAGCUCUUUCACUGUUUUAUAAAAU-7.520.422


Target Position: 3592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592GCAAAGUAUAACCAUAUGA88.1589582

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3590-3612AAGCAAAGTATAACCATATGATAUCAUAUGGUUAUACUUUGCUUGCAAAGUAUAACCAUAUGAUAU18.811.821


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930UGCUUGUCCUCUUAAUCUU76.30442054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901948TGCTTGTCCTCTTAATCTTAAGATTAAGAGGACAAGCA0.249500.126700.715500.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585CCAGUACCAAAGUUGAUAA93.9564200

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_358519CCAGTACCAAAGTTGATAA1/1/0/097.75RB1NM_000321.21NANANA13:48919254..48919272(+)00RB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984603CCAGTACCAAAGTTGATAATTATCAACTTTGGTACTGG0.115900.067500.810301.000000.923900.62500


Target Position: 2113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113GUUUUAUAAAAAAGUGUAU81.71971282

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2111-2133CTGTTTTATAAAAAAGTGTATCGAUACACUUUUUUAUAAAACAGGUUUUAUAAAAAAGUGUAUCGU19.0-7.512


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692UGAGAAGUUCCAGAAAAUA84.05031020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942710TGAGAAGTTCCAGAAAATATATTTTCTGGAACTTCTCA0.355900.050000.681000.750001.000001.00000


Target Position: 2092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092GAAAUCUACCUCUCUUUCA89.6776451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2090-2112TTGAAATCTACCTCTCTTTCACTUGAAAGAGAGGUAGAUUUCAAGAAAUCUACCUCUCUUUCACUU19.16.923


Target Position: 3120, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120CACUUGAAAUGUUAGUCAU91.0158372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813138CACTTGAAATGTTAGTCATATGACTAACATTTCAAGTG0.211500.073000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3118-3140GCCACTTGAAATGTTAGTCATTGAUGACUAACAUUUCAAGUGGCCACUUGAAAUGUUAGUCAUUGU20.319.232


Target Position: 1028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GUGAAAAAUGUUUAUUUCA87.2356677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1026-1048AGGTGAAAAATGTTTATTTCAAAUGAAAUAAACAUUUUUCACCUGUGAAAAAUGUUUAUUUCAAAU2.17.721


Target Position: 3427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3427GCCCAUUCACCAAAAUUAU81.48951314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3823445GCCCATTCACCAAAATTATATAATTTTGGTGAATGGGC0.300500.131900.956901.000001.000001.00000


Target Position: 4690, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4690GUACAUUUAAAAUUGCUAU84.03921024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7594708GTACATTTAAAATTGCTATATAGCAATTTTAAATGTAC0.183900.043100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4688-4710CTGTACATTTAAAATTGCTATGTAUAGCAAUUUUAAAUGUACAGGUACAUUUAAAAUUGCUAUGUU19.76.922


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679UCCAACUUAUGUUUUUAAA76.00012095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933697TCCAACTTATGTTTTTAAATTTAAAAACATAAGTTGGA0.114100.045900.870700.750001.000001.00000


Target Position: 3764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3764CUAGUACUUGAAAAAGUAA93.6329215

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3762-3784ATCTAGTACTTGAAAAAGTAAAGUUACUUUUUCAAGUACUAGAUCUAGUACUUGAAAAAGUAAAGU4.918.822


Target Position: 3454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3454CUUCUGCAAAAAUGGAUAU76.10642077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9713472CTTCTGCAAAAATGGATATATATCCATTTTTGCAGAAG0.121200.054800.594800.750001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133GAAAUUUAUCUUAAAAAUA95.9505110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451151GAAATTTATCTTAAAAATATATTTTTAAGATAAATTTC0.345200.104700.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1131-1153AAGAAATTTATCTTAAAAATAAAUAUUUUUAAGAUAAAUUUCUUGAAAUUUAUCUUAAAAAUAAAU-9.7-9.711


Target Position: 550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550CCAUAAAUUCUUUAACUUA98.620153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
548-570GTCCATAAATTCTTTAACTTACTUAAGUUAAAGAAUUUAUGGACCCAUAAAUUCUUUAACUUACUU4.9-1.822


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173UCCUGCCAUUUAAAAAGUU66.68773373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6903191TCCTGCCATTTAAAAAGTTAACTTTTTAAATGGCAGGA0.428900.040300.724100.750001.000001.00000


