Input target sequence

Length: 1791
CCCAGAAATTCTACCCAAGCTCCCTCAGCACCATGTACCGAGCACTTCGGCTCCTCGCGCGCTCGCGTCCCCTCGTGCGGGCTCCAGCCGCAGCCTTAGCTTCGGCTCCCGGCTTGGGTGGCGCGGCCGTGCCCTCGTTTTGGCCTCCGAACGCGGCTCGAATGGCAAGCCAAAATTCCTTCCGGATAGAATATGATACCTTTGGTGAACTAAAGGTGCCAAATGATAAGTATTATGGCGCCCAGACCGTGAGATCTACGATGAACTTTAAGATTGGAGGTGTGACAGAACGCATGCCAACCCCAGTTATTAAAGCTTTTGGCATCTTGAAGCGAGCGGCCGCTGAAGTAAACCAGGATTATGGTCTTGATCCAAAGATTGCTAATGCAATAATGAAGGCAGCAGATGAGGTAGCTGAAGGTAAATTAAATGATCATTTTCCTCTCGTGGTATGGCAGACTGGATCAGGAACTCAGACAAATATGAATGTAAATGAAGTCATTAGCAATAGAGCAATTGAAATGTTAGGAGGTGAACTTGGCAGCAAGATACCTGTGCATCCCAACGATCATGTTAATAAAAGCCAGAGCTCAAATGATACTTTTCCCACAGCAATGCACATTGCTGCTGCAATAGAAGTTCATGAAGTACTGTTACCAGGACTACAGAAGTTACATGATGCTCTTGATGCAAAATCCAAAGAGTTTGCACAGATCATCAAGATTGGACGTACTCATACTCAGGATGCTGTTCCACTTACTCTTGGGCAGGAATTTAGTGGTTATGTTCAACAAGTAAAATATGCAATGACAAGAATAAAAGCTGCCATGCCAAGAATCTATGAGCTCGCAGCTGGAGGCACTGCTGTTGGTACAGGTTTAAATACTAGAATTGGCTTTGCAGAAAAGGTTGCTGCAAAAGTGGCTGCACTTACAGGCTTGCCTTTTGTCACTGCTCCGAATAAATTTGAAGCTCTGGCTGCTCATGACGCTCTGGTTGAGCTCAGTGGAGCCATGAACACTACTGCCTGCAGTCTGATGAAGATAGCAAATGATATTCGATTTTTGGGTTCTGGTCCTCGGTCAGGTCTGGGAGAATTGATCTTGCCTGAAAATGAACCAGGAAGCAGTATCATGCCAGGCAAGGTGAACCCTACTCAGTGTGAAGCAATGACCATGGTTGCAGCCCAAGTCATGGGGAACCATGTTGCTGTCACTGTCGGAGGCAGCAATGGACATTTTGAGTTGAATGTTTTCAAGCCAATGATGATTAAAAATGTGTTACACTCAGCCAGGCTGCTGGGGGATGCTTCAGTTTCCTTTACAGAAAACTGCGTGGTGGGAATCCAGGCCAATACAGAAAGGATCAACAAGCTGATGAATGAGTCTCTAATGTTGGTGACAGCTCTCAATCCTCATATAGGGTATGACAAGGCAGCAAAGATTGCTAAGACAGCACACAAAAATGGATCAACCTTAAAGGAAACTGCTATCGAACTTGGCTATCTCACAGCAGAGCAGTTTGACGAATGGGTAAAACCTAAGGACATGCTGGGTCCAAAGTGATTTACATAAATTTATAATGAAAATAAACATGTATAAAATTTAAAAAAACAGACTCCCATTTCTTAAAAACGGATAAGTTTGAAAGGAAACTGCTATTGAACTTAAGCATCTCTAGCAGAGCAATTTGATCAGTATATAAAACCCTAGGATGTGCTAGGTCTAAGATGGATTAAACAAGTATAAAATAAAATACATTTATAAAATAAAAAGGAAAACAGACTTAAAA