Target Position: 2016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016GUUCAACUACGCGUGUAAA89.1928489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2014-2036AGGTTCAACTACGCGTGTAAATTUUUACACGCGUAGUUGAACCUGUUCAACUACGCGUGUAAAUUU21.019.244


Target Position: 3943, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3943GUCUAAUUGCAUCUCAAAA92.2634287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9173961GTCTAATTGCATCTCAAAATTTTGAGATGCAATTAGAC0.126800.040000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3941-3963TTGTCTAATTGCATCTCAAAATTUUUUGAGAUGCAAUUAGACAAGUCUAAUUGCAUCUCAAAAUUU20.46.922


Target Position: 3631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3631AGAUUUCAUACCUCAGAAU84.03341027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9993649AGATTTCATACCTCAGAATATTCTGAGGTATGAAATCT0.140400.020200.715500.750000.989100.62500


Target Position: 775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GGAAGUAUUACAAAUGGAA97.276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
773-795GGGGAAGTATTACAAATGGAAGAUUCCAUUUGUAAUACUUCCCCGGAAGUAUUACAAAUGGAAGAU20.114.521


Target Position: 3217, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217GUAAAAUUGCUGUGCUUUA90.0786426

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10321719GTAAAATTGCTGTGCTTTA1/1/0/097.75RB1NM_000321.21NANANA13:49054471..49054489(+)00RB1(0.002)


Target Position: 4334, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4334CUUUUAGGAAAAUCACUUU79.56131581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7664352CTTTTAGGAAAATCACTTTAAAGTGATTTTCCTAAAAG0.196600.064400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4332-4354AGCTTTTAGGAAAATCACTTTGTAAAGUGAUUUUCCUAAAAGCUCUUUUAGGAAAAUCACUUUGUU19.211.022


Target Position: 3677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3677CAUCCAACUUAUGUUUUUA95.2158137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683695CATCCAACTTATGTTTTTATAAAAACATAAGTTGGATG0.182000.128200.620700.750001.000001.00000


Target Position: 3760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3760CCAUCUAGUACUUGAAAAA95.3644128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3758-3780ACCCATCTAGTACTTGAAAAAGTUUUUUCAAGUACUAGAUGGGUCCAUCUAGUACUUGAAAAAGUU7.717.822


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099ACCUCUCUUUCACUGUUUU75.34842201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692117ACCTCTCTTTCACTGTTTTAAAACAGTGAAAGAGAGGT0.294900.189200.853400.750001.000001.00000


Target Position: 390, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390GGUUAACUUGGGAGAAAGU82.64421163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
388-410TTGGTTAACTTGGGAGAAAGTTTACUUUCUCCCAAGUUAACCAAGGUUAACUUGGGAGAAAGUUUU19.112.922


Target Position: 3320, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3320GAUGUUUGCUCUUGUUUUU84.8366933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8213338GATGTTTGCTCTTGTTTTTAAAAACAAGAGCAAACATC0.145500.083000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3318-3340GTGATGTTTGCTCTTGTTTTTATAAAAACAAGAGCAAACAUCACGAUGUUUGCUCUUGUUUUUAUU5.612.112


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735UGCUAAAAGUUUCUUGGAU75.75212133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908753TGCTAAAAGTTTCTTGGATATCCAAGAAACTTTTAGCA0.128100.038400.672400.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742AGUUUCUUGGAUCACAUUU73.28942498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
759760AGTTTCTTGGATCACATTTAAATGTGATCCAAGAAACT0.158400.037700.706900.750001.000001.00000


Target Position: 4595, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4595CAGAAUUUUAGGAACUUCA88.3318567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4593-4615GCCAGAATTTTAGGAACTTCAGAUGAAGUUCCUAAAAUUCUGGCCAGAAUUUUAGGAACUUCAGAU21.55.322


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CCAUAUAAAACAGCUGUUA86.0769787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464896CCATATAAAACAGCTGTTATAACAGCTGTTTTATATGG0.328600.066300.810301.000001.000001.00000


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431GGAGGUUAUAUUCAAAAGA89.0629496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811449GGAGGTTATATTCAAAAGATCTTTTGAATATAACCTCC0.149000.053600.646600.750001.000001.00000


Target Position: 869, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869CUCAAAGAACCAUAUAAAA91.4156341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471887CTCAAAGAACCATATAAAATTTTATATGGTTCTTTGAG0.249300.149600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
867-889TGCTCAAAGAACCATATAAAACAUUUUAUAUGGUUCUUUGAGCACUCAAAGAACCAUAUAAAACAU-8.020.433


Target Position: 3863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863AGAAUUAAGAUACAAAUUA88.5273549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7573881AGAATTAAGATACAAATTATAATTTGTATCTTAATTCT0.198400.034500.689700.750001.000001.00000


Target Position: 4495, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4495CAUUGUUUCUGCAUGAAUA101.12127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4493-4515ATCATTGTTTCTGCATGAATATCUAUUCAUGCAGAAACAAUGAUCAUUGUUUCUGCAUGAAUAUCU13.65.321


Target Position: 868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868GCUCAAAGAACCAUAUAAA98.797848

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
866-888TTGCTCAAAGAACCATATAAAACUUUAUAUGGUUCUUUGAGCAAGCUCAAAGAACCAUAUAAAACU0.016.632


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770UCCUAAACCACUGAAAAAA74.49012332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682788TCCTAAACCACTGAAAAAATTTTTTCAGTGGTTTAGGA0.502500.268900.870700.750001.000001.00000


Target Position: 2301, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2301GCAAAGUGAAGAAUAUAGA89.3082477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262319GCAAAGTGAAGAATATAGATCTATATTCTTCACTTTGC0.190700.060900.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2299-2321ATGCAAAGTGAAGAATATAGACCUCUAUAUUCUUCACUUUGCAUGCAAAGUGAAGAAUAUAGACCU-2.716.733


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GCACGGAUAGCAAAACAAC75.92652111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721965GCACGGATAGCAAAACAACGTTGTTTTGCTATCCGTGC0.268500.061300.706900.750001.000001.00000


Target Position: 3231, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231CUUUAUGGAUAGUAAGAAU92.2315290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3229-3251TGCTTTATGGATAGTAAGAATGGAUUCUUACUAUCCAUAAAGCACUUUAUGGAUAGUAAGAAUGGU14.612.822


Target Position: 3288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288GACUACUUUGCCUUCUUUU81.30131344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5373306GACTACTTTGCCTTCTTTTAAAAGAAGGCAAAGTAGTC0.853700.055900.819000.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3286-3308CTGACTACTTTGCCTTCTTTTGTAAAAGAAGGCAAAGUAGUCAGGACUACUUUGCCUUCUUUUGUU10.317.622


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590CCUGAAGAGUCCAUAUAAA99.664436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922608CCTGAAGAGTCCATATAAATTTATATGGACTCTTCAGG0.855200.031700.844801.000001.000001.00000


Target Position: 2379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2379CAUUCAAACGUGUUUUGAU91.0593369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2377-2399GACATTCAAACGTGTTTTGATCAAUCAAAACACGUUUGAAUGUCCAUUCAAACGUGUUUUGAUCAU14.97.422


Target Position: 3453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3453UCUUCUGCAAAAAUGGAUA76.64921993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863471TCTTCTGCAAAAATGGATATATCCATTTTTGCAGAAGA0.115400.047900.681000.750001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747CUUGGAUCACAUUUUUAUU83.76141057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854765CTTGGATCACATTTTTATTAATAAAAATGTGATCCAAG0.167100.049500.629300.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736GCUAAAAGUUUCUUGGAUC76.39572038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863754GCTAAAAGTTTCTTGGATCGATCCAAGAAACTTTTAGC0.137100.034900.672400.750001.000001.00000


Target Position: 3424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3424ACUGCCCAUUCACCAAAAU70.1792922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6583442ACTGCCCATTCACCAAAATATTTTGGTGAATGGGCAGT0.424200.187300.698300.750001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100CCUCUCUUUCACUGUUUUA87.262673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262118CCTCTCTTTCACTGTTTTATAAAACAGTGAAAGAGAGG0.344300.200000.810301.000001.000001.00000


Target Position: 3542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542CUGUGUGCUUGUUUUAUAA95.6604118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3903560CTGTGTGCTTGTTTTATAATTATAAAACAAGCACACAG0.510700.357500.750000.750001.000001.00000


Target Position: 1991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1991CCUGUAAGAUCUCCAAAGA88.5758543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182009CCTGTAAGATCTCCAAAGATCTTTGGAGATCTTACAGG0.371000.024900.620700.750001.000001.00000


Target Position: 3198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198GAUUGUUUCCUCUUCCAAA98.736151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8393216GATTGTTTCCTCTTCCAAATTTGGAAGAGGAAACAATC0.423900.258500.681000.750001.000001.00000


Target Position: 3950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3950UGCAUCUCAAAAUUAUUCU65.18143529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653968TGCATCTCAAAATTATTCTAGAATAATTTTGAGATGCA0.545700.083600.629300.500001.000001.00000


Target Position: 3010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3010GAUGUGACUGUAUAACUUU91.3404349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633028GATGTGACTGTATAACTTTAAAGTTATACAGTCACATC0.293100.022200.681000.750001.000001.00000


Target Position: 3317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317GGUGAUGUUUGCUCUUGUU90.1898415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153335GGTGATGTTTGCTCTTGTTAACAAGAGCAAACATCACC0.146400.072100.706901.000001.000001.00000


Target Position: 1753, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753CAAAGUGAUCGAAAGUUUU84.8098934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1751-1773TACAAAGTGATCGAAAGTTTTATAAAACUUUCGAUCACUUUGUACAAAGUGAUCGAAAGUUUUAUU3.219.222


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792GACAAGAGAAAUGAUAAAA91.3843343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901810GACAAGAGAAATGATAAAATTTTATCATTTCTCTTGTC0.114600.070500.819000.750001.000001.00000


Target Position: 3399, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3399CUAUCUUCCAAAUGCAAUU78.64341710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523417CTATCTTCCAAATGCAATTAATTGCATTTGGAAGATAG0.469600.396100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3397-3419ATCTATCTTCCAAATGCAATTTGAAUUGCAUUUGGAAGAUAGAUCUAUCUUCCAAAUGCAAUUUGU19.916.022


Target Position: 4039, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4039GGCAAUUGUCUAUUUAUCU85.4625867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4414057GGCAATTGTCTATTTATCTAGATAAATAGACAATTGCC0.497500.260100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4037-4059CTGGCAATTGTCTATTTATCTTTAGAUAAAUAGACAAUUGCCAGGGCAAUUGUCUAUUUAUCUUUU1.820.032


Target Position: 2454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454GACUGAAAACAAAUAUUUU93.2868233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872472GACTGAAAACAAATATTTTAAAATATTTGTTTTCAGTC0.552400.020900.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474GAGACTGAAAACAAATATTTTGCAAAAUAUUUGUUUUCAGUCUCGACUGAAAACAAAUAUUUUGCU-10.319.222


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519CUGAGCUACAGAAAAACAU78.03261794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819537CTGAGCTACAGAAAAACATATGTTTTTCTGTAGCTCAG0.470900.069500.629300.750000.989100.62500


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391GUGAAUCCAAAAGAAAGUA82.061244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161409GTGAATCCAAAAGAAAGTATACTTTCTTTTGGATTCAC0.355300.170600.612100.750001.000001.00000


Target Position: 3552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3552GUUUUAUAAAAUUUUGCUU77.15461928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3550-3572TTGTTTTATAAAATTTTGCTTTTAAGCAAAAUUUUAUAAAACAAGUUUUAUAAAAUUUUGCUUUUU18.6-7.511


Target Position: 1981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1981GUAUCUUUCUCCUGUAAGA92.6902263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1979-2001ATGTATCTTTCTCCTGTAAGATCUCUUACAGGAGAAAGAUACAUGUAUCUUUCUCCUGUAAGAUCU16.46.923


Target Position: 3860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860UGAAGAAUUAAGAUACAAA93.9233202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7653878TGAAGAATTAAGATACAAATTTGTATCTTAATTCTTCA0.819600.062200.724100.750001.000001.00000


Target Position: 1132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132AGAAAUUUAUCUUAAAAAU85.6302844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621150AGAAATTTATCTTAAAAATATTTTTAAGATAAATTTCT0.253100.092200.715500.750000.994600.62500


Target Position: 546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
546GUGUCCAUAAAUUCUUUAA88.239575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830564GTGTCCATAAATTCTTTAATTAAAGAATTTATGGACAC0.142800.112000.758600.750001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766AGCUAAAGGGGAAGUAUUA88.7742519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901784AGCTAAAGGGGAAGTATTATAATACTTCCCCTTTAGCT0.299300.112500.819000.750001.000001.00000


Target Position: 3810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3810GGACCCUAACACAGUAUAU91.5985329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753828GGACCCTAACACAGTATATATATACTGTGTTAGGGTCC0.265800.021400.827601.000001.000001.00000


Target Position: 3630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3630CAGAUUUCAUACCUCAGAA97.538970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9483648CAGATTTCATACCTCAGAATTCTGAGGTATGAAATCTG0.128800.022900.612100.750000.972800.62500


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943GAGUGCACGGAUAGCAAAA91.0596368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
854961GAGTGCACGGATAGCAAAATTTTGCTATCCGTGCACTC0.202600.027900.810300.750000.902200.75000


Target Position: 4339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4339AGGAAAAUCACUUUGUCUA87.4535651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7354357AGGAAAATCACTTTGTCTATAGACAAAGTGATTTTCCT0.164700.070200.672400.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287UGACUACUUUGCCUUCUUU79.78941544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733305TGACTACTTTGCCTTCTTTAAAGAAGGCAAAGTAGTCA0.806800.052700.724100.750000.913000.62500


Target Position: 4392, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4392GUUAGAAAACAAAAUUUUA93.7038213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4390-4412TTGTTAGAAAACAAAATTTTATTUAAAAUUUUGUUUUCUAACAAGUUAGAAAACAAAAUUUUAUUU-12.07.111


Target Position: 1438, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438CAUCUUUAAAGAGAAAUUU78.64781709

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1436-1458TACATCTTTAAAGAGAAATTTGCAAAUUUCUCUUUAAAGAUGUACAUCUUUAAAGAGAAAUUUGCU5.36.921


Target Position: 1778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1778GCAGAAGGCAACUUGACAA94.9486144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171796GCAGAAGGCAACTTGACAATTGTCAAGTTGCCTTCTGC0.146000.046000.706901.000001.000001.00000


Target Position: 4571, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4571CUAAGUUCACAUUAGAAUU84.6406955

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4569-4591TACTAAGTTCACATTAGAATTAGAAUUCUAAUGUGAACUUAGUACUAAGUUCACAUUAGAAUUAGU6.914.632


Target Position: 4450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4450GUUAUUUUGAUAACAAUGA79.69551560

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4448-4470CAGTTATTTTGATAACAATGACAUCAUUGUUAUCAAAAUAACUGGUUAUUUUGAUAACAAUGACAU12.1-9.722


Target Position: 1573, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CAUUCAAAAUUUUAGCAAA98.420155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6331591CATTCAAAATTTTAGCAAATTTGCTAAAATTTTGAATG0.476800.154300.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1571-1593TCCATTCAAAATTTTAGCAAACTUUUGCUAAAAUUUUGAAUGGACAUUCAAAAUUUUAGCAAACUU19.77.402


Target Position: 1316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316CAAUUAAUGAUGAUUUUAA98.792249

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1314-1336AACAATTAATGATGATTTTAAATUUAAAAUCAUCAUUAAUUGUUCAAUUAAUGAUGAUUUUAAAUU2.1-10.322


Target Position: 3205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3205UCCUCUUCCAAAGUAAAAU65.8133468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6933223TCCTCTTCCAAAGTAAAATATTTTACTTTGGAAGAGGA0.176600.131800.862100.750000.978300.62500


Target Position: 4509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4509GAAUAUCAUACAAAUCAGU85.9686800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4507-4529ATGAATATCATACAAATCAGTTAACUGAUUUGUAUGAUAUUCAUGAAUAUCAUACAAAUCAGUUAU12.08.722


Target Position: 3547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3547UGCUUGUUUUAUAAAAUUU75.56162167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6793565TGCTTGTTTTATAAAATTTAAATTTTATAAAACAAGCA0.181500.172700.853400.750001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827UGUGUCCUUGACUAUUUUA82.20541220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802845TGTGTCCTTGACTATTTTATAAAATAGTCAAGGACACA0.150700.031900.672400.750000.962000.87500


Target Position: 1154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154GAUCUAGAUGCAAGAUUAU92.9549254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1152-1174AAGATCTAGATGCAAGATTATTTAUAAUCUUGCAUCUAGAUCUUGAUCUAGAUGCAAGAUUAUUUU6.920.232


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UCCUUGACUAUUUUAUUAA80.71551419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
418849TCCTTGACTATTTTATTAATTAATAAAATAGTCAAGGA0.368900.071400.836200.750001.000001.00000


Target Position: 3392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3392GUCCUAUCUAUCUUCCAAA92.3308285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4133410GTCCTATCTATCTTCCAAATTTGGAAGATAGATAGGAC0.622300.346000.819000.750001.000001.00000


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652GCCACAUAUAGCAGAAGUA94.7281159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191670GCCACATATAGCAGAAGTATACTTCTGCTATATGTGGC0.167900.054800.819001.000000.934800.62500


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CCUUGACUAUUUUAUUAAA99.148243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364850CCTTGACTATTTTATTAAATTTAATAAAATAGTCAAGG0.370000.079700.844801.000001.000001.00000


Target Position: 4463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4463CAAUGACACUAGAAAACUU97.71866

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4461-4483AACAATGACACTAGAAAACTTGAAAGUUUUCUAGUGUCAUUGUUCAAUGACACUAGAAAACUUGAU13.320.533


Target Position: 4379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4379GAAAUCUGGUCUUGUUAGA86.1746781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4377-4399AAGAAATCTGGTCTTGTTAGAAAUCUAACAAGACCAGAUUUCUUGAAAUCUGGUCUUGUUAGAAAU11.812.033


Target Position: 2261, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2261CAUUUGGACCAAAUUAUGA88.3125569

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2259-2281GGCATTTGGACCAAATTATGATGUCAUAAUUUGGUCCAAAUGCCCAUUUGGACCAAAUUAUGAUGU-1.820.123


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499CCUUGUCACCAAUACCUCA91.7436318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752517CCTTGTCACCAATACCTCATGAGGTATTGGTGACAAGG0.653700.274600.620700.750000.989100.75000


Target Position: 1308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308CUAUCCAACAAUUAAUGAU83.76291056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1306-1328CACTATCCAACAATTAATGATGAAUCAUUAAUUGUUGGAUAGUGCUAUCCAACAAUUAAUGAUGAU8.921.233


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GCUAAAGGGGAAGUAUUAC69.67832986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852785GCTAAAGGGGAAGTATTACGTAATACTTCCCCTTTAGC0.291200.129700.672400.750001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GGAGUAUUGGGAGGUUAUA90.5856395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806440GGAGTATTGGGAGGTTATATATAACCTCCCAATACTCC0.150200.035500.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
420-442ATGGAGTATTGGGAGGTTATATTUAUAACCUCCCAAUACUCCAUGGAGUAUUGGGAGGUUAUAUUU18.514.533


Target Position: 3446, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3446CCUGAACUCUUCUGCAAAA93.9121204

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1344619CCTGAACTCTTCTGCAAAA1/1/0/0100.00RB1NM_000321.21NANANA13:49054700..49054718(+)00RB1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783464CCTGAACTCTTCTGCAAAATTTTGCAGAAGAGTTCAGG0.634000.624600.844801.000001.000001.00000


Target Position: 1566, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566GAUUAUCCAUUCAAAAUUU91.1574361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841584GATTATCCATTCAAAATTTAAATTTTGAATGGATAATC0.249300.068300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1564-1586ACGATTATCCATTCAAAATTTTAAAAUUUUGAAUGGAUAAUCGUGAUUAUCCAUUCAAAAUUUUAU-3.315.402


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992CUGUAAGAUCUCCAAAGAA94.7621158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8922010CTGTAAGATCTCCAAAGAATTCTTTGGAGATCTTACAG0.518100.033700.612100.750001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668ACAUGUGAACUUAUAUAUU85.9092811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890686ACATGTGAACTTATATATTAATATATAAGTTCACATGT0.361700.028800.698300.750001.000001.00000


Target Position: 1794, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794CAAGAGAAAUGAUAAAACA98.437454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1792-1814GACAAGAGAAATGATAAAACATTUGUUUUAUCAUUUCUCUUGUCCAAGAGAAAUGAUAAAACAUUU-0.319.122


Target Position: 4648, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4648CAGAUAUUAUUGCUUUAUU89.5718460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9714666CAGATATTATTGCTTTATTAATAAAGCAATAATATCTG0.117400.035300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4646-4668TTCAGATATTATTGCTTTATTGCAAUAAAGCAAUAAUAUCUGAACAGAUAUUAUUGCUUUAUUGCU13.66.622


Target Position: 3290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3290CUACUUUGCCUUCUUUUGU70.49392894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3288-3310GACTACTTTGCCTTCTTTTGTAGACAAAAGAAGGCAAAGUAGUCCUACUUUGCCUUCUUUUGUAGU12.211.832


Target Position: 2598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2598GUCCAUAUAAAAUUUCAGA85.1196902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2596-2618GAGTCCATATAAAATTTCAGAAGUCUGAAAUUUUAUAUGGACUCGUCCAUAUAAAAUUUCAGAAGU12.021.222


Target Position: 4629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4629GAUUUCUUAAAUAAUGCUU79.07081653

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4627-4649GAGATTTCTTAAATAATGCTTCAAAGCAUUAUUUAAGAAAUCUCGAUUUCUUAAAUAAUGCUUCAU19.75.322


Target Position: 2186, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186CCAGAAUUAGAACAUAUCA92.3786281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722204CCAGAATTAGAACATATCATGATATGTTCTAATTCTGG0.420000.079400.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2184-2206ACCCAGAATTAGAACATATCATCUGAUAUGUUCUAAUUCUGGGUCCAGAAUUAGAACAUAUCAUCU16.012.023


Target Position: 4155, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4155GGCAUUAAUGUUUCUAUCU82.26511208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894173GGCATTAATGTTTCTATCTAGATAGAAACATTAATGCC0.165300.035300.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4153-4175TAGGCATTAATGTTTCTATCTGAAGAUAGAAACAUUAAUGCCUAGGCAUUAAUGUUUCUAUCUGAU16.015.333


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495CCUACCUUGUCACCAAUAC67.34613300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942513CCTACCTTGTCACCAATACGTATTGGTGACAAGGTAGG0.614100.182800.663800.750000.989100.87500


Target Position: 1129, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129CGAAGAAAUUUAUCUUAAA101.31926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7611147CGAAGAAATTTATCTTAAATTTAAGATAAATTTCTTCG0.170900.033800.793101.000000.934800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1127-1149TACGAAGAAATTTATCTTAAAAAUUUAAGAUAAAUUUCUUCGUACGAAGAAAUUUAUCUUAAAAAU6.914.822


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079CCCAGAAGCCAUUGAAAUC70.76332863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682097CCCAGAAGCCATTGAAATCGATTTCAATGGCTTCTGGG0.150300.027400.810300.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224CACAGAGAACACCACGAAA96.0408106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331242CACAGAGAACACCACGAAATTTCGTGGTGTTCTCTGTG0.556100.154300.793100.750001.000001.00000


Target Position: 4241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4241CACCUAAAGGUGUAUUUAA96.814283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4239-4261TACACCTAAAGGTGTATTTAAACUUAAAUACACCUUUAGGUGUACACCUAAAGGUGUAUUUAAACU1.418.623


Target Position: 2407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407GGAGUAUGAUUCUAUUAUA110.4772

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2405-2427GAGGAGTATGATTCTATTATAGTUAUAAUAGAAUCAUACUCCUCGGAGUAUGAUUCUAUUAUAGUU-2.720.322


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306CACUAUCCAACAAUUAAUG73.7082436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371324CACTATCCAACAATTAATGCATTAATTGTTGGATAGTG0.208700.064600.637900.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538AGAAAUCAGUGUCCAUAAA90.9363375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721556AGAAATCAGTGTCCATAAATTTATGGACACTGATTTCT0.280300.037500.724100.750001.000001.00000


Target Position: 3891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3891CAUAAACAGACUGUUAAUU79.76311548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3889-3911TCCATAAACAGACTGTTAATTATAAUUAACAGUCUGUUUAUGGACAUAAACAGACUGUUAAUUAUU6.96.932


Target Position: 4723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4723CAAUUAAUAGUUUGUCUAU92.3685283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4721-4743TACAATTAATAGTTTGTCTATTTAUAGACAAACUAUUAAUUGUACAAUUAAUAGUUUGUCUAUUUU20.3-10.332


Target Position: 3468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3468GAUAUUAUUAGAAAUUAGA93.118243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3466-3488TGGATATTATTAGAAATTAGAAAUCUAAUUUCUAAUAAUAUCCAGAUAUUAUUAGAAAUUAGAAAU-4.3-8.632